Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

PubMed

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Functional Intersection Area -- Oregon Department of Transportation

DOT National Transportation Integrated Search

1996-01-01

This discussion paper addresses the concepts involved in defining the functional area of an intersection. The elements which comprise the upstream functional area are identified; dimensions of the upstream area exclusive of queue storage, are given f...

Spatial and temporal distribution of metals in suspended particulate matter of the Kali estuary, India

NASA Astrophysics Data System (ADS)

Suja, S.; Kessarkar, Pratima M.; Fernandes, Lina L.; Kurian, Siby; Tomer, Arti

2017-09-01

Major (Al, Fe, Mn, Ti, Mg) and trace (Cu, Zn, Pb, Cr, Ni, Co, Zr, Rb, Sr, Ba, Li, Be, Sc, V, Ga, Nb, Mo, Sn, Sb, Cs, Hf, Ta, Bi, Th, U) elements and particulate organic carbon (POC) concentrations in surface suspended particulate matter (SPM) of the Kali estuary, (central west coast of India) were studied during the pre-monsoon, monsoon and post monsoon seasons to infer estuarine processes, source of SPM and Geoaccumulation Index (Igeo) assigned pollutionIgeo levels. Distribution of SPM indicates the presence of the estuarine turbidity maximum (ETM) during all three seasons near the river mouth and a second ETM during the post monsoon time in the upstream associated with salinities gradient. The SPM during the monsoon is finer grained (avg. 53 μm), characterized by uniformly low normalized elemental concentration, whereas the post and pre monsoon are characterized by high normalized elemental concentration with coarser grain size (avg. 202 μm and 173 μm respectively) with highest ratios in the upstream estuary. The elemental composition and principal component analysis for the upstream estuary SPM support more contribution from the upstream catchment area rocks during the monsoon season; there is additional contribution from the downstream catchment area during the pre and post monsoon period due to the tidal effect. The Kali estuarine SPM has higher Al, Fe, Mn, Ti, Mg, Ni, Co, Ba, Li and V with respect to Average World River SPM (WRSPM). Igeo values for the SPM indicate Kali Estuary to be severely enriched with Mn and moderately enriched with Cu, Zn, Ni, Co, U and Mo in the upstream estuary during pre and post monsoon seasons. Seasonal changes in salinity gradient (reduced freshwater flow due to closing of the dam gates), reduced velocity at meandering region of the estuary and POC of 1.6-2.3% resulted in co-precipitation of trace elements that were further fortified by flocculation and coagulation throughout the water column resulting in metal trapping in the upstream region.

Alphavirus replicon approach to promoterless analysis of IRES elements.

PubMed

Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

2007-04-10

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

PubMed Central

Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

2007-01-01

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Computational methods in sequence and structure prediction

NASA Astrophysics Data System (ADS)

Lang, Caiyi

This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed a software package which is capable of designing novel protein structures at the atomic resolution. This software package allows us to perform protein structure design with a flexible backbone. The backbone flexibility includes loop region relaxation as well as a secondary structure collective mode relaxation scheme. (Abstract shortened by UMI.)

Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

PubMed Central

Lloyd, G S; Busby, S J; Savery, N J

1998-01-01

During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Method and apparatus for in-cell vacuuming of radiologically contaminated materials

DOEpatents

Spadaro, Peter R.; Smith, Jay E.; Speer, Elmer L.; Cecconi, Arnold L.

1987-01-01

A vacuum air flow operated cyclone separator arrangement for collecting, handling and packaging loose contaminated material in accordance with acceptable radiological and criticality control requirements. The vacuum air flow system includes a specially designed fail-safe prefilter installed upstream of the vacuum air flow power supply. The fail-safe prefilter provides in-cell vacuum system flow visualization and automatically reduces or shuts off the vacuum air flow in the event of an upstream prefilter failure. The system is effective for collecting and handling highly contaminated radiological waste in the form of dust, dirt, fuel element fines, metal chips and similar loose material in accordance with radiological and criticality control requirements for disposal by means of shipment and burial.

Modulation of tissue repair by regeneration enhancer elements.

PubMed

Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

2016-04-14

How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

PubMed Central

Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

2015-01-01

Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

Vertical distribution of trace-element concentrations and occurrence of metallurgical slag particles in accumulated bed sediments of Lake Roosevelt, Washington, September 2002

USGS Publications Warehouse

Cox, S.E.; Bell, P.R.; Lowther, J.S.; Van Metre, P.C.

2005-01-01

Sediment cores were collected from six locations in Lake Roosevelt to determine the vertical distributions of trace-element concentrations in the accumulated sediments of Lake Roosevelt. Elevated concentrations of arsenic, cadmium, copper, lead, mercury, and zinc occurred throughout much of the accumulated sediments. Concentrations varied greatly within the sediment core profiles, often covering a range of 5 to 10 fold. Trace-element concentrations typically were largest below the surficial sediments in the lower one-half of each profile, with generally decreasing concentrations from the 1964 horizon to the surface of the core. The trace-element profiles reflect changes in historical discharges of trace elements to the Columbia River by an upstream smelter. All samples analyzed exceeded clean-up guidelines adopted by the Confederated Tribes of the Colville Reservation for cadmium, lead, and zinc and more than 70 percent of the samples exceeded cleanup guidelines for mercury, arsenic, and copper. Although 100 percent of the samples exceeded sediment guidelines for cadmium, lead, and zinc, surficial concentrations of arsenic, copper, and mercury in some cores were less than the sediment-quality guidelines. With the exception of copper, the trace-element profiles of the five cores collected along the pre-reservoir Columbia River channel typically showed trends of decreasing concentrations in sediments deposited after the 1964 time horizon. The decreasing concentrations of trace elements in the upper half of cores from along the pre-reservoir Columbia River showed a pattern of decreasing concentrations similar to reductions in trace-element loading in liquid effluent from an upstream smelter. Except for arsenic, trace-element concentrations typically were smaller at downstream reservoir locations along the pre-reservoir Columbia River. Trace-element concentration in sediments from the Spokane Arm of the reservoir showed distinct differences compared to the similarities observed in cores from along the pre-reservoir Columbia River. Particles of slag, which have physical and chemical characteristics of slag discharged to the Columbia River by a lead-zinc smelter upstream of the reservoir at Trail, British Columbia, were found in sediments of Lake Roosevelt. Slag particles are more common in the upstream reaches of the reservoir. The chemical composition of the interior matrix of slag collected from Lake Roosevelt closely approximated the reported elemental concentrations of fresh smelter slag, although evidence of slag weathering was observed. Exfoliation flakes were observed on the surface of weathered slag particles isolated from the core sediments. The concentrations of zinc on the exposed surface of slag grains were smaller than concentrations on interior surfaces. Weathering rinds also were observed in the cross section of weathered slag grains, indicating that the glassy slag material was undergoing hydration and chemical weathering. Trace elements observed in accumulated sediments in the middle and lower reaches of the reservoir are more likely due to the input from liquid effluent discharges compared to slag discharges from the upstream smelter.

