Lloyd, G S; Busby, S J; Savery, N J
1998-01-01
During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538
Means, A L; Farnham, P J
1990-02-01
We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).
Nafissi, Maryam; Chau, Jeannette; Xu, Jimin
2012-01-01
Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I
1990-03-25
The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.
Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M
1989-10-05
We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.
Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark
2006-08-15
The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.
Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L
1993-01-01
The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buchman, A.R.; Kimmerly, W.J.; Rine, J.
1988-01-01
Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda
2006-07-07
In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less
Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H
2006-11-21
Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.
Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S
1997-01-01
GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less
GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE
Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...
Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui
2017-06-01
The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.
Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta
2008-07-01
Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.
Yamasu, K; Wilt, F H
1999-02-01
The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.
Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R
1995-11-11
The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.
Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R
1995-01-01
The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455
Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas
2015-01-01
Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com
Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less
Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.
Sasaki, H; Yokoyama, E; Kuroiwa, A
1990-01-01
The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in
The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less
Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh
2012-09-01
The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.
Rim, Jong S; Kozak, Leslie P
2002-09-13
Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.
Regulatory elements of Caenorhabditis elegans ribosomal protein genes
2012-01-01
Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635
Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef
2012-01-01
The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559
Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C
1992-01-01
Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867
Characterization of Rous sarcoma virus polyadenylation site use in vitro
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maciolek, Nicole L.; McNally, Mark T.
2008-05-10
Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less
2013-01-01
Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559
Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu
2015-08-01
Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.
Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook
2002-07-26
The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques
2008-01-01
This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).
Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko
2010-02-01
GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.
Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H
1995-01-01
The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582
Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.
Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter
2004-02-11
In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.
Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase
Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter
2004-01-01
In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta
2016-01-15
Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Lazennec, G; Kern, L; Valotaire, Y; Salbert, G
1997-01-01
The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383
Li, Cong; Yue, Jing; Wu, Xiaowei; Xu, Cong; Yu, Jingjuan
2014-10-01
The DREB (dehydration-responsive element binding)-type transcription factors regulate the expression of stress-inducible genes by binding the DRE/CRT cis-elements in promoter regions. The upstream transcription factors that regulate the transcription of DREB transcription factors have not been clearly defined, although the function of DREB transcription factors in abiotic stress is known. In this study, an abscisic acid (ABA)-responsive DREB-binding protein gene (SiARDP) was cloned from foxtail millet (Setaria italica). The transcript level of SiARDP increased not only after drought, high salt, and low temperature stresses, but also after an ABA treatment in foxtail millet seedlings. Two ABA-responsive elements (ABRE1: ACGTGTC; ABRE2: ACGTGGC) exist in the promoter of SiARDP. Further analyses showed that two ABA-responsive element binding (AREB)-type transcription factors, SiAREB1 and SiAREB2, could physically bind to the ABRE core element in vitro and in vivo. The constitutive expression of SiARDP in Arabidopsis thaliana enhanced drought and salt tolerance during seed germination and seedling development, and overexpression of SiARDP in foxtail millet improved drought tolerance. The expression levels of target genes of SiARDP were upregulated in transgenic Arabidopsis and foxtail millet. These results reveal that SiARDP, one of the target genes of SiAREB, is involved in ABA-dependent signal pathways and plays a critical role in the abiotic stress response in plants. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Fisher, R P; Topper, J N; Clayton, D A
1987-07-17
Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.
Qiao, Huan; May, James M.
2013-01-01
SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893
Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G
2009-01-01
Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.
1988-01-01
Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henderson, S.L.; Ryan, K.; Sollner-Webb, B.
1989-02-01
We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.
Mavrothalassitis, G J; Watson, D K; Papas, T S
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.
Calonge, María Julia; Seoane, Joan; Massagué, Joan
2004-05-28
A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.
Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.
Schreiber, T; Tissier, A
2016-01-01
The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi
Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less
Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W
1989-12-01
A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.
Mutations That Stimulate flhDC Expression in Escherichia coli K-12.
Fahrner, Karen A; Berg, Howard C
2015-10-01
Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Gause, M; Hovhannisyan, H; Kan, T; Kuhfittig, S; Mogila, V; Georgiev, P
1998-01-01
The su(Hw) protein is responsible for the insulation mediated by the su(Hw)-binding region present in the gypsy retrotransposon. In the y2 mutant, su(Hw) protein partially inhibits yellow transcription by repressing the function of transcriptional enhancers located distally from the yellow promoter with respect to gypsy. y2 mutation derivatives have been induced by the insertion of two hobo copies on the both sides of gypsy: into the yellow intron and into the 5' regulatory region upstream of the wing and body enhancers. The hobo elements have the same structure and orientation, opposite to the direction of yellow transcription. In the sequence context, where two copies of hobo are separated by the su(Hw)-binding region, hobo-dependent rearrangements are frequently associated with duplications of the region between the hobo elements. Duplication of the su(Hw)-binding region strongly inhibits the insulation of the yellow promoter separated from the body and wing enhancers by gypsy. These results provide a better insight into mechanisms by which the su(Hw)-binding region affects the enhancer function. PMID:9649529
Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.
Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki
2014-07-01
Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.
Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De
2002-03-01
To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.
2010-01-01
Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545
Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R
1994-05-01
Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.
Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru
2017-11-01
We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.
Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.
Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E
2015-09-01
The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.
Schörg, Alexandra; Santambrogio, Sara; Platt, James L.; Schödel, Johannes; Lindenmeyer, Maja T.; Cohen, Clemens D.; Schrödter, Katrin; Mole, David R.; Wenger, Roland H.; Hoogewijs, David
2015-01-01
A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the −82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the −82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the −82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. PMID:26007655
Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.
Kageyama, R; Merlino, G T; Pastan, I
1989-09-15
Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.
Imai, S; Fujino, T; Nishibayashi, S; Manabe, T; Takano, T
1994-01-01
Dramatic changes occur in expression of the type I collagenase gene during the process of immortalization in simian virus 40 large T antigen-transformed human fibroblasts (S. Imai and T. Takano, Biochem. Biophys. Res. Commun. 189:148-153, 1992). From transient transfection assays, it was determined that these changes involved the functions of two immortalization-susceptible cis-acting elements, ISE1 and ISE2, located in a 100-bp region about 1.7 kb upstream. The profiles of binding of an activator, Proserpine, to the enhancer ISE1 were similar in the extracts of young, senescent preimmortalized and immortalized cells. ISE2 contained both negative and positive regulatory elements located adjacent to each other. The positive regulatory element consisted of a tandem array of putative Ets family- and AP-1-binding sites. An activator, Pluto, interacted with this positive regulatory element and had an AP-1-related component as a complex. The binding activity of Pluto was predominantly detected only in the extract from senescent preimmortalized cells. In contrast, a repressor, Orpheus, which bound to the ATG-rich negative regulatory element of ISE2, was prominently detected in extracts from both young preimmortalized and immortalized cells and appeared to suppress transcription in an orientation-dependent manner. Thus, the interplay of Pluto and Orpheus was suggested to be crucial for regulation of the collagenase gene accompanying in vitro aging and immortalization. Proserpine seemed to interact with Pluto to mediate strong expression of the collagenase gene in cellular senescence. On the basis of these results, we propose a model for regulation of the collagenase gene during in vitro aging and immortalization. Images PMID:7935433
Le, My-Tra; Kasprzak, Wojciech K; Kim, Taejin; Gao, Feng; Young, Megan YL; Yuan, Xuefeng; Shapiro, Bruce A; Seog, Joonil; Simon, Anne E
2017-01-01
Turnip crinkle virus contains a T-shaped, ribosome-binding, translation enhancer (TSS) in its 3’UTR that serves as a hub for interactions throughout the region. The viral RNA-dependent RNA polymerase (RdRp) causes the TSS/surrounding region to undergo a conformational shift postulated to inhibit translation. Using optical tweezers (OT) and steered molecular dynamic simulations (SMD), we found that the unusual stability of pseudoknotted element H4a/Ψ3 required five upstream adenylates, and H4a/Ψ3 was necessary for cooperative association of two other hairpins (H5/H4b) in Mg2+. SMD recapitulated the TSS unfolding order in the absence of Mg2+, showed dependence of the resistance to pulling on the 3D orientation and gave structural insights into the measured contour lengths of the TSS structure elements. Adenylate mutations eliminated one-site RdRp binding to the 3’UTR, suggesting that RdRp binding to the adenylates disrupts H4a/Ψ3, leading to loss of H5/H4b interaction and promoting a conformational switch interrupting translation and promoting replication. DOI: http://dx.doi.org/10.7554/eLife.22883.001 PMID:28186489
Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.
Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R
2008-09-15
Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.
Ueki, Toshiyuki; Inouye, Sumiko
2003-01-01
Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461
Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi
2016-01-01
Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3′ untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3′-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall–related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide. PMID:27845367
Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi
2016-11-15
Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3' untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3'-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall-related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide.
A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.
Clos, J; Buttgereit, D; Grummt, I
1986-01-01
A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157
Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A
2008-12-01
Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.
Systematic prediction of control proteins and their DNA binding sites
Sorokin, Valeriy; Severinov, Konstantin; Gelfand, Mikhail S.
2009-01-01
We present here the results of a systematic bioinformatics analysis of control (C) proteins, a class of DNA-binding regulators that control time-delayed transcription of their own genes as well as restriction endonuclease genes in many type II restriction-modification systems. More than 290 C protein homologs were identified and DNA-binding sites for ∼70% of new and previously known C proteins were predicted by a combination of phylogenetic footprinting and motif searches in DNA upstream of C protein genes. Additional analysis revealed that a large proportion of C protein genes are translated from leaderless RNA, which may contribute to time-delayed nature of genetic switches operated by these proteins. Analysis of genetic contexts of newly identified C protein genes revealed that they are not exclusively associated with restriction-modification genes; numerous instances of associations with genes originating from mobile genetic elements were observed. These instances might be vestiges of ancient horizontal transfers and indicate that during evolution ancestral restriction-modification system genes were the sites of mobile elements insertions. PMID:19056824
Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis
NASA Astrophysics Data System (ADS)
Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew
2015-09-01
An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.
D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W
1995-09-01
Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.
Wang, Haijun; Song, Chunhua; Ding, Yali; Pan, Xiaokang; Ge, Zheng; Tan, Bi-Hua; Gowda, Chandrika; Sachdev, Mansi; Muthusami, Sunil; Ouyang, Hongsheng; Lai, Liangxue; Francis, Olivia L.; Morris, Christopher L.; Abdel-Azim, Hisham; Dorsam, Glenn; Xiang, Meixian; Payne, Kimberly J.; Dovat, Sinisa
2016-01-01
Impaired function of the Ikaros (IKZF1) protein is associated with the development of high-risk B-cell precursor acute lymphoblastic leukemia (B-ALL). The mechanisms of Ikaros tumor suppressor activity in leukemia are unknown. Ikaros binds to the upstream regulatory elements of its target genes and regulates their transcription via chromatin remodeling. Here, we report that Ikaros represses transcription of the histone H3K4 demethylase, JARID1B (KDM5B). Transcriptional repression of JARID1B is associated with increased global levels of H3K4 trimethylation. Ikaros-mediated repression of JARID1B is dependent on the activity of the histone deacetylase, HDAC1, which binds to the upstream regulatory element of JARID1B in complex with Ikaros. In leukemia, JARID1B is overexpressed, and its inhibition results in cellular growth arrest. Ikaros-mediated repression of JARID1B in leukemia is impaired by pro-oncogenic casein kinase 2 (CK2). Inhibition of CK2 results in increased binding of the Ikaros-HDAC1 complex to the promoter of JARID1B, with increased formation of trimethylated histone H3 lysine 27 and decreased histone H3 Lys-9 acetylation. In cases of high-risk B-ALL that carry deletion of one Ikaros (IKZF1) allele, targeted inhibition of CK2 restores Ikaros binding to the JARID1B promoter and repression of JARID1B. In summary, the presented data suggest a mechanism through which Ikaros and HDAC1 regulate the epigenetic signature in leukemia: via regulation of JARID1B transcription. The presented data identify JARID1B as a novel therapeutic target in B-ALL and provide a rationale for the use of CK2 inhibitors in the treatment of high-risk B-ALL. PMID:26655717
Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133
2009-01-01
Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581
Improved Dual-Luciferase Reporter Assays for Nuclear Receptors
Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank
2010-01-01
Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L
1998-07-01
Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.
Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L
1999-09-24
To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.
Schörg, Alexandra; Santambrogio, Sara; Platt, James L; Schödel, Johannes; Lindenmeyer, Maja T; Cohen, Clemens D; Schrödter, Katrin; Mole, David R; Wenger, Roland H; Hoogewijs, David
2015-07-13
A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the -82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the -82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the -82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.
Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong
2012-09-01
The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.
Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy
2018-05-09
Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.
Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim
2013-07-01
Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.
Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H
1988-01-01
cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787
Transcriptional regulation of hepatic lipogenesis.
Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook
2015-11-01
Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.
Yoshino, M; Tsutsumi, K; Kanazawa, A
2015-01-01
β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Asaduzzaman, Md.; Kinoshita, Shigeharu, E-mail: akino@mail.ecc.u-tokyo.ac.jp; Bhuiyan, Sharmin Siddique
The myosin heavy chain gene, MYH{sub M86-2}, exhibited restricted expression in slow muscle fibers of torafugu embryos and larvae, suggesting its functional roles for embryonic and larval muscle development. However, the transcriptional mechanisms involved in its expression are still ambiguous. The present study is the first extensive analysis of slow muscle-specific MYH{sub M86-2} promoter in fish for identifying the cis-elements that are crucial for its expression. Combining both transient transfection and transgenic approaches, we demonstrated that the 2614 bp 5′-flanking sequences of MYH{sub M86-2} contain a sufficient promoter activity to drive gene expression specific to superficial slow muscle fibers. Bymore » cyclopamine treatment, we also demonstrated that the differentiation of such superficial slow muscle fibers depends on hedgehog signaling activity. The deletion analyses defined an upstream fragment necessary for repressing ectopic MYH{sub M86-2} expression in the fast muscle fibers. The transcriptional mechanism that prevents MYH{sub M86-2} expression in the fast muscle fibers is mediated through Sox6 binding elements. We also demonstrated that Sox6 may function as a transcriptional repressor of MYH{sub M86-2} expression. We further discovered that nuclear factor of activated T cells (NFAT) binding elements plays a key role and myocyte enhancer factor-2 (MEF2) binding elements participate in the transcriptional regulation of MYH{sub M86-2} expression. - Highlights: ► MYH{sub M86-2} is highly expressed in slow muscle fibers of torafugu embryos and larvae. ► MYH{sub M86-2} promoter activity depends on the hedgehog signaling. ► Sox6 binding elements inhibits MYH{sub M86-2} expression in fast muscle fibers. ► Sox6 elements function as transcriptional repressor of MYH{sub M86-2} promoter activity. ► NFAT and MEF2 binding elements play a key role for directing MYH{sub M86-2} expression.« less
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-01-01
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934
Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee
2005-11-01
The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.
Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E
2012-01-01
Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.
Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E
2012-01-01
Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895
E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.
Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie
2008-08-01
Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
Computational methods in sequence and structure prediction
NASA Astrophysics Data System (ADS)
Lang, Caiyi
This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed a software package which is capable of designing novel protein structures at the atomic resolution. This software package allows us to perform protein structure design with a flexible backbone. The backbone flexibility includes loop region relaxation as well as a secondary structure collective mode relaxation scheme. (Abstract shortened by UMI.)
Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition
Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.
2000-01-01
Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123
Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven
2010-01-01
The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899
Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*
Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.
2011-01-01
Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829
Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U
1999-11-19
As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.
Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation
Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G.; Xie, Jiuyong
2012-01-01
The molecular basis of cell signal-regulated alternative splicing at the 3′ splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3′ splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3′ splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3′ splice site usage. PMID:22684629
Seal, S N; Davis, D L; Burch, J B
1991-05-01
The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.
Molecular identification and transcriptional regulation of porcine IFIT2 gene.
Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di
2018-04-06
IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.
Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P
1992-01-01
Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
Yang, Xiaoyang; Jin, Yan; Cattini, Peter A
2010-07-01
Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-07-27
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Beusch, Irene; Barraud, Pierre; Moursy, Ahmed; Cléry, Antoine; Allain, Frédéric Hai-Trieu
2017-01-01
HnRNP A1 regulates many alternative splicing events by the recognition of splicing silencer elements. Here, we provide the solution structures of its two RNA recognition motifs (RRMs) in complex with short RNA. In addition, we show by NMR that both RRMs of hnRNP A1 can bind simultaneously to a single bipartite motif of the human intronic splicing silencer ISS-N1, which controls survival of motor neuron exon 7 splicing. RRM2 binds to the upstream motif and RRM1 to the downstream motif. Combining the insights from the structure with in cell splicing assays we show that the architecture and organization of the two RRMs is essential to hnRNP A1 function. The disruption of the inter-RRM interaction or the loss of RNA binding capacity of either RRM impairs splicing repression by hnRNP A1. Furthermore, both binding sites within the ISS-N1 are important for splicing repression and their contributions are cumulative rather than synergistic. DOI: http://dx.doi.org/10.7554/eLife.25736.001 PMID:28650318
NASA Technical Reports Server (NTRS)
Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.
1999-01-01
Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.
van der Fits, L; Zhang, H; Menke, F L; Deneka, M; Memelink, J
2000-11-01
Plants respond to pathogen attack by induction of various defence responses, including the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the elicitor-induced expression of the terpenoid indole alkaloid biosynthetic gene Strictosidine synthase (Str) is mediated via the plant stress hormonejasmonate. In the promoters of several defence-related genes, cis-acting elements have been identified that are important for transcriptional regulation upon stress signals. Here we show that an upstream region in the Str promoter confers responsiveness to partially purified yeast elicitor and jasmonate. Yeast one-hybrid screening with this element as a bait identified a MYB-like protein, which shows high homology to parsley box P-binding factor-1 (PcBPF-1). In vitro analyses showed that the Str promoter fragment contained a novel binding site for BPF-1-like proteins with higher binding affinity than the previously described box P. CrBPF-1 mRNA accumulated rapidly in elicitor-treated C. roseus suspension cells, whereas no induction was observed with jasmonate. Inhibitor studies indicated that CrBPF-1 plays a role in an elicitor-responsive but jasmonate-independent signal transduction pathway, acting downstream of protein phosphorylation and calcium influx.
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Negi, Sanjana; Tak, Himanshu; Ganapathi, T R
2018-03-01
MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.
Müller, Benedikt; Bovet, Michael; Yin, Yi; Stichel, Damian; Malz, Mona; González-Vallinas, Margarita; Middleton, Alistair; Ehemann, Volker; Schmitt, Jennifer; Muley, Thomas; Meister, Michael; Herpel, Esther; Singer, Stephan; Warth, Arne; Schirmacher, Peter; Drasdo, Dirk; Matthäus, Franziska; Breuhahn, Kai
2015-11-01
Transcription factors integrate a variety of oncogenic input information, facilitate tumour growth and cell dissemination, and therefore represent promising therapeutic target structures. Because over-expression of DNA-interacting far upstream element binding protein (FBP) supports non-small cell lung cancer (NSCLC) migration, we asked whether its repressor, FBP-interacting repressor (FIR) is functionally inactivated and how FIR might affect NSCLC cell biology. Different FIR splice variants were highly expressed in the majority of NSCLCs, with the highest levels in tumours carrying genomic gains of chromosome 8q24.3, which contained the FIR gene locus. Nuclear FIR expression was significantly enriched at the invasion front of primary NSCLCs, but this did not correlate with tumour cell proliferation. FIR accumulation was associated with worse patient survival and tumour recurrence; in addition, FIR over-expression significantly correlated with lymph node metastasis in squamous cell carcinomas (SCCs). In vitro, we applied newly developed methods and modelling approaches for the quantitative and time-resolved description of the pro-migratory and pro-invasive capacities of SCC cells. siRNA-mediated silencing of all FIR variants significantly reduced the speed and directional movement of tumour cells in all phases of migration. Furthermore, sprouting efficiency and single cell invasiveness were diminished following FIR inhibition. Interestingly, the silencing of FIR isoforms lacking exon 2 (FIR(Δexon2)) alone was sufficient to reduce lateral migration and invasion. In summary, by using scale-spanning data derived from primary human tissues, quantitative cellular analyses and mathematical modelling, we have demonstrated that concomitant over-expression of FIR and its splice variants drives NSCLC migration and dissemination. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.
Sweet, D H; Jang, Y K; Sancar, G B
1997-11-01
In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.
Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.
Gilmartin, G M; Fleming, E S; Oetjen, J
1992-01-01
The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577
Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C.; MacPherson, Laura; Ruan, Hai-Bin; Wu, Jing; Pedersen, Thomas Å.; Steffensen, Knut R.; Yang, Xiaoyong; Matthews, Jason; Mandrup, Susanne; Nebb, Hilde I.; Grønning-Wang, Line M.
2015-01-01
Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β+/+ and LXRα/β−/− mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose metabolic sensors upstream of ChREBP by modulating GK expression, nuclear O-GlcNAc signaling, and ChREBP expression and activity. PMID:25724563
Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.
2011-01-01
Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra
2012-01-01
We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr+). The epithelial invasion of Dr+ E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by down-regulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5′-untranslated region and mapped NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5′-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3′-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. The NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. PMID:23176121
Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra
2013-02-01
We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr(+) ). The epithelial invasion of Dr(+) E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by downregulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5'-untranslated region and mapped the NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5'-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3'-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to the AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. © 2012 The Authors Journal compilation © 2012 FEBS.
Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B
2013-12-06
Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.
Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.
2013-01-01
Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027
Robinett, C C; O'Connor, A; Dunaway, M
1997-01-01
We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359
Kuroyanagi, Hidehito; Watanabe, Yohei; Suzuki, Yutaka; Hagiwara, Masatoshi
2013-01-01
A large fraction of protein-coding genes in metazoans undergo alternative pre-mRNA splicing in tissue- or cell-type-specific manners. Recent genome-wide approaches have identified many putative-binding sites for some of tissue-specific trans-acting splicing regulators. However, the mechanisms of splicing regulation in vivo remain largely unknown. To elucidate the modes of splicing regulation by the neuron-specific CELF family RNA-binding protein UNC-75 in Caenorhabditis elegans, we performed deep sequencing of poly(A)+ RNAs from the unc-75(+)- and unc-75-mutant worms and identified more than 20 cassette and mutually exclusive exons repressed or activated by UNC-75. Motif searches revealed that (G/U)UGUUGUG stretches are enriched in the upstream and downstream introns of the UNC-75-repressed and -activated exons, respectively. Recombinant UNC-75 protein specifically binds to RNA fragments carrying the (G/U)UGUUGUG stretches in vitro. Bi-chromatic fluorescence alternative splicing reporters revealed that the UNC-75-target exons are regulated in tissue-specific and (G/U)UGUUGUG element-dependent manners in vivo. The unc-75 mutation affected the splicing reporter expression specifically in the nervous system. These results indicate that UNC-75 regulates alternative splicing of its target exons in neuron-specific and position-dependent manners through the (G/U)UGUUGUG elements in C. elegans. This study thus reveals the repertoire of target events for the CELF family in the living organism. PMID:23416545
Regulation of the plasma cell transcription factor Blimp-1 gene by Bach2 and Bcl6.
Ochiai, Kyoko; Muto, Akihiko; Tanaka, Hiromu; Takahashi, Shinichiro; Igarashi, Kazuhiko
2008-03-01
B lymphocyte-induced maturation protein 1 (Blimp-1) is a key regulator for plasma cell differentiation. Prior to the terminal differentiation into plasma cells, Blimp-1 expression is suppressed in B cells by transcription repressors BTB and CNC homology 2 (Bach2) and B cell lymphoma 6 (Bcl6). Bach2 binds to the Maf recognition element (MARE) of the promoter upstream region of the Blimp-1 gene (Prdm1) by forming a heterodimer with MafK. Bach2 and Bcl6 were found to interact with each other in B cells. While both Bach2 and Bcl6 possess the BTB domain which mediates protein-protein interactions, they interacted in a BTB-independent manner. Bcl6 is known to repress Prdm1 through a Bcl6 recognition element 1 in the intron 5, in which a putative, evolutionarily conserved MARE was identified. Both repressed the expression of a reporter gene containing the intron 5 region depending on the presence of the respective binding sites in 18-81 pre-B cells. Co-expression of Bach2 and Bcl6 resulted in further repression of the reporter plasmid. Chromatin immunoprecipitation assays showed MafK to bind to the intron MARE in various B cell lines, thus suggesting that it binds as a heterodimer with Bach2. Therefore, the interaction between Bach2 and Bcl6 might be crucial for the proper repression of Prdm1 in B cells.
Heyduk, E; Baichoo, N; Heyduk, T
2001-11-30
The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka
2016-08-29
Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-familymore » replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.« less
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel
2017-07-01
Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.
COUP-TF1 antagonizes Nkx2.5-mediated activation of the calreticulin gene during cardiac development.
Guo, L; Lynch, J; Nakamura, K; Fliegel, L; Kasahara, H; Izumo, S; Komuro, I; Agellon, L B; Michalak, M
2001-01-26
Calreticulin, a Ca(2+) binding chaperone of the endoplasmic reticulum, is also highly expressed in the embryonic heart, and knockout of the calreticulin gene is lethal during embryogenesis because of impaired cardiac development. The protein is down-regulated after birth, and elevated expression of calreticulin in newborn hearts is associated with severe cardiac pathology and death. Here we show that the transcription factor Nkx2.5 activates expression of the calreticulin gene in the heart. Binding of chicken ovalbumin upstream promoter-transcription factor 1 to the Nkx2.5 binding site suppresses transcription from the calreticulin promoter. Nkx2.5 and chicken ovalbumin upstream promoter-transcription factor 1 play antagonistic roles in regulating the expression of calreticulin during cardiac development. These studies indicate that cardiac-specific transcription factor Nkx2.5 plays a central role in activating calreticulin expression and that there is a cooperation between chicken ovalbumin upstream promoter-transcription factor 1 and Nkx2.5 at the calreticulin promoter.
The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.
Diccianni, M B; Imagawa, M; Muramatsu, M
1992-01-01
Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis. Images PMID:1408831
The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.
Diccianni, M B; Imagawa, M; Muramatsu, M
1992-10-11
Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.
Insulin signalling mechanisms for triacylglycerol storage.
Czech, M P; Tencerova, M; Pedersen, D J; Aouadi, M
2013-05-01
Insulin signalling is uniquely required for storing energy as fat in humans. While de novo synthesis of fatty acids and triacylglycerol occurs mostly in liver, adipose tissue is the primary site for triacylglycerol storage. Insulin signalling mechanisms in adipose tissue that stimulate hydrolysis of circulating triacylglycerol, uptake of the released fatty acids and their conversion to triacylglycerol are poorly understood. New findings include (1) activation of DNA-dependent protein kinase to stimulate upstream stimulatory factor (USF)1/USF2 heterodimers, enhancing the lipogenic transcription factor sterol regulatory element binding protein 1c (SREBP1c); (2) stimulation of fatty acid synthase through AMP kinase modulation; (3) mobilisation of lipid droplet proteins to promote retention of triacylglycerol; and (4) upregulation of a novel carbohydrate response element binding protein β isoform that potently stimulates transcription of lipogenic enzymes. Additionally, insulin signalling through mammalian target of rapamycin to activate transcription and processing of SREBP1c described in liver may apply to adipose tissue. Paradoxically, insulin resistance in obesity and type 2 diabetes is associated with increased triacylglycerol synthesis in liver, while it is decreased in adipose tissue. This and other mysteries about insulin signalling and insulin resistance in adipose tissue make this topic especially fertile for future research.
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.
Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen
2018-04-10
Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G
2000-06-01
The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.
GATA3 acts upstream of FOXA1 in mediating ESR1 binding by shaping enhancer accessibility.
Theodorou, Vasiliki; Stark, Rory; Menon, Suraj; Carroll, Jason S
2013-01-01
Estrogen receptor (ESR1) drives growth in the majority of human breast cancers by binding to regulatory elements and inducing transcription events that promote tumor growth. Differences in enhancer occupancy by ESR1 contribute to the diverse expression profiles and clinical outcome observed in breast cancer patients. GATA3 is an ESR1-cooperating transcription factor mutated in breast tumors; however, its genomic properties are not fully defined. In order to investigate the composition of enhancers involved in estrogen-induced transcription and the potential role of GATA3, we performed extensive ChIP-sequencing in unstimulated breast cancer cells and following estrogen treatment. We find that GATA3 is pivotal in mediating enhancer accessibility at regulatory regions involved in ESR1-mediated transcription. GATA3 silencing resulted in a global redistribution of cofactors and active histone marks prior to estrogen stimulation. These global genomic changes altered the ESR1-binding profile that subsequently occurred following estrogen, with events exhibiting both loss and gain in binding affinity, implying a GATA3-mediated redistribution of ESR1 binding. The GATA3-mediated redistributed ESR1 profile correlated with changes in gene expression, suggestive of its functionality. Chromatin loops at the TFF locus involving ESR1-bound enhancers occurred independently of ESR1 when GATA3 was silenced, indicating that GATA3, when present on the chromatin, may serve as a licensing factor for estrogen-ESR1-mediated interactions between cis-regulatory elements. Together, these experiments suggest that GATA3 directly impacts ESR1 enhancer accessibility, and may potentially explain the contribution of mutant-GATA3 in the heterogeneity of ESR1+ breast cancer.
GATA3 acts upstream of FOXA1 in mediating ESR1 binding by shaping enhancer accessibility
Theodorou, Vasiliki; Stark, Rory; Menon, Suraj; Carroll, Jason S.
2013-01-01
Estrogen receptor (ESR1) drives growth in the majority of human breast cancers by binding to regulatory elements and inducing transcription events that promote tumor growth. Differences in enhancer occupancy by ESR1 contribute to the diverse expression profiles and clinical outcome observed in breast cancer patients. GATA3 is an ESR1-cooperating transcription factor mutated in breast tumors; however, its genomic properties are not fully defined. In order to investigate the composition of enhancers involved in estrogen-induced transcription and the potential role of GATA3, we performed extensive ChIP-sequencing in unstimulated breast cancer cells and following estrogen treatment. We find that GATA3 is pivotal in mediating enhancer accessibility at regulatory regions involved in ESR1-mediated transcription. GATA3 silencing resulted in a global redistribution of cofactors and active histone marks prior to estrogen stimulation. These global genomic changes altered the ESR1-binding profile that subsequently occurred following estrogen, with events exhibiting both loss and gain in binding affinity, implying a GATA3-mediated redistribution of ESR1 binding. The GATA3-mediated redistributed ESR1 profile correlated with changes in gene expression, suggestive of its functionality. Chromatin loops at the TFF locus involving ESR1-bound enhancers occurred independently of ESR1 when GATA3 was silenced, indicating that GATA3, when present on the chromatin, may serve as a licensing factor for estrogen–ESR1-mediated interactions between cis-regulatory elements. Together, these experiments suggest that GATA3 directly impacts ESR1 enhancer accessibility, and may potentially explain the contribution of mutant-GATA3 in the heterogeneity of ESR1+ breast cancer. PMID:23172872
Lu, X; Welsh, T M; Peterlin, B M
1993-01-01
The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708
Li, Xiaoze; Johansson, Cecilia; Glahder, Jacob; Mossberg, Ann-Kristin; Schwartz, Stefan
2013-01-01
Human papillomavirus type 16 (HPV-16) 5′-splice site SD3632 is used exclusively to produce late L1 mRNAs. We identified a 34-nt splicing inhibitory element located immediately upstream of HPV-16 late 5′-splice site SD3632. Two AUAGUA motifs located in these 34 nt inhibited SD3632. Two nucleotide substitutions in each of the HPV-16 specific AUAGUA motifs alleviated splicing inhibition and induced late L1 mRNA production from episomal forms of the HPV-16 genome in primary human keratinocytes. The AUAGUA motifs bind specifically not only to the heterogeneous nuclear RNP (hnRNP) D family of RNA-binding proteins including hnRNP D/AUF, hnRNP DL and hnRNP AB but also to hnRNP A2/B1. Knock-down of these proteins induced HPV-16 late L1 mRNA expression, and overexpression of hnRNP A2/B1, hnRNP AB, hnRNP DL and the two hnRNP D isoforms hnRNP D37 and hnRNP D40 further suppressed L1 mRNA expression. This inhibition may allow HPV-16 to hide from the immune system and establish long-term persistent infections with enhanced risk at progressing to cancer. There is an inverse correlation between expression of hnRNP D proteins and hnRNP A2/B1 and HPV-16 L1 production in the cervical epithelium, as well as in cervical cancer, supporting the conclusion that hnRNP D proteins and A2/B1 inhibit HPV-16 L1 mRNA production. PMID:24013563
Pattison, Jillian M.; Posternak, Valeriya; Cole, Michael D.
2016-01-01
It is well established that environmental toxins, such as exposure to arsenic, are risk factors in the development of urinary bladder cancer, yet recent genome-wide association studies (GWAS) provide compelling evidence that there is a strong genetic component associated with disease predisposition. A single nucleotide polymorphism (SNP), rs8102137, was identified on chromosome 19q12, residing 6 kb upstream of the important cell cycle regulator and proto-oncogene, Cyclin E1 (CCNE1). However, the functional role of this variant in bladder cancer predisposition has been unclear since it lies within a non-coding region of the genome. Here, it is demonstrated that bladder cancer cells heterozygous for this SNP exhibit biased allelic expression of CCNE1 with 1.5-fold more transcription occurring from the risk allele. Furthermore, using chromatin immunoprecipitation assays, a novel enhancer element was identified within the first intron of CCNE1 that binds Kruppel-like Factor 5 (KLF5), a known transcriptional activator in bladder cancer. Moreover, the data reveal that the presence of rs200996365, a SNP in high linkage disequilibrium with rs8102137 residing in the center of a KLF5 motif, alters KLF5 binding to this genomic region. Through luciferase assays and CRISPR-Cas9 genome editing, a novel polymorphic intronic regulatory element controlling CCNE1 transcription is characterized. These studies uncover how a cancer-associated polymorphism mechanistically contributes to an increased predisposition for bladder cancer development. Implications A polymorphic KLF5 binding site near the CCNE1 gene explains genetic risk identified through genome wide association studies. PMID:27514407
Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi
2014-08-01
Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.
Apparatus for purifying exhaust gases of internal combustion engines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kakinuma, O.; Oya, H.
1980-06-03
Apparatus for purifying the exhaust gases of internal combustion engines is disclosed is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a shell having an inlet chamber, catalyst chamber, and an outlet chamber. The axial lines of the inlet ports are arranged to cross each other in the inlet chamber at a position near, but upstream of, the upstream facing end of said monolithic catalyst element, so that gas flow can diffuse to the entire plane of the element.
Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S
1991-09-11
The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.
Regulation of zebrafish CYP3A65 transcription by AHR2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting
2013-07-15
CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenicmore » lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in mammalian CYP3 genes.« less
Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve
2014-01-01
Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.
Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude
2005-01-01
Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058
Blaeser, Frank; Sanders, Matthew J; Truong, Nga; Ko, Shanelle; Wu, Long Jun; Wozniak, David F; Fanselow, Michael S; Zhuo, Min; Chatila, Talal A
2006-12-01
Signaling by the Ca(2+)/calmodulin kinase (CaMK) cascade has been implicated in neuronal gene transcription, synaptic plasticity, and long-term memory consolidation. The CaM kinase kinase alpha (CaMKKalpha) isoform is an upstream component of the CaMK cascade whose function in different behavioral and learning and memory paradigms was analyzed by targeted gene disruption in mice. CaMKKalpha mutants exhibited normal long-term spatial memory formation and cued fear conditioning but showed deficits in context fear during both conditioning and long-term follow-up testing. They also exhibited impaired activation of the downstream kinase CaMKIV/Gr and its substrate, the transcription factor cyclic AMP-responsive element binding protein (CREB) upon fear conditioning. Unlike CaMKIV/Gr-deficient mice, the CaMKKalpha mutants exhibited normal long-term potentiation and normal levels of anxiety-like behavior. These results demonstrate a selective role for CaMKKalpha in contextual fear memory and suggest that different combinations of upstream and downstream components of the CaMK cascade may serve distinct physiological functions.
Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas
2002-01-01
The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996
Wang, Xiuyun; Zhuang, Lili; Huang, Bingru
2017-01-01
Abscisic acid (ABA) is known to play roles in regulating plant tolerance to various abiotic stresses, but whether ABA’s effects on heat tolerance are associated with its regulation of heat stress transcription factors (HSFs) and heat shock proteins (HSPs) is not well documented. The objective of this study was to determine whether improved heat tolerance of tall fescue (Festuca arundinacea Schreb.) by ABA was through the regulation of HSFs and HSPs. ABA-responsive transcriptional factors, ABA-responsive element binding protein 3 (FaAREB3) and dehydration-responsive element binding protein 2A (FaDREB2A) of tall fescue, were able to bind to the cis-elements in the promoter of tall fescue heat stress transcription factor A2c (FaHSFA2c). Exogenous ABA (5 μM) application enhanced heat tolerance of tall fescue, as manifested by increased leaf photochemical efficiency and membrane stability under heat stress (37/32 °C, day/night). The expression levels of FaHSFA2c, several tall fescue HSPs (FaHSPs), and ABA-responsive transcriptional factors were up-regulated in plants treated with ABA. Deficiency of Arabidopsis heat stress transcription factor A2 (AtHSFA2) suppressed ABA-induction of AtHSPs expression and ABA-improved heat tolerance in Arabidopsis. These results suggested that HSFA2 plays an important role in ABA-mediated plant heat tolerance, and FaAREB3 and FaDREB2A may function as upstream trans-acting factors and regulate transcriptional activity of FaHSFA2c and the downstream FaHSPs, leading to improved heat tolerance. PMID:28914758
Fine-tuning the onset of myogenesis by homeobox proteins that interact with the Myf5 limb enhancer
Daubas, Philippe; Duval, Nathalie; Bajard, Lola; Langa Vives, Francina; Robert, Benoît; Mankoo, Baljinder S.; Buckingham, Margaret
2015-01-01
ABSTRACT Skeletal myogenesis in vertebrates is initiated at different sites of skeletal muscle formation during development, by activation of specific control elements of the myogenic regulatory genes. In the mouse embryo, Myf5 is the first myogenic determination gene to be expressed and its spatiotemporal regulation requires multiple enhancer sequences, extending over 120 kb upstream of the Mrf4-Myf5 locus. An enhancer, located at −57/−58 kb from Myf5, is responsible for its activation in myogenic cells derived from the hypaxial domain of the somite, that will form limb muscles. Pax3 and Six1/4 transcription factors are essential activators of this enhancer, acting on a 145-bp core element. Myogenic progenitor cells that will form the future muscle masses of the limbs express the factors necessary for Myf5 activation when they delaminate from the hypaxial dermomyotome and migrate into the forelimb bud, however they do not activate Myf5 and the myogenic programme until they have populated the prospective muscle masses. We show that Msx1 and Meox2 homeodomain-containing transcription factors bind in vitro and in vivo to specific sites in the 145-bp element, and are implicated in fine-tuning activation of Myf5 in the forelimb. Msx1, when bound between Pax and Six sites, prevents the binding of these key activators, thus inhibiting transcription of Myf5 and consequent premature myogenic differentiation. Meox2 is required for Myf5 activation at the onset of myogenesis via direct binding to other homeodomain sites in this sequence. Thus, these homeodomain factors, acting in addition to Pax3 and Six1/4, fine-tune the entry of progenitor cells into myogenesis at early stages of forelimb development. PMID:26538636
Enhancer elements upstream of the SHOX gene are active in the developing limb.
Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun
2010-05-01
Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.
Enhancer elements upstream of the SHOX gene are active in the developing limb
Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun
2010-01-01
Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128
Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo
2010-01-01
The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960
cis- and trans-acting elements of the estrogen-regulated vitellogenin gene B1 of Xenopus laevis.
Wahli, W; Martinez, E; Corthésy, B; Cardinaux, J R
1989-01-01
Vitellogenin genes are expressed under strict estrogen control in the liver of female oviparous vertebrates. Gene transfer experiments using estrogen-responsive cells have shown that the 13 bp perfect palindromic element GGTCACTGTGACC found upstream of the Xenopus laevis vitellogenin gene A2 promoter mediates hormonal stimulation and thus, was called the estrogen-responsive element (ERE). In the Xenopus vitellogenin genes B1 and B2 there are two closely adjacent EREs with one or more base substitutions when compared to the consensus ERE GGTCANNNTGACC. On their own, these degenerated elements have only a low or no regulatory capacity at all but act together synergistically to form an estrogen-responsive unit (ERU) with the same strength as the perfect palindromic 13 bp element. Analysis of estrogen receptor binding to the gene B1 ERU revealed a cooperative interaction of receptor dimers to the two adjacent imperfect EREs which most likely explains the synergistic stimulation observed in vivo. Furthermore, a promoter activator element located between positions --113 and --42 of the gene B1 and functional in the human MCF-7 and the Xenopus B3.2 cells has been identified and shown to be involved in the high level of induced transcription activity when the ERE is placed at a distance from the promoter. Finally, a hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to characterize two additional novel cis-acting elements within the vitellogenin gene B1 promoter. One of them, a negative regulatory element (NRE), is responsible for repression of promoter activity in the absence of hormone. The second is related to the NF-I binding site and is required, together with the ERE, to mediate hormonal induction. Moreover, we detected three trans-acting activities in Xenopus liver nuclear extracts that interact with these regions and demonstrated that they participate in the regulation of the expression of the vitellogenin promoter in vitro.
Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.
Qureshi, S A; Khoo, B; Baumann, P; Jackson, S P
1995-01-01
The Archaea (archaebacteria) constitute a group of prokaryotes that are phylogenetically distinct from Eucarya (eukaryotes) and Bacteria (eubacteria). Although Archaea possess only one RNA polymerase, evidence suggests that their transcriptional apparatus is similar to that of Eucarya. For example, Archaea contain a homolog of the TATA-binding protein which interacts with the TATA-box like A-box sequence upstream of many archaeal genes. Here, we report the cloning of a Sulfolobus shibatae gene that encodes a protein (transcription factor TFB) with striking homology to the eukaryotic basal transcription factor TFIIB. We show by primer extension analysis that transcription of the S. shibatae TFB gene initiates 27 bp downstream from a consensus A-box element. Significantly, S. shibatae TFB contains an N-terminal putative metal-binding region and two imperfect direct repeats--structural features that are well conserved in eukaryotic TFIIBs. This suggests that TFB may perform analogous functions in Archaea and Eucarya. Consistent with this, we demonstrate that S. shibatae TFB promotes the binding of S. shibatae TBP to the A-box element of the Sulfolobus 16S/23S rRNA gene. Finally, we show that S. shibatae TFB is significantly more related to TFB of the archaeon Pyrococcus woesei than it is to eukaryotic TFIIBs. These data suggest that TFB arose in the common archaeal/eukaryotic ancestor and that the lineages leading to P. woesei and S. shibatae separated after the divergence of the archaeal and eukaryotic lines of descent. Images Fig. 2 Fig. 3 PMID:7597084
Li, Yang; Lv, Zhaohui; Zhu, Jie; Lin, Jing; Ding, Lihua; Ye, Qinong
2016-01-01
The DEK oncogene is overexpressed in various cancers and overexpression of DEK correlates with poor clinical outcome. Vascular endothelial growth factor (VEGF) is the most important regulator of tumor angiogenesis, a process essential for tumor growth and metastasis. However, whether DEK enhances tumor angiogenesis remains unclear. Here, we show that DEK is a key regulator of VEGF expression and tumor angiogenesis. Using chromatin immunoprecipitation assay, we found that DEK promoted VEGF transcription in breast cancer cells (MCF7, ZR75-1 and MDA-MB-231) by directly binding to putative DEK-responsive element (DRE) of the VEGF promoter and indirectly binding to hypoxia response element (HRE) upstream of the DRE through its interaction with the transcription factor hypoxia-inducible factor 1α (HIF-1α), a master regulator of tumor angiogenesis and growth. DEK is responsible for recruitment of HIF-1α and the histone acetyltransferase p300 to the VEGF promoter. DEK-enhanced VEGF increases vascular endothelial cell proliferation, migration and tube formation as well as angiogenesis in the chick chorioallantoic membrane. DEK promotes tumor angiogenesis and growth in nude mice in HIF-1α-dependent and -independent manners. Immunohistochemical staining showed that DEK expression positively correlates with the expression of VEGF and microvessel number in 58 breast cancer patients. Our data establish DEK as a sequence-specific binding transcription factor, a novel coactivator for HIF-1α in regulation of VEGF transcription and a novel promoter of angiogenesis. PMID:26988756
Walsh, Mary F; Ampasala, Dinakar R; Rishi, Arun K; Basson, Marc D
2009-02-01
TGF-beta and FAK modulate cell migration, differentiation, proliferation and apoptosis, and TGF-beta promotes FAK transcription in intestinal epithelial cells via Smad-dependent and independent pathways. We utilized a 1320 bp FAK promoter-luciferase construct to characterize basal and TGF-beta-mediated FAK gene transcription in IEC-6 cells. Inhibiting JNK or Akt negated TGF-beta-stimulated promoter activity; ERK inhibition did not block the TGF-beta effect but increased basal activity. Co-transfection with Co-Smad4 enhanced the TGF-beta response while the inhibitory Smad7 abolished it. Serial deletions sequentially removing the four Smad binding elements (SBE) in the 5' untranslated region of the promoter revealed that the two most distal SBE's are positive regulators while SBE3 exerts a negative influence. Mutational deletion of two upstream p53 sites enhanced basal but did not affect TGF-beta-stimulated increases in promoter activity. TGF-beta increased DNA binding of Smad4, phospho-Smad2/3 and Runx1/AML1a to the most distal 435 bp containing 3 SBE and 2 AML1a sites by ChIP assay. However, although point mutation of SBE1 ablated the TGF-beta-mediated rise in SV40-promoter activity, mutation of AML1a sites did not. TGF-beta regulation of FAK transcription reflects a complex interplay between positive and negative non-Smad signals and SBE's, the last independent of p53 or AML1a.
FOXD3 inhibits SCN2A gene transcription in intractable epilepsy cell models.
Xiang, Jun; Wen, Fang; Zhang, Lingyun; Zhou, Yu
2018-04-01
The expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) is closely related to the development of epilepsy. This study investigated regulatory element of the SCN2A gene involved in epilepsy. An intractable epilepsy cell model was constructed using hippocampal primary neurons and the SH-SY5Y cell line. SCN2A protein and gene expression in cells as well as the level of lactic acid dehydrogenase (LDH) in the cell culture supernatants was detected. Potential regulatory factors of SCN2A and its upstream regulatory elements were identified using the dual-luciferase reporter assay. Finally, the role of the hypothetical transcription factor in epilepsy was examined by using its small interfering RNA (siRNA). Results found that levels of LDH and expression of the hypothetical transcription factor, Forkhead box D3 (FOXD3), was both increased in the model cells, whereas that of SCN2A was decreased. The results of dual-luciferase reporter assays revealed that an upstream region of SCN2A gene spanning from nucleotides -1617 to -1470 was a transcription factor binding region and a trans-acting factor role of FOXD3 was identified in the core region (GGCAAAATTAT). Then the FOXD3 binding site was further verified by the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA). After SH-SY5Y cells were transfected with FOXD3 siRNA, the release of LDH into culture supernatants and the LDH expression levels in cells were significantly decreased. SCN2A expression in model cells was increased by knockdown of FOXD3. Therefore, this study demonstrated that FOXD3 is a trans-acting factor of SCN2A, and this mechanism may play a role in cell injury after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Ihara, Kohei; Sato, Kazuki; Hori, Hatsuhiro; Makino, Yumiko; Shigenobu, Shuji; Ando, Tasuke; Isogai, Emiko; Yoneyama, Hiroshi
2017-04-01
The alaE gene in Escherichia coli encodes an l-alanine exporter that catalyzes the active export of l-alanine using proton electrochemical potential. In our previous study, alaE expression was shown to increase in the presence of l-alanyl-l-alanine (Ala-Ala). In this study, the global regulator leucine-responsive regulatory protein (Lrp) was identified as an activator of the alaE gene. A promoter less β-galactosidase gene was fused to an alaE upstream region (240 nucleotides). Cells that were lacZ-deficient and harbored this reporter plasmid showed significant induction of β-galactosidase activity (approximately 17-fold) in the presence of 6 mM l-alanine, l-leucine, and Ala-Ala. However, a reporter plasmid possessing a smaller alaE upstream region (180 nucleotides) yielded transformants with strikingly low enzyme activity under the same conditions. In contrast, lrp-deficient cells showed almost no β-galactosidase induction, indicating that Lrp positively regulates alaE expression. We next performed an electrophoretic mobility shift assay (EMSA) and a DNase I footprinting assay using purified hexahistidine-tagged Lrp (Lrp-His). Consequently, we found that Lrp-His binds to the alaE upstream region spanning nucleotide -161 to -83 with a physiologically relevant affinity (apparent K D , 288.7 ± 83.8 nM). Furthermore, the binding affinity of Lrp-His toward its cis-element was increased by l-alanine and l-leucine, but not by Ala-Ala and d-alanine. Based on these results, we concluded that the gene expression of the alaE is regulated by Lrp in response to intracellular levels of l-alanine, which eventually leads to intracellular homeostasis of l-alanine concentrations. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Rat prostatic steroid binding protein: DNA sequence and transcript maps of the two C3 genes.
Hurst, H C; Parker, M G
1983-01-01
In the rat there are two non-allelic genes C3(1) and C3(2) for the C3 polypeptide of prostatic steroid binding protein. We have cloned and sequenced both genes and show that only C3(1) is responsible for the production of authentic C3. Although there is a marked difference in their transcriptional activity, the two genes share extensive DNA sequence homology there being only one base difference from nucleotide - 235 to within the first intron. Transcript mapping has shown that there are two distinct C3 transcripts which share a unique 3' terminus but have 5' termini 38 bases apart each preceded by a 'TATA' box homology. Interestingly, an identical repetitive element is present just upstream of both genes. Both families of transcripts, which are produced in a ratio of 18:1, are coordinately regulated by testosterone. Images Fig. 3. Fig. 4. Fig. 5. PMID:6685625
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ranatunga, Wasantha; Hill, Emma E.; Mooster, Jana L.
We have determined the crystal structure, at 1.4, of the Nudix hydrolase DR1025 from the extremely radiation resistant bacterium Deinococcus radiodurans. The protein forms an intertwined homodimer by exchanging N-terminal segments between chains. We have identified additional conserved elements of the Nudix fold, including the metal-binding motif, a kinked b-strand characterized by a proline two positions upstream of the Nudix consensus sequence, and participation of the N-terminal extension in the formation of the substrate-binding pocket. Crystal structures were also solved of DR1025 crystallized in the presence of magnesium and either a GTP analog or Ap4A (both at 1.6 resolution). Inmore » the Ap4Aco-crystal, the electron density indicated that the product of asymmetric hydrolysis, ATP, was bound to the enzyme. The GTP analog bound structure showed that GTP was bound almost identically as ATP. Neither nucleoside triphosphate was further cleaved.« less
Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol
2016-07-19
The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.
Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L
2015-06-01
IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.
Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie
2010-01-01
Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262
Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie
2010-06-01
Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.
Thyroid hormone and COUP-TF1 regulate kallikrein-binding protein (KBP) gene expression.
Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen; Brent, Gregory A
2011-03-01
Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T(3) and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5' flanking region (-53 to -29) and nTRE2, located in the first intron (104-132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T(3). COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T(3) repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T(3). Nuclear corepressor knockdown resulted in loss of T(3) repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T(3) induction of positive thyroid hormone response elements, reverses T(3) repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T(3) and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T(3).
Thyroid Hormone and COUP-TF1 Regulate Kallikrein-Binding Protein (KBP) Gene Expression
Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen
2011-01-01
Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T3 and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5′ flanking region (−53 to −29) and nTRE2, located in the first intron (104–132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T3. COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T3 repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T3. Nuclear corepressor knockdown resulted in loss of T3 repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T3 induction of positive thyroid hormone response elements, reverses T3 repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T3 and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T3. PMID:21266512
Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A
2016-02-18
We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wang, G; Liao, J; Tang, M; Yu, S
2018-02-01
1. Microphthalmia-associated transcription factor (MITF) plays a pivotal role in melanocyte development by regulating the transcription of major pigmentation enzymes (e.g. TYR, TYRP1 and DCT). A single-nucleotide polymorphism (SNP), c.-638T>C, was identified in the MITF promoter, and genotyping of a population (n = 426) revealed that SNP c.-638T>C was associated with skin colour in black-boned chickens. 2. Individuals with genotypes CC and TC exhibited greater MTIF expression than those with genotype TT. Luciferase assays also revealed that genotype CC and TC promoters had higher activity levels than genotype TT. Expression of melanogenesis-related gene (TYR) was higher in the skin of chickens with the CC and CT genotype compared to TT chickens (P < 0.05). 3. Transcription factor-binding site analyses showed that the c.-638C allele contains a putative binding site for transcription factor sterol regulatory element-binding transcription factor 2, aryl hydrocarbon receptor nuclear translocator, transcription factor binding to IGHM enhancer 3 and upstream transcription factor 2. In contrast, the c.-638T allele contains binding sites for Sp3 transcription factor and Krüppel-like factor 1. 4. It was concluded that MITF promoter polymorphisms affected chicken skin colour. SNP c.-638T>C could be used for the marker-assisted selection of skin colour in black-boned chicken breeding.
DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus
Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...
2014-08-23
Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less
Tsutsui, Tomokazu; Kato, Wataru; Asada, Yutaka; Sako, Kaori; Sato, Takeo; Sonoda, Yutaka; Kidokoro, Satoshi; Yamaguchi-Shinozaki, Kazuko; Tamaoki, Masanori; Arakawa, Keita; Ichikawa, Takanari; Nakazawa, Miki; Seki, Motoaki; Shinozaki, Kazuo; Matsui, Minami; Ikeda, Akira; Yamaguchi, Junji
2009-11-01
Plants have evolved intricate mechanisms to respond and adapt to a wide variety of biotic and abiotic stresses in their environment. The Arabidopsis DEAR1 (DREB and EAR motif protein 1; At3g50260) gene encodes a protein containing significant homology to the DREB1/CBF (dehydration-responsive element binding protein 1/C-repeat binding factor) domain and the EAR (ethylene response factor-associated amphiphilic repression) motif. We show here that DEAR1 mRNA accumulates in response to both pathogen infection and cold treatment. Transgenic Arabidopsis overexpressing DEAR1 (DEAR1ox) showed a dwarf phenotype and lesion-like cell death, together with constitutive expression of PR genes and accumulation of salicylic acid. DEAR1ox also showed more limited P. syringae pathogen growth compared to wild-type, consistent with an activated defense phenotype. In addition, transient expression experiments revealed that the DEAR1 protein represses DRE/CRT (dehydration-responsive element/C-repeat)-dependent transcription, which is regulated by low temperature. Furthermore, the induction of DREB1/CBF family genes by cold treatment was suppressed in DEAR1ox, leading to a reduction in freezing tolerance. These results suggest that DEAR1 has an upstream regulatory role in mediating crosstalk between signaling pathways for biotic and abiotic stress responses.
Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo
2011-02-10
Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.
Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P
2007-08-01
To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.
Tecalco-Cruz, Angeles C.; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina
2012-01-01
The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified. PMID:22674574
Tecalco-Cruz, Angeles C; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina
2012-08-03
The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified.
Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee
2017-02-21
The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.
A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.
Mehmood, Tahir; Bohlin, Jon; Snipen, Lars
2015-01-01
The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.
Negi, Sanjana; Tak, Himanshu; Ganapathi, T R
2018-01-01
Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.
2018-01-01
Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404
Multiple splicing defects in an intronic false exon.
Sun, H; Chasin, L A
2000-09-01
Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P
1984-01-01
We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950
Regulation of the scp Genes in the Cyanobacterium Synechocystis sp. PCC 6803--What is New?
Cheregi, Otilia; Funk, Christiane
2015-08-12
In the cyanobacterium Synechocystis sp. PCC 6803 there are five genes encoding small CAB-like (SCP) proteins, which have been shown to be up-regulated under stress. Analyses of the promoter sequences of the scp genes revealed the existence of an NtcA binding motif in two scp genes, scpB and scpE. Binding of NtcA, the key transcriptional regulator during nitrogen stress, to the promoter regions was shown by electrophoretic mobility shift assay. The metabolite 2-oxoglutarate did not increase the affinity of NtcA for binding to the promoters of scpB and scpE. A second motif, the HIP1 palindrome 5' GGCGATCGCC 3', was detected in the upstream regions of scpB and scpC. The transcription factor encoded by sll1130 has been suggested to recognize this motif to regulate heat-responsive genes. Our data suggest that HIP1 is not a regulatory element within the scp genes. Further, the presence of the high light regulatory (HLR1) motif was confirmed in scpB-E, in accordance to their induced transcriptions in cells exposed to high light. The HLR1 motif was newly discovered in eight additional genes.
Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.
Behrens, R; Hayles, J; Nurse, P
2000-12-01
Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.
Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames
Behrens, Ralf; Hayles, Jacky; Nurse, Paul
2000-01-01
Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681
Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho
2014-01-01
The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877
Localization of TFIIB binding regions using serial analysis of chromatin occupancy
Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon
2007-01-01
Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859
Functional elements in the minimal promoter of the human proton-coupled folate transporter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G., E-mail: assaraf@tx.technion.ac.il
2009-10-09
The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 andmore » AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.« less
Kumar, V; Wong, D T; Pasion, S G; Biswas, D K
1987-12-08
The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.
Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve
2003-01-01
The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766
MusTRD can regulate postnatal fiber-specific expression.
Issa, Laura L; Palmer, Stephen J; Guven, Kim L; Santucci, Nicole; Hodgson, Vanessa R M; Popovic, Kata; Joya, Josephine E; Hardeman, Edna C
2006-05-01
Human MusTRD1alpha1 was isolated as a result of its ability to bind a critical element within the Troponin I slow upstream enhancer (TnIslow USE) and was predicted to be a regulator of slow fiber-specific genes. To test this hypothesis in vivo, we generated transgenic mice expressing hMusTRD1alpha1 in skeletal muscle. Adult transgenic mice show a complete loss of slow fibers and a concomitant replacement by fast IIA fibers, resulting in postural muscle weakness. However, developmental analysis demonstrates that transgene expression has no impact on embryonic patterning of slow fibers but causes a gradual postnatal slow to fast fiber conversion. This conversion was underpinned by a demonstrable repression of many slow fiber-specific genes, whereas fast fiber-specific gene expression was either unchanged or enhanced. These data are consistent with our initial predictions for hMusTRD1alpha1 and suggest that slow fiber genes contain a specific common regulatory element that can be targeted by MusTRD proteins.
Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei
2015-01-01
LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less
Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...
2016-03-26
Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less
Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E
2005-08-01
The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.
Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.
2005-01-01
The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237
Transcriptional activation of Mina by Sp1/3 factors.
Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark
2013-01-01
Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.
Transcriptional Activation of Mina by Sp1/3 Factors
Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark
2013-01-01
Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617
[Bacteriophage λ: electrostatic properties of the genome and its elements].
Krutinina, G G; Krutinin, E A; Kamzolova, S G; Osypov, A A
2015-01-01
Bacteriophage λ is a classical model object in molecular biology, but little is still known on the physical properties of its DNA and regulatory elements. A study was made of the electrostatic properties of phage λ DNA and regulatory elements. A global electrostatic potential distribution along the phage genome was found to be nonuniform with main regulatory elements being located in a limited region with a high potential. The RNA polymerase binding frequency on the linearized phage chromosome directly correlates with its local potential. Strong promoters of the phage and its host Escherichia coli have distinct electrostatic upstream elements, which differ in nucleotide sequence. Attachment and recombination sites of phage λ and its host have a higher potential, which possibly facilitates their recognition by integrase. Phage λ and host Rho-independent terminators have a symmetrical M-shaped potential profile, which only slightly depends on the annotated terminator palindrome length, and occur in a region with a substantially higher potential, which may cause polymerase retention, facilitating the formation of a terminator hairpin in RNA. It was concluded that virtually all elements of phage λ genome have potential distribution specifics, which are related to their structural properties and may play a role in their biological function. The global potential distribution along the phage genome reflects the architecture of the regulation of its transcription and integration in the host genome.
Etsrp/etv2 is directly regulated by foxc1a/b in the zebrafish angioblast
Veldman, Matthew B.; Lin, Shuo
2012-01-01
Rationale Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. Objective We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. Methods and Results To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all three regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative RT-PCR and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed while pronephric gene pax2a was relatively normal in expression level and pattern. Conclusions These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast. PMID:22135404
Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.
Veldman, Matthew B; Lin, Shuo
2012-01-20
Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.
Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.
Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C
2010-05-01
Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.
Functional Intersection Area -- Oregon Department of Transportation
DOT National Transportation Integrated Search
1996-01-01
This discussion paper addresses the concepts involved in defining the functional area of an intersection. The elements which comprise the upstream functional area are identified; dimensions of the upstream area exclusive of queue storage, are given f...
Prieur, Xavier; Coste, Herve; Rodriguez, Joan C
2003-07-11
The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.
Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya A; Mergny, Jean-Louis; Salgado, Gilmar F
2017-05-12
Non-canonical base pairing within guanine-rich DNA and RNA sequences can produce G-quartets, whose stacking leads to the formation of a G-quadruplex (G4). G4s can coexist with canonical duplex DNA in the human genome and have been suggested to suppress gene transcription, and much attention has therefore focused on studying G4s in promotor regions of disease-related genes. For example, the human KRAS proto-oncogene contains a nuclease-hypersensitive element located upstream of the major transcription start site. The KRAS nuclease-hypersensitive element (NHE) region contains a G-rich element (22RT; 5'-AGGGCGGTGTGGGAATAGGGAA-3') and encompasses a Myc-associated zinc finger-binding site that regulates KRAS transcription. The NEH region therefore has been proposed as a target for new drugs that control KRAS transcription, which requires detailed knowledge of the NHE structure. In this study, we report a high-resolution NMR structure of the G-rich element within the KRAS NHE. We found that the G-rich element forms a parallel structure with three G-quartets connected by a four-nucleotide loop and two short one-nucleotide double-chain reversal loops. In addition, a thymine bulge is found between G8 and G9. The loops of different lengths and the presence of a bulge between the G-quartets are structural elements that potentially can be targeted by small chemical ligands that would further stabilize the structure and interfere or block transcriptional regulators such as Myc-associated zinc finger from accessing their binding sites on the KRAS promoter. In conclusion, our work suggests a possible new route for the development of anticancer agents that could suppress KRAS expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Lens-Specific Gene Recruitment of ζ-Crystallin through Pax6, Nrl-Maf, and Brain Suppressor Sites
Sharon-Friling, Ronit; Richardson, Jill; Sperbeck, Sally; Lee, Douglas; Rauchman, Michael; Maas, Richard; Swaroop, Anand; Wistow, Graeme
1998-01-01
ζ-Crystallin is a taxon-specific crystallin, an enzyme which has undergone direct gene recruitment as a structural component of the guinea pig lens through a Pax6-dependent mechanism. Tissue specificity arises through a combination of effects involving three sites in the lens promoter. The Pax6 site (ZPE) itself shows specificity for an isoform of Pax6 preferentially expressed in lens cells. High-level expression of the promoter requires a second site, identical to an αCE2 site or half Maf response element (MARE), adjacent to the Pax6 site. A promoter fragment containing Pax6 and MARE sites gives lens-preferred induction of a heterologous promoter. Complexes binding the MARE in lens nuclear extracts are antigenically related to Nrl, and cotransfection with Nrl elevates ζ-crystallin promoter activity in lens cells. A truncated ζ promoter containing Nrl-MARE and Pax6 sites has a high level of expression in lens cells in transgenic mice but is also active in the brain. Suppression of the promoter in the brain requires sequences between −498 and −385, and a site in this region forms specific complexes in brain extract. A three-level model for lens-specific Pax6-dependent expression and gene recruitment is suggested: (i) binding of a specific isoform of Pax6; (ii) augmentation of expression through binding of Nrl or a related factor; and (iii) suppression of promoter activity in the central nervous system by an upstream negative element in the brain but not in the lens. PMID:9528779
NASA Astrophysics Data System (ADS)
Suja, S.; Kessarkar, Pratima M.; Fernandes, Lina L.; Kurian, Siby; Tomer, Arti
2017-09-01
Major (Al, Fe, Mn, Ti, Mg) and trace (Cu, Zn, Pb, Cr, Ni, Co, Zr, Rb, Sr, Ba, Li, Be, Sc, V, Ga, Nb, Mo, Sn, Sb, Cs, Hf, Ta, Bi, Th, U) elements and particulate organic carbon (POC) concentrations in surface suspended particulate matter (SPM) of the Kali estuary, (central west coast of India) were studied during the pre-monsoon, monsoon and post monsoon seasons to infer estuarine processes, source of SPM and Geoaccumulation Index (Igeo) assigned pollutionIgeo levels. Distribution of SPM indicates the presence of the estuarine turbidity maximum (ETM) during all three seasons near the river mouth and a second ETM during the post monsoon time in the upstream associated with salinities gradient. The SPM during the monsoon is finer grained (avg. 53 μm), characterized by uniformly low normalized elemental concentration, whereas the post and pre monsoon are characterized by high normalized elemental concentration with coarser grain size (avg. 202 μm and 173 μm respectively) with highest ratios in the upstream estuary. The elemental composition and principal component analysis for the upstream estuary SPM support more contribution from the upstream catchment area rocks during the monsoon season; there is additional contribution from the downstream catchment area during the pre and post monsoon period due to the tidal effect. The Kali estuarine SPM has higher Al, Fe, Mn, Ti, Mg, Ni, Co, Ba, Li and V with respect to Average World River SPM (WRSPM). Igeo values for the SPM indicate Kali Estuary to be severely enriched with Mn and moderately enriched with Cu, Zn, Ni, Co, U and Mo in the upstream estuary during pre and post monsoon seasons. Seasonal changes in salinity gradient (reduced freshwater flow due to closing of the dam gates), reduced velocity at meandering region of the estuary and POC of 1.6-2.3% resulted in co-precipitation of trace elements that were further fortified by flocculation and coagulation throughout the water column resulting in metal trapping in the upstream region.
Landini, P; Bown, J A; Volkert, M R; Busby, S J
1998-05-22
The methylated form of the Ada protein (meAda) binds the ada and aidB promoters between 60 and 40 base pairs upstream from the transcription start and activates transcription of the Escherichia coli ada and aidB genes. This region is also a binding site for the alpha subunit of RNA polymerase and resembles the rrnB P1 UP element in A/T content and location relative to the core promoter. In this report, we show that deletion of the C-terminal domain of the alpha subunit severely decreases meAda-independent binding of RNA polymerase to ada and aidB, affecting transcription initiation at these promoters. We provide evidence that meAda activates transcription by direct interaction with the C-terminal domain of RNA polymerase sigma70 subunit (amino acids 574-613). Several negatively charged residues in the sigma70 C-terminal domain are important for transcription activation by meAda; in particular, a glutamic acid to valine substitution at position 575 has a dramatic effect on meAda-dependent transcription. Based on these observations, we propose that the role of the alpha subunit at ada and aidB is to allow initial binding of RNA polymerase to the promoters. However, transcription initiation is dependent on meAda-sigma70 interaction.
Alphavirus replicon approach to promoterless analysis of IRES elements.
Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F
2007-04-10
Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.
Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements
Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.
2007-01-01
Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813
Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi
2018-05-17
Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.
Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R
1997-09-05
To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.
A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization
Vilaboa, Nuria; Bermejo, Rodrigo; Martinez, Pilar; Bornstein, Rafael; Calés, Carmela
2004-01-01
Cdc6 is a key regulator of the strict alternation of S and M phases during the mitotic cell cycle. In mammalian and plant cells that physiologically become polyploid, cdc6 is transcriptionally and post-translationally regulated. We have recently reported that Cdc6 levels are maintained in megakaryoblastic HEL cells, but severely downregulated by ectopic expression of transcriptional repressor Drosophila melanogaster escargot. Here, we show that cdc6 promoter activity is upregulated during megakaryocytic differentiation of HEL endoreplicating cells, and that Escargot interferes with such activation. Transactivation experiments showed that a 1.7 kb region located at 2800 upstream cdc6 transcription initiation site behaved as a potent enhancer in endoreplicating cells only. This activity was mainly dependent on a novel cis-regulatory element composed by an E2 box overlapping a GATA motif. Ectopic Escargot could bind this regulatory element in vitro and endogenous GATA-1 and E2A formed specific complexes in megakaryoblastic cells as well as in primary megakaryocytes. Chromatin Immunoprecipitation analysis revealed that both transcription factors were occupying the E2 box/GATA site in vivo. Altogether, these data suggest that cdc6 expression could be actively maintained during megakaryocytic differentiation through transcriptional mechanisms involving specific cis- and trans-regulatory elements. PMID:15590906
Zhou, Yong; Hu, Lifang; Jiang, Lunwei; Liu, Shiqiang
2018-06-01
YTH domain-containing RNA-binding proteins are involved in post-transcriptional regulation and play important roles in the growth and development as well as abiotic stress responses of plants. However, YTH genes have not been previously studied in cucumber (Cucumis sativus). In this study, a total of five YTH genes (CsYTH1-CsYTH5) were identified in cucumber, which could be mapped on three out of the seven cucumber chromosomes. All CsYTH proteins had highly conserved C-terminal YTH domains, and two of them (CsYTH1 and CsYTH4) harbored extra CCCH and P/Q/N-rich domains. The phylogenesis, conserved motifs and exon-intron structure of YTH genes from cucumber, Arabidopsis and rice were also analyzed. The phylogenetically closely clustered YTHs shared similar gene structures and conserved motifs. An analysis of the cis-acting regulatory elements in the upstream region of these genes resulted in the identification of many cis-elements related to stress, hormone and development. Expression analysis based on the transcriptome data showed that some CsYTHs had development- or tissue-specific expression. In addition, their expression levels were altered under various stresses such as salt, drought, cold, and abscisic acid (ABA) treatments. These findings lay the foundation for the functional analysis of CsYTHs in the future.