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

PubMed

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

The membrane-tethered transcription factor ANAC089 serves as redox-dependent suppressor of stromal ascorbate peroxidase gene expression

PubMed Central

Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef

2012-01-01

The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559

The Evolution of Riparian Landscape Elements Following Upstream Regulation and Depletion on the Rio Grande

NASA Astrophysics Data System (ADS)

Everitt, B. L.

2006-12-01

In 1915 closure of Elephant Butte Dam in central New Mexico profoundly altered the hydrologic regime of the Rio Grande for 560 km downstream, and set in motion a cascade of interwoven geomorphic, biological, and cultural responses. Geomorphic response included shrinking of the width and depth of the channel, and an increase in sinuosity. Cultural responses included artificial channel modification on 320 km of the river within the boundaries of the original irrigation project, beginning in 1933. The pre-dam river and its flood plain consisted of a mosaic of geomorphic elements that formed a functional riverine landscape, and founded a diverse habitat for the plants, animals, and people that lived there. A preliminary comparison of the modern river with pre-dam topographic mapping permits identification of individual landscape elements, including overflow land (flood plain) both cultivated and uncultivated, with oxbows and back-swamps. The pre-dam channel included a low water thread and un-vegetated flood bars. From pre-dam description and photographs we can assume the usual complement of pools and riffles, point bars and undercut banks. Until dredged in the 1970s, the unmodified reach retained the entire suite of landscape elements, although in somewhat different proportions from the pre-dam river, and remained a functional riparian system. Channel sinuosity increased from 1.45 in 1910 to 1.7 in 1970, thus riverbank habitat increased by 1.17%. In 1970 undercut banks still provided protection for fish, and point bars generated by lateral migration still provided seed beds for pioneer species. The smaller shallower channel raised groundwater beneath the flood plain and retarded flood waves, creating a generally more mesic environment, although the river occasionally dries up, as it did prior to 1915. In contrast, an impoverished suite of landscape elements characterizes the channelized reach. Lateral stability precludes point bars and undercut banks. Bounding levees separate the channel from its former flood plain. All areas are impacted by heavy machinery during periodic channel maintenance. I conclude that the environmental degradation caused by artificial channel modification has far outweighed any generated by upstream hydrologic control.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells

PubMed Central

Leddin, Mathias; Perrod, Chiara; Hoogenkamp, Maarten; Ghani, Saeed; Assi, Salam; Heinz, Sven; Wilson, Nicola K.; Follows, George; Schönheit, Jörg; Vockentanz, Lena; Mosammam, Ali M.; Chen, Wei; Tenen, Daniel G.; Westhead, David R.; Göttgens, Berthold

2011-01-01

The transcription factor PU.1 occupies a central role in controlling myeloid and early B-cell development, and its correct lineage-specific expression is critical for the differentiation choice of hematopoietic progenitors. However, little is known of how this tissue-specific pattern is established. We previously identified an upstream regulatory cis element whose targeted deletion in mice decreases PU.1 expression and causes leukemia. We show here that the upstream regulatory cis element alone is insufficient to confer physiologic PU.1 expression in mice but requires the cooperation with other, previously unidentified elements. Using a combination of transgenic studies, global chromatin assays, and detailed molecular analyses we present evidence that PU.1 is regulated by a novel mechanism involving cross talk between different cis elements together with lineage-restricted autoregulation. In this model, PU.1 regulates its expression in B cells and macrophages by differentially associating with cell type–specific transcription factors at one of its cis-regulatory elements to establish differential activity patterns at other elements. PMID:21239694

Apparatus for purifying exhaust gases of internal combustion engines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kakinuma, A.; Oya, H.

1980-06-03

Apparatus for purifying the exhaust gases of internal combustion engines is disclosed that is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a cylindrical shell having an inlet chamber, a catalyst chamber, an outlet chamber, and a monolithic catalyst element in the catalyst chamber. The inlet chamber has inlet ports communicating with the upstream exhaust pipes respectively and axial lines of the inlet ports cross each other in the inlet chamber. In the inlet chamber, a diffusion means is provided to diffuse the exhaust gas for uniformly distributingmore » it to the catalyst element.« less

Method and apparatus to selectively reduce NO.sub.x in an exhaust gas feedstream

DOEpatents

Schmieg, Steven J [Troy, MI; Blint, Richard J [Shelby Township, MI; Den, Ling [Sterling Heights, MI; Viola, Michael B [Macomb Township, MI; Lee, Jong-Hwan [Rochester Hills, MI

2011-08-30

A method and apparatus are described to selectively reduce NO.sub.x emissions of an internal combustion engine. An exhaust aftertreatment system includes an injection device operative to dispense a hydrocarbon reductant upstream of a silver-alumina catalytic reactor device. A control system determines a NO.sub.x concentration and hydrocarbon/NOx ratio based upon selected parameters of the exhaust gas feedstream and dispenses hydrocarbon reductant during lean engine operation. Included is a method to control elements of the feedstream during lean operation. The hydrocarbon reductant may include engine fuel.

Observations on the Growth of Roughness Elements Into Icing Feathers

NASA Technical Reports Server (NTRS)

Vargas, Mario; Tsao, Jen, Ching

2007-01-01

This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

PubMed Central

Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

1997-01-01

GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

PubMed

He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

2017-08-23

The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

PubMed

Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

2018-05-09

Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

Application of finite element approach to transonic flow problems

NASA Technical Reports Server (NTRS)

Hafez, M. M.; Murman, E. M.; Wellford, L. C., Jr.

1976-01-01

A variational finite element model for transonic small disturbance calculations is described. Different strategy is adopted in subsonic and supersonic regions, and blending elements are introduced between different regions. In the supersonic region, no upstream effect is allowed. If rectangular elements with linear shape functions are used, the model is similar to Murman's finite difference operators. Higher order shape functions, nonrectangular elements, and discontinuous approximation of shock waves are also discussed.

A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.

PubMed

Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J

2012-09-01

Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Optimal frequency-response sensitivity of compressible flow over roughness elements

NASA Astrophysics Data System (ADS)

Fosas de Pando, Miguel; Schmid, Peter J.

2017-04-01

Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.

Computational fluid dynamics modeling of intracranial aneurysms: effects of parent artery segmentation on intra-aneurysmal hemodynamics.

PubMed

Castro, M A; Putman, C M; Cebral, J R

2006-09-01

The purpose of this study is to show the influence of the upstream parent artery geometry on intraaneurysmal hemodynamics of cerebral aneurysms. Patient-specific models of 4 cerebral aneurysms (1 posterior communicating artery [PcomA], 2 middle cerebral artery [MCA], and 1 anterior communicating artery [AcomA]) were constructed from 3D rotational angiography images. Two geometric models were constructed for each aneurysm. One model had the native parent vessel geometry; the second model was truncated approximately 1 cm upstream from the aneurysm, and the parent artery replaced with a straight cylinder. Corresponding finite element grids were generated and computational fluid dynamics simulations were carried out under pulsatile flow conditions. The intra-aneurysmal flow patterns and wall shear stress (WSS) distributions were visualized and compared. Models using the truncated parent vessel underestimated the WSS in the aneurysms in all cases and shifted the impaction zone to the neck compared with the native geometry. These effects were more pronounced in the PcomA and AcomA aneurysms where upstream curvature was substantial. The MCA aneurysm with a long M1 segment was the least effected. The more laminar flow pattern within the parent vessel in truncated models resulted in a less complex intra-aneurysmal flow patterns with fewer vortices and less velocity at the dome. Failure to properly model the inflow stream contributed by the upstream parent artery can significantly influence the results of intra-aneurysmal hemodynamic models. The upstream portion of the parent vessel of cerebral aneurysms should be included to accurately represent the intra-aneurysmal hemodynamics.

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Estimating bioaccessibility of trace elements in particles suspended in the Athabasca River using sequential extraction.

PubMed

Javed, Muhammad Babar; Shotyk, William

2018-05-10

Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.

PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

PubMed Central

Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

2001-01-01

Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

Near-field flow structures about subcritical surface roughness

NASA Astrophysics Data System (ADS)

Doolittle, Charles J.; Drews, Scott D.; Goldstein, David B.

2014-12-01

Laminar flow over a periodic array of cylindrical surface roughness elements is simulated with an immersed boundary spectral method both to validate the method for subsequent studies and to examine how persistent streamwise vortices are introduced by a low Reynolds number roughness element. Direct comparisons are made with prior studies at a roughness-based Reynolds number Rek (=U(k) k/ν) of 205 and a diameter to spanwise spacing ratio d/λ of 1/3. Downstream velocity contours match present and past experiments very well. The shear layer developed over the top of the roughness element produces the downstream velocity deficit. Upstream of the roughness element, the vortex topology is found to be consistent with juncture flow experiments, creating three cores along the recirculation line. Streamtraces stemming from these upstream cores, however, have unexpectedly little effect on the downstream flowfield as lateral divergence of the boundary layer quickly dissipates their vorticity. Long physical relaxation time of the recirculating wake behind the roughness remains a prominent issue for simulating this type of flowfield.

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

PubMed

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

PubMed

Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

2015-08-01

Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

USGS Publications Warehouse

Fallon, James D.; Yaeger, Christine S.

2009-01-01

Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1.7 percent), ammonia plus organic nitrogen (13 percent), total phosphorus (62 percent), and suspended sediment (11 percent) during the study. All constituents had seasonal peaks in spring and fall. The large loads during the fall resulted from unusually large precipitation and streamflow patterns. This caused the two greatest streamflow peaks at both sites to occur during October (2004 and 2005). In Seguchie Creek, bed-sediment concentrations of five metals and trace elements (arsenic, cadmium, chromium, lead, and zinc) exceeded the Interim Sediment Quality Guidelines (ISQG) set by the Canadian Council of Ministers of the Environment. Bed-sediment samples from the upstream site had more exceedances of ISQGs for metals and trace elements than did samples from the downstream site (seven and two exceedances, respectively). Bed-sediment samples from the downstream site had more exceedances of ISQGs (20 exceedances) for semivolatile organic compounds than did samples from the upstream site (8 exceedances), indicating different sources for organic compounds than for metals and trace elements. Concentrations of 11 semivolatile organic compounds exceeded ISQGs: ancenaphthene, acenaphthylene, anthracene, benzo[a]anthracene, benzo[a]pyrene, chrysene, fluoranthene, fluorene, naphthalene, phenanthrene, and pyrene. In bed-sediment samples collected from three wetlands, concentrations of all six metals exceeded ISQGs: arsenic, cadmium, chromium, copper, lead, and zinc. Concentrations of three semivolatile organic compounds exceeded ISQGs: flouranthene, phenanthrene, and pyrene. Results indicate that areas appearing relatively undisturbed and of high resource value can have degraded quality from previous unknown land use.

The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

PubMed

Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

2005-07-01

Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

PubMed Central

Lo, W Y; Ting, L P

1994-01-01

Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

Accumulation of trace elements, pesticides, and polychlorinated biphenyls in sediments and the clam Corbicula manilensis of the Apalachicola River, Florida

USGS Publications Warehouse

Elder, J.F.; Mattraw, H.C.

1984-01-01

A survey of trace element and synthetic organic compound concentrations in botton materials was conducted on the Apalachichola River in northwest Florida in 1979-80 as part of the Apalachicola River Quality Assessment. Substances analyzed included trace elements (predominantly heavy metals), organochlorine insecticides, organophosphorus insecticides, chlorinated phenoxy-acid herbicides, and polychlorinated biphenyls (PCBs). Three kinds of materials were surveyed: fine-grained sediments, whole-body tissue of the Asiatic clam Corbicula manilensis, and bottom-load organic detritus. No hazardous levels of any of the substances were found. Concentrations in the fine-grained sediments and clams were generally at least ten times lower than maximum limits considered safe for biota of aquatic systems. A comparison of trace-substance data from the Apalachicola River with data from Lake Seminole (upstream) and Apalachicola Bay (downstream) showed lower concentrations in riverine clams. Sediment concentrations in all parts of the system were comparable. Most trace substances in the Apalachicola River enter the river from the upstream part of the basin (the Chattahoochee and Flint Rivers in Georgia and Alabama) and from nonpoint sources throughout the basin. There are no major point discharges along the Apalachicola. Trend analysis was limited by the scope of the study, but did not reveal any spatial or temporal trends in concentrations of any of the substances analyzed. Concentrations of organic compounds and most metals in Corbicula manilensis did not correlate with those in sediments.

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Short interspersed elements (SINEs) from insectivores. Two classes of mammalian SINEs distinguished by A-rich tail structure.