The BMP pathway acts to directly regulate Tbx20 in the developing heart
Mandel, Elizabeth M.; Kaltenbrun, Erin; Callis, Thomas E.; Zeng, Xin-Xin I.; Marques, Sara R.; Yelon, Deborah; Wang, Da-Zhi; Conlon, Frank L.
2010-01-01
TBX20 has been shown to be essential for vertebrate heart development. Mutations within the TBX20 coding region are associated with human congenital heart disease, and the loss of Tbx20 in a wide variety of model systems leads to cardiac defects and eventually heart failure. Despite the crucial role of TBX20 in a range of cardiac cellular processes, the signal transduction pathways that act upstream of Tbx20 remain unknown. Here, we have identified and characterized a conserved 334 bp Tbx20 cardiac regulatory element that is directly activated by the BMP/SMAD1 signaling pathway. We demonstrate that this element is both necessary and sufficient to drive cardiac-specific expression of Tbx20 in Xenopus, and that blocking SMAD1 signaling in vivo specifically abolishes transcription of Tbx20, but not that of other cardiac factors, such as Tbx5 and MHC, in the developing heart. We further demonstrate that activation of Tbx20 by SMAD1 is mediated by a set of novel, non-canonical, high-affinity SMAD-binding sites located within this regulatory element and that phospho-SMAD1 directly binds a non-canonical SMAD1 site in vivo. Finally, we show that these non-canonical sites are necessary and sufficient for Tbx20 expression in Xenopus, and that reporter constructs containing these sites are expressed in a cardiac-specific manner in zebrafish and mouse. Collectively, our findings define Tbx20 as a direct transcriptional target of the BMP/SMAD1 signaling pathway during cardiac maturation. PMID:20460370
Hepatocyte nuclear factor-4alpha is a central transactivator of the mouse Ntcp gene.
Geier, Andreas; Martin, Ina V; Dietrich, Christoph G; Balasubramaniyan, Natarajan; Strauch, Sonja; Suchy, Frederick J; Gartung, Carsten; Trautwein, Christian; Ananthanarayanan, Meenakshisundaram
2008-08-01
Sodium taurocholate cotransporting polypeptide (Ntcp) is the major uptake system for conjugated bile acids. Deletions of hepatocyte nuclear factor (HNF)-1alpha and retinoid X receptor-alpha:retinoic acid receptor-alpha binding sites in the mouse 5'-flanking region corresponding to putatively central regulatory elements of rat Ntcp do not significantly reduce promoter activity. We hypothesized that HNF-4alpha, which is increasingly recognized as a central regulator of hepatocyte function, may directly transactivate mouse (mNtcp). A 1.1-kb 5'-upstream region including the mouse Ntcp promoter was cloned and compared with the rat promoter. In contrast to a moderate 3.5-fold activation of mNtcp by HNF-1alpha, HNF-4alpha cotransfection led to a robust 20-fold activation. Deletion analysis of mouse and rat Ntcp promoters mapped a conserved HNF-4alpha consensus site at -345/-326 and -335/-316 bp, respectively. p-475bpmNtcpLUC is not transactivated by HNF-1alpha but shows a 50-fold enhanced activity upon cotransfection with HNF-4alpha. Gel mobility shift assays demonstrated a complex of the HNF-4alpha-element formed with liver nuclear extracts that was blocked by an HNF-4alpha specific antibody. HNF-4alpha binding was confirmed by chromatin immunoprecipitation. Using Hepa 1-6 cells, HNF-4alpha-knockdown resulted in a significant 95% reduction in NTCP mRNA. In conclusion, mouse Ntcp is regulated by HNF-4alpha via a conserved distal cis-element independently of HNF-1alpha.
Park, Jin-Sup; Frost, Jennifer M.; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S.; Fischer, Robert L.; Choi, Yeonhee
2017-01-01
The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana. DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation. PMID:28130550
Liu, Mary Y.; Khachigian, Levon M.
2009-01-01
Understanding the mechanisms governing cytokine control of growth factor expression in smooth muscle cells would provide invaluable insight into the molecular regulation of vascular phenotypes and create future opportunities for therapeutic intervention. Here, we report that the proinflammatory cytokine interleukin (IL)-1β suppresses platelet-derived growth factor (PDGF)-D promoter activity and mRNA and protein expression in smooth muscle cells. NF-κB p65, induced by IL-1β, interacts with a novel element in the PDGF-D promoter and inhibits PDGF-D transcription. Interferon regulatory factor-1 (IRF-1) is also induced by IL-1β and binds to a different element upstream in the promoter. Immunoprecipitation and chromatin immunoprecipitation experiments showed that IL-1β stimulates p65 interaction with IRF-1 and the accumulation of both factors at the PDGF-D promoter. Mutation of the IRF-1 and p65 DNA-binding elements relieved the promoter from IL-1β-mediated repression. PDGF-D repression by IL-1β involves histone deacetylation and interaction of HDAC-1 with IRF-1 and p65. HDAC-1 small interfering RNA ablates complex formation with IRF-1 and p65 and abrogates IRF-1 and p65 occupancy of the PDGF-D promoter. Thus, HDAC-1 is enriched at the PDGF-D promoter in cells exposed to IL-1β and forms a cytokine-inducible gene-silencing complex with p65 and IRF-1. PMID:19843519
Cogoi, Susanna; Paramasivam, Manikandan; Membrino, Alexandro; Yokoyama, Kazunari K.; Xodo, Luigi E.
2010-01-01
The murine KRAS promoter contains a G-rich nuclease hypersensitive element (GA-element) upstream of the transcription start site that is essential for transcription. Pulldown and chromatin immunoprecipitation assays demonstrate that this GA-element is bound by the Myc-associated zinc finger (MAZ) and poly(ADP-ribose) polymerase 1 (PARP-1) proteins. These proteins are crucial for transcription, because when they are knocked down by short hairpin RNA, transcription is down-regulated. This is also the case when the poly(ADP-ribosyl)ation activity of PARP-1 is inhibited by 3,4-dihydro-5-[4-(1-piperidinyl) butoxyl]-1(2H) isoquinolinone. We found that MAZ specifically binds to the duplex and quadruplex conformations of the GA-element, whereas PARP-1 shows specificity only for the G-quadruplex. On the basis of fluorescence resonance energy transfer melting and polymerase stop assays we saw that MAZ stabilizes the KRAS quadruplex. When the capacity of folding in the GA-element is abrogated by specific G → T or G → A point mutations, KRAS transcription is down-regulated. Conversely, guanidine-modified phthalocyanines, which specifically interact with and stabilize the KRAS G-quadruplex, push the promoter activity up to more than double. Collectively, our data support a transcription mechanism for murine KRAS that involves MAZ, PARP-1 and duplex-quadruplex conformational changes in the promoter GA-element. PMID:20457603
Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn
2005-01-01
Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016
An ant colony optimization based algorithm for identifying gene regulatory elements.
Liu, Wei; Chen, Hanwu; Chen, Ling
2013-08-01
It is one of the most important tasks in bioinformatics to identify the regulatory elements in gene sequences. Most of the existing algorithms for identifying regulatory elements are inclined to converge into a local optimum, and have high time complexity. Ant Colony Optimization (ACO) is a meta-heuristic method based on swarm intelligence and is derived from a model inspired by the collective foraging behavior of real ants. Taking advantage of the ACO in traits such as self-organization and robustness, this paper designs and implements an ACO based algorithm named ACRI (ant-colony-regulatory-identification) for identifying all possible binding sites of transcription factor from the upstream of co-expressed genes. To accelerate the ants' searching process, a strategy of local optimization is presented to adjust the ants' start positions on the searched sequences. By exploiting the powerful optimization ability of ACO, the algorithm ACRI can not only improve precision of the results, but also achieve a very high speed. Experimental results on real world datasets show that ACRI can outperform other traditional algorithms in the respects of speed and quality of solutions. Copyright © 2013 Elsevier Ltd. All rights reserved.
Zhang, Monica; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Furey, Terrence S.; Crawford, Gregory E.; Yan, Hai; He, Yiping
2014-01-01
Despite an emerging understanding of the genetic alterations giving rise to various tumors, the mechanisms whereby most oncogenes are overexpressed remain unclear. Here we have utilized an integrated approach of genomewide regulatory element mapping via DNase-seq followed by conventional reporter assays and transcription factor binding site discovery to characterize the transcriptional regulation of the medulloblastoma oncogene Orthodenticle Homeobox 2 (OTX2). Through these studies we have revealed that OTX2 is differentially regulated in medulloblastoma at the level of chromatin accessibility, which is in part mediated by DNA methylation. In cell lines exhibiting chromatin accessibility of OTX2 regulatory regions, we found that autoregulation maintains OTX2 expression. Comparison of medulloblastoma regulatory elements with those of the developing brain reveals that these tumors engage a developmental regulatory program to drive OTX2 transcription. Finally, we have identified a transcriptional regulatory element mediating retinoid-induced OTX2 repression in these tumors. This work characterizes for the first time the mechanisms of OTX2 overexpression in medulloblastoma. Furthermore, this study establishes proof of principle for applying ENCODE datasets towards the characterization of upstream trans-acting factors mediating expression of individual genes. PMID:25198066
Landini, P; Volkert, M R
1995-04-07
The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.
Hao, Hailing; Li, Ying; Tzatzalos, Evangeline; Gilbert, Jordana; Zala, Dhara; Bhaumik, Mantu; Cai, Li
2014-01-01
Precise control of lineage-specific gene expression in the neural stem/progenitor cells is crucial for generation of the diversity of neuronal and glial cell types in the central nervous system (CNS). The mechanism underlying such gene regulation, however, is not fully elucidated. Here, we report that a 377 bp evolutionarily conserved DNA fragment (CR5), located approximately 32 kbp upstream of Olig2 transcription start site, acts as a cis-regulator for gene expression in the development of the neonatal forebrain. CR5 is active in a time-specific and brain region-restricted manner. CR5 activity is not detected in the embryonic stage, but it is exclusively in a subset of Sox5+ cells in the neonatal ventral forebrain. Furthermore, we show that Sox5 binding motif in CR5 is important for this cell-specific gene regulatory activity; mutation of Sox5 binding motif in CR5 alters reporter gene expression with different cellular composition. Together, our study provides new insights into the regulation of cell-specific gene expression during CNS development. PMID:24954155
Higashi, Kiyoshi; Inagaki, Yutaka; Fujimori, Ko; Nakao, Atsuhito; Kaneko, Hideo; Nakatsuka, Iwao
2003-10-31
Transforming growth factor-beta (TGF-beta) and interferon-gamma (IFN-gamma) exert antagonistic effects on collagen synthesis in human dermal fibroblasts. We have recently shown that Y box-binding protein YB-1 mediates the inhibitory effects of IFN-gamma on alpha2(I) procollagen gene (COL1A2) transcription through the IFN-gamma response element located between -161 and -150. Here we report that YB-1 counter-represses TGF-beta-stimulated COL1A2 transcription by interfering with Smad3 bound to the upstream sequence around -265 and subsequently by interrupting the Smad3-p300 interaction. Western blot and immunofluorescence analyses using inhibitors for Janus kinases or casein kinase II suggested that the casein kinase II-dependent signaling pathway mediates IFN-gamma-induced nuclear translocation of YB-1. Down-regulation of endogenous YB-1 expression by double-stranded YB-1-specific RNA abrogated the transcriptional repression of COL1A2 by IFN-gamma in the absence and presence of TGF-beta. In transient transfection assays, overexpression of YB-1 in human dermal fibroblasts exhibited antagonistic actions against TGF-beta and Smad3. Physical interaction between Smad3 and YB-1 was demonstrated by immunoprecipitation-Western blot analyses, and electrophoretic mobility shift assays using the recombinant Smad3 and YB-1 proteins indicated that YB-1 forms a complex with Smad3 bound to the Smad-binding element. Glutathione S-transferase pull-down assays showed that YB-1 binds to the MH1 domain of Smad3, whereas the central and carboxyl-terminal regions of YB-1 were required for its interaction with Smad3. YB-1 also interferes with the Smad3-p300 interaction by its preferential binding to p300. Altogether, the results provide a novel insight into the mechanism by which IFN-gamma/YB-1 counteracts TGF-beta/Smad3. They also indicate that IFN-gamma/YB-1 inhibits COL1A2 transcription by dual actions: via the IFN-gamma response element and through a cross-talk with the TGF-beta/Smad signaling pathway.
Ursolic Acid Inhibits Adipogenesis in 3T3-L1 Adipocytes through LKB1/AMPK Pathway
He, Yonghan; Li, Ying; Zhao, Tiantian; Wang, Yanwen; Sun, Changhao
2013-01-01
Background Ursolic acid (UA) is a triterpenoid compound with multiple biological functions. This compound has recently been reported to possess an anti-obesity effect; however, the mechanisms are less understood. Objective As adipogenesis plays a critical role in obesity, the present study was conducted to investigate the effect of UA on adipogenesis and mechanisms of action in 3T3-L1 preadipocytes. Methods and Results The 3T3-L1 preadipocytes were induced to differentiate in the presence or absence of UA for 6 days. The cells were determined for proliferation, differentiation, fat accumulation as well as the protein expressions of molecular targets that regulate or are involved in fatty acid synthesis and oxidation. The results demonstrated that ursolic acid at concentrations ranging from 2.5 µM to 10 µM dose-dependently attenuated adipogenesis, accompanied by reduced protein expression of CCAAT element binding protein β (C/EBPβ), peroxisome proliferator-activated receptor γ (PPARγ), CCAAT element binding protein α (C/EBPα) and sterol regulatory element binding protein 1c (SREBP-1c), respectively. Ursolic acid increased the phosphorylation of acetyl-CoA carboxylase (ACC) and protein expression of carnitine palmitoyltransferase 1 (CPT1), but decreased protein expression of fatty acid synthase (FAS) and fatty acid-binding protein 4 (FABP4). Ursolic acid increased the phosphorylation of AMP-activated protein kinase (AMPK) and protein expression of (silent mating type information regulation 2, homolog) 1 (Sirt1). Further studies demonstrated that the anti-adipogenic effect of UA was reversed by the AMPK siRNA, but not by the Sirt1 inhibitor nicotinamide. Liver kinase B1 (LKB1), the upstream kinase of AMPK, was upregulated by UA. When LKB1 was silenced with siRNA or the inhibitor radicicol, the effect of UA on AMPK activation was diminished. Conclusions Ursolic acid inhibited 3T3-L1 preadipocyte differentiation and adipogenesis through the LKB1/AMPK pathway. There is potential to develop UA into a therapeutic agent for the prevention or treatment of obesity. PMID:23922935
Kubo, E; Fatma, N; Sharma, P; Shinohara, T; Chylack, L T; Akagi, Y; Singh, D P
2002-07-26
Human involucrin (hINV), first appears in the cytosol of keratinocytes and ultimately cross-linked to membrane proteins via transglutaminase and forms a protective barrier as an insoluble envelope beneath the plasma membrane. Although the function and evolution of involucrin is known, the regulation of its gene expression is not well understood. An analysis of the hINV gene sequence, upstream of the transcription start site (-534 to +1 nt) revealed the presence of potential sites for binding of lens epithelium-derived growth factor (LEDGF); stress response element (STRE; A/TGGGGA/T) and heat shock element (HSE; nGAAn). We reported earlier that LEDGF activates stress-associated genes by binding to these elements and elevates cellular resistance to various stresses. Here, gel-shift and super-shift assays confirm the binding of LEDGF to the DNA fragments containing HSEs and STREs that are present in the involucrin gene promoter. Furthermore, hINV promoter linked to CAT reporter gene, cotransfected in human corneal simian virus 40-transformed keratinocytes (HCK), was transactivated by LEDGF significantly. In contrast, the activity of hINV promoter bearing mutations at the WT1 (containing HSE and STRE), WT2 (containing STRE) and WT3 (containing STRE) binding sites was diminished. In addition, in HCK cell over-expressing LEDGF, the levels of hINV mRNA and hINV protein are increased by four to five-fold. LEDGF is inducible to oxidants. Cells treated with 12-O-tetradecanoyl-phorbol-13-acetate (TPA), known to stimulate production of H(2)O(2), showed higher levels of LEDGF mRNA. Furthermore, our immunohistochemical studies revealed that hINV protein is found in the cytoplasm of HCK cells over-expressing LEDGF, but not detectable in the normal HCK cells or HCK cells transfected with vector. This regulation appears to be physiologically important, as over-expression of HCK with LEDGF increases the expression of the endogenous hINV gene and may provide new insight to understand the molecular mechanism of transcriptional regulation of this gene. LEDGF may play an important role in establishing an important barrier in corneal keratinocytes by maintaining epidermal turn-over rate, and protecting HCKs against stress.
Bigler, J; Eisenman, R N
1994-01-01
Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476
Matsumura, Ritsuko; Akashi, Makoto
2017-09-29
Cell-autonomous oscillation in clock gene expression drives circadian rhythms. The development of comprehensive analytical techniques, such as bioinformatics and ChIP-sequencing, has enabled the genome-wide identification of potential circadian transcriptional elements that regulate the transcriptional oscillation of clock genes. However, detailed analyses using traditional biochemical and molecular-biological approaches, such as binding and reporter assays, are still necessary to determine whether these potential circadian transcriptional elements are actually functional and how significantly they contribute to driving transcriptional oscillation. Here, we focused on the molecular mechanism of transcriptional oscillations in the mammalian clock gene Period3 ( Per3 ). The PER3 protein is essential for robust peripheral clocks and is a key component in circadian output processes. We found three E box-like elements located upstream of human Per3 transcription start sites that additively contributed to cell-autonomous transcriptional oscillation. However, we also found that Per3 is still expressed in a circadian manner when all three E box-like elements are functionally impaired. We noted that Per3 transcription was activated by the synergistic actions of two D box-like elements and the three E box-like elements, leading to a drastic increase in circadian amplitude. Interestingly, circadian expression of Per3 was completely disrupted only when all five transcriptional elements were functionally impaired. These results indicate that three E box-like and two D box-like elements cooperatively and redundantly regulate cell-autonomous transcriptional oscillation of Per3 . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru
2017-11-15
Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.
Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8
DOE Office of Scientific and Technical Information (OSTI.GOV)
Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong
2010-02-19
Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less
Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.
Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N
1999-01-01
The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.
Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module
Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan
2015-01-01
Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873
Buermeyer, A B; Thompson, N E; Strasheim, L A; Burgess, R R; Farnham, P J
1992-05-01
We examined the ability of purified RNA polymerase (RNAP) II lacking the carboxy-terminal heptapeptide repeat domain (CTD), called RNAP IIB, to transcribe a variety of promoters in HeLa extracts in which endogenous RNAP II activity was inhibited with anti-CTD monoclonal antibodies. Not all promoters were efficiently transcribed by RNAP IIB, and transcription did not correlate with the in vitro strength of the promoter or with the presence of a consensus TATA box. This was best illustrated by the GC-rich, non-TATA box promoters of the bidirectional dihydrofolate reductase (DHFR)-REP-encoding locus. Whereas the REP promoter was transcribed by RNAP IIB, the DHFR promoter remained inactive after addition of RNAP IIB to the antibody-inhibited reactions. However, both promoters were efficiently transcribed when purified RNAP with an intact CTD was added. We analyzed a series of promoter deletions to identify which cis elements determine the requirement for the CTD of RNAP II. All of the promoter deletions of both DHFR and REP retained the characteristics of their respective full-length promoters, suggesting that the information necessary to specify the requirement for the CTD is contained within approximately 65 bp near the initiation site. Furthermore, a synthetic minimal promoter of DHFR, consisting of a single binding site for Sp1 and a binding site for the HIP1 initiator cloned into a bacterial vector sequence, required RNAP II with an intact CTD for activity in vitro. Since the synthetic minimal promoter of DHFR and the smallest REP promoter deletion are both activated by Sp1, the differential response in this assay does not result from upstream activators. However, the sequences around the start sites of DHFR and REP are not similar and our data suggest that they bind different proteins. Therefore, we propose that specific initiator elements are important for determination of the requirement of some promoters for the CTD.
Purification and characterization of human mitochondrial transcription factor 1.
Fisher, R P; Clayton, D A
1988-01-01
We purified to near homogeneity a transcription factor from human KB cell mitochondria. This factor, designated mitochondrial transcription factor 1 (mtTF1), is required for the in vitro recognition of both major promoters of human mitochondrial DNA by the homologous mitochondrial RNA polymerase. Furthermore, it has been shown to bind upstream regulatory elements of the two major promoters. After separation from RNA polymerase by phosphocellulose chromatography, mtTF1 was chromatographed on a MonoQ anion-exchange fast-performance liquid chromatography column. Analysis of mtTF1-containing fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single major polypeptide with an Mr of approximately 25,000. Centrifugation in analytical glycerol gradients indicated a sedimentation coefficient of approximately 2.5 S, consistent with a monomeric 25-kilodalton protein. Finally, when the 25-kilodalton polypeptide was excised from a stained sodium dodecyl sulfate-polyacrylamide gel and allowed to renature, it regained DNA-binding and transcriptional stimulatory activities at both promoters. Although mtTF1 is the only mitochondrial DNA-binding transcription factor to be purified and characterized, its properties, such as a high affinity for random DNA and a weak specificity for one of its target sequences, may typify this class of regulatory proteins. Images PMID:3211148
Tosetti, Valentina; Sassone, Jenny; Ferri, Anna L. M.; Taiana, Michela; Bedini, Gloria; Nava, Sara; Brenna, Greta; Di Resta, Chiara; Pareyson, Davide; Di Giulio, Anna Maria; Carelli, Stephana
2017-01-01
The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR) is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA) Sox2 overlapping transcript (Sox2OT) plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE), and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT. PMID:28704421
Tosetti, Valentina; Sassone, Jenny; Ferri, Anna L M; Taiana, Michela; Bedini, Gloria; Nava, Sara; Brenna, Greta; Di Resta, Chiara; Pareyson, Davide; Di Giulio, Anna Maria; Carelli, Stephana; Parati, Eugenio A; Gorio, Alfredo
2017-01-01
The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR) is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA) Sox2 overlapping transcript (Sox2OT) plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE), and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT.
Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.
2017-01-01
The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171
Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro
2011-01-01
Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884
NASA Astrophysics Data System (ADS)
Murugan, R.
2010-10-01
In this paper, we develop a theory on the mechanism of distal action of the transcription factors, which are bound at their respective cis-regulatory enhancer modules on the promoter-RNA polymerase II (PR) complexes to initiate the transcription event in eukaryotes. We consider both the looping and tracking modes of their distal communication and calculate the mean first passage time that is required for the distal interactions of the complex of enhancer and transcription factor with the PR via both these modes. We further investigate how this mean first passage time is dependent on the length of the DNA segment (L, base-pairs) that connects the cis-regulatory binding site and the respective promoter. When the radius of curvature of this connecting segment of DNA is R that was induced upon binding of the transcription factor at the cis-acting element and RNAPII at the promoter in cis-positions, our calculations indicate that the looping mode of distal action will dominate when L is such that L > 2πR and the tracking mode of distal action will be favored when L < 2πR. The time required for the distal action will be minimum when L = 2πR where the typical value of R for the binding of histones will be R ~ 16 bps and L ~ 102 bps. It seems that the free energy associated with the binding of the transcription factor with its cis-acting element and the distance of this cis-acting element from the corresponding promoter of the gene of interest is negatively correlated. Our results suggest that the looping and tracking modes of distal action are concurrently operating on the transcription activation and the physics that determines the timescales associated with the looping/tracking in the mechanism of action of these transcription factors on the initiation of the transcription event must put a selection pressure on the distribution of the distances of cis-regulatory modules from their respective promoters of the genes. The computational analysis of the upstream sequences of promoters of various genes in the human and mouse genomes for the presence of putative cis-regulatory elements for a set of known transcription factors using the position weight matrices available with the JASPAR database indicates the presence of cis-acting elements with maximum probability at a distance of ~102 bps from the promoters which substantiates our theoretical predictions.
PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.
Feng, Youjun; Cronan, John E
2014-01-01
Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.
Src is a major signaling component for CTGF induction by TGF-β1 in osteoblasts
X, Zhang; JA, Arnott; S, Rehman; WG, DeLong; A, Sanjay; FF, Safadi; SN, Popoff
2010-01-01
Connective tissue growth factor (CTGF/CCN2) is induced by transforming growth factor beta 1(TGF-β1) where it acts as a downstream mediator of TGF-β1 induced matrix production in osteoblasts. We have shown the requirement of Src, Erk and Smad signaling for CTGF induction by TGF-β1 in osteoblasts, however the potential interaction among these signaling pathways remains undetermined. In this study we demonstrate that TGF-β1 activates Src kinase in ROS17/2.8 cells and that treatment with the Src family kinase inhibitor PP2 prevents Src activation and CTGF induction by TGF-β1. Additionally, inhibiting Src activation prevented Erk activation, Smad 2 & 3 activation and nuclear translocation by TGF-β1, demonstrating that Src is an essential upstream signaling partner of both Erk and Smads in osteoblasts. MAPKs such as Erk can modulate the Smad pathway through directly mediating the phosphorylation of Smads or indirectly through activation/inactivation of required nuclear co-activators that mediate Smad DNA binding. When we treated cells with the Erk inhibitor, PD98059 it inhibited TGF-β1-induced CTGF protein expression but had no effect on Src activation, Smad activation or Smad nuclear translocation. However PD98059 impaired transcriptional complex formation on the Smad binding element (SBE) on the CTGF promoter, demonstrating that Erk activation was required for SBE transactivation. This data demonstrates that Src is an essential upstream signaling transducer of Erk and Smad signaling with respect to TGF-β1 in osteoblasts and that Smads and Erk function independently but are both essential for forming a transcriptionally active complex on the CTGF promoter in osteoblasts. PMID:20432467
Stelman, David
1989-01-01
A contactor/filter arrangement for removing particulate contaminants from a gaseous stream includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. The housing further includes a gas inlet means, a gas outlet means, and means for moving a body of granular material through the zone. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. Disposed on the upstream face of the filter element is a cover screen which isolates the filter element from contact with the moving granular bed and collects a portion of the particulates so as to form a dust cake having openings small enough to exclude the granular material, yet large enough to receive the dust particles. In one embodiment, the granular material is comprised of prous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses.
Karki, Pratap; Webb, Anton; Smith, Keisha; Lee, Kyuwon; Son, Deok-Soo; Aschner, Michael; Lee, Eunsook
2013-01-01
Tamoxifen (TX), a selective estrogen receptor modulator, exerts antagonistic effects on breast tissue and is used to treat breast cancer. Recent evidence also suggests that it may act as an agonist in brain tissue. We reported previously that TX enhanced the expression and function of glutamate transporter 1 (GLT-1) in rat astrocytes, an effect that was mediated by TGF-α. To gain further insight into the mechanisms that mediate TX-induced up-regulation of GLT-1 (EAAT2 in humans), we investigated its effect on GLT-1 at the transcriptional level. TX phosphorylated the cAMP response element-binding protein (CREB) and recruited CREB to the GLT-1 promoter consensus site. The effect of TX on astrocytic GLT-1 was attenuated by the inhibition of PKA, the upstream activator of the CREB pathway. In addition, the effect of TX on GLT-1 promoter activity was abolished by the inhibition of the NF-κB pathway. Furthermore, TX recruited the NF-κB subunits p65 and p50 to the NF-κB binding domain of the GLT-1 promoter. Mutation of NF-κB (triple, −583/-282/-251) or CRE (-308) sites on the GLT-1 promoter led to significant repression of the promoter activity, but neither mutant completely abolished the TX-induced GLT-1 promoter activity. Mutation of both the NF-κB (-583/-282/-251) and CRE (-308) sites led to a complete abrogation of the effect of TX on GLT-1 promoter activity. Taken together, our findings establish that TX regulates GLT-1 via the CREB and NF-κB pathways. PMID:23955341
Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa
Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min
2012-01-01
NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166
A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon
Carlo, Troy; Sierra, Rebecca; Berget, Susan M.
2000-01-01
Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741
Guirola, Maria; Pérez-Rafael, Sílvia; Capdevila, Mercè; Palacios, Oscar; Atrian, Sílvia
2012-01-01
Non-vertebrate chordates, specifically amphioxus, are considered of the utmost interest for gaining insight into the evolutionary trends, i.e. differentiation and specialization, of gene/protein systems. In this work, MTs (metallothioneins), the most important metal binding proteins, are characterized for the first time in the cephalochordate subphylum at both gene and protein level, together with the main features defining the amphioxus response to cadmium and copper overload. Two MT genes (BfMT1 and BfMT2) have been identified in a contiguous region of the genome, as well as several ARE (antioxidant response element) and MRE (metal response element) located upstream the transcribed region. Their corresponding cDNAs exhibit identical sequence in the two lancelet species (B. floridae and B. lanceolatum), BfMT2 cDNA resulting from an alternative splicing event. BfMT1 is a polyvalent metal binding peptide that coordinates any of the studied metal ions (Zn, Cd or Cu) rendering complexes stable enough to last in physiological environments, which is fully concordant with the constitutive expression of its gene, and therefore, with a metal homeostasis housekeeping role. On the contrary, BfMT2 exhibits a clear ability to coordinate Cd(II) ions, while it is absolutely unable to fold into stable Cu (I) complexes, even as mixed species. This identifies it as an essential detoxification agent, which is consequently only induced in emergency situations. The cephalochordate MTs are not directly related to vertebrate MTs, neither by gene structure, protein similarity nor metal-binding behavior of the encoded peptides. The closest relative is the echinoderm MT, which confirm proposed phylogenetic relationships between these two groups. The current findings support the existence in most organisms of two types of MTs as for their metal binding preferences, devoted to different biological functions: multivalent MTs for housekeeping roles, and specialized MTs that evolve either as Cd-thioneins or Cu-thioneins, according to the ecophysiological needs of each kind of organisms.
Capdevila, Mercè; Palacios, Òscar; Atrian, Sílvia
2012-01-01
Non-vertebrate chordates, specifically amphioxus, are considered of the utmost interest for gaining insight into the evolutionary trends, i.e. differentiation and specialization, of gene/protein systems. In this work, MTs (metallothioneins), the most important metal binding proteins, are characterized for the first time in the cephalochordate subphylum at both gene and protein level, together with the main features defining the amphioxus response to cadmium and copper overload. Two MT genes (BfMT1 and BfMT2) have been identified in a contiguous region of the genome, as well as several ARE (antioxidant response element) and MRE (metal response element) located upstream the transcribed region. Their corresponding cDNAs exhibit identical sequence in the two lancelet species (B. floridae and B. lanceolatum), BfMT2 cDNA resulting from an alternative splicing event. BfMT1 is a polyvalent metal binding peptide that coordinates any of the studied metal ions (Zn, Cd or Cu) rendering complexes stable enough to last in physiological environments, which is fully concordant with the constitutive expression of its gene, and therefore, with a metal homeostasis housekeeping role. On the contrary, BfMT2 exhibits a clear ability to coordinate Cd(II) ions, while it is absolutely unable to fold into stable Cu (I) complexes, even as mixed species. This identifies it as an essential detoxification agent, which is consequently only induced in emergency situations. The cephalochordate MTs are not directly related to vertebrate MTs, neither by gene structure, protein similarity nor metal-binding behavior of the encoded peptides. The closest relative is the echinoderm MT, which confirm proposed phylogenetic relationships between these two groups. The current findings support the existence in most organisms of two types of MTs as for their metal binding preferences, devoted to different biological functions: multivalent MTs for housekeeping roles, and specialized MTs that evolve either as Cd-thioneins or Cu-thioneins, according to the ecophysiological needs of each kind of organisms. PMID:22905252
Martínez, Paula; Huedo, Pol; Martinez-Servat, Sònia; Planell, Raquel; Ferrer-Navarro, Mario; Daura, Xavier; Yero, Daniel; Gibert, Isidre
2015-01-01
Quorum Sensing (QS) mediated by Acyl Homoserine Lactone (AHL) molecules are probably the most widespread and studied among Gram-negative bacteria. Canonical AHL systems are composed by a synthase (LuxI family) and a regulator element (LuxR family), whose genes are usually adjacent in the genome. However, incomplete AHL-QS machinery lacking the synthase LuxI is frequently observed in Proteobacteria, and the regulator element is then referred as LuxR solo. It has been shown that certain LuxR solos participate in interspecific communication by detecting signals produced by different organisms. In the case of Stenotrophomonas maltophilia, a preliminary genome sequence analysis revealed numerous putative luxR genes, none of them associated to a luxI gene. From these, the hypothetical LuxR solo Smlt1839, here designated SmoR, presents a conserved AHL binding domain and a helix-turn-helix DNA binding motif. Its genomic organization-adjacent to hchA gene-indicate that SmoR belongs to the new family "LuxR regulator chaperone HchA-associated." AHL-binding assays revealed that SmoR binds to AHLs in-vitro, at least to oxo-C8-homoserine lactone, and it regulates operon transcription, likely by recognizing a conserved palindromic regulatory box in the hchA upstream region. Supplementation with concentrated supernatants from Pseudomonas aeruginosa, which contain significant amounts of AHLs, promoted swarming motility in S. maltophilia. Contrarily, no swarming stimulation was observed when the P. aeruginosa supernatant was treated with the lactonase AiiA from Bacillus subtilis, confirming that AHL contributes to enhance the swarming ability of S. maltophilia. Finally, mutation of smoR resulted in a swarming alteration and an apparent insensitivity to the exogenous AHLs provided by P. aeruginosa. In conclusion, our results demonstrate that S. maltophilia senses AHLs produced by neighboring bacteria through the LuxR solo SmoR, regulating population behaviors such as swarming motility.
Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J
2016-01-04
The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.
Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.
2015-01-01
The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315
Kedzierska, Barbara; Lee, David J.; Węgrzyn, Grzegorz; Busby, Stephen J. W.; Thomas, Mark S.
2004-01-01
The bacteriophage λ CII protein stimulates the activity of three phage promoters, pE, pI and paQ, upon binding to a site overlapping the –35 element at each promoter. Here we used preparations of RNA polymerase carrying a DNA cleavage reagent attached to specific residues in the C-terminal domain of the RNA polymerase α subunit (αCTD) to demonstrate that one αCTD binds near position –41 at pE, whilst the other αCTD binds further upstream. The αCTD bound near position –41 is oriented such that its 261 determinant is in close proximity to σ70. The location of αCTD in CII-dependent complexes at the pE promoter is very similar to that found at many activator-independent promoters, and represents an alternative configuration for αCTD at promoters where activators bind sites overlapping the –35 region. We also used an in vivo alanine scan analysis to show that the DNA-binding determinant of αCTD is involved in stimulation of the pE promoter by CII, and this was confirmed by in vitro transcription assays. We also show that whereas the K271E substitution in αCTD results in a drastic decrease in CII-dependent activation of pE, the pI and paQ promoters are less sensitive to this substitution, suggesting that the role of αCTD at the three lysogenic promoters may be different. PMID:14762211
Quantitative and predictive model of kinetic regulation by E. coli TPP riboswitches
Guedich, Sondés; Puffer-Enders, Barbara; Baltzinger, Mireille; Hoffmann, Guillaume; Da Veiga, Cyrielle; Jossinet, Fabrice; Thore, Stéphane; Bec, Guillaume; Ennifar, Eric; Burnouf, Dominique; Dumas, Philippe
2016-01-01
ABSTRACT Riboswitches are non-coding elements upstream or downstream of mRNAs that, upon binding of a specific ligand, regulate transcription and/or translation initiation in bacteria, or alternative splicing in plants and fungi. We have studied thiamine pyrophosphate (TPP) riboswitches regulating translation of thiM operon and transcription and translation of thiC operon in E. coli, and that of THIC in the plant A. thaliana. For all, we ascertained an induced-fit mechanism involving initial binding of the TPP followed by a conformational change leading to a higher-affinity complex. The experimental values obtained for all kinetic and thermodynamic parameters of TPP binding imply that the regulation by A. thaliana riboswitch is governed by mass-action law, whereas it is of kinetic nature for the two bacterial riboswitches. Kinetic regulation requires that the RNA polymerase pauses after synthesis of each riboswitch aptamer to leave time for TPP binding, but only when its concentration is sufficient. A quantitative model of regulation highlighted how the pausing time has to be linked to the kinetic rates of initial TPP binding to obtain an ON/OFF switch in the correct concentration range of TPP. We verified the existence of these pauses and the model prediction on their duration. Our analysis also led to quantitative estimates of the respective efficiency of kinetic and thermodynamic regulations, which shows that kinetically regulated riboswitches react more sharply to concentration variation of their ligand than thermodynamically regulated riboswitches. This rationalizes the interest of kinetic regulation and confirms empirical observations that were obtained by numerical simulations. PMID:26932506
Quantitative and predictive model of kinetic regulation by E. coli TPP riboswitches.
Guedich, Sondés; Puffer-Enders, Barbara; Baltzinger, Mireille; Hoffmann, Guillaume; Da Veiga, Cyrielle; Jossinet, Fabrice; Thore, Stéphane; Bec, Guillaume; Ennifar, Eric; Burnouf, Dominique; Dumas, Philippe
2016-01-01
Riboswitches are non-coding elements upstream or downstream of mRNAs that, upon binding of a specific ligand, regulate transcription and/or translation initiation in bacteria, or alternative splicing in plants and fungi. We have studied thiamine pyrophosphate (TPP) riboswitches regulating translation of thiM operon and transcription and translation of thiC operon in E. coli, and that of THIC in the plant A. thaliana. For all, we ascertained an induced-fit mechanism involving initial binding of the TPP followed by a conformational change leading to a higher-affinity complex. The experimental values obtained for all kinetic and thermodynamic parameters of TPP binding imply that the regulation by A. thaliana riboswitch is governed by mass-action law, whereas it is of kinetic nature for the two bacterial riboswitches. Kinetic regulation requires that the RNA polymerase pauses after synthesis of each riboswitch aptamer to leave time for TPP binding, but only when its concentration is sufficient. A quantitative model of regulation highlighted how the pausing time has to be linked to the kinetic rates of initial TPP binding to obtain an ON/OFF switch in the correct concentration range of TPP. We verified the existence of these pauses and the model prediction on their duration. Our analysis also led to quantitative estimates of the respective efficiency of kinetic and thermodynamic regulations, which shows that kinetically regulated riboswitches react more sharply to concentration variation of their ligand than thermodynamically regulated riboswitches. This rationalizes the interest of kinetic regulation and confirms empirical observations that were obtained by numerical simulations.
Bütof, Lucy; Schmidt-Vogler, Christopher; Herzberg, Martin; Große, Cornelia
2017-01-01
ABSTRACT Zinc is an essential trace element, yet it is toxic at high concentrations. In the betaproteobacterium Cupriavidus metallidurans, the highly efficient removal of surplus zinc from the periplasm is responsible for the outstanding metal resistance of the organism. Rather than having a typical Zur-dependent, high-affinity ATP-binding cassette transporter of the ABC protein superfamily for zinc uptake at low concentrations, C. metallidurans has the secondary zinc importer ZupT of the zinc-regulated transporter, iron-regulated transporter (ZRT/IRT)-like protein (ZIP) family. It is important to understand, therefore, how this zinc-resistant bacterium copes with exposure to low zinc concentrations. Members of the Zur regulon in C. metallidurans were identified by comparing the transcriptomes of a Δzur mutant and its parent strain. The consensus sequence of the Zur-binding box was derived for the zupTp promoter-regulatory region by use of a truncation assay. The motif was used to predict possible Zur boxes upstream of Zur regulon members. The binding of Zur to these boxes was confirmed. Two Zur boxes upstream of the cobW1 gene, encoding a putative zinc chaperone, proved to be required for complete repression of cobW1 and its downstream genes in cells cultivated in mineral salts medium. A Zur box upstream of each of zur-cobW2, cobW3, and zupT permitted both low expression levels of these genes and their upregulation under conditions of zinc starvation. This demonstrates a compartmentalization of zinc homeostasis in C. metallidurans, where the periplasm is responsible for the removal of surplus zinc, cytoplasmic components are responsible for the management of zinc as an essential cofactor, and the two compartments are connected by ZupT. IMPORTANCE Elucidating zinc homeostasis is necessary for understanding both host-pathogen interactions and the performance of free-living bacteria in their natural environments. Escherichia coli acquires zinc under conditions of low zinc concentrations via the Zur-controlled ZnuABC importer of the ABC superfamily, and this was also the paradigm for other bacteria. In contrast, the heavy-metal-resistant bacterium C. metallidurans achieves high tolerance to zinc through sophisticated zinc handling and efflux systems operating on periplasmic zinc ions, so that removal of surplus zinc is a periplasmic feature in this bacterium. It is shown here that this process is augmented by the management of zinc by cytoplasmic zinc chaperones, whose synthesis is controlled by the Zur regulator. This demonstrates a new mechanism, involving compartmentalization, for organizing zinc homeostasis. PMID:28808127
Bütof, Lucy; Schmidt-Vogler, Christopher; Herzberg, Martin; Große, Cornelia; Nies, Dietrich H
2017-08-14
Zinc is an essential trace element and at the same time it is toxic at high concentrations. In the beta-proteobacterium Cupriavidus metallidurans the highly efficient removal of surplus zinc from the periplasm is responsible for its outstanding metal resistance. Rather than having a typical Zur-dependent, high-affinity ATP-binding cassette transporter of the ABC protein superfamily for zinc uptake at low concentrations, C. metallidurans instead has the secondary zinc importer ZupT of the ZRT/IRT (ZIP) family. It is important to understand, therefore, how this zinc-resistant bacterium copes when it is exposed to low zinc concentrations. Members of the Zur regulon in C. metallidurans were identified by comparing the transcriptomes of a Δ zur mutant and its parent strain. The consensus sequence of the Zur-binding box was derived for the zupTp promoter-regulatory region using a truncation assay. The motif was used to predict possible Zur-boxes upstream of Zur regulon members. Binding of Zur to these boxes was confirmed. Two Zur-boxes upstream of the cobW 1 gene, encoding a putative zinc chaperone, proved to be required for complete repression of cobW 1 and its downstream genes in cells cultivated in mineral salts medium. A Zur box upstream of each of zur-cobW 2 , cobW 3 and zupT permitted low-expression level of these genes plus their up-regulation under zinc starvation conditions. This demonstrates a compartmentalization of zinc homeostasis in C. metallidurans with the periplasm being responsible for removal of surplus zinc and cytoplasmic components for management of zinc as an essential co-factor, with both compartments connected by ZupT. Importance Elucidating zinc homeostasis is necessary to understand both host-pathogen interactions and performance of free-living bacteria in their natural environment. Escherichia coli acquires zinc under low zinc concentrations by the Zur-controlled ZnuABC importer of the ABC superfamily, and this was also the paradigm for other bacteria. In contrast, the heavy metal-resistant bacterium C. metallidurans achieves high tolerance to zinc due to sophisticated zinc handling and efflux systems operating on periplasmic zinc ions, so that removal of surplus zinc is a periplasmic feature in this bacterium. It is shown here that this process is augmented by management of zinc through cytoplasmic zinc chaperones, whose syntheses are controlled by the Zur regulator. This demonstrates a new mechanism to organize zinc homeostasis through compartmentalization. Copyright © 2017 American Society for Microbiology.
Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.
2014-01-01
The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924
Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence.
Benko, Sabina; Fantes, Judy A; Amiel, Jeanne; Kleinjan, Dirk-Jan; Thomas, Sophie; Ramsay, Jacqueline; Jamshidi, Negar; Essafi, Abdelkader; Heaney, Simon; Gordon, Christopher T; McBride, David; Golzio, Christelle; Fisher, Malcolm; Perry, Paul; Abadie, Véronique; Ayuso, Carmen; Holder-Espinasse, Muriel; Kilpatrick, Nicky; Lees, Melissa M; Picard, Arnaud; Temple, I Karen; Thomas, Paul; Vazquez, Marie-Paule; Vekemans, Michel; Roest Crollius, Hugues; Hastie, Nicholas D; Munnich, Arnold; Etchevers, Heather C; Pelet, Anna; Farlie, Peter G; Fitzpatrick, David R; Lyonnet, Stanislas
2009-03-01
Pierre Robin sequence (PRS) is an important subgroup of cleft palate. We report several lines of evidence for the existence of a 17q24 locus underlying PRS, including linkage analysis results, a clustering of translocation breakpoints 1.06-1.23 Mb upstream of SOX9, and microdeletions both approximately 1.5 Mb centromeric and approximately 1.5 Mb telomeric of SOX9. We have also identified a heterozygous point mutation in an evolutionarily conserved region of DNA with in vitro and in vivo features of a developmental enhancer. This enhancer is centromeric to the breakpoint cluster and maps within one of the microdeletion regions. The mutation abrogates the in vitro enhancer function and alters binding of the transcription factor MSX1 as compared to the wild-type sequence. In the developing mouse mandible, the 3-Mb region bounded by the microdeletions shows a regionally specific chromatin decompaction in cells expressing Sox9. Some cases of PRS may thus result from developmental misexpression of SOX9 due to disruption of very-long-range cis-regulatory elements.
Pavelitz, Thomas; Bailey, Arnold D.; Elco, Christopher P.; Weiner, Alan M.
2008-01-01
In mammals, small multigene families generate spliceosomal U snRNAs that are nearly as abundant as rRNA. Using the tandemly repeated human U2 genes as a model, we show by footprinting with DNase I and permanganate that nearly all sequences between the enhancer-like distal sequence element and the initiation site are protected during interphase whereas the upstream half of the U2 snRNA coding region is exposed. We also show by chromatin immunoprecipitation that the SNAPc complex, which binds the TATA-like proximal sequence element, is removed at metaphase but remains bound under conditions that induce locus-specific metaphase fragility of the U2 genes, such as loss of CSB, BRCA1, or BRCA2 function, treatment with actinomycin D, or overexpression of the tetrameric p53 C terminus. We propose that the U2 snRNA promoter establishes a persistently open state to facilitate rapid reinitiation and perhaps also to bypass TFIIH-dependent promoter melting; this open state would then be disassembled to allow metaphase chromatin condensation. PMID:18378697
Richter, Wito; Conti, Marco
2004-07-16
PDE4 splice variants are classified into long and short forms depending on the presence or absence of two unique N-terminal domains termed upstream conserved regions 1 and 2 (UCR1 and -2). We have shown previously that the UCR module mediates dimerization of PDE4 long forms, whereas short forms, which lack UCR1, behave as monomers. In the present study, we demonstrate that dimerization is an essential structural element that determines the regulatory properties and inhibitor sensitivities of PDE4 enzymes. Comparing the properties of the dimeric wild type PDE4D3 with several monomeric mutant PDE4D3 constructs revealed that disruption of dimerization ablates the activation of PDE4 long forms by either protein kinase A phosphorylation or phosphatidic acid binding. Moreover, the analysis of heterodimers consisting of a catalytically active and a catalytically inactive PDE4D3 subunit indicates that protein kinase A phosphorylation of both subunits is essential to fully activate PDE4 enzymes. In addition to affecting enzyme regulation, disruption of dimerization reduces the sensitivity of the enzymes toward the prototypical PDE4 inhibitor rolipram. Parallel binding assays indicated that this shift in rolipram sensitivity is likely mediated by a decrease in the number of inhibitor binding sites in the high affinity rolipram binding state. Thus, although dimerization is not a requirement for high affinity rolipram binding, it functions to stabilize PDE4 long forms in their high affinity rolipram binding conformation. Taken together, our data indicate that dimerization defines the properties of PDE4 enzymes and suggest a common structural and functional organization for all PDEs.
Modulation of tissue repair by regeneration enhancer elements.
Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D
2016-04-14
How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.
Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta
2010-01-01
POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840
Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F
1999-01-01
In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.
Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes
Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine
1999-01-01
The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570
Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching
2015-01-01
Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517
Cox, S.E.; Bell, P.R.; Lowther, J.S.; Van Metre, P.C.
2005-01-01
Sediment cores were collected from six locations in Lake Roosevelt to determine the vertical distributions of trace-element concentrations in the accumulated sediments of Lake Roosevelt. Elevated concentrations of arsenic, cadmium, copper, lead, mercury, and zinc occurred throughout much of the accumulated sediments. Concentrations varied greatly within the sediment core profiles, often covering a range of 5 to 10 fold. Trace-element concentrations typically were largest below the surficial sediments in the lower one-half of each profile, with generally decreasing concentrations from the 1964 horizon to the surface of the core. The trace-element profiles reflect changes in historical discharges of trace elements to the Columbia River by an upstream smelter. All samples analyzed exceeded clean-up guidelines adopted by the Confederated Tribes of the Colville Reservation for cadmium, lead, and zinc and more than 70 percent of the samples exceeded cleanup guidelines for mercury, arsenic, and copper. Although 100 percent of the samples exceeded sediment guidelines for cadmium, lead, and zinc, surficial concentrations of arsenic, copper, and mercury in some cores were less than the sediment-quality guidelines. With the exception of copper, the trace-element profiles of the five cores collected along the pre-reservoir Columbia River channel typically showed trends of decreasing concentrations in sediments deposited after the 1964 time horizon. The decreasing concentrations of trace elements in the upper half of cores from along the pre-reservoir Columbia River showed a pattern of decreasing concentrations similar to reductions in trace-element loading in liquid effluent from an upstream smelter. Except for arsenic, trace-element concentrations typically were smaller at downstream reservoir locations along the pre-reservoir Columbia River. Trace-element concentration in sediments from the Spokane Arm of the reservoir showed distinct differences compared to the similarities observed in cores from along the pre-reservoir Columbia River. Particles of slag, which have physical and chemical characteristics of slag discharged to the Columbia River by a lead-zinc smelter upstream of the reservoir at Trail, British Columbia, were found in sediments of Lake Roosevelt. Slag particles are more common in the upstream reaches of the reservoir. The chemical composition of the interior matrix of slag collected from Lake Roosevelt closely approximated the reported elemental concentrations of fresh smelter slag, although evidence of slag weathering was observed. Exfoliation flakes were observed on the surface of weathered slag particles isolated from the core sediments. The concentrations of zinc on the exposed surface of slag grains were smaller than concentrations on interior surfaces. Weathering rinds also were observed in the cross section of weathered slag grains, indicating that the glassy slag material was undergoing hydration and chemical weathering. Trace elements observed in accumulated sediments in the middle and lower reaches of the reservoir are more likely due to the input from liquid effluent discharges compared to slag discharges from the upstream smelter.
Orengo, Dorcas J.; Aguadé, Montserrat
2017-01-01
The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Sakumi, K; Sekiguchi, M
1989-01-20
The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.
Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G
2010-12-01
The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. © 2010 Blackwell Publishing Ltd.
Costet, Philippe; Cariou, Bertrand; Lambert, Gilles; Lalanne, Florent; Lardeux, Bernard; Jarnoux, Anne-Laure; Grefhorst, Aldo; Staels, Bart; Krempf, Michel
2006-03-10
Familial autosomal dominant hypercholesterolemia is associated with high risk for cardiovascular accidents and is related to mutations in the low density lipoprotein receptor or its ligand apolipoprotein B (apoB). Mutations in a third gene, proprotein convertase subtilisin kexin 9 (PCSK9), were recently associated to this disease. PCSK9 acts as a natural inhibitor of the low density lipoprotein receptor pathway, and both genes are regulated by depletion of cholesterol cell content and statins, via sterol regulatory element-binding protein (SREBP). Here we investigated the regulation of PCSK9 gene expression during nutritional changes. We showed that PCSK9 mRNA quantity is decreased by 73% in mice after 24 h of fasting, leading to a 2-fold decrease in protein level. In contrast PCSK9 expression was restored upon high carbohydrate refeeding. PCSK9 mRNA increased by 4-5-fold in presence of insulin in rodent primary hepatocytes, whereas glucose had no effect. Moreover, insulin up-regulated hepatic PCSK9 expression in vivo during a hyperinsulinemic-euglycemic clamp in mice. Adenoviral mediated overexpression of a dominant or negative form of SREBP-1c confirmed the implication of this transcription factor in insulin-mediated stimulation of PCSK9 expression. Liver X receptor agonist T0901317 also regulated PCSK9 expression via this same pathway (a 2-fold increase in PCSK9 mRNA of primary hepatocytes cultured for 24 h in presence of 1 microm T0901317). As our last investigation, we isolated PCSK9 proximal promoter and verified the functionality of a SREBP-1c responsive element located from 335 bp to 355 bp upstream of the ATG. Together, these results show that PCSK9 expression is regulated by nutritional status and insulinemia.
Aporntewan, Chatchawit; Pin-on, Piyapat; Chaiyaratana, Nachol; Pongpanich, Monnat; Boonyaratanakornkit, Viroj; Mutirangura, Apiwat
2013-10-01
A-repeats are the simplest form of tandem repeats and are found ubiquitously throughout genomes. These mononucleotide repeats have been widely believed to be non-functional 'junk' DNA. However, studies in yeasts suggest that A-repeats play crucial biological functions, and their role in humans remains largely unknown. Here, we showed a non-random pattern of distribution of sense A- and T-repeats within 20 kb around transcription start sites (TSSs) in the human genome. Different distributions of these repeats are observed upstream and downstream of TSSs. Sense A-repeats are enriched upstream, whereas sense T-repeats are enriched downstream of TSSs. This enrichment directly correlates with repeat size. Genes with different functions contain different lengths of repeats. In humans, tissue-specific genes are enriched for short repeats of <10 bp, whereas housekeeping genes are enriched for long repeats of ≥10 bp. We demonstrated that DICER1 and Argonaute proteins are required for the cis-regulatory role of A-repeats. Moreover, in the presence of a synthetic polymer that mimics an A-repeat, protein binding to A-repeats was blocked, resulting in a dramatic change in the expression of genes containing upstream A-repeats. Our findings suggest a length-dependent cis-regulatory function of A-repeats and that Argonaute proteins serve as trans-acting factors, binding to A-repeats.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu
2010-10-15
Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less
Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T
1993-12-22
The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.
Hall-Pogar, Tyra; Liang, Songchun; Hague, Lisa K.; Lutz, Carol S.
2007-01-01
Two cyclooxygenase (COX) enzymes, COX-1 and COX-2, are present in human cells. While COX-1 is constitutively expressed, COX-2 is inducible and up-regulated in response to many signals. Since increased transcriptional activity accounts for only part of COX-2 up-regulation, we chose to explore other RNA processing mechanisms in the regulation of this gene. Previously, we showed that COX-2 is regulated by alternative polyadenylation, and that the COX-2 proximal polyadenylation signal contains auxiliary upstream sequence elements (USEs) that are very important in efficient polyadenylation. To explore trans-acting protein factors interacting with these cis-acting RNA elements, we performed pull-down assays with HeLa nuclear extract and biotinylated RNA oligonucleotides representing COX-2 USEs. We identified PSF, p54nrb, PTB, and U1A as proteins specifically bound to the COX-2 USEs. We further explored their participation in polyadenylation using MS2 phage coat protein-MS2 RNA binding site tethering assays, and found that tethering any of these four proteins to the COX-2 USE mutant RNA can compensate for these cis-acting elements. Finally, we suggest that these proteins (p54nrb, PTB, PSF, and U1A) may interact as a complex since immunoprecipitations of the transfected MS2 fusion proteins coprecipitate the other proteins. PMID:17507659
Qiao, Huan; May, James M.
2011-01-01
The sodium-dependent vitamin C transporter (SVCT) 2 is crucial for ascorbate uptake in metabolically active and specialized tissues. The present study focused on the gene regulation of the SVCT2 exon 1b, which is ubiquitously expressed in human and mouse tissues. Although the human SVCT2 exon 1b promoter doesn’t contain a classical TATA-box, we found that it does contain a functional initiator (Inr) that binds YY1 and interacts with upstream Sp1/Sp3 elements in the proximal promoter region. These elements in turn play a critical role in regulating YY1-mediated transcription of the exon 1b gene. Formation of YY1/Sp complexes on the promoter is required for its optional function. YY1 with Sp1 or Sp3 synergistically enhanced exon 1b promoter activity as well as the endogenous SVCT2 protein expression. Further, in addition to Sp1/Sp3 both EGR-1 and -2 were detected in the protein complexes that bound the three GC boxes bearing overlapping binding sites for EGR/WT1 and Sp1/3. The EGR family factors, WT1 and MAZ were found to differentially regulate exon 1b promoter activity. These results show that differential occupancy of transcription factors on the GC-rich consensus sequences in SVCT2 exon 1b promoter contributes to the regulation of cell and tissue expression of SVCT2. PMID:21335086
Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.
Abedini, Davar; Rashidi Monfared, Sajad
2018-06-01
A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.
Chen, Liang; Zheng, Yuhong; Dong, Zhimin; Meng, Fanfan; Sun, Xingmiao; Fan, Xuhong; Zhang, Yunfeng; Wang, Mingliang; Wang, Shuming
2018-04-01
Soybean is the world's most important leguminous crop producing high-quality protein and oil. Elevating oil accumulation in soybean seed is always many researchers' goal. WRINKLED1 (WRI1) encodes a transcription factor of the APETALA2/ethylene responsive element-binding protein (AP2/EREBP) family that plays important roles during plant seed oil accumulation. In this study, we isolated and characterized three distinct orthologues of WRI1 in soybean (Glycine max) that display different organ-specific expression patterns, among which GmWRI1a was highly expressed in maturing soybean seed. Electrophoretic mobility shift assays and yeast one-hybrid experiments demonstrated that the GmWRI1a protein was capable of binding to AW-box, a conserved sequence in the proximal upstream regions of many genes involved in various steps of oil biosynthesis. Transgenic soybean seeds overexpressing GmWRI1a under the control of the seed-specific napin promoter showed the increased total oil and fatty acid content and the changed fatty acid composition. Furthermore, basing on the activated expressions in transgenic soybean seeds and existence of AW-box element in the promoter regions, direct downstream genes of GmWRI1a were identified, and their products were responsible for fatty acid production, elongation, desaturation and export from plastid. We conclude that GmWRI1a transcription factor can positively regulate oil accumulation in soybean seed by a complex gene expression network related to fatty acid biosynthesis.
Zock, C; Iselt, A; Doerfler, W
1993-01-01
Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643
A mechanism underlying position-specific regulation of alternative splicing
Hamid, Fursham M.
2017-01-01
Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.
Efficient activation of transcription in yeast by the BPV1 E2 protein.
Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M
1989-01-01
The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584
Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J
1996-01-01
The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664
Kumar, Hitesh; Kumar, Sanjay
2013-09-15
The leaves of stevia [Stevia rebaudiana (Bertoni)] are a rich source of steviol glycosides that are used as non-calorific sweetener in many countries around the world. Steviol moiety of steviol glycosides is synthesized via plastidial 2C-methyl-D-erythritol 4-phosphate pathway, where (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR) is the key enzyme. HDR catalyzes the simultaneous conversion of (E)-4-hydroxy-3-methylbut-2-enyl diphosphate into five carbon isoprenoid units, isopentenyl diphosphate and dimethylallyl diphosphate. Stevia HDR (SrHDR) successfully rescued HDR lethal mutant strain MG1655 ara<>ispH upon genetic complementation, suggesting SrHDR to encode a functional protein. The gene exhibited diurnal variation in expression. To identify the possible regulatory elements, upstream region of the gene was cloned and putative cis-acting elements were detected by in silico analysis. Electrophoretic mobility shift assay, using a putative light responsive element GATA showed the binding of nuclear proteins (NP) isolated from leaves during light period of the day, but not with the NP from leaves during the dark period. Data suggested the involvement of GATA box in light mediated gene regulation of SrHDR in stevia. Copyright © 2013 Elsevier B.V. All rights reserved.
Van Doorslaer, Koenraad; Chen, Dan; Chapman, Sandra; Khan, Jameela
2017-01-01
ABSTRACT Human papillomavirus (HPV) genomes are replicated and maintained as extrachromosomal plasmids during persistent infection. The viral E2 proteins are thought to promote stable maintenance replication by tethering the viral DNA to host chromatin. However, this has been very difficult to prove genetically, as the E2 protein is involved in transcriptional regulation and initiation of replication, as well as its assumed role in genome maintenance. This makes mutational analysis of viral trans factors and cis elements in the background of the viral genome problematic and difficult to interpret. To circumvent this problem, we have developed a complementation assay in which the complete wild-type HPV18 genome is transfected into primary human keratinocytes along with subgenomic or mutated replicons that contain the minimal replication origin. The wild-type genome provides the E1 and E2 proteins in trans, allowing us to determine additional cis elements that are required for long-term replication and partitioning of the replicon. We found that, in addition to the core replication origin (and the three E2 binding sites located therein), additional sequences from the transcriptional enhancer portion of the URR (upstream regulatory region) are required in cis for long-term genome replication. PMID:29162712
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen P.
2006-10-17
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen
2000-01-01
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Structural features of diverse Pin-II proteinase inhibitor genes from Capsicum annuum.
Mahajan, Neha S; Dewangan, Veena; Lomate, Purushottam R; Joshi, Rakesh S; Mishra, Manasi; Gupta, Vidya S; Giri, Ashok P
2015-02-01
The proteinase inhibitor (PI) genes from Capsicum annuum were characterized with respect to their UTR, introns and promoter elements. The occurrence of PIs with circularly permuted domain organization was evident. Several potato inhibitor II (Pin-II) type proteinase inhibitor (PI) genes have been analyzed from Capsicum annuum (L.) with respect to their differential expression during plant defense response. However, complete gene characterization of any of these C. annuum PIs (CanPIs) has not been carried out so far. Complete gene architectures of a previously identified CanPI-7 (Beads-on-string, Type A) and a member of newly isolated Bracelet type B, CanPI-69 are reported in this study. The 5' UTR (untranslated region), 3'UTR, and intronic sequences of both the CanPI genes were obtained. The genomic sequence of CanPI-7 exhibited, exon 1 (49 base pair, bp) and exon 2 (740 bp) interrupted by a 294-bp long type I intron. We noted the occurrence of three multi-domain PIs (CanPI-69, 70, 71) with circularly permuted domain organization. CanPI-69 was found to possess exon 1 (49 bp), exon 2 (551 bp) and a 584-bp long type I intron. The upstream sequence analysis of CanPI-7 and CanPI-69 predicted various transcription factor-binding sites including TATA and CAAT boxes, hormone-responsive elements (ABRELATERD1, DOFCOREZM, ERELEE4), and a defense-responsive element (WRKY71OS). Binding of transcription factors such as zinc finger motif MADS-box and MYB to the promoter regions was confirmed using electrophoretic mobility shift assay followed by mass spectrometric identification. The 3' UTR analysis for 25 CanPI genes revealed unique/distinct 3' UTR sequence for each gene. Structures of three domain CanPIs of type A and B were predicted and further analyzed for their attributes. This investigation of CanPI gene architecture will enable the better understanding of the genetic elements present in CanPIs.
Hanna, Ebert Seixas; Roque-Barreira, Maria-Cristina; Mendes, Guilherme Martines Teixeira; Soares, Sandro Gomes; Brocchi, Marcelo
2008-06-01
Dps, found in many eubacterial and archaebacterial species, appears to protect cells from oxidative stress and/or nutrient-limited environment. Dps has been shown to accumulate during the stationary phase, to bind to DNA non-specifically, and to form a crystalline structure that compacts and protects the chromosome. Our previous results have indicated that Dps is glycosylated at least for a certain period of the bacterial cell physiology and this glycosylation is thought to be orchestrated by some factors not yet understood, explaining our difficulties in standardizing the Dps purification process. In the present work, the open reading frame of the dps gene, together with all the upstream regulatory elements, were cloned into a PCR cloning vector. As a result, the expression of dps was also controlled by the plasmid system introduced in the bacterial cell. The gene was then over-expressed regardless of the growth phase of the culture and a glycosylated fraction was purified to homogeneity by lectin-immobilized chromatography assay. Unlike the high level expression of Dps in Salmonella cells, less than 1% of the recombinant protein was purified by affinity chromatography using jacalin column. Sequencing and mass spectrometry data confirmed the identity of the dps gene and the protein, respectively. In spite of the low level of purification of the jacalin-binding Dps, this work shall aid further investigations into the mechanism of Dps glycosylation.
Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D; Castle, John C; Raymond, Christopher K; Lappala, Colin R; Schaefer, Amy L; Harwood, Caroline S; Greenberg, E Peter
2011-05-01
The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon.
Two alternative ways of start site selection in human norovirus reinitiation of translation.
Luttermann, Christine; Meyers, Gregor
2014-04-25
The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.
Nozaki, T; Arase, T; Shigeta, Y; Asai, T; Leustek, T; Takeuchi, T
1998-12-08
A gene encoding adenosine-5'-triphosphate sulfurylase (AS) was cloned from the enteric protozoan parasite Entamoeba histolytica by polymerase chain reaction using degenerate oligonucleotide primers corresponding to conserved regions of the protein from a variety of organisms. The deduced amino acid sequence of E. histolytica AS revealed a calculated molecular mass of 47925 Da and an unusual basic pI of 9.38. The amebic protein sequence showed 23-48% identities with AS from bacteria, yeasts, fungi, plants, and animals with the highest identities being to Synechocystis sp. and Bacillus subtilis (48 and 44%, respectively). Four conserved blocks including putative sulfate-binding and phosphate-binding regions were highly conserved in the E. histolytica AS. The upstream region of the AS gene contained three conserved elements reported for other E. histolytica genes. A recombinant E. histolytica AS revealed enzymatic activity, measured in both the forward and reverse directions. Expression of the E. histolytica AS complemented cysteine auxotrophy of the AS-deficient Escherichia coli strains. Genomic hybridization revealed that the AS gene exists as a single copy gene. In the literature, this is the first description of an AS gene in Protozoa.
Canneva, Fabio; Branzoni, Manuela; Riccardi, Giovanna; Provvedi, Roberta; Milano, Anna
2005-01-01
In a previous work, we demonstrated that the Mycobacterium tuberculosis Rv2358-furB operon is induced by zinc. In this study, the orthologous genes from Mycobacterium smegmatis mc2155 were inactivated and mutants analyzed. Rv2358 protein was purified and found to bind upstream of the Rv2358 gene. Binding was inhibited by Zn2+ ions. PMID:16077132
Ding, Zhihu; Gillespie, Laura L; Mercer, F Corinne; Paterno, Gary D
2004-07-02
To gain insight into the regulation of hmi-er1 expression, we cloned a human genomic DNA fragment containing one of the two hmi-er1 promoters and consisting of 1460 bp upstream of the translation initiation codon of hMI-ER1. Computer-assisted sequence analysis revealed that the hmi-er1 promoter region contains a CpG island but lacks an identifiable TATA element, initiator sequence and downstream promoter element. This genomic DNA was able to direct transcription of a luciferase reporter gene in a variety of human cell lines, and the minimal promoter was shown to be located within-68/+144 bp. Several putative Sp1 binding sites were identified, and we show that Sp1 can bind to the hmi-er1 minimal promoter and increase transcription, suggesting that the level of hmi-er1 expression may depend on the availability of Sp1 protein. Functional analysis revealed that hMI-ER1 represses Sp1-activated transcription from the minimal promoter by a histone deacetylase-independent mechanism. Chromatin immunoprecipitation analysis demonstrated that both Sp1 and hMI-ER1 are associated with the chromatin of the hmi-er1 promoter and that overexpression of hMI-ER1 in cell lines that allow Tet-On-inducible expression resulted in loss of detectable Sp1 from the endogenous hmi-er1 promoter. The mechanism by which this occurs does not involve binding of hMI-ER1 to cis-acting elements. Instead, we show that hMI-ER1 physically associates with Sp1 and that endogenous complexes containing the two proteins could be detected in vivo. Furthermore, hMI-ER1 specifically interferes with binding of Sp1 to the hmi-er1 minimal promoter as well as to an Sp1 consensus oligonucleotide. Deletion analysis revealed that this interaction occurs through a region containing the SANT domain of hMI-ER1. Together, these data reveal a functional role for the SANT domain in the action of co-repressor regulatory factors and suggest that the association of hMI-ER1 with Sp1 represents a novel mechanism for the negative regulation of Sp1 target promoters.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamaji, Takashi; Lopez, David; Pellegrini, Matteo
Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less
Stelman, D.