PubMed

Borodulina, O R; Kramerov, D A

2001-10-01

Four tRNA-related SINE families were isolated from the genome of the shrew Sorex araneus (SOR element), mole Mogera robusta (TAL element), and hedgehog Mesechinus dauuricus (ERI-1 and ERI-2 elements). Each of these SINEs families is specific for a single Insectivora family: SOR, for Soricidae (shrews); TAL, for Talpidae (moles and desmans); ERI-1 and ERI-2, for Erinaceidae (hedgehogs). There is a long polypyrimidine region (TC-motif) in TAL, ERI-1, and ERI-2 elements located immediately upstream of an A-rich tail with polyadenylation signals (AATAAA) and an RNA polymerase III terminator (T(4-6)) or TCT(3-4)). Ten out of 14 analyzed mammalian tRNA-related SINE families have an A-rich tail similar to that of TAL, ERI-1, and ERI-2 elements. These elements were assigned to class T+. The other four SINEs including SOR element have no polyadenylation signal and transcription terminator in their A-rich tail and were assigned to class T-. Class T+ SINEs occur only in mammals, and most of them have a long polypyrimidine region. Possible models of retroposition of class T+ and T- SINEs are discussed.

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

PubMed

Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

2010-02-01

GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE PAGES

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

2015-03-22

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

PubMed

Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

2017-07-01

Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

PubMed

Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

2015-06-01

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

PubMed

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

PubMed

Yamasu, K; Wilt, F H

1999-02-01

The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

High cancer-specific expression of mesothelin (MSLN) is attributable to an upstream enhancer containing a transcription enhancer factor dependent MCAT motif.

PubMed

Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E

2007-10-01

Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.

Computation of Feedback Aeroacoustic System by the CE/SE Method

NASA Technical Reports Server (NTRS)

Loh, Ching Y.; Wang, Xiao Y.; Chang, Sin-Chung; Jorgenson, Philip C. E.

2000-01-01

It is well known that due to vortex shedding in high speed flow over cutouts, cavities, and gaps, intense noise may be generated. Strong tonal oscillations occur in a feedback cycle in which the vortices shed from the upstream edge of the cavity convect downstream and impinge on the cavity lip, generating acoustic waves that propagate upstream to excite new vortices. Numerical simulation of such a complicated process requires a scheme that can: (1) resolve acoustic waves with low dispersion and numerical dissipation, (2) handle nonlinear and discontinuous waves (e.g. shocks), and (3) have an effective (near field) nonreflecting boundary condition (NRBC). The new space time conservation element and solution element method, or CE/SE for short, is a numerical method that meets the above requirements.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, Michael John; McConnaughhay, Johnie Franklin

A combustor includes a tube bundle that extends radially across at least a portion of the combustor. The tube bundle includes an upstream surface axially separated from a downstream surface, and a plurality of tubes extend from the upstream surface through the downstream surface to provide fluid communication through the tube bundle. A barrier extends radially inside the tube bundle between the upstream and downstream surfaces, and a baffle extends axially inside the tube bundle between the upstream surface and the barrier.

Open cycle ocean thermal energy conversion system

DOEpatents

Wittig, J. Michael

1980-01-01

An improved open cycle ocean thermal energy conversion system including a flash evaporator for vaporizing relatively warm ocean surface water and an axial flow, elastic fluid turbine having a vertical shaft and axis of rotation. The warm ocean water is transmitted to the evaporator through a first prestressed concrete skirt-conduit structure circumferentially situated about the axis of rotation. The unflashed warm ocean water exits the evaporator through a second prestressed concrete skirt-conduit structure located circumferentially about and radially within the first skirt-conduit structure. The radially inner surface of the second skirt conduit structure constitutes a cylinder which functions as the turbine's outer casing and obviates the need for a conventional outer housing. The turbine includes a radially enlarged disc element attached to the shaft for supporting at least one axial row of radially directed blades through which the steam is expanded. A prestressed concrete inner casing structure of the turbine has upstream and downstream portions respectively situated upstream and downstream from the disc element. The radially outer surfaces of the inner casing portions and radially outer periphery of the axially interposed disc cooperatively form a downwardly radially inwardly tapered surface. An annular steam flowpath of increasing flow area in the downward axial direction is radially bounded by the inner and outer prestressed concrete casing structures. The inner casing portions each include a transversely situated prestressed concrete circular wall for rotatably supporting the turbine shaft and associated structure. The turbine blades are substantially radially coextensive with the steam flowpath and receive steam from the evaporator through an annular array of prestressed concrete stationary vanes which extend between the inner and outer casings to provide structural support therefor and impart a desired flow direction to the steam.

Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

NASA Astrophysics Data System (ADS)

Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

2004-12-01

Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

FAT1 cadherin acts upstream of Hippo signalling through TAZ to regulate neuronal differentiation.

PubMed

Ahmed, Abdulrzag F; de Bock, Charles E; Lincz, Lisa F; Pundavela, Jay; Zouikr, Ihssane; Sontag, Estelle; Hondermarck, Hubert; Thorne, Rick F

2015-12-01

The Hippo pathway is emerging as a critical nexus that balances self-renewal of progenitors against differentiation; however, upstream elements in vertebrate Hippo signalling are poorly understood. High expression of Fat1 cadherin within the developing neuroepithelium and the manifestation of severe neurological phenotypes in Fat1-knockout mice suggest roles in neurogenesis. Using the SH-SY5Y model of neuronal differentiation and employing gene silencing techniques, we show that FAT1 acts to control neurite outgrowth, also driving cells towards terminal differentiation via inhibitory effects on proliferation. FAT1 actions were shown to be mediated through Hippo signalling where it activated core Hippo kinase components and antagonised functions of the Hippo effector TAZ. Suppression of FAT1 promoted the nucleocytoplasmic shuttling of TAZ leading to enhanced transcription of the Hippo target gene CTGF together with accompanying increases in nuclear levels of Smad3. Silencing of TAZ reversed the effects of FAT1 depletion thus connecting inactivation of TAZ-TGFbeta signalling with Hippo signalling mediated through FAT1. These findings establish FAT1 as a new upstream Hippo element regulating early stages of differentiation in neuronal cells.

Achieving a golden mean: mechanisms by which coronaviruses ensure synthesis of the correct stoichiometric ratios of viral proteins.

PubMed

Plant, Ewan P; Rakauskaite, Rasa; Taylor, Deborah R; Dinman, Jonathan D

2010-05-01

In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed -1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the -1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a "golden mean" model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins.

Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

PubMed Central

Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

1993-01-01

The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

PubMed Central

González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina

2018-01-01

Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs from environmental hotspots such as discharge sites of pharmaceutical effluents. PMID:29387045

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

Nutrient, suspended sediment, and trace element loads in the Blackstone River Basin in Massachusetts and Rhode Island, 2007 to 2009

USGS Publications Warehouse

Zimmerman, Marc J.; Waldron, Marcus C.; DeSimone, Leslie A.

2015-01-01

Analysis of the representative constituents (total phosphorus, total chromium, and suspended sediment) upstream and downstream of impoundments indicated that the existing impoundments, such as Rice City Pond, can be sources of particulate contaminant loads in the Blackstone River. Loads of particulate phosphorus, particulate chromium, and suspended sediment were consistently higher downstream from Rice City Pond than upstream during high-flow events, and there was a positive, linear relation between streamflow and changes in these constituents from upstream to downstream of the impoundment. Thus, particulate contaminants were mobilized from Rice City Pond during high-flow events and transported downstream. In contrast, downstream loads of particulate phosphorus, particulate chromium, and suspended sediment were generally lower than or equal to upstream loads for the former Rockdale Pond impoundment. Sediments associated with the former impoundment at Rockdale Pond, breached in the late 1960s, did not appear to be mobilized during the high-flow events monitored during this study.

Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.

DTIC Science & Technology

1976-11-01

periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic

The effects of land use on fluvial sediment chemistry for the conterminous U.S. - Results from the first cycle of the NAWQA Program: Trace and major elements, phosphorus, carbon, and sulfur

USGS Publications Warehouse

Horowitz, A.J.; Stephens, V.C.

2008-01-01

In 1991, the U.S. Geological Survey (USGS) began the first cycle of its National Water Quality Assessment (NAWQA) Program. The Program encompassed 51 river basins that collectively accounted for more than 70% of the total water use (excluding power generation), and 50% of the drinking water supply in the U.S. The basins represented a variety of hydrologic settings, rock types (geology), land-use categories, and population densities. One aspect of the first cycle included bed sediment sampling; sites were chosen to represent baseline and important land-use categories (e.g., agriculture, urban) in each basin. In total, over 1200 bed sediment samples were collected. All samples were size-limited (< 63????m) to facilitate spatial and/or temporal comparisons, and subsequently analyzed for a variety of chemical constituents including major (e.g., Fe, Al,) and trace elements (e.g., Cu, Zn, Cd), nutrients (e.g., P), and carbon. The analyses yielded total (??? 95% of the concentrations present), rather than total-recoverable chemical data. Land-use percentages, upstream underlying geology, and population density were determined for each site and evaluated to asses their relative influence on sediment chemistry. Baseline concentrations for the entire U.S. also were generated from a subset of all the samples, and are based on material collected from low population (??? 27??p km- 2) density, low percent urban (??? 5%), agricultural or undeveloped areas. The NAWQA baseline values are similar to those found in other national and global datasets. Further, it appears that upstream/underlying rock type has only a limited effect (mostly major elements) on sediment chemistry. The only land-use category that appears to substantially affect sediment chemistry is percent urban, and this result is mirrored by population density; in fact, the latter appears more consistent than the former.

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

PubMed Central

Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

1988-01-01

We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

Effects of metals on a montane aquatic system evaluated using an integrated assessment approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beltman, D.; Lipton, J.; Cacela, D.

Surface water, benthic invertebrates, aufwuchs, and sediments were sampled in a Rocky Mountain stream impacted by a cobalt-copper mine. A randomized study design was employed to ensure valid inferences beyond the areas sampled. As, Co, and Cu concentrations in all media downstream of the mine were 1--3 orders of magnitude greater than concentrations upstream, and concentrations in invertebrates were greater than those that adversely affect trout via dietary intake. Correlational analysis shows that bioaccumulation mechanisms and pathways between the different media differ from element to element; the differences are related to geochemical characteristics of the elements. The benthic invertebrate communitymore » is severely impacted for at least 50 km downstream of the mine: Ephemeropteran density, number of taxa, and total biomass are as low as 0.1% of values upstream. Other indices of the effects of metals on invertebrate communities that have been used elsewhere were ineffective in detecting these severe impacts. The integrated assessment approach used in this study provides information on contaminant sources, exposure pathways and mechanisms, and impacts to the stream ecosystem at several organizational levels.« less

Metagenomic exploration reveals a marked change in the river resistome and mobilome after treated wastewater discharges.

PubMed

Lekunberri, Itziar; Balcázar, José Luis; Borrego, Carles M

2018-03-01

Mobile genetic elements (MGEs) are key agents in the spread of antibiotic resistance genes (ARGs) across environments. Here we used metagenomics to compare the river resistome (collection of all ARGs) and mobilome (e.g., integrases, transposases, integron integrases and insertion sequence common region "ISCR" elements) between samples collected upstream (n = 6) and downstream (n = 6) of an urban wastewater treatment plant (UWWTP). In comparison to upstream metagenomes, downstream metagenomes showed a drastic increase in the abundance of ARGs, as well as markers of MGEs, particularly integron integrases and ISCR elements. These changes were accompanied by a concomitant prevalence of 16S rRNA gene signatures of bacteria affiliated to families encompassing well-known human and animal pathogens. Our results confirm that chronic discharges of treated wastewater severely impact the river resistome affecting not only the abundance and diversity of ARGs but also their potential spread by enriching the river mobilome in a wide variety of MGEs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sternberg, E.A.; Spizz, G.; Perry, W.M.

1988-07-01

Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

Culvert roughness elements for native Utah fish passage : phase II.

DOT National Transportation Integrated Search

2012-04-01

Native fishes have become an increasingly important concern when designing fish passable culverts. Many operational culverts constrict waterways which increase velocities and prevent upstream passage of small fish species. The current method to ensur...

Linear theory of boundary effects in open wind tunnels with finite jet lengths

NASA Technical Reports Server (NTRS)

Katzoff, S; Gardner, Clifford S; Diesendruck, Leo; Eisenstadt, Bertram J

1950-01-01

In the first part, the boundary conditions for an open wind tunnel (incompressible flow) are examined with special reference to the effects of the closed entrance and exit sections. Basic conditions are that the velocity must be continuous at the entrance lip and that the velocities in the upstream and downstream closed portions must be equal. In the second part, solutions are derived for four types of two-dimensional open tunnels, including one in which the pressures on the two free surfaces are not equal. Numerical results are given for every case. In general, if the lifting element is more than half the tunnel height from the inlet, the boundary effect at the lifting element is the same as for an infinitely long open tunnel. In the third part, a general method is given for calculating the boundary effect in an open circular wind tunnel of finite jet length. Numerical results are given for a lifting element concentrate at a point on the axis.