1988-06-30
A contactor/filter arrangement for removing particulate contaminants from a gaseous stream is described. The filter includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. A cover screen isolates the filter element from contact with the moving granular bed. In one embodiment, the granular material is comprised of porous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses. 6 figs.
Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark
2002-01-01
Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208
Al-Khouri, Anna Maria; Paule, Marvin R.
2002-01-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852
Al-Khouri, Anna Maria; Paule, Marvin R
2002-02-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.
Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C
2004-09-01
Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.
Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio
2016-01-01
In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. PMID:27016735
ASR5 is involved in the regulation of miRNA expression in rice.
Neto, Lauro Bücker; Arenhart, Rafael Augusto; de Oliveira, Luiz Felipe Valter; de Lima, Júlio Cesar; Bodanese-Zanettini, Maria Helena; Margis, Rogerio; Margis-Pinheiro, Márcia
2015-11-01
The work describes an ASR knockdown transcriptomic analysis by deep sequencing of rice root seedlings and the transactivation of ASR cis-acting elements in the upstream region of a MIR gene. MicroRNAs are key regulators of gene expression that guide post-transcriptional control of plant development and responses to environmental stresses. ASR (ABA, Stress and Ripening) proteins are plant-specific transcription factors with key roles in different biological processes. In rice, ASR proteins have been suggested to participate in the regulation of stress response genes. This work describes the transcriptomic analysis by deep sequencing two libraries, comparing miRNA abundance from the roots of transgenic ASR5 knockdown rice seedlings with that of the roots of wild-type non-transformed rice seedlings. Members of 59 miRNA families were detected, and 276 mature miRNAs were identified. Our analysis detected 112 miRNAs that were differentially expressed between the two libraries. A predicted inverse correlation between miR167abc and its target gene (LOC_Os07g29820) was confirmed using RT-qPCR. Protoplast transactivation assays showed that ASR5 is able to recognize binding sites upstream of the MIR167a gene and drive its expression in vivo. Together, our data establish a comparative study of miRNAome profiles and is the first study to suggest the involvement of ASR proteins in miRNA gene regulation.
Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells
Leddin, Mathias; Perrod, Chiara; Hoogenkamp, Maarten; Ghani, Saeed; Assi, Salam; Heinz, Sven; Wilson, Nicola K.; Follows, George; Schönheit, Jörg; Vockentanz, Lena; Mosammam, Ali M.; Chen, Wei; Tenen, Daniel G.; Westhead, David R.; Göttgens, Berthold
2011-01-01
The transcription factor PU.1 occupies a central role in controlling myeloid and early B-cell development, and its correct lineage-specific expression is critical for the differentiation choice of hematopoietic progenitors. However, little is known of how this tissue-specific pattern is established. We previously identified an upstream regulatory cis element whose targeted deletion in mice decreases PU.1 expression and causes leukemia. We show here that the upstream regulatory cis element alone is insufficient to confer physiologic PU.1 expression in mice but requires the cooperation with other, previously unidentified elements. Using a combination of transgenic studies, global chromatin assays, and detailed molecular analyses we present evidence that PU.1 is regulated by a novel mechanism involving cross talk between different cis elements together with lineage-restricted autoregulation. In this model, PU.1 regulates its expression in B cells and macrophages by differentially associating with cell type–specific transcription factors at one of its cis-regulatory elements to establish differential activity patterns at other elements. PMID:21239694
Coliphage HK022 Nun protein inhibits RNA polymerase translocation
Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max
2014-01-01
The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501
Apparatus for purifying exhaust gases of internal combustion engines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kakinuma, A.; Oya, H.
1980-06-03
Apparatus for purifying the exhaust gases of internal combustion engines is disclosed that is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a cylindrical shell having an inlet chamber, a catalyst chamber, an outlet chamber, and a monolithic catalyst element in the catalyst chamber. The inlet chamber has inlet ports communicating with the upstream exhaust pipes respectively and axial lines of the inlet ports cross each other in the inlet chamber. In the inlet chamber, a diffusion means is provided to diffuse the exhaust gas for uniformly distributingmore » it to the catalyst element.« less
Expression of eukaryotic polypeptides in chloroplasts
Mayfield, Stephen P.
2013-06-04
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.
2007-01-01
Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009
Huang, Xi; Duan, Min; Liao, Jiakai; Yuan, Xi; Chen, Hui; Feng, Jiejie; Huang, Ji; Zhang, Hong-Sheng
2014-01-01
Homeodomain-leucine zipper type I (HD-Zip I) proteins are involved in the regulation of plant development and response to environmental stresses. In this study, OsSLI1 (Oryza sativa stress largely induced 1), encoding a member of the HD-Zip I subfamily, was isolated from rice. The expression of OsSLI1 was dramatically induced by multiple abiotic stresses and exogenous abscisic acid (ABA). In silico sequence analysis discovered several cis-acting elements including multiple ABREs (ABA-responsive element binding factors) in the upstream promoter region of OsSLI1. The OsSLI1-GFP fusion protein was localized in the nucleus of rice protoplast cells and the transcriptional activity of OsSLI1 was confirmed by the yeast hybrid system. Further, it was found that OsSLI1 expression was enhanced in an ABI5-Like1 (ABL1) deficiency rice mutant abl1 under stress conditions, suggesting that ABL1 probably negatively regulates OsSLI1 gene expression. Moreover, it was found that OsSLI1 was regulated in panicle development. Taken together, OsSLI1 may be a transcriptional activator regulating stress-responsive gene expression and panicle development in rice.
Observations on the Growth of Roughness Elements Into Icing Feathers
NASA Technical Reports Server (NTRS)
Vargas, Mario; Tsao, Jen, Ching
2007-01-01
This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.
Kim, You-Mie; Song, Insun; Seo, Yong-Hak; Yoon, Gyesoon
2013-12-01
Enhanced lipogenesis plays a critical role in cell senescence via induction of expression of the mature form of sterol regulatory element binding protein 1 (SREBP1), which contributes to an increase in organellar mass, one of the indicators of senescence. We investigated the molecular mechanisms by which signaling molecules control SREBP1-mediated lipogenesis and senescence. We developed cellular models for stress-induced senescence, by exposing Chang cells, which are immortalized human liver cells, to subcytotoxic concentrations (200 µM) of deferoxamine (DFO) and H2O2. In this model of stress-induced cell senescence using DFO and H2O2, the phosphorylation profile of glycogen synthase kinase 3α (GSK3α) and β corresponded closely to the expression profile of the mature form of SREBP-1 protein. Inhibition of GSK3 with a subcytotoxic concentration of the selective GSK3 inhibitor SB415286 significantly increased mature SREBP1 expression, as well as lipogenesis and organellar mass. In addition, GSK3 inhibition was sufficient to induce senescence in Chang cells. Suppression of GSK3 expression with siRNAs specific to GSK3α and β also increased mature SREBP1 expression and induced senescence. Finally, blocking lipogenesis with fatty acid synthase inhibitors (cerulenin and C75) and siRNA-mediated silencing of SREBP1 and ATP citrate lyase (ACL) significantly attenuated GSK3 inhibition-induced senescence. GSK3 inactivation is an important upstream event that induces SREBP1-mediated lipogenesis and consequent cell senescence.
Buckbinder, L; Miralles, V J; Reinberg, D
1989-01-01
We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661
Inductively heated particulate matter filter regeneration control system
Gonze, Eugene V; Paratore Jr., Michael J; Kirby, Kevin W; Phelps, Amanda; Gregoire, Daniel J
2012-10-23
A system includes a particulate matter (PM) filter with an upstream end for receiving exhaust gas, a downstream end and zones. The system also includes a heating element. A control module selectively activates the heating element to inductively heat one of the zones.
Application of finite element approach to transonic flow problems
NASA Technical Reports Server (NTRS)
Hafez, M. M.; Murman, E. M.; Wellford, L. C., Jr.
1976-01-01
A variational finite element model for transonic small disturbance calculations is described. Different strategy is adopted in subsonic and supersonic regions, and blending elements are introduced between different regions. In the supersonic region, no upstream effect is allowed. If rectangular elements with linear shape functions are used, the model is similar to Murman's finite difference operators. Higher order shape functions, nonrectangular elements, and discontinuous approximation of shock waves are also discussed.
Optimal frequency-response sensitivity of compressible flow over roughness elements
NASA Astrophysics Data System (ADS)
Fosas de Pando, Miguel; Schmid, Peter J.
2017-04-01
Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.
Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression
Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang
2007-01-01
Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802
Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter
2010-01-01
The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111
Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D.; Castle, John C.; Raymond, Christopher K.; Lappala, Colin R.; Schaefer, Amy L.; Harwood, Caroline S.; Greenberg, E. Peter
2011-01-01
The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His6-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon. PMID:21378182
Moyroud, Edwige; Monniaux, Marie; Thévenon, Emmanuel; Dumas, Renaud; Scutt, Charles P; Frohlich, Michael W; Parcy, François
2017-10-01
Flowering plants evolved from an unidentified gymnosperm ancestor. Comparison of the mechanisms controlling development in angiosperm flowers and gymnosperm cones may help to elucidate the mysterious origin of the flower. We combined gene expression studies with protein behaviour characterization in Welwitschia mirabilis to test whether the known regulatory links between LEAFY and its MADS-box gene targets, central to flower development, might also contribute to gymnosperm reproductive development. We found that WelLFY, one of two LEAFY-like genes in Welwitschia, could be an upstream regulator of the MADS-box genes APETALA3/PISTILLATA-like (B-genes). We demonstrated that, even though their DNA-binding domains are extremely similar, WelLFY and its paralogue WelNDLY exhibit distinct DNA-binding specificities, and that, unlike WelNDLY, WelLFY shares with its angiosperm orthologue the capacity to bind promoters of Welwitschia B-genes. Finally, we identified several cis-elements mediating these interactions in Welwitschia and obtained evidence that the link between LFY homologues and B-genes is also conserved in two other gymnosperms, Pinus and Picea. Although functional approaches to investigate cone development in gymnosperms are limited, our state-of-the-art biophysical techniques, coupled with expression studies, provide evidence that crucial links, central to the control of floral development, may already have existed before the appearance of flowers. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
RNA chaperone activity of human La protein is mediated by variant RNA recognition motif.
Naeeni, Amir R; Conte, Maria R; Bayfield, Mark A
2012-02-17
La proteins are conserved factors in eukaryotes that bind and protect the 3' trailers of pre-tRNAs from exonuclease digestion via sequence-specific recognition of UUU-3'OH. La has also been hypothesized to assist pre-tRNAs in attaining their native fold through RNA chaperone activity. In addition to binding polymerase III transcripts, human La has also been shown to enhance the translation of several internal ribosome entry sites and upstream ORF-containing mRNA targets, also potentially through RNA chaperone activity. Using in vitro FRET-based assays, we show that human and Schizosaccharomyces pombe La proteins harbor RNA chaperone activity by enhancing RNA strand annealing and strand dissociation. We use various RNA substrates and La mutants to show that UUU-3'OH-dependent La-RNA binding is not required for this function, and we map RNA chaperone activity to its RRM1 motif including a noncanonical α3-helix. We validate the importance of this α3-helix by appending it to the RRM of the unrelated U1A protein and show that this fusion protein acquires significant strand annealing activity. Finally, we show that residues required for La-mediated RNA chaperone activity in vitro are required for La-dependent rescue of tRNA-mediated suppression via a mutated suppressor tRNA in vivo. This work delineates the structural elements required for La-mediated RNA chaperone activity and provides a basis for understanding how La can enhance the folding of its various RNA targets.
Link, Gerhard
1984-01-01
A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540
Javed, Muhammad Babar; Shotyk, William
2018-05-10
Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.
Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David
2001-01-01
Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681
Near-field flow structures about subcritical surface roughness
NASA Astrophysics Data System (ADS)
Doolittle, Charles J.; Drews, Scott D.; Goldstein, David B.
2014-12-01
Laminar flow over a periodic array of cylindrical surface roughness elements is simulated with an immersed boundary spectral method both to validate the method for subsequent studies and to examine how persistent streamwise vortices are introduced by a low Reynolds number roughness element. Direct comparisons are made with prior studies at a roughness-based Reynolds number Rek (=U(k) k/ν) of 205 and a diameter to spanwise spacing ratio d/λ of 1/3. Downstream velocity contours match present and past experiments very well. The shear layer developed over the top of the roughness element produces the downstream velocity deficit. Upstream of the roughness element, the vortex topology is found to be consistent with juncture flow experiments, creating three cores along the recirculation line. Streamtraces stemming from these upstream cores, however, have unexpectedly little effect on the downstream flowfield as lateral divergence of the boundary layer quickly dissipates their vorticity. Long physical relaxation time of the recirculating wake behind the roughness remains a prominent issue for simulating this type of flowfield.
Shielded regeneration heating element for a particulate filter
Gonze, Eugene V [Pinckney, MI; Ament, Frank [Troy, MI
2011-01-04
An exhaust system includes a particulate filter (PF) that is disposed downstream from an engine. The PF filters particulates within an exhaust from the engine. A heating element heats particulate matter in the PF. A catalyst substrate or a flow converter is disposed upstream from said heating element. The catalyst substrate oxidizes the exhaust prior to reception by the heating element. The flow converter converts turbulent exhaust flow to laminar exhaust flow prior to reception by the heating element.
Prediction of Geomagnetic Activity and Key Parameters in High-latitude Ionosphere
NASA Technical Reports Server (NTRS)
Khazanov, George V.; Lyatsky, Wladislaw; Tan, Arjun; Ridley, Aaron
2007-01-01
Prediction of geomagnetic activity and related events in the Earth's magnetosphere and ionosphere are important tasks of US Space Weather Program. Prediction reliability is dependent on the prediction method, and elements included in the prediction scheme. Two of the main elements of such prediction scheme are: an appropriate geomagnetic activity index, and an appropriate coupling function (the combination of solar wind parameters providing the best correlation between upstream solar wind data and geomagnetic activity). We have developed a new index of geomagnetic activity, the Polar Magnetic (PM) index and an improved version of solar wind coupling function. PM index is similar to the existing polar cap PC index but it shows much better correlation with upstream solar wind/IMF data and other events in the magnetosphere and ionosphere. We investigate the correlation of PM index with upstream solar wind/IMF data for 10 years (1995-2004) that include both low and high solar activity. We also have introduced a new prediction function for the predicting of cross-polar-cap voltage and Joule heating based on using both PM index and upstream solar wind/IMF data. As we show such prediction function significantly increase the reliability of prediction of these important parameters. The correlation coefficients between the actual and predicted values of these parameters are approx. 0.9 and higher.
Kel, AlexanderE
2017-02-01
Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.
Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.
Lo, W Y; Ting, L P
1994-01-01
Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237
Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu
2013-01-01
The INDUCER OF CBF EXPRESSION (ICE)–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several JASMONATE ZIM-DOMAIN (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance. PMID:23933884
Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu
2013-08-01
The inducer of cbf expression (ICE)-C-repeat binding factor/DRE binding factor1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several jasmonate ZIM-domain (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance.
Qiao, Huan; May, James M.
2012-01-01
Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872
Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.
Stone, D E; Craig, E A
1990-01-01
To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281
Papaioannou, Danai; Geibel, Sebastian; Kunze, Micha B A; Kay, Christopher W M; Waksman, Gabriel
2016-03-01
The adaptor protein Grb2 is a key element of mitogenetically important signaling pathways. With its SH2 domain it binds to upstream targets while its SH3 domains bind to downstream proteins thereby relaying signals from the cell membranes to the nucleus. The Grb2 SH2 domain binds to its targets by recognizing a phosphotyrosine (pY) in a pYxNx peptide motif, requiring an Asn at the +2 position C-terminal to the pY with the residue either side of this Asn being hydrophobic. Structural analysis of the Grb2 SH2 domain in complex with its cognate peptide has shown that the peptide adopts a unique β-turn conformation, unlike the extended conformation that phosphopeptides adopt when bound to other SH2 domains. TrpEF1 (W121) is believed to force the peptide into this unusual conformation conferring this unique specificity to the Grb2 SH2 domain. Using X-ray crystallography, electron paramagnetic resonance (EPR) spectroscopy, and isothermal titration calorimetry (ITC), we describe here a series of experiments that explore the role of TrpEF1 in determining the specificity of the Grb2 SH2 domain. Our results demonstrate that the ligand does not adopt a pre-organized structure before binding to the SH2 domain, rather it is the interaction between the two that imposes the hairpin loop to the peptide. Furthermore, we find that the peptide adopts a similar structure when bound to both the wild-type Grb2 SH2 domain and a TrpEF1Gly mutant. This suggests that TrpEF1 is not the determining factor for the conformation of the phosphopeptide. © 2015 The Protein Society.
Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio
2016-07-27
In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce
2004-07-01
The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.
TEs or not TEs? That is the evolutionary question.
Vaknin, Keren; Goren, Amir; Ast, Gil
2009-10-23
Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.
Tchoudakova, A; Kishida, M; Wood, E; Callard, G V
2001-11-01
Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most prominently in retinal ganglion cells (RGC) and axon-like projections to the optic tectum. Expression of a cyp19a/GFP reporter was not detectable up to 72 hpf. Tandem analysis of cyp19a and cyp19b promoters in living zebrafish embryos can be a useful approach for identifying cis-elements and cellular factors involved in the correct tissue-specific, spatial, temporal and estrogen regulated expression of aromatase genes during CNS and gonadal development.
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Identification of Natural RORγ Ligands that Regulate the Development of Lymphoid Cells
Santori, Fabio R.; Huang, Pengxiang; van de Pavert, Serge A.; Douglass, Eugene F.; Leaver, David J.; Haubrich, Brad A.; Keber, Rok; Lorbek, Gregor; Konijn, Tanja; Rosales, Brittany N.; Horvat, Simon; Rozman, Damjana; Rahier, Alain; Mebius, Reina E.; Rastinejad, Fraydoon; Nes, W. David; Littman, Dan R.
2015-01-01
SUMMARY Mice deficient in the nuclear hormone receptor RORγt have defective development of thymocytes, lymphoid organs, Th17 cells and type 3 innate lymphoid cells. RORγt binds to oxysterols derived from cholesterol catabolism but it is not clear whether these are its natural ligands. Here, we show that sterol lipids are necessary and sufficient to drive RORγt-dependent transcription. We combined overexpression, RNA interference and genetic deletion of metabolic enzymes to study RORγ-dependent transcription. Our results are consistent with the RORγt ligand(s) being a cholesterol biosynthetic intermediate (CBI) downstream of lanosterol and upstream of zymosterol. Analysis of lipids bound to RORγ identified molecules with molecular weights consistent with CBIs. Furthermore, CBIs stabilized the RORγ ligand-binding domain and induced co-activator recruitment. Genetic deletion of metabolic enzymes upstream of the RORγt-ligand(s) affected the development of lymph nodes and Th17 cells. Our data suggest that CBIs play a role in lymphocyte development potentially through regulation of RORγt. PMID:25651181
Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M
1993-01-01
Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916
Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji
2018-05-03
Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.
Aldosterone alters the chromatin structure of the murine endothelin-1 gene.
Welch, Amanda K; Jeanette Lynch, I; Gumz, Michelle L; Cain, Brian D; Wingo, Charles S
2016-08-15
Aldosterone increases sodium reabsorption in the renal collecting duct and systemic blood pressure. Paradoxically, aldosterone also induces transcription of the endothelin-1 (Edn1) gene to increase protein (ET-1) levels, which inhibits sodium reabsorption. Here we investigated changes in the chromatin structure of the Edn1 gene of collecting duct cell lines in response to aldosterone treatment. The Edn1 gene has a CpG island that encompasses the transcription start site and four sites in the 5' regulatory region previously linked to transcriptional regulation. The chromatin structure of the Edn1 gene was investigated using a quantitative PCR-based DNaseI hypersensitivity assay in murine hepatocyte (AML12), renal cortical collecting duct (mpkCCDC14), outer medullary collecting duct1 (OMCD1), and inner medullary collecting duct-3 (IMCD-3) cell lines. The CpG island was uniformly accessible. One calcium-responsive NFAT element remained at low chromatin accessibility in all cell lines under all conditions tested. However, the second calcium responsive NFAT element located at -1563bp upstream became markedly more accessible in IMCD-3 cells exposed to aldosterone. Importantly, one established aldosterone hormone response element HRE at -671bp relative to the transcription start site was highly accessible, and another HRE (-551bp) became more accessible in aldosterone-treated IMCD-3 and OMCD1 cells. The evidence supports a model in which aldosterone activation of the mineralocorticoid receptor (MR) results in the MR-hormone complex binding at HRE at -671bp to open chromatin structure around other regulatory elements in the Edn1 gene. Published by Elsevier Inc.
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Kortmann, Jens; Seekircher, Stephanie; Heroven, Ann Kathrin; Berger, Evelin; Pisano, Fabio; Thiermann, Tanja; Wolf-Watz, Hans; Narberhaus, Franz; Dersch, Petra
2012-01-01
Expression of all Yersinia pathogenicity factors encoded on the virulence plasmid, including the yop effector and the ysc type III secretion genes, is controlled by the transcriptional activator LcrF in response to temperature. Here, we show that a protein- and RNA-dependent hierarchy of thermosensors induce LcrF synthesis at body temperature. Thermally regulated transcription of lcrF is modest and mediated by the thermo-sensitive modulator YmoA, which represses transcription from a single promoter located far upstream of the yscW-lcrF operon at moderate temperatures. The transcriptional response is complemented by a second layer of temperature-control induced by a unique cis-acting RNA element located within the intergenic region of the yscW-lcrF transcript. Structure probing demonstrated that this region forms a secondary structure composed of two stemloops at 25°C. The second hairpin sequesters the lcrF ribosomal binding site by a stretch of four uracils. Opening of this structure was favored at 37°C and permitted ribosome binding at host body temperature. Our study further provides experimental evidence for the biological relevance of an RNA thermometer in an animal model. Following oral infections in mice, we found that two different Y. pseudotuberculosis patient isolates expressing a stabilized thermometer variant were strongly reduced in their ability to disseminate into the Peyer's patches, liver and spleen and have fully lost their lethality. Intriguingly, Yersinia strains with a destabilized version of the thermosensor were attenuated or exhibited a similar, but not a higher mortality. This illustrates that the RNA thermometer is the decisive control element providing just the appropriate amounts of LcrF protein for optimal infection efficiency. PMID:22359501
Berg, Jordan A.; Merrill, Bryan D.; Crockett, Justin T.; Esplin, Kyle P.; Evans, Marlee R.; Heaton, Karli E.; Hilton, Jared A.; Hyde, Jonathan R.; McBride, Morgan S.; Schouten, Jordan T.; Simister, Austin R.; Thurgood, Trever L.; Ward, Andrew T.; Breakwell, Donald P.; Hope, Sandra; Grose, Julianne H.
2016-01-01
Brevibacillus laterosporus is a spore-forming bacterium that causes a secondary infection in beehives following European Foulbrood disease. To better understand the contributions of Brevibacillus bacteriophages to the evolution of their hosts, five novel phages (Jenst, Osiris, Powder, SecTim467, and Sundance) were isolated and characterized. When compared with the five Brevibacillus phages currently in NCBI, these phages were assigned to clusters based on whole genome and proteome synteny. Powder and Osiris, both myoviruses, were assigned to the previously described Jimmer-like cluster. SecTim467 and Jenst, both siphoviruses, formed a novel phage cluster. Sundance, a siphovirus, was assigned as a singleton phage along with the previously isolated singleton, Emery. In addition to characterizing the basic relationships between these phages, several genomic features were observed. A motif repeated throughout phages Jenst and SecTim467 was frequently upstream of genes predicted to function in DNA replication, nucleotide metabolism, and transcription, suggesting transcriptional co-regulation. In addition, paralogous gene pairs that encode a putative transcriptional regulator were identified in four Brevibacillus phages. These paralogs likely evolved to bind different DNA sequences due to variation at amino acid residues predicted to bind specific nucleotides. Finally, a putative transposable element was identified in SecTim467 and Sundance that carries genes homologous to those found in Brevibacillus chromosomes. Remnants of this transposable element were also identified in phage Jenst. These discoveries provide a greater understanding of the diversity of phages, their behavior, and their evolutionary relationships to one another and to their host. In addition, they provide a foundation with which further Brevibacillus phages can be compared. PMID:27304881
Ay, Muhammet; Luo, Jie; Langley, Monica; Jin, Huajun; Anantharam, Vellareddy; Kanthasamy, Arthi; Kanthasamy, Anumantha G
2017-06-01
Quercetin, one of the major flavonoids in plants, has been recently reported to have neuroprotective effects against neurodegenerative processes. However, since the molecular signaling mechanisms governing these effects are not well clarified, we evaluated quercetin's effect on the neuroprotective signaling events in dopaminergic neuronal models and further tested its efficacy in the MitoPark transgenic mouse model of Parkinson's disease (PD). Western blot analysis revealed that quercetin significantly induced the activation of two major cell survival kinases, protein kinase D1 (PKD1) and Akt in MN9D dopaminergic neuronal cells. Furthermore, pharmacological inhibition or siRNA knockdown of PKD1 blocked the activation of Akt, suggesting that PKD1 acts as an upstream regulator of Akt in quercetin-mediated neuroprotective signaling. Quercetin also enhanced cAMP response-element binding protein phosphorylation and expression of the cAMP response-element binding protein target gene brain-derived neurotrophic factor. Results from qRT-PCR, Western blot analysis, mtDNA content analysis, and MitoTracker assay experiments revealed that quercetin augmented mitochondrial biogenesis. Quercetin also increased mitochondrial bioenergetics capacity and protected MN9D cells against 6-hydroxydopamine-induced neurotoxicity. To further evaluate the neuroprotective efficacy of quercetin against the mitochondrial dysfunction underlying PD, we used the progressive dopaminergic neurodegenerative MitoPark transgenic mouse model of PD. Oral administration of quercetin significantly reversed behavioral deficits, striatal dopamine depletion, and TH neuronal cell loss in MitoPark mice. Together, our findings demonstrate that quercetin activates the PKD1-Akt cell survival signaling axis and suggest that further exploration of quercetin as a promising neuroprotective agent for treating PD may offer clinical benefits. © 2017 International Society for Neurochemistry.
Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli
2012-01-01
Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR – COUP-TF1 – which could possibly play a role in human prostate cancer. PMID:23056316
Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli
2012-01-01
Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR - COUP-TF1 - which could possibly play a role in human prostate cancer.
2014-01-01
Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182
A riboswitch-regulated antisense RNA in Listeria monocytogenes.
Mellin, J R; Tiensuu, Teresa; Bécavin, Christophe; Gouin, Edith; Johansson, Jörgen; Cossart, Pascale
2013-08-06
Riboswitches are ligand-binding elements located in 5' untranslated regions of messenger RNAs, which regulate expression of downstream genes. In Listeria monocytogenes, a vitamin B12-binding (B12) riboswitch was identified, not upstream of a gene but downstream, and antisense to the adjacent gene, pocR, suggesting it might regulate pocR in a nonclassical manner. In Salmonella enterica, PocR is a transcription factor that is activated by 1,2-propanediol, and subsequently activates expression of the pdu genes. The pdu genes mediate propanediol catabolism and are implicated in pathogenesis. As enzymes involved in propanediol catabolism require B12 as a cofactor, we hypothesized that the Listeria B12 riboswitch might be involved in pocR regulation. Here we demonstrate that the B12 riboswitch is transcribed as part of a noncoding antisense RNA, herein named AspocR. In the presence of B12, the riboswitch induces transcriptional termination, causing aspocR to be transcribed as a short transcript. In contrast, in the absence of B12, aspocR is transcribed as a long antisense RNA, which inhibits pocR expression. Regulation by AspocR ensures that pocR, and consequently the pdu genes, are maximally expressed only when both propanediol and B12 are present. Strikingly, AspocR can inhibit pocR expression in trans, suggesting it acts through a direct interaction with pocR mRNA. Together, this study demonstrates how pocR and the pdu genes can be regulated by B12 in bacteria and extends the classical definition of riboswitches from elements governing solely the expression of mRNAs to a wider role in controlling transcription of noncoding RNAs.
Böhme, Katja; Steinmann, Rebekka; Kortmann, Jens; Seekircher, Stephanie; Heroven, Ann Kathrin; Berger, Evelin; Pisano, Fabio; Thiermann, Tanja; Wolf-Watz, Hans; Narberhaus, Franz; Dersch, Petra
2012-02-01
Expression of all Yersinia pathogenicity factors encoded on the virulence plasmid, including the yop effector and the ysc type III secretion genes, is controlled by the transcriptional activator LcrF in response to temperature. Here, we show that a protein- and RNA-dependent hierarchy of thermosensors induce LcrF synthesis at body temperature. Thermally regulated transcription of lcrF is modest and mediated by the thermo-sensitive modulator YmoA, which represses transcription from a single promoter located far upstream of the yscW-lcrF operon at moderate temperatures. The transcriptional response is complemented by a second layer of temperature-control induced by a unique cis-acting RNA element located within the intergenic region of the yscW-lcrF transcript. Structure probing demonstrated that this region forms a secondary structure composed of two stemloops at 25°C. The second hairpin sequesters the lcrF ribosomal binding site by a stretch of four uracils. Opening of this structure was favored at 37°C and permitted ribosome binding at host body temperature. Our study further provides experimental evidence for the biological relevance of an RNA thermometer in an animal model. Following oral infections in mice, we found that two different Y. pseudotuberculosis patient isolates expressing a stabilized thermometer variant were strongly reduced in their ability to disseminate into the Peyer's patches, liver and spleen and have fully lost their lethality. Intriguingly, Yersinia strains with a destabilized version of the thermosensor were attenuated or exhibited a similar, but not a higher mortality. This illustrates that the RNA thermometer is the decisive control element providing just the appropriate amounts of LcrF protein for optimal infection efficiency.
Retrotransposon Tf1 is targeted to pol II promoters by transcription activators
Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.
2008-01-01
SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330
Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.
Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L
2008-04-11
The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.
Cloning and functional analysis of 5'-upstream region of the Pokemon gene.
Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang
2008-04-01
Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Particle Velocity Measuring System
NASA Technical Reports Server (NTRS)
Arndt, G. Dickey (Inventor); Carl, James R. (Inventor)
1998-01-01
Method and apparatus are provided for determining the velocity of individual food particles within a liquid/solid food mixture that is cooked by an aseptic cooking method whereby the food mixture is heated as it flows through a flowline. At least one upstream and at least one downstream microwave transducer are provided to determine the minimum possible travel time of the fastest food particle through the flowline. In one embodiment, the upstream detector is not required. In another embodiment, a plurality of small dipole antenna markers are secured to a plurality of food particles to provide a plurality of signals as the markers pass the upstream and downstream transducers. The dipole antenna markers may also include a non-linear element to reradiate a harmonic frequency of a transmitter frequency. Upstream and downstream transducers include dipole antennas that are matched to the impedance of the food slurry and a signal transmission cable by various impedance matching means including unbalanced feed to the antennas.
Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda
2012-09-01
Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.
Kim, K H; Hemenway, C
1997-05-26
The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.
Transcriptional Profiling Identifies Functional Interactions of TGFβ and PPARβ/δ Signaling
Kaddatz, Kerstin; Adhikary, Till; Finkernagel, Florian; Meissner, Wolfgang; Müller-Brüsselbach, Sabine; Müller, Rolf
2010-01-01
Peroxisome proliferator-activated receptors (PPARs) not only play a key role in regulating metabolic pathways but also modulate inflammatory processes, pointing to a functional interaction between PPAR and cytokine signaling pathways. In this study, we show by genome-wide transcriptional profiling that PPARβ/δ and transforming growth factor-β (TGFβ) pathways functionally interact in human myofibroblasts and that a subset of these genes is cooperatively activated by TGFβ and PPARβ/δ. Using the angiopoietin-like 4 (ANGPTL4) gene as a model, we demonstrate that two enhancer regions cooperate to mediate the observed synergistic response. A TGFβ-responsive enhancer located ∼8 kb upstream of the transcriptional start site is regulated by a mechanism involving SMAD3, ETS1, RUNX, and AP-1 transcription factors that interact with multiple contiguous binding sites. A second enhancer (PPAR-E) consisting of three juxtaposed PPAR response elements is located in the third intron ∼3.5 kb downstream of the transcriptional start site. The PPAR-E is strongly activated by all three PPAR subtypes, with a novel type of PPAR response element motif playing a central role. Although the PPAR-E is not regulated by TGFβ, it interacts with SMAD3, ETS1, RUNX2, and AP-1 in vivo, providing a possible mechanistic explanation for the observed synergism. PMID:20595396
Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe
2014-01-01
Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649
Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR
Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen
2014-01-01
Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487
Transcription factor trapping by RNA in gene regulatory elements.
Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A
2015-11-20
Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.
Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R
1992-04-01
Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common feature which defines the capacity of these elements to confer T3 induction.
Onal, Melda; St John, Hillary C; Danielson, Allison L; Pike, J Wesley
2016-02-01
Receptor activator of nuclear factor-κB ligand (RANKL) is a tumor necrosis factor (TNF)-like cytokine that is necessary for osteoclast formation and survival. Elevated RANKL synthesis is associated with both increased osteoclast number and bone resorption. Earlier studies identified an enhancer 76 kb upstream of the Tnfsf11 transcriptional start site (TSS) termed RL-D5 or the distal control region (DCR) that modulates RANKL expression in response to PTH, 1,25(OH)2D3,, and an array of cytokines. Mice lacking RL-D5 exhibit high bone mass associated with decreased RANKL expression in bone, spleen, and thymus. In addition to RL-D5, genome-wide studies have identified 9 additional Tnfsf11 enhancers residing upstream of the gene's TSS, which provide RANKL cell type-specificity and responsiveness to local and systemic factors. ChIP-chip analyses has revealed inducible vitamin D receptor (VDR) and cAMP response element-binding protein (CREB) binding at an enhancer termed RL-D2 23 kb upstream of the Tnfsf11 TSS in osteoblastic ST2 cells. Herein, we use ChIP-seq analyses to confirm this finding and then delete this enhancer from the mouse genome to determine its physiological role in vivo. RL-D2(-/-) primary stromal cells showed decreased RANKL-induction by both forskolin and 1,25(OH)2D3 ex vivo. Consistent with this, the parathyroid hormone (PTH) induction of RANKL expression was significantly blunted in RL-D2(-/-) mice in vivo. In contrast, lack of RL-D2 had no effect on 1,25(OH)2D3 induction of RANKL in vivo. Similar to the results found in RL-D5(-/-) mice, lack of RL-D2 led to decreased skeletal RANKL expression, resulting in decreased osteoclast numbers and a progressive increase in bone mineral density. Lack of RL-D2 increased cancellous bone mass in femur and spine but did not alter femoral cortical bone thickness. These results highlight the role of distal enhancers in the regulation of RANKL expression by PTH and perhaps 1,25(OH)2D3 and suggest that the RL-D2 and RL-D5 enhancers contribute in either an additive or synergistic manner to regulate bone remodeling. © 2015 American Society for Bone and Mineral Research.
Das, G; Henning, D; Wright, D; Reddy, R
1988-01-01
Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121
Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E
2007-10-01
Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.
Regulation of neural macroRNAs by the transcriptional repressor REST
Johnson, Rory; Teh, Christina Hui-Leng; Jia, Hui; Vanisri, Ravi Raj; Pandey, Tridansh; Lu, Zhong-Hao; Buckley, Noel J.; Stanton, Lawrence W.; Lipovich, Leonard
2009-01-01
The essential transcriptional repressor REST (repressor element 1-silencing transcription factor) plays central roles in development and human disease by regulating a large cohort of neural genes. These have conventionally fallen into the class of known, protein-coding genes; recently, however, several noncoding microRNA genes were identified as REST targets. Given the widespread transcription of messenger RNA-like, noncoding RNAs (“macroRNAs”), some of which are functional and implicated in disease in mammalian genomes, we sought to determine whether this class of noncoding RNAs can also be regulated by REST. By applying a new, unbiased target gene annotation pipeline to computationally discovered REST binding sites, we find that 23% of mammalian REST genomic binding sites are within 10 kb of a macroRNA gene. These putative target genes were overlooked by previous studies. Focusing on a set of 18 candidate macroRNA targets from mouse, we experimentally demonstrate that two are regulated by REST in neural stem cells. Flanking protein-coding genes are, at most, weakly repressed, suggesting specific targeting of the macroRNAs by REST. Similar to the majority of known REST target genes, both of these macroRNAs are induced during nervous system development and have neurally restricted expression profiles in adult mouse. We observe a similar phenomenon in human: the DiGeorge syndrome-associated noncoding RNA, DGCR5, is repressed by REST through a proximal upstream binding site. Therefore neural macroRNAs represent an additional component of the REST regulatory network. These macroRNAs are new candidates for understanding the role of REST in neuronal development, neurodegeneration, and cancer. PMID:19050060
Regulation of neural macroRNAs by the transcriptional repressor REST.
Johnson, Rory; Teh, Christina Hui-Leng; Jia, Hui; Vanisri, Ravi Raj; Pandey, Tridansh; Lu, Zhong-Hao; Buckley, Noel J; Stanton, Lawrence W; Lipovich, Leonard
2009-01-01
The essential transcriptional repressor REST (repressor element 1-silencing transcription factor) plays central roles in development and human disease by regulating a large cohort of neural genes. These have conventionally fallen into the class of known, protein-coding genes; recently, however, several noncoding microRNA genes were identified as REST targets. Given the widespread transcription of messenger RNA-like, noncoding RNAs ("macroRNAs"), some of which are functional and implicated in disease in mammalian genomes, we sought to determine whether this class of noncoding RNAs can also be regulated by REST. By applying a new, unbiased target gene annotation pipeline to computationally discovered REST binding sites, we find that 23% of mammalian REST genomic binding sites are within 10 kb of a macroRNA gene. These putative target genes were overlooked by previous studies. Focusing on a set of 18 candidate macroRNA targets from mouse, we experimentally demonstrate that two are regulated by REST in neural stem cells. Flanking protein-coding genes are, at most, weakly repressed, suggesting specific targeting of the macroRNAs by REST. Similar to the majority of known REST target genes, both of these macroRNAs are induced during nervous system development and have neurally restricted expression profiles in adult mouse. We observe a similar phenomenon in human: the DiGeorge syndrome-associated noncoding RNA, DGCR5, is repressed by REST through a proximal upstream binding site. Therefore neural macroRNAs represent an additional component of the REST regulatory network. These macroRNAs are new candidates for understanding the role of REST in neuronal development, neurodegeneration, and cancer.
Sawado, T; Igarashi, K; Groudine, M
2001-08-28
The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.
RNA Chaperone Activity of Human La Protein Is Mediated by Variant RNA Recognition Motif*
Naeeni, Amir R.; Conte, Maria R.; Bayfield, Mark A.
2012-01-01
La proteins are conserved factors in eukaryotes that bind and protect the 3′ trailers of pre-tRNAs from exonuclease digestion via sequence-specific recognition of UUU-3′OH. La has also been hypothesized to assist pre-tRNAs in attaining their native fold through RNA chaperone activity. In addition to binding polymerase III transcripts, human La has also been shown to enhance the translation of several internal ribosome entry sites and upstream ORF-containing mRNA targets, also potentially through RNA chaperone activity. Using in vitro FRET-based assays, we show that human and Schizosaccharomyces pombe La proteins harbor RNA chaperone activity by enhancing RNA strand annealing and strand dissociation. We use various RNA substrates and La mutants to show that UUU-3′OH-dependent La-RNA binding is not required for this function, and we map RNA chaperone activity to its RRM1 motif including a noncanonical α3-helix. We validate the importance of this α3-helix by appending it to the RRM of the unrelated U1A protein and show that this fusion protein acquires significant strand annealing activity. Finally, we show that residues required for La-mediated RNA chaperone activity in vitro are required for La-dependent rescue of tRNA-mediated suppression via a mutated suppressor tRNA in vivo. This work delineates the structural elements required for La-mediated RNA chaperone activity and provides a basis for understanding how La can enhance the folding of its various RNA targets. PMID:22203678
Control of the actin cytoskeleton in root hair development.
Pei, Weike; Du, Fei; Zhang, Yi; He, Tian; Ren, Haiyun
2012-05-01
The development of root hair includes four stages: bulge site selection, bulge formation, tip growth, and maturation. The actin cytoskeleton is involved in all of these stages and is organized into distinct arrangements in the different stages. In addition to the actin configuration, actin isoforms also play distinct roles in the different stages. The actin cytoskeleton is regulated by actin-binding proteins, such as formin, Arp2/3 complex, profilin, actin depolymerizing factor, and villin. Some upstream signals, i.e. calcium, phospholipids, and small GTPase regulate the activity of these actin-binding proteins to produce the proper actin configuration. We constructed a working model on how the actin cytoskeleton is controlled by actin-binding proteins and upstream signaling in root hair development based on the current literature: at the tip of hairs, actin polymerization appears to be facilitated by Arp2/3 complex that is activated by small GTPase, and profilin that is regulated by phosphatidylinositol 4,5-bisphosphate. Meanwhile, actin depolymerization and turnover are likely mediated by villin and actin depolymerizing factor, which are stimulated by calcium. At the shank, actin cables are produced by formin and villin. Under the complicated interaction, the actin cytoskeleton is controlled spatially and temporally during root hair development. © 2012 Elsevier Ireland Ltd. All rights reserved.
Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S
2000-06-01
17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Miyake, Tsuyoshi; Hiraishi, Hiroyuki; Sammoto, Hiroyuki; Ono, Bun-Ichiro
2003-10-10
The Saccharomyces cerevisiae gene HGT1/GSH11 encodes the high affinity glutathione transporter and is repressed by cysteine added to the culture medium. It has been found previously that a 5'-upstream cis-element, CCGCCACAC, is responsible for regulating GSH11 expression and that several proteins bind to this element (Miyake, T., Kanayama, M., Sammoto, H., and Ono, B. (2002) Mol. Genet. Genomics 266, 1004-1011). In this report we present evidence that the most prominent of these proteins is VDE, known previously as the homing endonuclease encoded by VMA1. We show also that GSH11 is not expressed in a VDE-deleted strain and that inability to express the GSH11 of this strain is overcome by introduction of the coding region of VDE or the entire VMA1 gene. It is also found that VDE does not cut DNA in the vicinity of the GSH11 cis-element. Rapamycin, an inhibitor of the target of rapamycin (TOR) signal-transduction system, is found to enhance expression of GSH11 in a VDE-dependent manner under conditions of sulfur starvation. These results indicate that GSH11 is regulated by a system sensitive to sulfur starvation (presumably via cysteine depletion) and a more general system involving the nutritional starvation signal mediated by the TOR system. Both systems need to be operational (inhibition of TOR and sulfur starvation) for full expression of GSH11.
Kibbey, Megan M; Jameson, Mark J; Eaton, Erin M; Rosenzweig, Steven A
2006-03-01
Signaling by the insulin-like growth factor (IGF)-1 receptor (IGF-1R) has been implicated in the promotion and aggressiveness of breast, prostate, colorectal, and lung cancers. The IGF binding proteins (IGFBPs) represent a class of natural IGF antagonists that bind to and sequester IGF-1/2 from the IGF-1R, making them attractive candidates as therapeutics for cancer prevention and control. Recombinant human IGFBP-2 significantly attenuated IGF-1-stimulated MCF-7 cell proliferation with coaddition of 20 or 100 nM IGFBP-2 (50 or 80% inhibition, respectively). We previously identified IGF-1 contact sites both upstream and downstream of the CWCV motif (residues 247-250) in human IGFBP-2 (J Biol Chem 276:2880-2889, 2001). To further test their contributions to IGFBP-2 function, the single tryptophan in human IGFBP-2, Trp-248, was selectively cleaved with 2-(2'nitrophenylsulfenyl)-3-methyl-3 bromoindolenine (BNPS-skatole) and the BNPS-skatole products IGFBP-2(1-248) and IGFBP-2(249-289) as well as IGFBP-2(1-190) were expressed as glutathione S-transferase-fusion proteins and purified. Based on competition binding analysis, deletion of residues 249 to 289 caused an approximately 20-fold decrease in IGF-1 binding affinity (IGFBP-2 EC50 = 0.35 nM and IGFBP-2(1-248) = 7 nM). Removal of the remainder of the C-terminal domain had no further effect on affinity (IGFBP-2(1-190) EC50 = 9.2 nM). In kinetic assays, IGFBP-2(1-248) and IGFBP-2(1-190) exhibited more rapid association and dissociation rates than full-length IGFBP-2. These results confirm that regions upstream and downstream of the CWCV motif participate in IGF-1 binding. They further support the development of full-length IGFBP-2 as a cancer therapeutic.
Nawaz, Zarqa; Kakar, Kaleem Ullah; Saand, Mumtaz A; Shu, Qing-Yao
2014-10-04
Cyclic nucleotide-gated channels (CNGCs) are Ca2+-permeable cation transport channels, which are present in both animal and plant systems. They have been implicated in the uptake of both essential and toxic cations, Ca2+ signaling, pathogen defense, and thermotolerance in plants. To date there has not been a genome-wide overview of the CNGC gene family in any economically important crop, including rice (Oryza sativa L.). There is an urgent need for a thorough genome-wide analysis and experimental verification of this gene family in rice. In this study, a total of 16 full length rice CNGC genes distributed on chromosomes 1-6, 9 and 12, were identified by employing comprehensive bioinformatics analyses. Based on phylogeny, the family of OsCNGCs was classified into four major groups (I-IV) and two sub-groups (IV-A and IV- B). Likewise, the CNGCs from all plant lineages clustered into four groups (I-IV), where group II was conserved in all land plants. Gene duplication analysis revealed that both chromosomal segmentation (OsCNGC1 and 2, 10 and 11, 15 and 16) and tandem duplications (OsCNGC1 and 2) significantly contributed to the expansion of this gene family. Motif composition and protein sequence analysis revealed that the CNGC specific domain "cyclic nucleotide-binding domain (CNBD)" comprises a "phosphate binding cassette" (PBC) and a "hinge" region that is highly conserved among the OsCNGCs. In addition, OsCNGC proteins also contain various other functional motifs and post-translational modification sites. We successively built a stringent motif: (LI-X(2)-[GS]-X-[FV]-X-G-[1]-ELL-X-W-X(12,22)-SA-X(2)-T-X(7)-[EQ]-AF-X-L) that recognizes the rice CNGCs specifically. Prediction of cis-acting regulatory elements in 5' upstream sequences and expression analyses through quantitative qPCR demonstrated that OsCNGC genes were highly responsive to multiple stimuli including hormonal (abscisic acid, indoleacetic acid, kinetin and ethylene), biotic (Pseudomonas fuscovaginae and Xanthomonas oryzae pv. oryzae) and abiotic (cold) stress. There are 16 CNGC genes in rice, which were probably expanded through chromosomal segmentation and tandem duplications and comprise a PBC and a "hinge" region in the CNBD domain, featured by a stringent motif. The various cis-acting regulatory elements in the upstream sequences may be responsible for responding to multiple stimuli, including hormonal, biotic and abiotic stresses.
Computation of Feedback Aeroacoustic System by the CE/SE Method
NASA Technical Reports Server (NTRS)
Loh, Ching Y.; Wang, Xiao Y.; Chang, Sin-Chung; Jorgenson, Philip C. E.
2000-01-01
It is well known that due to vortex shedding in high speed flow over cutouts, cavities, and gaps, intense noise may be generated. Strong tonal oscillations occur in a feedback cycle in which the vortices shed from the upstream edge of the cavity convect downstream and impinge on the cavity lip, generating acoustic waves that propagate upstream to excite new vortices. Numerical simulation of such a complicated process requires a scheme that can: (1) resolve acoustic waves with low dispersion and numerical dissipation, (2) handle nonlinear and discontinuous waves (e.g. shocks), and (3) have an effective (near field) nonreflecting boundary condition (NRBC). The new space time conservation element and solution element method, or CE/SE for short, is a numerical method that meets the above requirements.
Cawley, William E.; Warnick, Robert F.
1982-01-01
1. In a nuclear reactor incorporating a plurality of columns of tubular fuel elements disposed in horizontal tubes in a mass of graphite wherein water flows through the tubes to cool the fuel elements, the improvement comprising at least one control column disposed in a horizontal tube including fewer fuel elements than in a normal column of fuel elements and tubular control elements disposed at both ends of said control column, and means for varying the horizontal displacement of the control column comprising a winch at the upstream end of the control column and a cable extending through the fuel and control elements and attached to the element at the downstream end of the column.
Myh7b/miR-499 gene expression is transcriptionally regulated by MRFs and Eos
Yeung, Fan; Chung, Eunhee; Guess, Martin G.; Bell, Matthew L.; Leinwand, Leslie A.
2012-01-01
The sarcomeric myosin gene, Myh7b, encodes an intronic microRNA, miR-499, which regulates cardiac and skeletal muscle biology, yet little is known about its transcriptional regulation. To identify the transcription factors involved in regulating Myh7b/miR-499 gene expression, we have mapped the transcriptional start sites and identified an upstream 6.2 kb region of the mouse Myh7b gene whose activity mimics the expression pattern of the endogenous Myh7b gene both in vitro and in vivo. Through promoter deletion analysis, we have mapped a distal E-box element and a proximal Ikaros site that are essential for Myh7b promoter activity in muscle cells. We show that the myogenic regulatory factors, MyoD, Myf5 and Myogenin, bind to the E-box, while a lymphoid transcription factor, Ikaros 4 (Eos), binds to the Ikaros motif. Further, we show that through physical interaction, MyoD and Eos form an active transcriptional complex on the chromatin to regulate the expression of the endogenous Myh7b/miR-499 gene in muscle cells. We also provide the first evidence that Eos can regulate expression of additional myosin genes (Myosin 1 and β-Myosin) via the miR-499/Sox6 pathway. Therefore, our results indicate a novel role for Eos in the regulation of the myofiber gene program. PMID:22638570
Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins
Zhao, Baoyu; Shu, Chang; Gao, Xinsheng; ...
2016-06-02
Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less
Yallowitz, Alisha R.; Gong, Ke-Qin; Swinehart, Ilea T.; Nelson, Lisa T.; Wellik, Deneen M.
2009-01-01
Summary Hox genes control many developmental events along the AP axis, but few target genes have been identified. Whether target genes are activated or repressed, what enhancer elements are required for regulation, and how different domains of the Hox proteins contribute to regulatory specificity is poorly understood. Six2 is genetically downstream of both the Hox11 paralogous genes in the developing mammalian kidney and Hoxa2 in branchial arch and facial mesenchyme. Loss-of-function of Hox11 leads to loss of Six2 expression and loss-of-function of Hoxa2 leads to expanded Six2 expression. Herein we demonstrate that a single enhancer site upstream of the Six2 coding sequence is responsible for both activation by Hox11 proteins in the kidney and repression by Hoxa2 in the branchial arch and facial mesenchyme in vivo. DNA binding activity is required for both activation and repression, but differential activity is not controlled by differences in the homeodomains. Rather, protein domains N- and C-terminal to the homeodomain confer activation versus repression activity. These data support a model in which the DNA binding specificity of Hox proteins in vivo may be similar, consistent with accumulated in vitro data, and that unique functions result mainly from differential interactions mediated by non-homeodomain regions of Hox proteins. PMID:19716816
Goller, Carlos; Wang, Xin; Itoh, Yoshikane; Romeo, Tony
2006-01-01
The pgaABCD operon of Escherichia coli is required for production of the biofilm adhesin poly-β-1,6-N-acetyl-d-glucosamine (PGA). We establish here that NhaR, a DNA-binding protein of the LysR family of transcriptional regulators, activates transcription of this operon. Disruption of the nhaR gene decreased biofilm formation without affecting planktonic growth. PGA production was undetectable in an nhaR mutant strain. Expression of a pgaA′-′lacZ translational fusion was induced by NaCl and alkaline pH, but not by CaCl2 or sucrose, in an nhaR-dependent fashion. Primer extension and quantitative real-time reverse transcription-PCR analyses further revealed that NhaR affects the steady-state level of pga mRNA. A purified recombinant NhaR protein bound specifically and with high affinity within the pgaABCD promoter region; one apparent binding site overlaps the −35 element, and a second site lies immediately upstream of the first. This protein was necessary and sufficient for activation of in vitro transcription from the pgaA promoter. These results define a novel mechanism for regulation of biofilm formation in response to environmental conditions and suggest an expanded role for NhaR in promoting bacterial survival. PMID:16997959
Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Baoyu; Shu, Chang; Gao, Xinsheng
Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less
Universal light-switchable gene promoter system
Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae
2005-02-22
An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.
Out of Place, Out of Mind: Schema-Driven False Memory Effects for Object-Location Bindings
ERIC Educational Resources Information Center
Lew, Adina R.; Howe, Mark L.
2017-01-01
Events consist of diverse elements, each processed in specialized neocortical networks, with temporal lobe memory systems binding these elements to form coherent event memories. We provide a novel theoretical analysis of an unexplored consequence of the independence of memory systems for elements and their bindings, 1 that raises the paradoxical…
Geiss, G K; Radebaugh, C A; Paule, M R
1997-11-14
Acanthamoeba castellanii transcription initiation factor-IB (TIF-IB) is the TATA-binding protein-containing transcription factor that binds the rRNA promoter to form the committed complex. Minor groove-specific drugs inhibit TIF-IB binding, with higher concentrations needed to disrupt preformed complexes because of drug exclusion by bound TIF-IB. TIF-IB/DNA interactions were mapped by hydroxyl radical and uranyl nitrate footprinting. TIF-IB contacts four minor grooves in its binding site. TIF-IB and DNA wrap around each other in a right-handed superhelix of high pitch, so the upstream and downstream contacts are on opposite faces of the helix. Dimethyl sulfate protection assays revealed limited contact with a few guanines in the major groove. This detailed analysis suggests significant DNA conformation dependence of the interaction.
NASA Astrophysics Data System (ADS)
Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.
2004-12-01
Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.
Out of place, out of mind: Schema-driven false memory effects for object-location bindings.
Lew, Adina R; Howe, Mark L
2017-03-01
Events consist of diverse elements, each processed in specialized neocortical networks, with temporal lobe memory systems binding these elements to form coherent event memories. We provide a novel theoretical analysis of an unexplored consequence of the independence of memory systems for elements and their bindings, 1 that raises the paradoxical prediction that schema-driven false memories can act solely on the binding of event elements despite the superior retrieval of individual elements. This is because if 2, or more, schema-relevant elements are bound together in unexpected conjunctions, the unexpected conjunction will increase attention during encoding to both the elements and their bindings, but only the bindings will receive competition with evoked schema-expected bindings. We test our model by examining memory for object-location bindings in recognition (Study 1) and recall (Studies 2 and 3) tasks. After studying schema-relevant objects in unexpected locations (e.g., pan on a stool in a kitchen scene), participants who then viewed these objects in expected locations (e.g., pan on stove) at test were more likely to falsely remember this object-location pairing as correct, compared with participants that viewed a different unexpected object-location pairing (e.g., pan on floor). In recall, participants were more likely to correctly remember individual schema-relevant objects originally viewed in unexpected, as opposed to expected locations, but were then more likely to misplace these items in the original room scene to expected places, relative to control schema-irrelevant objects. Our theoretical analysis and novel paradigm provide a tool for investigating memory distortions acting on binding processes. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Marciniak, R A; Garcia-Blanco, M A; Sharp, P A
1990-01-01
Human immunodeficiency virus type 1 RNAs contain a sequence, trans-activation-response (TAR) element, which is required for tat protein-mediated trans-activation of viral gene expression. We have identified a nuclear protein from extracts of HeLa cells that binds to the TAR element RNA in a sequence-specific manner. The binding of this 68-kDa polypeptide was detected by UV cross-linking proteins to TAR element RNA transcribed in vitro. Competition experiments were performed by using a partially purified preparation of the protein to quantify the relative binding affinities of TAR element RNA mutants. The binding affinity of the TAR mutants paralleled the reported ability of those mutants to support tat trans-activation in vivo. We propose that this cellular protein moderates TAR activity in vivo. Images PMID:2333305
FAT1 cadherin acts upstream of Hippo signalling through TAZ to regulate neuronal differentiation.
Ahmed, Abdulrzag F; de Bock, Charles E; Lincz, Lisa F; Pundavela, Jay; Zouikr, Ihssane; Sontag, Estelle; Hondermarck, Hubert; Thorne, Rick F
2015-12-01
The Hippo pathway is emerging as a critical nexus that balances self-renewal of progenitors against differentiation; however, upstream elements in vertebrate Hippo signalling are poorly understood. High expression of Fat1 cadherin within the developing neuroepithelium and the manifestation of severe neurological phenotypes in Fat1-knockout mice suggest roles in neurogenesis. Using the SH-SY5Y model of neuronal differentiation and employing gene silencing techniques, we show that FAT1 acts to control neurite outgrowth, also driving cells towards terminal differentiation via inhibitory effects on proliferation. FAT1 actions were shown to be mediated through Hippo signalling where it activated core Hippo kinase components and antagonised functions of the Hippo effector TAZ. Suppression of FAT1 promoted the nucleocytoplasmic shuttling of TAZ leading to enhanced transcription of the Hippo target gene CTGF together with accompanying increases in nuclear levels of Smad3. Silencing of TAZ reversed the effects of FAT1 depletion thus connecting inactivation of TAZ-TGFbeta signalling with Hippo signalling mediated through FAT1. These findings establish FAT1 as a new upstream Hippo element regulating early stages of differentiation in neuronal cells.
Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E
2015-03-20
Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.
Identification of regulatory targets for the bacterial Nus factor complex.
Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T
2017-12-11
Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.
The role of heterologous chloroplast sequence elements in transgene integration and expression.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-04-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-01-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101
Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi
2016-05-01
STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa. © 2016 Japanese Society of Developmental Biologists.
Ying, Shibo; Dünnebier, Thomas; Si, Jing; Hamann, Ute
2013-01-01
UBC9 encodes a protein that conjugates small ubiquitin-related modifier (SUMO) to target proteins thereby changing their functions. Recently, it was noted that UBC9 expression and activity play a role in breast tumorigenesis and response to anticancer drugs. However, the underlying mechanism is poorly understood. To investigate the transcriptional regulation of the UBC9 gene, we identified and characterized its promoter and cis-elements. Promoter activity was tested using luciferase reporter assays. The binding of transcription factors to the promoter was detected by chromatin immunoprecipitation (ChIP), and their functional role was confirmed by siRNA knockdown. UBC9 mRNA and protein levels were measured by quantitative reverse transcription PCR and Western blot analysis, respectively. An increased expression of UBC9 mRNA and protein was found in MCF-7 breast cancer cells treated with 17β-estradiol (E2). Analysis of various deletion mutants revealed a 137 bp fragment upstream of the transcription initiation site to be sufficient for reporter gene transcription. Mutations of putative estrogen receptor α (ER-α) (one imperfect estrogen response element, ERE) and/or nuclear factor Y (NF-Y) binding sites (two CCAAT boxes) markedly reduced promoter activity. Similar results were obtained in ER-negative MDA-MB-231 cells except that the ERE mutation did not affect promoter activity. Additionally, promoter activity was stimulated upon E2 treatment and overexpression of ER-α or NF-YA in MCF-7 cells. ChIP confirmed direct binding of both transcription factors to the UBC9 promoter in vivo. Furthermore, UBC9 expression was diminished by ER-α and NF-Y siRNAs on the mRNA and protein levels. In conclusion, we identified the proximal UBC9 promoter and provided evidence that ER-α and NF-Y regulate UBC9 expression on the transcriptional level in response to E2 in MCF-7 cells. These findings may contribute to a better understanding of the regulation of UBC9 in ER-positive breast cancer and be useful for the development of cancer therapies targeting UBC9.
Developmental Control of NRAMP1 (SLC11A1) Expression in Professional Phagocytes.
Cellier, Mathieu F M
2017-05-03
NRAMP1 (SLC11A1) is a professional phagocyte membrane importer of divalent metals that contributes to iron recycling at homeostasis and to nutritional immunity against infection. Analyses of data generated by several consortia and additional studies were integrated to hypothesize mechanisms restricting NRAMP1 expression to mature phagocytes. Results from various epigenetic and transcriptomic approaches were collected for mesodermal and hematopoietic cell types and compiled for combined analysis with results of genetic studies associating single nucleotide polymorphisms (SNPs) with variations in NRAMP1 expression (eQTLs). Analyses establish that NRAMP1 is part of an autonomous topologically associated domain delimited by ubiquitous CCCTC-binding factor (CTCF) sites. NRAMP1 locus contains five regulatory regions: a predicted super-enhancer (S-E) key to phagocyte-specific expression; the proximal promoter; two intronic areas, including 3' inhibitory elements that restrict expression during development; and a block of upstream sites possibly extending the S-E domain. Also the downstream region adjacent to the 3' CTCF locus boundary may regulate expression during hematopoiesis. Mobilization of the locus 14 predicted transcriptional regulatory elements occurs in three steps, beginning with hematopoiesis; at the onset of myelopoiesis and through myelo-monocytic differentiation. Basal expression level in mature phagocytes is further influenced by genetic variation, tissue environment, and in response to infections that induce various epigenetic memories depending on microorganism nature. Constitutively associated transcription factors (TFs) include CCAAT enhancer binding protein beta (C/EBPb), purine rich DNA binding protein (PU.1), early growth response 2 (EGR2) and signal transducer and activator of transcription 1 (STAT1) while hypoxia-inducible factors (HIFs) and interferon regulatory factor 1 (IRF1) may stimulate iron acquisition in pro-inflammatory conditions. Mouse orthologous locus is generally conserved; chromatin patterns typify a de novo myelo-monocytic gene whose expression is tightly controlled by TFs Pu.1, C/ebps and Irf8; Irf3 and nuclear factor NF-kappa-B p 65 subunit (RelA) regulate expression in inflammatory conditions. Functional differences in the determinants identified at these orthologous loci imply that species-specific mechanisms control gene expression.
White, J H; Johnson, A L; Lowndes, N F; Johnston, L H
1991-01-01
By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644
Zimmerman, Marc J.; Waldron, Marcus C.; DeSimone, Leslie A.
2015-01-01
Analysis of the representative constituents (total phosphorus, total chromium, and suspended sediment) upstream and downstream of impoundments indicated that the existing impoundments, such as Rice City Pond, can be sources of particulate contaminant loads in the Blackstone River. Loads of particulate phosphorus, particulate chromium, and suspended sediment were consistently higher downstream from Rice City Pond than upstream during high-flow events, and there was a positive, linear relation between streamflow and changes in these constituents from upstream to downstream of the impoundment. Thus, particulate contaminants were mobilized from Rice City Pond during high-flow events and transported downstream. In contrast, downstream loads of particulate phosphorus, particulate chromium, and suspended sediment were generally lower than or equal to upstream loads for the former Rockdale Pond impoundment. Sediments associated with the former impoundment at Rockdale Pond, breached in the late 1960s, did not appear to be mobilized during the high-flow events monitored during this study.
NASA Astrophysics Data System (ADS)
Chopra, Nikita; Agarwal, Shivangi; Verma, Shashikala; Bhatnagar, Sonika; Bhatnagar, Rakesh
2011-03-01
Our previous report on Bacillus anthracis toxin-antitoxin module (MoxXT) identified it to be a two component system wherein, PemK-like toxin (MoxT) functions as a ribonuclease (Agarwal S et al. JBC 285:7254-7270, 2010). The labile antitoxin (MoxX) can bind to/neutralize the action of the toxin and is also a DNA-binding protein mediating autoregulation. In this study, molecular modeling of MoxX in its biologically active dimeric form was done. It was found that it contains a conserved Ribbon-Helix-Helix (RHH) motif, consistent with its DNA-binding function. The modeled MoxX monomers dimerize to form a two-stranded antiparallel ribbon, while the C-terminal region adopts an extended conformation. Knowledge guided protein-protein docking, molecular dynamics simulation, and energy minimization was performed to obtain the structure of the MoxXT complex, which was exploited for the de novo design of a peptide capable of binding to MoxT. It was found that the designed peptide caused a decrease in MoxX binding to MoxT by 42% at a concentration of 2 μM in vitro. We also show that MoxX mediates negative transcriptional autoregulation by binding to its own upstream DNA. The interacting regions of both MoxX and DNA were identified in order to model their complex. The repressor activity of MoxX was found to be mediated by the 16 N-terminal residues that contains the ribbon of the RHH motif. Based on homology with other RHH proteins and deletion mutant studies, we propose a model of the MoxX-DNA interaction, with the antiparallel β-sheet of the MoxX dimer inserted into the major groove of its cognate DNA. The structure of the complex of MoxX with MoxT and its own upstream regulatory region will facilitate design of molecules that can disrupt these interactions, a strategy for development of novel antibacterials.
Korde, Asawari; Rosselot, Jessica M.; Donze, David
2014-01-01
The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746
Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak
2016-01-01
Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102
Heat Shock Response of Archaeoglobus fulgidus†
Rohlin, Lars; Trent, Jonathan D.; Salmon, Kirsty; Kim, Unmi; Gunsalus, Robert P.; Liao, James C.
2005-01-01
The heat shock response of the hyperthermophilic archaeon Archaeoglobus fulgidus strain VC-16 was studied using whole-genome microarrays. On the basis of the resulting expression profiles, approximately 350 of the 2,410 open reading frames (ORFs) (ca. 14%) exhibited increased or decreased transcript abundance. These span a range of cell functions, including energy production, amino acid metabolism, and signal transduction, where the majority are uncharacterized. One ORF called AF1298 was identified that contains a putative helix-turn-helix DNA binding motif. The gene product, HSR1, was expressed and purified from Escherichia coli and was used to characterize specific DNA recognition regions upstream of two A. fulgidus genes, AF1298 and AF1971. The results indicate that AF1298 is autoregulated and is part of an operon with two downstream genes that encode a small heat shock protein, Hsp20, and cdc48, an AAA+ ATPase. The DNase I footprints using HSR1 suggest the presence of a cis-binding motif upstream of AF1298 consisting of CTAAC-N5-GTTAG. Since AF1298 is negatively regulated in response to heat shock and encodes a protein only distantly related to the N-terminal DNA binding domain of Phr of Pyrococcus furiosus, these results suggest that HSR1 and Phr may belong to an evolutionarily diverse protein family involved in heat shock regulation in hyperthermophilic and mesophilic Archaea organisms. PMID:16109946
Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.
1976-11-01
periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic
Nagy, Andrea; Kénesi, Erzsébet; Rentsendorj, Otgonchimeg; Molnár, Annamária; Szénási, Tibor; Sinkó, Ildikó; Zvara, Ágnes; Thottathil Oommen, Sajit; Barta, Endre; Puskás, László G.; Lefebvre, Veronique; Kiss, Ibolya
2011-01-01
To help uncover the mechanisms underlying the staggered expression of cartilage-specific genes in the growth plate, we dissected the transcriptional mechanisms driving expression of the matrilin-1 gene (Matn1). We show that a unique assembly of evolutionarily conserved cis-acting elements in the Matn1 proximal promoter restricts expression to the proliferative and prehypertrophic zones of the growth plate. These elements functionally interact with distal elements and likewise are capable of restricting the domain of activity of a pancartilaginous Col2a1 enhancer. The proximal elements include a Pe1 element binding the chondrogenic L-Sox5, Sox6, and Sox9 proteins, a SI element binding Nfi proteins, and an initiator Ine element binding the Sox trio and other factors. Sox9 binding to Pe1 is indispensable for functional interaction with the distal promoter. Binding of L-Sox5/Sox6 to Ine and Nfib to SI modulates Sox9 transactivation in a protein dose-dependent manner, possibly to enhance Sox9 activity in early stages of chondrogenesis and repress it at later stages. Hence, our data suggest a novel model whereby Sox and Nfi proteins bind to conserved Matn1 proximal elements and functionally interact with each other to finely tune gene expression in specific zones of the cartilage growth plate. PMID:21173167
Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R
1988-01-01
We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343
Kang, J J; Yokoi, T J; Holland, M J
1995-12-01
The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.