Sall4-Gli3 system in early limb progenitors is essential for the development of limb skeletal elements.

PubMed

Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko

2015-04-21

Limb skeletal elements originate from the limb progenitor cells, which undergo expansion and patterning to develop each skeletal element. Posterior-distal skeletal elements, such as the ulna/fibula and posterior digits develop in a Sonic hedgehog (Shh)-dependent manner. However, it is poorly understood how anterior-proximal elements, such as the humerus/femur, the radius/tibia and the anterior digits, are developed. Here we show that the zinc finger factors Sall4 and Gli3 cooperate for proper development of the anterior-proximal skeletal elements and also function upstream of Shh-dependent posterior skeletal element development. Conditional inactivation of Sall4 in the mesoderm before limb outgrowth caused severe defects in the anterior-proximal skeletal elements in the hindlimb. We found that Gli3 expression is reduced in Sall4 mutant hindlimbs, but not in forelimbs. This reduction caused posteriorization of nascent hindlimb buds, which is correlated with a loss of anterior digits. In proximal development, Sall4 integrates Gli3 and the Plzf-Hox system, in addition to proliferative expansion of cells in the mesenchymal core of nascent hindlimb buds. Whereas forelimbs developed normally in Sall4 mutants, further genetic analysis identified that the Sall4-Gli3 system is a common regulator of the early limb progenitor cells in both forelimbs and hindlimbs. The Sall4-Gli3 system also functions upstream of the Shh-expressing ZPA and the Fgf8-expressing AER in fore- and hindlimbs. Therefore, our study identified a critical role of the Sall4-Gli3 system at the early steps of limb development for proper development of the appendicular skeletal elements.

Staged electrostatic precipitator

DOEpatents

Miller, Stanley J.; Almlie, Jay C.; Zhuang, Ye

2016-03-01

A device includes a chamber having an air inlet and an air outlet. The device includes a plurality of stages including at least a first stage adjacent a second stage. The plurality of stages are disposed in the chamber and each stage has a plurality of discharge electrodes disposed in an interior region and is bounded by an upstream baffle on an end proximate the air inlet and bounded by a downstream baffle on an end proximate the air outlet. Each stage has at least one sidewall between the upstream baffle and the downstream baffle. The sidewall is configured as a collection electrode and has a plurality of apertures disposed along a length between the upstream baffle and the downstream baffle. The upstream baffle of the first stage is positioned in staggered alignment relative to the upstream baffle of the second stage and the downstream baffle of the first stage are positioned in staggered alignment relative to the downstream baffle of the second stage.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Achieving a Golden Mean: Mechanisms by Which Coronaviruses Ensure Synthesis of the Correct Stoichiometric Ratios of Viral Proteins▿

PubMed Central

Plant, Ewan P.; Rakauskaitė, Rasa; Taylor, Deborah R.; Dinman, Jonathan D.

2010-01-01

In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed −1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the −1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a “golden mean” model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins. PMID:20164235

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene

PubMed Central

Levy, Nitzan; Tatomer, Dierdre; Herber, Candice B.; Zhao, Xiaoyue; Tang, Hui; Sargeant, Toby; Ball, Lonnele J.; Summers, Jonathan; Speed, Terence P.; Leitman, Dale C.

2008-01-01

Estrogen receptors (ERs) regulate gene transcription by interacting with regulatory elements. Most information regarding how ER activates genes has come from studies using a small set of target genes or simple consensus sequences such as estrogen response element, activator protein 1, and Sp1 elements. However, these elements cannot explain the differences in gene regulation patterns and clinical effects observed with estradiol (E2) and selective estrogen receptor modulators. To obtain a greater understanding of how E2 and selective estrogen receptor modulators differentially regulate genes, it is necessary to investigate their action on a more comprehensive set of native regulatory elements derived from ER target genes. Here we used chromatin immunoprecipitation-cloning and sequencing to isolate 173 regulatory elements associated with ERα. Most elements were found in the introns (38%) and regions greater than 10 kb upstream of the transcription initiation site (38%); 24% of the elements were found in the proximal promoter region (<10 kb). Only 11% of the elements contained a classical estrogen response element; 23% of the elements did not have any known response elements, including one derived from the naked cuticle homolog gene, which was associated with the recruitment of p160 coactivators. Transfection studies found that 80% of the 173 elements were regulated by E2, raloxifene, or tamoxifen with ERα or ERβ. Tamoxifen was more effective than raloxifene at activating the elements with ERα, whereas raloxifene was superior with ERβ. Our findings demonstrate that E2, tamoxifen, and raloxifene differentially regulate native ER-regulatory elements isolated by chromatin immunoprecipitation with ERα and ERβ. PMID:17962382

Formation of fluvial knickzones in Japanese mountainous areas: A spatial analysis using GIS and DEMs

NASA Astrophysics Data System (ADS)

Hayakawa, Y. S.; Oguchi, T.

2006-12-01

Fluvial knickzones are the elements of bedrock rivers that can enhance stream erosion into bedrock, and they can be key morphologies highlighting interactions among earth surface processes such as erosion, tectonics, and volcanism. This study examines the longitudinal profiles of Japanese mountain rivers to illustrate the distribution of knickzones and discusses their role in the landscape development. Using 50-m DEMs, knickzones were extracted based on a quantitative criterion, and 5,753 knickzones were identified in the rivers of ca. 65,000 km long. The location of the knickzones was then examined along with other GIS data including topography, geology and precipitation. Overall, topographical conditions have the strongest influences on knickzone abundance, and upstream steep reaches of the rivers are more favorable for knickzone existence. The knickzone abundance for each rock type is also controlled by stream gradients, and lighologic boundaries do not show significant correlations with the knickzone locations. The controls of lithologic substrate on the knickzone locations are therefore limited. The abundant knickzones in steep river reaches indicate a hydraulic origin of knickzones, where stream erosions have enough strength in shaping the bedrock. Moreover, the knickzones are frequently observed in reaches slightly upstream from the major confluences at which stream discharge abruptly increases, indicating that the hydraulic anomalies of water flows at the confluences can cause knickzones which may later migrate upstream. The other possible causes of knickzone initiation including volcanic, tectonic and climatic effects are also suggested. The abundant knickzones in Japanese mountain rivers, resulted from the interactions among surface processes, suggest that river morphology modeling needs to consider the initiation and development of knickzones. tokyo.ac.jp/~hayakawa/

Thinking Upstream: A 25-Year Retrospective and Conceptual Model Aimed at Reducing Health Inequities.

PubMed

Butterfield, Patricia G

Thinking upstream was first introduced into the nursing vernacular in 1990 with the goal of advancing broad and context-rich perspectives of health. Initially invoked as conceptual framing language, upstream precepts were subsequently adopted and adapted by a generation of thoughtful nursing scholars. Their work reduced health inequities by redirecting actions further up etiologic pathways and by emphasizing economic, political, and environmental health determinants. US health care reform has fostered a much broader adoption of upstream language in policy documents. This article includes a semantic exploration of thinking upstream and a new model, the Butterfield Upstream Model for Population Health (BUMP Health).

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

PubMed

Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

1990-03-25

The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

PubMed

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE

EPA Science Inventory

Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution

PubMed Central

Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.

2005-01-01

The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818

Prediction of Geomagnetic Activity and Key Parameters in High-Latitude Ionosphere-Basic Elements

NASA Technical Reports Server (NTRS)

Lyatsky, W.; Khazanov, G. V.

2007-01-01

Prediction of geomagnetic activity and related events in the Earth's magnetosphere and ionosphere is an important task of the Space Weather program. Prediction reliability is dependent on the prediction method and elements included in the prediction scheme. Two main elements are a suitable geomagnetic activity index and coupling function -- the combination of solar wind parameters providing the best correlation between upstream solar wind data and geomagnetic activity. The appropriate choice of these two elements is imperative for any reliable prediction model. The purpose of this work was to elaborate on these two elements -- the appropriate geomagnetic activity index and the coupling function -- and investigate the opportunity to improve the reliability of the prediction of geomagnetic activity and other events in the Earth's magnetosphere. The new polar magnetic index of geomagnetic activity and the new version of the coupling function lead to a significant increase in the reliability of predicting the geomagnetic activity and some key parameters, such as cross-polar cap voltage and total Joule heating in high-latitude ionosphere, which play a very important role in the development of geomagnetic and other activity in the Earth s magnetosphere, and are widely used as key input parameters in modeling magnetospheric, ionospheric, and thermospheric processes.

The flow field around a pair of cubic roughness elements with different spacings immersed in turbulent boundary layer

NASA Astrophysics Data System (ADS)

Agarwal, Karuna; Gao, Jian; Katz, Joseph

2017-11-01

The shape, size, and spacing between roughness elements in turbulent boundary layers affect the associated drag and noise. Understanding them require data on the flow structure around these elements. Dual-view tomographic holography is used to study the 3D 3-component velocity field around a pair of cubic roughness elements immersed in a turbulent boundary layer at Reτ = 2500 . These a = 1 mm high cubes correspond to 4% of the half channel height and 90 wall units (δν = 11 μ m). Tests are performed for spanwise spacings of a, 1.5 a and 2.5 a. The sample volume is 385δν × 250δν × 190δν and the vector spacing is 5.4δν. Conversed statistics is obtained by recording 1500 realizations in volumes centered upstream, downstream and around a cube. The boundary layer separating upstream of the cube does not reattach until the wake region, resulting in formation of a vortical ``canopy'' that engulfs each cube. It is dominated by spanwise vorticity above the cube and separated region, bounded by vertical vorticity on the sides. Flow channeling in the space between cubes causes asymmetry in the vorticity distributions along the inner and outer walls. The legs of horseshoe vortices remain near the wall between cubes, but grow and expand in the wake region. Funded by NSF and ONR.

Internal baffling for fuel injector

DOEpatents

Johnson, Thomas Edward; Lacy, Benjamin; Stevenson, Christian

2014-08-05

A fuel injector includes a fuel delivery tube; a plurality of pre-mixing tubes, each pre-mixing tube comprising at least one fuel injection hole; an upstream tube support plate that supports upstream ends of the plurality of pre-mixing tubes; a downstream tube support plate that supports downstream ends of the plurality of pre-mixing tubes; an outer wall connecting the upstream tube support plate and the downstream tube support plate and defining a plenum therewith; and a baffle provided in the plenum. The baffle includes a radial portion. A fuel delivered in the upstream direction by the fuel delivery tube is directed radially outwardly in the plenum between the radial portion of the baffle and the downstream tube support plate, then in the downstream direction around an outer edge portion of the radial portion, and then radially inwardly between the radial portion and the upstream tube support plate.

Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

PubMed

Richard, S; Zingg, H H

1991-12-01

The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

Vaporization and Zonal Mixing in Performance Modeling of Advanced LOX-Methane Rockets

NASA Technical Reports Server (NTRS)

Williams, George J., Jr.; Stiegemeier, Benjamin R.

2013-01-01

Initial modeling of LOX-Methane reaction control (RCE) 100 lbf thrusters and larger, 5500 lbf thrusters with the TDK/VIPER code has shown good agreement with sea-level and altitude test data. However, the vaporization and zonal mixing upstream of the compressible flow stage of the models leveraged empirical trends to match the sea-level data. This was necessary in part because the codes are designed primarily to handle the compressible part of the flow (i.e. contraction through expansion) and in part because there was limited data on the thrusters themselves on which to base a rigorous model. A more rigorous model has been developed which includes detailed vaporization trends based on element type and geometry, radial variations in mixture ratio within each of the "zones" associated with elements and not just between zones of different element types, and, to the extent possible, updated kinetic rates. The Spray Combustion Analysis Program (SCAP) was leveraged to support assumptions in the vaporization trends. Data of both thrusters is revisited and the model maintains a good predictive capability while addressing some of the major limitations of the previous version.

The 3’-Jα Region of the TCRα Locus Bears Gene Regulatory Activity in Thymic and Peripheral T Cells

PubMed Central

Kučerová-Levisohn, Martina; Knirr, Stefan; Mejia, Rosa I.; Ortiz, Benjamin D.

2015-01-01

Much progress has been made in understanding the important cis-mediated controls on mouse TCRα gene function, including identification of the Eα enhancer and TCRα locus control region (LCR). Nevertheless, previous data have suggested that other cis-regulatory elements may reside in the locus outside of the Eα/LCR. Based on prior findings, we hypothesized the existence of gene regulatory elements in a 3.9-kb region 5’ of the Cα exons. Using DNase hypersensitivity assays and TCRα BAC reporter transgenes in mice, we detected gene regulatory activity within this 3.9-kb region. This region is active in both thymic and peripheral T cells, and selectively affects upstream, but not downstream, gene expression. Together, these data indicate the existence of a novel cis-acting regulatory complex that contributes to TCRα transgene expression in vivo. The active chromatin sites we discovered within this region would remain in the locus after TCRα gene rearrangement, and thus may contribute to endogenous TCRα gene activity, particularly in peripheral T cells, where the Eα element has been found to be inactive. PMID:26177549

Electrically heated particulate filter embedded heater design

DOEpatents

Gonze, Eugene V.; Chapman, Mark R.