Zhang, Yunqin; Miao, Zhenyan; Xie, Can; Meng, Xiangzhao; Deng, Jie; Mysore, Kirankumar S.; Frugier, Florian; Wang, Tao
2016-01-01
Cold acclimation is an important process by which plants respond to low temperature and enhance their winter hardiness. C-REPEAT BINDING FACTOR1 (CBF1), CBF2, and CBF3 genes were shown previously to participate in cold acclimation in Medicago truncatula. In addition, MtCBF4 is transcriptionally induced by salt, drought, and cold stresses. We show here that MtCBF4, shown previously to enhance drought and salt tolerance, also positively regulates cold acclimation and freezing tolerance. To identify molecular factors acting upstream and downstream of the MtCBF4 transcription factor (TF) in cold responses, we first identified genes that are differentially regulated upon MtCBF4 overexpression using RNAseq Digital Gene Expression Profiling. Among these, we showed that MtCBF4 directly activates the transcription of the COLD ACCLIMATION SPECIFIC15 (MtCAS15) gene. To gain insights into how MtCBF4 is transcriptionally regulated in response to cold, an R2R3-MYB TF, MtMYB3, was identified based on a yeast one-hybrid screen as binding directly to MYB cis-elements in the MtCBF4 promoter, leading to the inhibition of MtCBF4 expression. In addition, another MYB TF, MtMYB61, identified as an interactor of MtMYB3, can relieve the inhibitory effect of MtMYB3 on MtCBF4 transcription. This study, therefore, supports a model describing how MtCBF4 is regulated by antagonistic MtMYB3/MtMYB61 TFs, leading to the up-regulation of downstream targets such as MtCAS15 acting in cold acclimation in M. truncatula. PMID:27578551
Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku
2016-01-01
Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches. PMID:26789284
Dong, Yewei; Wang, Shuqi; Chen, Junliang; Zhang, Qinghao; Liu, Yang; You, Cuihong; Monroig, Óscar; Tocher, Douglas R.; Li, Yuanyou
2016-01-01
Rabbitfish Siganus canaliculatus was the first marine teleost demonstrated to have the capability of biosynthesizing long-chain polyunsaturated fatty acids (LC-PUFA) from C18 precursors, and to possess a Δ4 fatty acyl desaturase (Δ4 Fad) which was the first report in vertebrates, and is a good model for studying the regulatory mechanisms of LC-PUFA biosynthesis in teleosts. In order to understand regulatory mechanisms of transcription of Δ4 Fad, the gene promoter was cloned and characterized in the present study. An upstream sequence of 1859 bp from the initiation codon ATG was cloned as the promoter candidate. On the basis of bioinformatic analysis, several binding sites of transcription factors (TF) including GATA binding protein 2 (GATA-2), CCAAT enhancer binding protein (C/EBP), nuclear factor 1 (NF-1), nuclear factor Y (NF-Y), hepatocyte nuclear factor 4α (HNF4α) and sterol regulatory element (SRE), were identified in the promoter by site-directed mutation and functional assays. HNF4α and NF-1 were confirmed to interact with the core promoter of Δ4 Fad by gel shift assay and mass spectrometry. Moreover, over-expression of HNF4α increased promoter activity in HEK 293T cells and mRNA level of Δ4 Fad in rabbitfish primary hepatocytes, respectively. The results indicated that HNF4α is a TF of rabbitfish Δ4 Fad. To our knowledge, this is the first report on promoter structure of a Δ4 Fad, and also the first demonstration of HNF4α as a TF of vertebrate Fad gene involved in transcription regulation of LC-PUFA biosynthesis. PMID:27472219
Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku
2016-01-01
Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches.
Shuh, Maureen; Derse, David
2000-01-01
The human T-cell leukemia virus type 1 Tax protein activates the expression of cellular immediate early genes controlled by the serum response element (SRE), which contains both the serum response factor (SRF) binding element (CArG box) and the ternary complex factor (TCF) binding element (Ets box). We show that TCF binding is necessary for Tax activation of the SRE and that Tax directly interacts with TCFs in vitro. In addition, Tax interactions with CREB binding protein (CBP) and p300- and CBP-associated factor were found to be essential for Tax activation of SRF-mediated transcription. PMID:11070040
Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing
2014-01-01
Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein could mediate ABA signaling both in rose and in A. thaliana. PMID:25290154
Jiang, Guimei; Jiang, Xinqiang; Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing
2014-01-01
Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein could mediate ABA signaling both in rose and in A. thaliana.
Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M
2004-02-01
The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.
Cichocki, Michał; Dałek, Miłosz; Szamałek, Mateusz; Baer-Dubowska, Wanda
2014-01-01
Epidermal growth factor receptor (EGFR) plays an important role in epithelial carcinogenesis and appears to be involved in STATs activation. In this study we investigated the possible interference of naturally occurring phenolic acids with EGFR, activator protein-1 (AP-1), and signal transducers and activators of transcription (STATs) pathways activated by topical application of tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) in Balb/c mice epidermis. Pretreatment with tannic or chlorogenic acid resulted in a significant decrease in the phosphorylation of EGFR Y-1068 and Y-1173 tyrosine residues, which was accompanied by reduced activation of AP-1. Tannic acid decreased also the c-Jun AP-1 subunit level and binding to TPA response element (TRE) (3- and 2-fold in comparison with TPA-treated group respectively). Simultaneous reduction of JNK activity might be responsible for reduced activation of AP-1. In contrast to these more complex phenolics, protocatechuic acid increased the activity of JNK and was also the most efficient inhibitor of STATs activation. These results indicate that naturally occurring phenolic acids, by decreasing EGFR, AP-1, and STATs activation, may modulate other elements both upstream and downstream in these pathways and thus inhibit the tumor development. Although more complex phenolics affect mainly the EGFR/AP-1 pathway, STATs seem to be the most important targets for simple compounds, such as protocatechuic acid.
Tissue-specific expression of squirrel monkey chorionic gonadotropin
Vasauskas, Audrey A.; Hubler, Tina R.; Boston, Lori; Scammell, Jonathan G.
2010-01-01
Pituitary gonadotropins LH and FSH play central roles in reproductive function. In Old World primates, LH stimulates ovulation in females and testosterone production in males. Recent studies have found that squirrel monkeys and other New World primates lack expression of LH in the pituitary. Instead, chorionic gonadotropin (CG), which is normally only expressed in the placenta of Old World primates, is the active luteotropic pituitary hormone in these animals. The goal of this study was to investigate the tissue-specific regulation of squirrel monkey CG. We isolated the squirrel monkey CGβ gene and promoter from genomic DNA from squirrel monkey B-lymphoblasts and compared the promoter sequence to that of the common marmoset, another New World primate, and human CGβ and LHβ. Using reporter gene assays, we found that a squirrel monkey CGβ promoter fragment (−1898/+9) is active in both mouse pituitary LβT2 and human placenta JEG3 cells, but not in rat adrenal PC12 cells. Furthermore, within this construct separate cis-elements are responsible for pituitary- and placenta-specific expression. Pituitary-specific expression is governed by Egr-1 binding sites in the proximal 250 bp of the promoter, whereas placenta-specific expression is controlled by AP-2 sites further upstream. Thus, selective expression of the squirrel monkey CGβ promoter in pituitary and placental cells is governed by distinct cis-elements that exhibit homology with human LHβ and marmoset CGβ promoters, respectively. PMID:21130091
Effects of metals on a montane aquatic system evaluated using an integrated assessment approach
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beltman, D.; Lipton, J.; Cacela, D.
Surface water, benthic invertebrates, aufwuchs, and sediments were sampled in a Rocky Mountain stream impacted by a cobalt-copper mine. A randomized study design was employed to ensure valid inferences beyond the areas sampled. As, Co, and Cu concentrations in all media downstream of the mine were 1--3 orders of magnitude greater than concentrations upstream, and concentrations in invertebrates were greater than those that adversely affect trout via dietary intake. Correlational analysis shows that bioaccumulation mechanisms and pathways between the different media differ from element to element; the differences are related to geochemical characteristics of the elements. The benthic invertebrate communitymore » is severely impacted for at least 50 km downstream of the mine: Ephemeropteran density, number of taxa, and total biomass are as low as 0.1% of values upstream. Other indices of the effects of metals on invertebrate communities that have been used elsewhere were ineffective in detecting these severe impacts. The integrated assessment approach used in this study provides information on contaminant sources, exposure pathways and mechanisms, and impacts to the stream ecosystem at several organizational levels.« less
Lekunberri, Itziar; Balcázar, José Luis; Borrego, Carles M
2018-03-01
Mobile genetic elements (MGEs) are key agents in the spread of antibiotic resistance genes (ARGs) across environments. Here we used metagenomics to compare the river resistome (collection of all ARGs) and mobilome (e.g., integrases, transposases, integron integrases and insertion sequence common region "ISCR" elements) between samples collected upstream (n = 6) and downstream (n = 6) of an urban wastewater treatment plant (UWWTP). In comparison to upstream metagenomes, downstream metagenomes showed a drastic increase in the abundance of ARGs, as well as markers of MGEs, particularly integron integrases and ISCR elements. These changes were accompanied by a concomitant prevalence of 16S rRNA gene signatures of bacteria affiliated to families encompassing well-known human and animal pathogens. Our results confirm that chronic discharges of treated wastewater severely impact the river resistome affecting not only the abundance and diversity of ARGs but also their potential spread by enriching the river mobilome in a wide variety of MGEs. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J
2000-12-01
The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.
Analysis of the Prefoldin Gene Family in 14 Plant Species
Cao, Jun
2016-01-01
Prefoldin is a hexameric molecular chaperone complex present in all eukaryotes and archaea. The evolution of this gene family in plants is unknown. Here, I identified 140 prefoldin genes in 14 plant species. These prefoldin proteins were divided into nine groups through phylogenetic analysis. Highly conserved gene organization and motif distribution exist in each prefoldin group, implying their functional conservation. I also observed the segmental duplication of maize prefoldin gene family. Moreover, a few functional divergence sites were identified within each group pairs. Functional network analyses identified 78 co-expressed genes, and most of them were involved in carrying, binding and kinase activity. Divergent expression profiles of the maize prefoldin genes were further investigated in different tissues and development periods and under auxin and some abiotic stresses. I also found a few cis-elements responding to abiotic stress and phytohormone in the upstream sequences of the maize prefoldin genes. The results provided a foundation for exploring the characterization of the prefoldin genes in plants and will offer insights for additional functional studies. PMID:27014333
Park, Shin-Ji; Jin, Mei Ling; An, Hyun-Kyu; Kim, Kyoung-Sook; Ko, Min Jung; Kim, Cheol Min; Choi, Young Whan; Lee, Young-Choon
2015-02-19
In this study, a neurite outgrowth-inducing substance was isolated from the ethylacetate extract of the Polygonum multiflorum roots and identified as emodin by gas-liquid chromatography-mass spectrometry and (1)H NMR and (13)C NMR. Emodin displayed remarkable neurite outgrowth-inducing activity in Neuro2a cells, as demonstrated by morphological changes and immunocytochemistry for class III β-tubulin. Emodin exhibited a stronger neutrophic activity than retinoic acid (RA) known as inducer of neurite outgrowth in Neuro2a cells. Emodin treatment resulted in marked increases in phosphorylation of Akt a direct downstream signaling molecule of phosphatidylinositol 3-kinase (PI3K), but upstream of glycogen synthase kinase-3β (GSK-3β) and cAMP response element-binding protein (CREB). These augmentations and neurite-bearing cells induced by emodin were remarkably reduced by the addition of PI3K inhibitor LY294002. These results demonstrate that emodin induces neuronal differentiation of Neuro2a cells via PI3K/Akt/GSK-3β pathway. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Neuronal Target Identification Requires AHA-1-Mediated Fine-Tuning of Wnt Signaling in C. elegans
Zhang, Jingyan; Li, Xia; Jevince, Angela R.; Guan, Liying; Wang, Jiaming; Hall, David H.; Huang, Xun; Ding, Mei
2013-01-01
Electrical synaptic transmission through gap junctions is a vital mode of intercellular communication in the nervous system. The mechanism by which reciprocal target cells find each other during the formation of gap junctions, however, is poorly understood. Here we show that gap junctions are formed between BDU interneurons and PLM mechanoreceptors in C. elegans and the connectivity of BDU with PLM is influenced by Wnt signaling. We further identified two PAS-bHLH family transcription factors, AHA-1 and AHR-1, which function cell-autonomously within BDU and PLM to facilitate the target identification process. aha-1 and ahr-1 act genetically upstream of cam-1. CAM-1, a membrane-bound receptor tyrosine kinase, is present on both BDU and PLM cells and likely serves as a Wnt antagonist. By binding to a cis-regulatory element in the cam-1 promoter, AHA-1 enhances cam-1 transcription. Our study reveals a Wnt-dependent fine-tuning mechanism that is crucial for mutual target cell identification during the formation of gap junction connections. PMID:23825972
The genomic structure of the human UFO receptor.
Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W
1993-02-01
Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hubin, Elizabeth A.; Fay, Allison; Xu, Catherine
RbpA and CarD are essential transcription regulators in mycobacteria. Mechanistic analyses of promoter open complex (RPo) formation establish that RbpA and CarD cooperatively stimulate formation of an intermediate (RP2) leading to RPo; formation of RP2 is likely a bottleneck step at the majority of mycobacterial promoters. Once RPo forms, CarD also disfavors its isomerization back to RP2. We determined a 2.76 Å-resolution crystal structure of a mycobacterial transcription initiation complex (TIC) with RbpA as well as a CarD/RbpA/TIC model. Both CarD and RbpA bind near the upstream edge of the -10 element where they likely facilitate DNA bending and impedemore » transcription bubble collapse. In vivo studies demonstrate the essential role of RbpA, show the effects of RbpA truncations on transcription and cell physiology, and indicate additional functions for RbpA not evident in vitro. This work provides a framework to understand the control of mycobacterial transcription by RbpA and CarD.« less
N-3 polyunsaturated fatty acid regulation of hepatic gene transcription
Jump, Donald B.
2009-01-01
Purpose of review The liver plays a central role in whole body lipid metabolism and adapts rapidly to changes in dietary fat composition. This adaption involves changes in the expression of genes involved in glycolysis, de-novo lipogenesis, fatty acid elongation, desaturation and oxidation. This review brings together metabolic and molecular studies that help explain n-3 (omega-3) polyunsaturated fatty acid regulation of hepatic gene transcription. Recent findings Dietary n-3 polyunsaturated fatty acid regulates hepatic gene expression by targeting three major transcriptional regulatory networks: peroxisome proliferator-activated receptor α, sterol regulatory element binding protein-1 and the carbohydrate regulatory element binding protein/Max-like factor X heterodimer. 22 : 6,n-3, the most prominent n-3 polyunsaturated fatty acid in tissues, is a weak activator of peroxisome proliferator-activated receptor α. Hepatic metabolism of 22 : 6,n-3, however, generates 20 : 5,n-3, a strong peroxisome proliferator-activated receptor α activator. In contrast to peroxisome proliferator-activated receptor α, 22 : 6,n-3 is the most potent fatty acid regulator of hepatic sterol regulatory element binding protein-1. 22 : 6,n-3 suppresses sterol regulatory element binding protein-1 gene expression while enhancing degradation of nuclear sterol regulatory element binding protein-1 through 26S proteasome and Erk1/2-dependent mechanisms. Both n-3 and n-6 polyunsaturated fatty acid suppress carbohydrate regulatory element binding protein and Max-like factor X nuclear abundance and interfere with glucose-regulated hepatic metabolism. Summary These studies have revealed unique mechanisms by which specific polyunsaturated fatty acids control peroxisome proliferator activated receptor α, sterol regulatory element binding protein-1 and carbohydrate regulatory element binding protein/Max-like factor X function. As such, specific metabolic and signal transduction pathways contribute significantly to the fatty acid regulation of these transcription factors and their corresponding regulatory networks. PMID:18460914
Marques, Alexandra T; Antunes, Agostinho; Fernandes, Pedro A; Ramos, Maria J
2006-01-01
Background The Aβ-binding alcohol dehydrogenase/17β-hydroxysteroid dehydrogenase type 10 (ABAD/HSD10) is an enzyme involved in pivotal metabolic processes and in the mitochondrial dysfunction seen in the Alzheimer's disease. Here we use comparative genomic analyses to study the evolution of the HADH2 gene encoding ABAD/HSD10 across several eukaryotic species. Results Both vertebrate and nematode HADH2 genes showed a six-exon/five-intron organization while those of the insects had a reduced and varied number of exons (two to three). Eutherian mammal HADH2 genes revealed some highly conserved noncoding regions, which may indicate the presence of functional elements, namely in the upstream region about 1 kb of the transcription start site and in the first part of intron 1. These regions were also conserved between Tetraodon and Fugu fishes. We identified a conserved alternative splicing event between human and dog, which have a nine amino acid deletion, causing the removal of the strand βF. This strand is one of the seven strands that compose the core β-sheet of the Rossman fold dinucleotide-binding motif characteristic of the short chain dehydrogenase/reductase (SDR) family members. However, the fact that the substrate binding cleft residues are retained and the existence of a shared variant between human and dog suggest that it might be functional. Molecular adaptation analyses across eutherian mammal orthologues revealed the existence of sites under positive selection, some of which being localized in the substrate-binding cleft and in the insertion 1 region on loop D (an important region for the Aβ-binding to the enzyme). Interestingly, a higher than expected number of nonsynonymous substitutions were observed between human/chimpanzee and orangutan, with six out of the seven amino acid replacements being under molecular adaptation (including three in loop D and one in the substrate binding loop). Conclusion Our study revealed that HADH2 genes maintained a reasonable conserved organization across a large evolutionary distance. The conserved noncoding regions identified among mammals and between pufferfishes, the evidence of an alternative splicing variant conserved between human and dog, and the detection of positive selection across eutherian mammals, may be of importance for further research on ABAD/HSD10 function and its implication in the Alzheimer's disease. PMID:16899120
D'Souza, V; Melamed, J; Habib, D; Pullen, K; Wallace, K; Summers, M F
2001-11-23
Murine leukemia virus (MLV) is currently the most widely used gene delivery system in gene therapy trials. The simple retrovirus packages two copies of its RNA genome by a mechanism that involves interactions between the nucleocapsid (NC) domain of a virally-encoded Gag polyprotein and a segment of the RNA genome located just upstream of the Gag initiation codon, known as the Psi-site. Previous studies indicated that the MLV Psi-site contains three stem loops (SLB-SLD), and that stem loops SLC and SLD play prominent roles in packaging. We have developed a method for the preparation and purification of large quantities of recombinant Moloney MLV NC protein, and have studied its interactions with a series of oligoribonucleotides that contain one or more of the Psi-RNA stem loops. At RNA concentrations above approximately 0.3 mM, isolated stem loop SLB forms a duplex and stem loops SL-C and SL-D form kissing complexes, as expected from previous studies. However, neither the monomeric nor the dimeric forms of these isolated stem loops binds NC with significant affinity. Longer constructs containing two stem loops (SL-BC and SL-CD) also exhibit low affinities for NC. However, NC binds with high affinity and stoichiometrically to both the monomeric and dimeric forms of an RNA construct that contains all three stem loops (SL-BCD; K(d)=132(+/-55) nM). Titration of SL-BCD with NC also shifts monomer-dimer equilibrium toward the dimer. Mutagenesis experiments demonstrate that the conserved GACG tetraloops of stem loops C and D do not influence the monomer-dimer equilibrium of SL-BCD, that the tetraloop of stem loop B does not participate directly in NC binding, and that the tetraloops of stem loops C and D probably also do not bind to NC. These surprising results differ considerably from those observed for HIV-1, where NC binds to individual stem loops with high affinity via interactions with exposed residues of the tetraloops. The present results indicate that MLV NC binds to a pocket or surface that only exists in the presence of all three stem loops. Copyright 2001 Academic Press.
Culvert roughness elements for native Utah fish passage : phase II.
DOT National Transportation Integrated Search
2012-04-01
Native fishes have become an increasingly important concern when designing fish passable culverts. Many operational culverts constrict waterways which increase velocities and prevent upstream passage of small fish species. The current method to ensur...
Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko
2015-04-21
Limb skeletal elements originate from the limb progenitor cells, which undergo expansion and patterning to develop each skeletal element. Posterior-distal skeletal elements, such as the ulna/fibula and posterior digits develop in a Sonic hedgehog (Shh)-dependent manner. However, it is poorly understood how anterior-proximal elements, such as the humerus/femur, the radius/tibia and the anterior digits, are developed. Here we show that the zinc finger factors Sall4 and Gli3 cooperate for proper development of the anterior-proximal skeletal elements and also function upstream of Shh-dependent posterior skeletal element development. Conditional inactivation of Sall4 in the mesoderm before limb outgrowth caused severe defects in the anterior-proximal skeletal elements in the hindlimb. We found that Gli3 expression is reduced in Sall4 mutant hindlimbs, but not in forelimbs. This reduction caused posteriorization of nascent hindlimb buds, which is correlated with a loss of anterior digits. In proximal development, Sall4 integrates Gli3 and the Plzf-Hox system, in addition to proliferative expansion of cells in the mesenchymal core of nascent hindlimb buds. Whereas forelimbs developed normally in Sall4 mutants, further genetic analysis identified that the Sall4-Gli3 system is a common regulator of the early limb progenitor cells in both forelimbs and hindlimbs. The Sall4-Gli3 system also functions upstream of the Shh-expressing ZPA and the Fgf8-expressing AER in fore- and hindlimbs. Therefore, our study identified a critical role of the Sall4-Gli3 system at the early steps of limb development for proper development of the appendicular skeletal elements.
Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene
2015-10-15
Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina; ...
2015-11-10
Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina
Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less
Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S
2012-05-01
The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail
2018-06-20
Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.
Lee, M O; Liu, Y; Zhang, X K
1995-08-01
The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene expression.
Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi
2013-08-01
The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.
Culvert roughness elements for native Utah fish passage : phase I.
DOT National Transportation Integrated Search
2011-01-01
Laboratory flume testing of native Utah non-salmonid fish was performed to observe how : they use altered flow around obstacles to swim upstream. Three experimental setups included : a bare Plexiglas flume, vertical cylinders, and natural substrate p...
Grünberg, Sebastian; Henikoff, Steven; Hahn, Steven; Zentner, Gabriel E
2016-11-15
Mediator is a conserved, essential transcriptional coactivator complex, but its in vivo functions have remained unclear due to conflicting data regarding its genome-wide binding pattern obtained by genome-wide ChIP Here, we used ChEC-seq, a method orthogonal to ChIP, to generate a high-resolution map of Mediator binding to the yeast genome. We find that Mediator associates with upstream activating sequences (UASs) rather than the core promoter or gene body under all conditions tested. Mediator occupancy is surprisingly correlated with transcription levels at only a small fraction of genes. Using the same approach to map TFIID, we find that TFIID is associated with both TFIID- and SAGA-dependent genes and that TFIID and Mediator occupancy is cooperative. Our results clarify Mediator recruitment and binding to the genome, showing that Mediator binding to UASs is widespread, partially uncoupled from transcription, and mediated in part by TFIID. © 2016 The Authors.
Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.
Kim, Yea Woon; Kim, AeRi
2017-07-20
Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).
Riboswitch-based sensor in low optical background
NASA Astrophysics Data System (ADS)
Harbaugh, Svetlana V.; Davidson, Molly E.; Chushak, Yaroslav G.; Kelley-Loughnane, Nancy; Stone, Morley O.
2008-08-01
Riboswitches are a type of natural genetic control element that use untranslated sequence in the RNA to recognize and bind to small molecules that regulate expression of that gene. Creation of synthetic riboswitches to novel ligands depends on the ability to screen for analyte binding sensitivity and specificity. In our work, we have coupled a synthetic riboswitch to an optical reporter assay based on fluorescence resonance energy transfer (FRET) between two genetically-coded fluorescent proteins. Specifically, a theophylline-sensitive riboswitch was placed upstream of the Tobacco Etch Virus (TEV) protease coding sequence, and a FRET-based construct, BFP-eGFP or eGFP-REACh, was linked by a peptide encoding the recognition sequence for TEV protease. Cells expressing the riboswitch showed a marked optical difference in fluorescence emission in the presence of theophylline. However, the BFP-eGFP FRET pair posses significant optical background that reduces the sensitivity of a FRET-based assay. To improve the optical assay, we designed a nonfluorescent yellow fluorescent protein (YFP) mutant called REACh (for Resonance Energy-Accepting Chromoprotein) as the FRET acceptor for eGFP. The advantage of using an eGFP-REACh pair is the elimination of acceptor fluorescence which leads to an improved detection of FRET via better signal-to-noise ratio. The EGFP-REACh fusion protein was constructed with the TEV protease cleavage site; thus upon TEV translation, cleavage occurs diminishing REACh quenching and increasing eGFP emission resulting in a 4.5-fold improvement in assay sensitivity.
René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y
2000-01-04
In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.
CDDO-Im protects from acetaminophen hepatotoxicity through induction of Nrf2-dependent genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reisman, Scott A.; Buckley, David B.; Tanaka, Yuji
CDDO-Im is a synthetic triterpenoid recently shown to induce cytoprotective genes through the Nrf2-Keap1 pathway, an important mechanism for the induction of cytoprotective genes in response to oxidative stress. Upon oxidative or electrophilic insult, the transcription factor Nrf2 translocates to the nucleus, heterodimerizes with small Maf proteins, and binds to antioxidant response elements (AREs) in the upstream promoter regions of various cytoprotective genes. To further elucidate the hepatoprotective effects of CDDO-Im, wild-type and Nrf2-null mice were pretreated with CDDO-Im (1 mg/kg, i.p.) or vehicle (DMSO), and then administered acetaminophen (500 mg/kg, i.p.). Pretreatment of wild-type mice with CDDO-Im reduced livermore » injury caused by acetaminophen. In contrast, hepatoprotection by CDDO-Im was not observed in Nrf2-null mice. CDDO-Im increased Nrf2 protein expression and Nrf2-ARE binding in wild-type, but not Nrf2-null mice. Furthermore, CDDO-Im increased the mRNA expression of the Nrf2 target genes NAD(P)H: quinone oxidoreductase-1 (Nqo1); glutamate-cysteine ligase, catalytic subunit (Gclc); and heme-oxygenase-1 (Ho-1), in both a dose- and time-dependent manner. Conversely, CDDO-Im did not induce Nqo1, Gclc, and Ho-1 mRNA expression in Nrf2-null mice. Collectively, the present study shows that CDDO-Im pretreatment induces Nrf2-dependent cytoprotective genes and protects the liver from acetaminophen-induced hepatic injury.« less
Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto
2010-01-01
Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012
Kleene, Kenneth C
2016-03-01
Many mRNAs encoding proteins needed for the construction of the specialized organelles of spermatozoa are stored as translationally repressed, free messenger ribonucleoproteins in round spermatids, to be actively translated in elongating and elongated spermatids. The factors that repress translation in round spermatids, however, have been elusive. Two lines of evidence implicate the highly abundant and well-known translational repressor, Y-box protein 2 (YBX2), as a critical factor: First, protamine 1 (Prm1) and sperm-mitochondria cysteine-rich protein (Smcp) mRNAs are prematurely recruited onto polysomes in Ybx2-knockout mouse round spermatids. Second, mutations in 3' untranslated region (3'UTR) cis-elements that abrogate YBX2 binding activate translation of Prm1 and Smcp mRNAs in round spermatids of transgenic mice. The abundance of YBX2 and its affinity for variable sequences, however, raise questions of how YBX2 targets specific mRNAs for repression. Mutations to the Prm1 and Smcp mRNAs in transgenic mice reveal that strong repression in round spermatids requires YBX2 binding sites located near the 3' ends of their 3'UTRs as locating the same sites in upstream positions produce negligible repression. This location-dependence implies that the assembly of repressive complexes is nucleated by adjacent cis-elements that enable cooperative interactions of YBX2 with co-factors. The available data suggest that, in vertebrates, YBX2 has the important role of coordinating the storage of translationally repressed mRNAs in round spermatids by inhibiting translational activity and the degradation of transcripts via translation-dependent deadenylation. These insights should facilitiate future experiments designed to unravel how YBX2 targets mRNAs for repression in round spermatids and how mutations in the YBX2 gene cause infertility in humans. Mol. Reprod. Dev. 83: 190-207, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling
2014-01-01
Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046
Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L
2017-07-18
Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.
Bone Morphogenetic Protein 15 (BMP15) Acts as a BMP and Wnt Inhibitor during Early Embryogenesis*
Di Pasquale, Elisa; Brivanlou, Ali H.
2009-01-01
Bone morphogenetic protein 15 (BMP15) belongs to an unusual subgroup of the transforming growth factor β (TGFβ) superfamily of signaling ligands as it lacks a key cysteine residue in the mature region required for proper intermolecular dimerization. Naturally occurring BMP15 mutation leads to early ovarian failure in humans, and BMP15 has been shown to activate the Smad1/5/8 pathway in that context. Despite its important role in germ cell specification, the embryological function of BMP15 remains unknown. Surprisingly, we find that during early Xenopus embryogenesis BMP15 acts solely as an inhibitor of the Smad1/5/8 pathway and the Wnt pathway. BMP15 gain-of-function leads to embryos with secondary ectopic heads and to direct neural induction in intact explants. BMP15 inhibits BMP4-mediated epidermal induction in dissociated explants. BMP15 strongly inhibits BRE response induced by BMP4 and blocks phosphorylation and activation of Smad1/5/8 MH2-domain. Mechanistically, BMP15 protein specifically interacts with BMP4 protein, suggesting inhibition upstream of receptor binding. Loss-of-function experiments using morpholinos or a naturally occurring human BMP15 dominant-negative mutant (BMP15-Y235C) leads to embryos lacking head. BMP15-Y235C also eliminates the inhibitory activity of BMP15 on BRE (BMP-responsive element). Finally, we show that BMP15 inhibits the canonical branch of the Wnt pathway, upstream of β-catenin. We, thus, demonstrate that BMP15 is necessary and sufficient for the specification of dorso-anterior structures and highlight novel mechanisms of BMP15 function that strongly suggest a reinterpretation of its function in ovaries specially for ovarian failure. PMID:19553676
NF-κB Participates in the Stem Cell Phenotype of Ovarian Cancer Cells.
Gonzalez-Torres, Carolina; Gaytan-Cervantes, Javier; Vazquez-Santillan, Karla; Mandujano-Tinoco, Edna Ayerim; Ceballos-Cancino, Gisela; Garcia-Venzor, Alfredo; Zampedri, Cecilia; Sanchez-Maldonado, Paulina; Mojica-Espinosa, Raul; Jimenez-Hernandez, Luis Enrique; Maldonado, Vilma
2017-05-01
NF-κB is a transcription factor involved in cancer stem cells maintenance of many tumors. Little is known about the specific stem-associated upstream regulators of this pathway in ovarian cancer. The Aim of the study was to analyze the role of the canonical and non-canonical NF-κB pathways in stem cells of ovarian cancer cell lines. Stem cells were isolated using sorting cytometry. Western blot and RT-PCR were used to quantify protein and messenger RNA levels. Loss and gain of function assays were performed using siRNAs and dominant-negative proteins, respectively. NF-κB binding activity was measured with a reporter gene assay. The stem phenotype was estimated with clonogenic assays using soft agar, colony formation, ovospheres formation and in vivo tumorigenicity assays. The CD44+ subpopulation of SKOV3 ovarian cancer cell line presented higher mRNA levels of key stemness genes, an increased tumorigenic capacity and higher expression of the RelA, RelB and IKKα. When the canonical pathway was inhibited by means of a dominant-negative version of IkBα, the stem cell population was reduced, as shown by a reduced CD44+ subpopulation, a decrease in the expression of the stemness genes and a reduction of the stem phenotype. In addition, IKKα, the main upstream non-canonical kinase, was highly expressed in the CSC population. Accordingly, when IKKα was inhibited using shRNAs, the expression of the stemness genes was reduced. This report is the first to show the importance of several elements of both NF-κB pathway in maintaining the ovarian cancer stem cell population. Copyright © 2017 IMSS. Published by Elsevier Inc. All rights reserved.
Abdelmageed, Haggag; Kang, Miyoung
2018-01-01
Gene expression during seed development in Arabidopsis thaliana is controlled by transcription factors including LEAFY COTYLEDON1 (LEC1) and LEC2, ABA INSENSITIVE3 (ABI3), FUSCA3 (FUS3), known as LAFL proteins, and AGAMOUS-LIKE15 (AGL15). The transition from seed maturation to germination and seedling growth requires the transcriptional silencing of these seed maturation-specific factors leading to downregulation of structural genes including those that encode seed storage proteins, oleosins, and dehydrins. During seed germination and vegetative growth, B3-domain protein HSI2/VAL1 is required for the transcriptional silencing of LAFL genes. Here, we report chromatin immunoprecipitation analysis indicating that HSI2/VAL1 binds to the upstream sequences of the AGL15 gene but not at LEC1, ABI3, FUS3, or LEC2 loci. Functional analysis indicates that the HSI2/VAL1 B3 domain interacts with two RY elements upstream of the AGL15 coding region and at least one of them is required for HSI2/VAL1-dependent AGL15 repression. Expression analysis of the major seed maturation regulatory genes LEC1, ABI3, FUS3, and LEC2 in different genetic backgrounds demonstrates that HSI2/VAL1 is epistatic to AGL15 and represses the seed maturation regulatory program through downregulation of AGL15 by deposition of H3K27me3 at this locus. This hypothesis is further supported by results that show that HSI2/VAL1 physically interacts with the Polycomb Repressive Complex 2 component protein MSI1, which is also enriched at the AGL15 locus. PMID:29475938
INTRINSIC REGULATION OF HEMOGLOBIN EXPRESSION BY VARIABLE SUBUNIT INTERFACE STRENGTHS
Manning, James M.; Popowicz, Anthony M.; Padovan, Julio C.; Chait, Brian T.; Manning, Lois R.
2012-01-01
SUMMARY The expression of the six types of human hemoglobin subunits over time is currently considered to be regulated mainly by transcription factors that bind to upstream control regions of the gene (the “extrinsic” component of regulation). Here we describe how subunit pairing and further assembly to tetramers in the liganded state is influenced by the affinity of subunits for one another (the “intrinsic” component of regulation). The adult hemoglobin dimers have the strongest subunit interfaces and the embryonic hemoglobins are the weakest with fetal hemoglobins of intermediate strength, corresponding to the temporal order of their expression. These variable subunit binding strengths and the attenuating effects of acetylation contribute to the differences with which these hemoglobin types form functional O2-binding tetramers consistent with gene switching. PMID:22129306
Moinier, Danielle; Byrne, Deborah; Amouric, Agnès; Bonnefoy, Violaine
2017-01-01
The chemical attack of ore by ferric iron and/or sulfuric acid releases valuable metals. The products of these reactions are recycled by iron and sulfur oxidizing microorganisms. These acidophilic chemolithotrophic prokaryotes, among which Acidithiobacillus ferrooxidans , grow at the expense of the energy released from the oxidation of ferrous iron and/or inorganic sulfur compounds (ISCs). In At. ferrooxidans , it has been shown that the expression of the genes encoding the proteins involved in these respiratory pathways is dependent on the electron donor and that the genes involved in iron oxidation are expressed before those responsible for ISCs oxidation when both iron and sulfur are present. Since the redox potential increases during iron oxidation but remains stable during sulfur oxidation, we have put forward the hypothesis that the global redox responding two components system RegB/RegA is involved in this regulation. To understand the mechanism of this system and its role in the regulation of the aerobic respiratory pathways in At. ferrooxidans , the binding of different forms of RegA (DNA binding domain, wild-type, unphosphorylated and phosphorylated-like forms of RegA) on the regulatory region of different genes/operons involved in ferrous iron and ISC oxidation has been analyzed. We have shown that the four RegA forms are able to bind specifically the upstream region of these genes. Interestingly, the phosphorylation of RegA did not change its affinity for its cognate DNA. The transcriptional start site of these genes/operons has been determined. In most cases, the RegA binding site(s) was (were) located upstream from the -35 (or -24) box suggesting that RegA does not interfere with the RNA polymerase binding. Based on the results presented in this report, the role of the RegB/RegA system in the regulation of the ferrous iron and ISC oxidation pathways in At. ferrooxidans is discussed.
Low exhaust temperature electrically heated particulate matter filter system
Gonze, Eugene V [Pinckney, MI; Paratore, Jr., Michael J.; Bhatia, Garima [Bangalore, IN
2012-02-14
A system includes a particulate matter (PM) filter, a sensor, a heating element, and a control module. The PM filter includes with an upstream end that receives exhaust gas, a downstream end and multiple zones. The sensor detects a temperature of the exhaust gas. The control module controls current to the heating element to convection heat one of the zones and initiate a regeneration process. The control module selectively increases current to the heating element relative to a reference regeneration current level when the temperature is less than a predetermined temperature.
Li, Xianting; Wang, Qing Jun; Pan, Nina; Lee, Sangkyu; Zhao, Yingming; Chait, Brian T.; Yue, Zhenyu
2011-01-01
Background Recent studies show that mutations in Leucine Rich Repeat Kinase 2 (LRRK2) are the cause of the most common inherited and some sporadic forms of Parkinson's disease (PD). The molecular mechanism underlying the pathogenic role of LRRK2 mutations in PD remains unknown. Methodology/Principal Findings Using affinity purification and mass spectrometric analysis, we investigated phosphorylation sites and binding proteins of LRRK2 purified from mouse brain. We identified multiple phosphorylation sites at N-terminus of LRRK2 including S910, S912, S935 and S973. Focusing on the high stoichiometry S935 phosphorylation site, we developed an anti-pS935 specific antibody and showed that LRRK2 is constitutively phosphorylated at S935 in various tissues (including brain) and at different ages in mice. We find that 14-3-3 proteins (especially isoforms γ and η) bind LRRK2 and this binding depends on phosphorylation of S935. The binding of 14-3-3, with little effect on dimer formation of LRRK2, confers protection of the phosphorylation status of S935. Furthermore, we show that protein kinase A (PKA), but not LRRK2 kinase itself, can cause the phosphorylation of LRRK2 at S935 in vitro and in cell culture, suggesting that PKA is a potential upstream kinase that regulates LRRK2 function. Finally, our study indicates that the common PD-related mutations of LRRK2, R1441G, Y1699C and G2019S, decrease homeostatic phosphorylation levels of S935 and impair 14-3-3 binding of LRRK2. Conclusions/Significance LRRK2 is extensively phosphorylated in vivo, and the phosphorylation of specific sites (e.g. S935) determines 14-3-3 binding of LRRK2. We propose that 14-3-3 is an important regulator of LRRK2-mediated cellular functions. Our study suggests that PKA, a cAMP-dependent kinase involved in regulating dopamine physiology, is a potential upstream kinase that phosphorylates LRRK2 at S935. Furthermore, the reduction of phosphorylation/14-3-3 binding of LRRK2 due to the common familial PD-related mutations provides novel insight into the pathogenic mechanism of LRRK2-linked PD. PMID:21390248
Mechanism of arginine sensing by CASTOR1 upstream of mTORC1
Saxton, Robert A.; Chantranupong, Lynne; Knockenhauer, Kevin E.; Schwartz, Thomas U.; Sabatini, David M.
2016-01-01
Summary The mechanistic Target of Rapamycin Complex 1 (mTORC1) is a major regulator of eukaryotic growth that coordinates anabolic and catabolic cellular processes with inputs such as growth factors and nutrients, including amino acids1–3. In mammals, arginine is particularly important and promotes diverse physiological effects including immune cell activation, insulin secretion, and muscle growth, largely through activation of mTORC14–7. Arginine activates mTORC1 upstream of the Rag GTPases8, through either the lysosomal amino acid transporter SLC38A9 or the GATOR2-interacting CASTOR1 (Cellular Arginine Sensor for mTORC1)9–12. However, the mechanism by which the mTORC1 pathway detects and transmits the arginine signal has been elusive. Here, we present the 1.8 Å crystal structure of arginine-bound CASTOR1. Homodimeric CASTOR1 binds arginine at the interface of two ACT domains, enabling allosteric control of the adjacent GATOR2-binding site to trigger dissociation from GATOR2 and the downstream activation of mTORC1. Our data reveal that CASTOR1 shares substantial structural homology with the lysine-binding regulatory domain of prokaryotic aspartate kinases, suggesting that the mTORC1 pathway exploited an ancient amino-acid-dependent allosteric mechanism to acquire arginine sensitivity. Together, these results establish a structural basis for arginine sensing by the mTORC1 pathway and provide insights into the evolution of a mammalian nutrient sensor. PMID:27487210
Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting
2017-03-17
The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Auxin-dependent compositional change in Mediator in ARF7- and ARF19-mediated transcription.
Ito, Jun; Fukaki, Hidehiro; Onoda, Makoto; Li, Lin; Li, Chuanyou; Tasaka, Masao; Furutani, Masahiko
2016-06-07
Mediator is a multiprotein complex that integrates the signals from transcription factors binding to the promoter and transmits them to achieve gene transcription. The subunits of Mediator complex reside in four modules: the head, middle, tail, and dissociable CDK8 kinase module (CKM). The head, middle, and tail modules form the core Mediator complex, and the association of CKM can modify the function of Mediator in transcription. Here, we show genetic and biochemical evidence that CKM-associated Mediator transmits auxin-dependent transcriptional repression in lateral root (LR) formation. The AUXIN/INDOLE 3-ACETIC ACID 14 (Aux/IAA14) transcriptional repressor inhibits the transcriptional activity of its binding partners AUXIN RESPONSE FACTOR 7 (ARF7) and ARF19 by making a complex with the CKM-associated Mediator. In addition, TOPLESS (TPL), a transcriptional corepressor, forms a bridge between IAA14 and the CKM component MED13 through the physical interaction. ChIP assays show that auxin induces the dissociation of MED13 but not the tail module component MED25 from the ARF7 binding region upstream of its target gene. These findings indicate that auxin-induced degradation of IAA14 changes the module composition of Mediator interacting with ARF7 and ARF19 in the upstream region of their target genes involved in LR formation. We suggest that this regulation leads to a quick switch of signal transmission from ARFs to target gene expression in response to auxin.
Shafiee, Mohamad N; Mongan, Nigel; Seedhouse, Claire; Chapman, Caroline; Deen, Suha; Abu, Jafaru; Atiomo, William
2017-05-01
Women with polycystic ovary syndrome have a three-fold higher risk of endometrial cancer. Insulin resistance and hyperlipidemia may be pertinent factors in the pathogenesis of both conditions. The aim of this study was to investigate endometrial sterol regulatory element binding protein-1 gene expression in polycystic ovary syndrome and endometrial cancer endometrium, and to correlate endometrial sterol regulatory element binding protein-1 gene expression with serum lipid profiles. A cross-sectional study was performed at Nottingham University Hospital, UK. A total of 102 women (polycystic ovary syndrome, endometrial cancer and controls; 34 participants in each group) were recruited. Clinical and biochemical assessments were performed before endometrial biopsies were obtained from all participants. Taqman real-time polymerase chain reaction for endometrial sterol regulatory element binding protein-1 gene and its systemic protein expression were analyzed. The body mass indices of women with polycystic ovary syndrome (29.28 ± 2.91 kg/m 2 ) and controls (28.58 ± 2.62 kg/m 2 ) were not significantly different. Women with endometrial cancer had a higher mean body mass index (32.22 ± 5.70 kg/m 2 ). Sterol regulatory element binding protein-1 gene expression was significantly increased in polycystic ovary syndrome and endometrial cancer endometrium compared with controls (p < 0.0001). Sterol regulatory element binding protein-1 gene expression was positively correlated with body mass index (r = 0.017, p = 0.921) and waist-hip ratio (r = 0.023, p = 0.544) in polycystic ovary syndrome, but this was not statistically significant. Similarly, statistically insignificant positive correlations were found between endometrial sterol regulatory element binding protein-1 gene expression and body mass index in endometrial cancer (r = 0.643, p = 0.06) and waist-hip ratio (r = 0.096, p = 0.073). Sterol regulatory element binding protein-1 gene expression was significantly positively correlated with triglyceride in both polycystic ovary syndrome and endometrial cancer (p = 0.028 and p = 0.027, respectively). Quantitative serum sterol regulatory element binding protein-1 gene correlated with endometrial gene expression (p < 0.05). Sterol regulatory element binding protein-1 gene expression is significantly increased in the endometrium of women with polycystic ovary syndrome and women with endometrial cancer compared with controls and positively correlates with serum triglyceride in both polycystic ovary syndrome and endometrial cancer. © 2017 Nordic Federation of Societies of Obstetrics and Gynecology.
Transcriptional switches in the control of macronutrient metabolism.
Wise, Alan
2008-06-01
This review shows how some transcription factors respond to alterations in macronutrients. Carbohydrates induce enzymes for their metabolism and fatty acid synthesis. Fatty acids reduce carbohydrate processing, induce enzymes for their metabolism, and increase both gluconeogenesis and storage of fat. Fat stores help control carbohydrate uptake by other cells. The following main transcription factors are discussed: carbohydrate response element-binding protein; sterol regulatory element-binding protein-1c, cyclic AMP response element-binding protein, peroxisome proliferator-activated receptor-alpha, and peroxisome proliferator-activated receptor-gamma.
Ryden, T A; de Mars, M; Beemon, K
1993-01-01
Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280
NASA Astrophysics Data System (ADS)
Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi
Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.
Barhl1 is directly regulated by thyroid hormone in the developing cerebellum of mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dong, Hongyan, E-mail: hongyan_dong@hc-sc.gc.ca; Yauk, Carole L.; Wade, Michael G.
Highlights: Black-Right-Pointing-Pointer Thyroid hormone receptor binds to the promoter region of Barhl1. Black-Right-Pointing-Pointer Barhl1 expression in cerebellum is negatively regulated by thyroid hormone. Black-Right-Pointing-Pointer Negative regulation of Barhl1 by thyroid hormone was confirmed in vitro. Black-Right-Pointing-Pointer Thyroid hormone may play a role in normal brain development through transcriptional control of Barhl1. -- Abstract: Thyroid hormones (THs) are essential for the brain development. Despite considerable effort, few genes directly regulated by THs have been identified. In this study, we investigate the effects of THs on the regulation of Barhl1, a transcription factor that regulates sensorineural development. Using DNA microarray combined withmore » chromatin immunoprecipitation (ChIP-chip), we identified a TR{beta} binding site in the promoter of Barhl1. The binding was further confirmed by ChIP-PCR. The site is located approximately 755 bp upstream of the transcription start site. Reporter vectors containing the binding site or mutated fragments were transfected into GH3 cells. T3 treatment decreased the transcriptional activity of the wild fragment but not the mutant. Two 28 bp oligonucleotides containing sequences that resemble known TH response elements (TREs) were derived from this binding site and DNA-protein interaction was performed using electrophoretic mobility shift assays (EMSA). Binding analysis in a nuclear extract containing TR{beta} revealed that one of these fragments bound TR{beta}. This complex was shifted with the addition of anti-TR{beta} antibody. We investigated Barhl1 expression in animal models and TH-treated cultured cells. Both long term treatment with 6-propyl-2-thiouracil and short-term treatment with 0.05% methimazole/1% sodium perchlorate (both treatments render mice hypothyroid) resulted in up-regulation of Barhl1. TH supplementation of hypothyroid mice caused a decrease in the expression of Barhl1 compared to control animals. Similarly, the expression of Barhl1 in cultured GH3 decreased with the addition of T3. Given the important role of Barhl1 in brain development, we propose that perturbations of TH-mediated transcriptional control of Barhl1 may play a role in the impaired neurodevelopment induced by hypothyroidism.« less
Wang, Hongyan; Zhang, Yingquan; Qiao, Mingqi
2013-01-01
The extracellular signal-regulated kinase/cAMP response element-binding protein/brain-derived neurotrophic factor signal transduction pathway plays an important role in the mechanism of action of antidepressant drugs and has dominated recent studies on the pathogenesis of depression. In the present review we summarize the known roles of extracellular signal-regulated kinase, cAMP response element-binding protein and brain-derived neurotrophic factor in the pathogenesis of depression and in the mechanism of action of antidepressant medicines. The extracellular signal-regulated kinase/cAMP response element-binding protein/brain-derived neurotrophic factor pathway has potential to be used as a biological index to help diagnose depression, and as such it is considered as an important new target in the treatment of depression. PMID:25206732
Laimins, L; Holmgren-König, M; Khoury, G
1986-01-01
The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279
Multivalent DNA-binding properties of the HMG-1 proteins.
Maher, J F; Nathans, D
1996-01-01
HMG-I proteins are DNA-binding proteins thought to affect the formation and function of transcription complexes. Each protein contains three DNA-binding motifs, known as AT-hooks, that bind in the minor groove of AT tracts in DNA. Multiple AT-hooks within a polypeptide chain should contact multiple AT tracts, but the rules governing these interactions have not been defined. In this study, we demonstrate that high-affinity binding uses two or three appropriately spaced AT tracts as a single multivalent binding site. These principles have implications for binding to regulatory elements such as the interferon beta enhancer, TATA boxes, and serum response elements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8692884
Bick, Gregory; Zhang, Fan; Meetei, A Ruhikanta; Andreassen, Paul R
2017-06-01
Fanconi anemia (FA) is a chromosome instability syndrome and the 20 identified FA proteins are organized into two main arms which are thought to function at distinct steps in the repair of DNA interstrand crosslinks (ICLs). These two arms include the upstream FA pathway, which culminates in the monoubiquitination of FANCD2 and FANCI, and downstream breast cancer (BRCA)-associated proteins that interact in protein complexes. How, and whether, these two groups of FA proteins are integrated is unclear. Here, we show that FANCD2 and PALB2, as indicators of the upstream and downstream arms, respectively, colocalize independently of each other in response to DNA damage induced by mitomycin C (MMC). We also show that ubiquitin chains are induced by MMC and colocalize with both FANCD2 and PALB2. Our finding that the RNF8 E3 ligase has a role in recruiting FANCD2 and PALB2 also provides support for the hypothesis that the two branches of the FA-BRCA pathway are coordinated by ubiquitin signaling. Interestingly, we find that the RNF8 partner, MDC1, as well as the ubiquitin-binding protein, RAP80, specifically recruit PALB2, while a different ubiquitin-binding protein, FAAP20, functions only in the recruitment of FANCD2. Thus, FANCD2 and PALB2 are not recruited in a single linear pathway, rather we define how their localization is coordinated and integrated by a network of ubiquitin-related proteins. We propose that such regulation may enable upstream and downstream FA proteins to act at distinct steps in the repair of ICLs.
Montealegre, Maria Camila; Roh, Jung Hyeob; Rae, Meredith; Davlieva, Milya G; Singh, Kavindra V; Shamoo, Yousif; Murray, Barbara E
2017-01-01
Ampicillin resistance in Enterococcus faecium is a serious concern worldwide, complicating the treatment of E. faecium infections. Penicillin-binding protein 5 (PBP5) is considered the main ampicillin resistance determinant in E. faecium The three known E. faecium clades showed sequence variations in the pbp5 gene that are associated with their ampicillin resistance phenotype; however, these changes alone do not explain the array of resistance levels observed among E. faecium clinical strains. We aimed to determine if the levels of PBP5 are differentially regulated between the E. faecium clades, with the hypothesis that variations in PBP5 levels could help account for the spectrum of ampicillin MICs seen in E. faecium We studied pbp5 mRNA levels and PBP5 protein levels as well as the genetic environment upstream of pbp5 in 16 E. faecium strains that belong to the different E. faecium clades and for which the ampicillin MICs covered a wide range. Our results found that pbp5 and PBP5 levels are increased in subclade A1 and A2 ampicillin-resistant strains compared to those in clade B and subclade A2 ampicillin-susceptible strains. Furthermore, we found evidence of major clade-associated rearrangements in the region upstream of pbp5, including large DNA fragment insertions, deletions, and single nucleotide polymorphisms, that may be associated with the differential regulation of PBP5 levels between the E. faecium clades. Overall, these findings highlight the contribution of the clade background to the regulation of PBP5 abundance and point to differences in the region upstream of pbp5 as likely contributors to the differential expression of ampicillin resistance. Copyright © 2016 American Society for Microbiology.
Datta, Kausiki; von Hippel, Peter H.
2008-01-01
Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878
Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan
2015-02-01
DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars.
Pluripotent and Multipotent Stem Cells Display Distinct Hypoxic miRNA Expression Profiles
Agrawal, Rahul; Dale, Tina P.; Al-Zubaidi, Mohammed A.; Benny Malgulwar, Prit; Forsyth, Nicholas R.; Kulshreshtha, Ritu
2016-01-01
MicroRNAs are reported to have a crucial role in the regulation of self-renewal and differentiation of stem cells. Hypoxia has been identified as a key biophysical element of the stem cell culture milieu however, the link between hypoxia and miRNA expression in stem cells remains poorly understood. We therefore explored miRNA expression in hypoxic human embryonic and mesenchymal stem cells (hESCs and hMSCs). A total of 50 and 76 miRNAs were differentially regulated by hypoxia (2% O2) in hESCs and hMSCs, respectively, with a negligible overlap of only three miRNAs. We found coordinate regulation of precursor and mature miRNAs under hypoxia suggesting their regulation mainly at transcriptional level. Hypoxia response elements were located upstream of 97% of upregulated hypoxia regulated miRNAs (HRMs) suggesting hypoxia-inducible-factor (HIF) driven transcription. HIF binding to the candidate cis-elements of specific miRNAs under hypoxia was confirmed by Chromatin immunoprecipitation coupled with qPCR. Role analysis of a subset of upregulated HRMs identified linkage to reported inhibition of differentiation while a downregulated subset of HRMs had a putative role in the promotion of differentiation. MiRNA-target prediction correlation with published hypoxic hESC and hMSC gene expression profiles revealed HRM target genes enriched in the cytokine:cytokine receptor, HIF signalling and pathways in cancer. Overall, our study reveals, novel and distinct hypoxia-driven miRNA signatures in hESCs and hMSCs with the potential for application in optimised culture and differentiation models for both therapeutic application and improved understanding of stem cell biology. PMID:27783707
Nadjar-Boger, Elisabeth; Hinits, Yaniv; Funkenstein, Bruria
2012-09-25
Myostatin (MSTN) is a negative regulator of skeletal muscle growth. In contrast to mammals, fish possess at least two paralogs of MSTN: MSTN-1 and MSTN-2. In this study, we analyzed the structural-functional features of the four variants of Sparus aurata MSTN-2 5'-flanking region: saMSTN-2a, saMSTN-2as, saMSTN-2b and saMSTN-2c. In silico analysis revealed numerous putative cis regulatory elements including several E-boxes known as binding sites to myogenic transcription factors. Transient transfection experiments using non-muscle and muscle cell lines showed surprisingly high transcriptional activity in muscle cells, suggesting the presence of regulatory elements unique to differentiated myotubes. These observations were confirmed by in situ intramuscular injections of promoter DNA followed by reporter gene assays. Moreover, high promoter activity was found in differentiated neural cell, in agreement with MSTN-2 expression in brain. Progressive 5'-deletion analysis, using reporter gene assays, showed that the core promoter is located within the first -127 bp upstream of the ATG, and suggested the presence of regulatory elements that either repress or induce transcriptional activity. Transient transgenic zebrafish provided evidence for saMSTN-2 promoter ability to direct GFP expression to myofibers. Finally, our data shows that although no mature saMSTN-2 mRNA is observed in muscle; unspliced forms accumulate, confirming high level of transcription. In conclusion, our study shows for the first time that MSTN-2 promoter is a very robust promoter, especially in muscle cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Li, Yang Eric; Xiao, Mu; Shi, Binbin; Yang, Yu-Cheng T; Wang, Dong; Wang, Fei; Marcia, Marco; Lu, Zhi John
2017-09-08
Crosslinking immunoprecipitation sequencing (CLIP-seq) technologies have enabled researchers to characterize transcriptome-wide binding sites of RNA-binding protein (RBP) with high resolution. We apply a soft-clustering method, RBPgroup, to various CLIP-seq datasets to group together RBPs that specifically bind the same RNA sites. Such combinatorial clustering of RBPs helps interpret CLIP-seq data and suggests functional RNA regulatory elements. Furthermore, we validate two RBP-RBP interactions in cell lines. Our approach links proteins and RNA motifs known to possess similar biochemical and cellular properties and can, when used in conjunction with additional experimental data, identify high-confidence RBP groups and their associated RNA regulatory elements.
Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2007-01-01
Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.
León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.
2013-01-01
Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665
Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.
Joshee, N; Kisaka, H; Kitagawa, Y
1998-01-01
One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liebhaber, S.A.; Weiss, I.; Cash, F.E.
Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less
Structure of transcription factor HetR required for heterocyst differentiation in cyanobacteria
Kim, Youngchang; Joachimiak, Grazyna; Ye, Zi; Binkowski, T. Andrew; Zhang, Rongguang; Gornicki, Piotr; Callahan, Sean M.; Hess, Wolfgang R.; Haselkorn, Robert; Joachimiak, Andrzej
2011-01-01
HetR is an essential regulator of heterocyst development in cyanobacteria. HetR binds to a DNA palindrome upstream of the hetP gene. We report the crystal structure of HetR from Fischerella at 3.0 Å. The protein is a dimer comprised of a central DNA-binding unit containing the N-terminal regions of the two subunits organized with two helix-turn-helix motifs; two globular flaps extending in opposite directions; and a hood over the central core formed from the C-terminal subdomains. The flaps and hood have no structural precedent in the protein database, therefore representing new folds. The structural assignments are supported by site-directed mutagenesis and DNA-binding studies. We suggest that HetR serves as a scaffold for assembly of transcription components critical for heterocyst development. PMID:21628585
Tissue-specific expression of squirrel monkey chorionic gonadotropin.
Vasauskas, Audrey A; Hubler, Tina R; Boston, Lori; Scammell, Jonathan G
2011-02-01
Pituitary gonadotropins LH and FSH play central roles in reproductive function. In Old World primates, LH stimulates ovulation in females and testosterone production in males. Recent studies have found that squirrel monkeys and other New World primates lack expression of LH in the pituitary. Instead, chorionic gonadotropin (CG), which is normally only expressed in the placenta of Old World primates, is the active luteotropic pituitary hormone in these animals. The goal of this study was to investigate the tissue-specific regulation of squirrel monkey CG. We isolated the squirrel monkey CGβ gene and promoter from genomic DNA from squirrel monkey B-lymphoblasts and compared the promoter sequence to that of the common marmoset, another New World primate, and human and rhesus macaque CGβ and LHβ. Using reporter gene assays, we found that a squirrel monkey CGβ promoter fragment (-1898/+9) is active in both mouse pituitary LβT2 and human placenta JEG3 cells, but not in rat adrenal PC12 cells. Furthermore, within this construct separate cis-elements are responsible for pituitary- and placenta-specific expression. Pituitary-specific expression is governed by Egr-1 binding sites in the proximal 250 bp of the promoter, whereas placenta-specific expression is controlled by AP-2 sites further upstream. Thus, selective expression of the squirrel monkey CGβ promoter in pituitary and placental cells is governed by distinct cis-elements that exhibit homology with human LHβ and marmoset CGβ promoters, respectively. Copyright © 2010 Elsevier Inc. All rights reserved.
Jornot, L; Junod, A F
1997-01-01
Human selenium-dependent glutathione peroxidase (GP) is implicated as a mechanism of resistance against oxygen free radicals. The 5' flanking sequence upstream from the coding region of GP contained an oxygen-responsive element termed ORE1 that is responsive to hypoxia, as well as several copies of the activator protein-1 (AP-1)- and AP-1-like-binding sites. In this study, we sought to define the molecular events that lead to GP gene transcription in response to hyperoxia in human umbilical-vein endothelial cells, and asked whether such induction is mimicked and sustained by activation of protein kinase C (PKC) by phorbol esters. Treatment of cells with 100 nM phorbol 12,13-dibutyrate (PdBu) induced a delayed (24-48 h) but significant (2-fold) increase in steady-state GP mRNA levels. Steady-state GP mRNA levels also rose after exposure to 95% O2, again after considerable delay (48-72 h). For both PdBu and oxygen, induction was transcriptionally regulated, as demonstrated by nuclear run-on experiments. The simulations by PdBu and oxygen were additive. In contrast with PdBu, hyperoxia did not stimulate translocation of PKC from the cytosol to the particulate fraction, although the specific activity of both cytosolic and particulate-associated PKC was increased 2-fold in cells exposed to 95% O2 for 5 days. In addition, gel mobility-shift assays using double-stranded tumour-promoting-agent-responsive element (TRE) and nuclear extracts derived from phorbol- and oxygen-treated cells revealed that PdBu, but not hyperoxia, increased AP-1 DNA-binding activity. On the other hand, the up-regulation of GP expression by oxygen could not be accounted for by the ORE1 core sequence, since no specific protein-DNA binding activity could be detected using nuclear extracts from hyperoxic cells and ORE1. Taken together, these results suggest that there may be different molecular mechanisms controlling GP expression. After exposure to PdBu, GP undergoes transcriptional activation via a process that can be readily explained by a classic AP-1 interaction with the TRE sites in the GP promoter. During hyperoxia, GP also undergoes transcriptional activity, but via a process that appears to involve neither TRE nor ORE1. PMID:9337858
NASA Astrophysics Data System (ADS)
Agarwal, Karuna; Gao, Jian; Katz, Joseph
2017-11-01
The shape, size, and spacing between roughness elements in turbulent boundary layers affect the associated drag and noise. Understanding them require data on the flow structure around these elements. Dual-view tomographic holography is used to study the 3D 3-component velocity field around a pair of cubic roughness elements immersed in a turbulent boundary layer at Reτ = 2500 . These a = 1 mm high cubes correspond to 4% of the half channel height and 90 wall units (δν = 11 μ m). Tests are performed for spanwise spacings of a, 1.5 a and 2.5 a. The sample volume is 385δν × 250δν × 190δν and the vector spacing is 5.4δν. Conversed statistics is obtained by recording 1500 realizations in volumes centered upstream, downstream and around a cube. The boundary layer separating upstream of the cube does not reattach until the wake region, resulting in formation of a vortical ``canopy'' that engulfs each cube. It is dominated by spanwise vorticity above the cube and separated region, bounded by vertical vorticity on the sides. Flow channeling in the space between cubes causes asymmetry in the vorticity distributions along the inner and outer walls. The legs of horseshoe vortices remain near the wall between cubes, but grow and expand in the wake region. Funded by NSF and ONR.
Cismasiu, Valeriu B; Duque, Javier; Paskaleva, Elena; Califano, Danielle; Ghanta, Sailaja; Young, Howard A; Avram, Dorina
2009-01-15
BCL11B is a transcriptional regulator with an important role in T-cell development and leukaemogenesis. We demonstrated recently that BCL11B controls expression from the IL (interleukin)-2 promoter through direct binding to the US1 (upstream site 1). In the present study, we provide evidence that BCL11B also participates in the activation of IL-2 gene expression by enhancing NF-kappaB (nuclear factor kappaB) activity in the context of TCR (T-cell receptor)/CD28-triggered T-cell activation. Enhanced NF-kappaB activation is not a consequence of BCL11B binding to the NF-kappaB response elements or association with the NF-kappaB-DNA complexes, but rather the result of higher translocation of NF-kappaB to the nucleus caused by enhanced degradation of IkappaB (inhibitor of NF-kappaB). The enhanced IkappaB degradation in cells with increased levels of BCL11B was specific for T-cells activated through the TCR, but not for cells activated through TNFalpha (tumour necrosis factor alpha) or UV light, and was caused by increased activity of IkappaB kinase, as indicated by its increase in phosphorylation. As BCL11B is a transcription factor, we investigated whether the expression of genes upstream of IkappaB kinase in the TCR/CD28 signalling pathway was affected by increased BCL11B expression, and found that Cot (cancer Osaka thyroid oncogene) kinase mRNA levels were elevated. Cot kinase is known to promote enhanced IkappaB kinase activity, which results in the phosphorylation and degradation of IkappaB and activation of NF-kappaB. The implied involvement of Cot kinase in BCL11B-mediated NF-kappaB activation in response to TCR activation is supported by the fact that a Cot kinase dominant-negative mutant or Cot kinase siRNA (small interfering RNA) knockdown blocked BCL11B-mediated NF-kappaB activation. In support of our observations, in the present study we report that BCL11B enhances the expression of several other NF-kappaB target genes, in addition to IL-2. In addition, we provide evidence that BCL11B associates with intron 2 of the Cot kinase gene to regulate its expression.
Wen, Cheng; Ye, Anpei
2013-01-01
BRaf (B- Rapid Accelerated Fibrosarcoma) protein is an important serine/threonine-protein kinase. Two domains on BRaf can independently bind its upstream kinase, Ras (Rat Sarcoma) protein. These are the Ras binding domain (RBD) and cysteine-rich-domain (CRD). Herein we use customized optical tweezers to compare the Ras binding process in two pathological mutants of BRaf responsible for CFC syndrome, abbreviated BRaf (A246P) and BRaf (Q257R). The two mutants differ in their kinetics of Ras-binding, though both bind Ras with similar increased overall affinity. BRaf (A246P) exhibits a slightly higher Ras/CRD unbinding force and a significantly higher Ras/RBD unbinding force versus the wild type. The contrary phenomenon is observed in the Q257R mutation. Simulations of the unstressed-off rate, koff(0), yield results in accordance with the changes revealed by the mean unbinding force. Our approach can be applied to rapidly assess other mutated proteins to deduce the effects of mutation on their kinetics compared to wild type proteins and to each other. PMID:24409384
Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.
Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A
2018-04-06
Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.
Velagapudi, Sai Pradeep; Pushechnikov, Alexei; Labuda, Lucas P; French, Jonathan M; Disney, Matthew D
2012-11-16
There are many potential RNA drug targets in bacterial, viral, and human transcriptomes. However, there are few small molecules that modulate RNA function. This is due, in part, to a lack of fundamental understanding about RNA-ligand interactions including the types of small molecules that bind to RNA structural elements and the RNA structural elements that bind to small molecules. In an effort to better understand RNA-ligand interactions, we diversified the 2-aminobenzimidazole core (2AB) and probed the resulting library for binding to a library of RNA internal loops. We chose the 2AB core for these studies because it is a privileged scaffold for binding RNA based on previous reports. These studies identified that N-methyl pyrrolidine, imidazole, and propylamine diversity elements at the R1 position increase binding to internal loops; variability at the R2 position is well tolerated. The preferred RNA loop space was also determined for five ligands using a statistical approach and identified trends that lead to selective recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Sungsoo, E-mail: sungsoo.lee@utsouthwestern.edu; Wang, Ping-Yuan; Jeong, Yangsik
Oxysterol binding protein related protein 1S (ORP1S) is a member of a family of sterol transport proteins. Here we present evidence that ORP1S translocates from the cytoplasm to the nucleus in response to sterol binding. The sterols that best promote nuclear import of ORP1S also activate the liver X receptor (LXR) transcription factors and we show that ORP1S binds to LXRs, promotes binding of LXRs to LXR response elements (LXREs) and specifically enhances LXR-dependent transcription via the ME.1 and ME.2 enhancer elements of the apoE gene. We propose that ORP1S is a cytoplasmic sterol sensor, which transports sterols to themore » nucleus and promotes LXR-dependent gene transcription through select enhancer elements. -- Highlights: Black-Right-Pointing-Pointer ORP1S translocates to the nucleus in response to sterol binding. Black-Right-Pointing-Pointer The sterols that best promote nuclear import of ORP1S are LXR agonists. Black-Right-Pointing-Pointer ORP1S binds to LXRs, enhances binding of LXRs to LXREs and promotes LXR-dependent transcription of apoE.« less
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be restricted to a subpopulation of OT neurons.
Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J
2012-09-01
Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.
Hwang, Cheol Kyu; Wagley, Yadav; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.
2016-01-01
Gene regulation at the post-transcriptional level is frequently based on cis- and trans-acting factors on target mRNAs. We found a C-rich element (CRE) in mu-opioid receptor (MOR) 3′-untranslated region (UTR) to which poly (rC) binding protein 1 (PCBP1) binds, resulting in MOR mRNA stabilization. RNA immunoprecipitation and RNA EMSA revealed the formation of PCBP1-RNA complexes at the element. Knockdown of PCBP1 decreased MOR mRNA half-life and protein expression. Stimulation by forskolin increased cytoplasmic localization of PCBP1 and PCBP1/MOR 3′-UTR interactions via increased serine phosphorylation that was blocked by protein kinase A (PKA) or (phosphatidyl inositol-3) PI3-kinase inhibitors. The forskolin treatment also enhanced serine- and tyrosine-phosphorylation of AU-rich element binding protein (AUF1), concurrent with its increased binding to the CRE, and led to an increased interaction of poly A binding protein (PABP) with the CRE and poly(A) sites. AUF1 phosphorylation also led to an increased interaction with PCBP1. These findings suggest that a single co-regulator, PCBP1, plays a crucial role in stabilizing MOR mRNA, and is induced by PKA signaling by conforming to AUF1 and PABP. PMID:27836661
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum
Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...
2017-06-24
In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less
Carlier, Aurelien L.; von Bodman, S. B.
2006-01-01
The upstream region of the Pantoea stewartii rcsA gene features two promoters, one for constitutive basal-level expression and a second autoregulated promoter for induced expression. The EsaR quorum-sensing repressor binds to a site centered between the two promoters, blocking transcription elongation from the regulated promoter under noninducing conditions. PMID:16740966
Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.
Vieille-Grosjean, I; Huber, P
1995-03-03
The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.
Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions
Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun
2012-01-01
Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557