2014-07-01

An exhaust system that processes exhaust generated by an engine is provided. The system generally includes a particulate filter (PF) that filters particulates from the exhaust wherein an upstream end of the PF receives exhaust from the engine and wherein an upstream surface of the particulate filter includes machined grooves. A grid of electrically resistive material is inserted into the machined grooves of the exterior upstream surface of the PF and selectively heats exhaust passing through the grid to initiate combustion of particulates within the PF.

Gain and loss of polyadenylation signals during evolution of green algae.

PubMed

Wodniok, Sabina; Simon, Andreas; Glöckner, Gernot; Becker, Burkhard

2007-04-18

The Viridiplantae (green algae and land plants) consist of two monophyletic lineages: the Chlorophyta and the Streptophyta. Most green algae belong to the Chlorophyta, while the Streptophyta include all land plants and a small group of freshwater algae known as Charophyceae. Eukaryotes attach a poly-A tail to the 3' ends of most nuclear-encoded mRNAs. In embryophytes, animals and fungi, the signal for polyadenylation contains an A-rich sequence (often AAUAAA or related sequence) 13 to 30 nucleotides upstream from the cleavage site, which is commonly referred to as the near upstream element (NUE). However, it has been reported that the pentanucleotide UGUAA is used as polyadenylation signal for some genes in volvocalean algae. We set out to investigate polyadenylation signal differences between streptophytes and chlorophytes that may have emerged shortly after the evolutionary split between Streptophyta and Chlorophyta. We therefore analyzed expressed genes (ESTs) from three streptophyte algae, Mesostigma viride, Klebsormidium subtile and Coleochaete scutata, and from two early-branching chlorophytes, Pyramimonas parkeae and Scherffelia dubia. In addition, to extend the database, our analyses included ESTs from six other chlorophytes (Acetabularia acetabulum, Chlamydomonas reinhardtii, Helicosporidium sp. ex Simulium jonesii, Prototheca wickerhamii, Scenedesmus obliquus and Ulva linza) and one streptophyte (Closterium peracerosum). Our results indicate that polyadenylation signals in green algae vary widely. The UGUAA motif is confined to late-branching Chlorophyta. Most streptophyte algae do not have an A-rich sequence motif like that in embryophytes, animals and fungi. We observed polyadenylation signals similar to those of Arabidopsis and other land plants only in Mesostigma. Polyadenylation signals in green algae show considerable variation. A new NUE (UGUAA) was invented in derived chlorophytes and replaced not only the A-rich NUE but the complete poly(A) signal in all chlorophytes investigated except Scherffelia (only NUE replaced) and Pyramimonas (UGUAA completely missing). The UGUAA element is completely absent from streptophytes. However, the structure of the poly(A) signal was often modified in streptophyte algae. In most species investigated, an A-rich NUE is missing; instead, these species seem to rely mainly on U-rich elements.

Sediment-quality assessment of Franklin D. Roosevelt Lake and the upstream reach of the Columbia River, Washington, 1992

USGS Publications Warehouse

Bortleson, Gilbert Carl; Cox, S.E.; Munn, M.D.; Schumaker, R.J.; Block, E.K.

2001-01-01

Elevated concentrations of trace elements were found in bed sediment of Lake Roosevelt and the Columbia River, its principal source of inflow. Trace-element concentrations in whole water samples did not exceed criteria for freshwater organisms. Bed sediments of Lake Roosevelt were analyzed for organic compounds associated with wood-pulp waste. Dioxins and furans were found in suspended sediment and water of the Columbia River. Abundance and diversity of benthic invertebrate communities were analyzed.

Trace elements in streambed sediments of small subtropical streams on O'ahu, Hawai'i: Results from the USGS NAWQA program

USGS Publications Warehouse

De Carlo, E. H.; Tomlinson, M.S.; Anthony, S.S.

2005-01-01

Data are presented for trace element concentrations determined in the <63 ??m fraction of streambed sediment samples collected at 24 sites on the island of O'ahu, Hawai'i. Sampling sites were classified as urban, agricultural, mixed (urban/agricultural), or forested based on their dominant land use, although the mixed land use at selected sampling sites consisted of either urban and agricultural or forested and agricultural land uses. Forest dominated sites were used as reference sites for calculating enrichment factors. Trace element concentrations were compared to concentrations from studies conducted in the conterminous United States using identical methods and to aquatic-life guidelines provided by the Canadian Council of Ministers of the Environment. A variety of elements including Pb, Cr, Cu and Zn exceeded the aquatic-life guidelines in selected samples. All of the Cr and Zn values and 16 of 24 Cu values exceeded their respective guidelines. The potential toxicity of elements exceeding guidelines, however, should be considered in the context of strong enrichments of selected trace elements attributable to source rocks in Hawai'i, as well as in the context of the abundance of fine-grained sediment in the streambed of O'ahu streams. Statistical methods including cluster analysis, Kruskal-Wallis non-parametric test, correlation analysis, and principal component analysis (PCA) were used to evaluate differences and elucidate relationships between trace elements and sites. Overall, trace element distributions and abundances can be correlated to three principal sources of elements. These include basaltic rocks of the volcanic edifice (Fe, Al, Ni, Co, Cr, V and Cu), carbonate/seawater derived elements (Mg, Ca, Na and Sr), and elements enriched owing to anthropogenic activity (P, Sn, Cd, Sn, Ba and Pb). Anthropogenic enrichment gradients were observed for Ba, Cd, Pb, Sn and Zn in the four streams in which sediments were collected upstream and downstream. The findings of this study are generally similar to but differ slightly from previous work on sediments and suspended particulate matter in streams, from two urban watersheds of O'ahu, Hawai'i. Inter-element associations in the latter were often stronger and indicated a mixture of anthropogenic, agricultural and basaltic sources of trace elements. Some elements fell into different statistical categories in the two studies, owing in part to differences in study design and the hydrogeological constraints on the respective study areas.

Articulated transition duct in turbomachine

DOEpatents

Flanagan, James Scott; McMahan, Kevin Weston; LeBegue, Jeffrey Scott; Pentecost, Ronnie Ray

2014-04-29

Turbine systems are provided. A turbine system includes a transition duct comprising an inlet, an outlet, and a duct passage extending between the inlet and the outlet and defining a longitudinal axis, a radial axis, and a tangential axis. The outlet of the transition duct is offset from the inlet along the longitudinal axis and the tangential axis. The duct passage includes an upstream portion and a downstream portion. The upstream portion extends from the inlet between an inlet end and an aft end. The downstream portion extends from the outlet between an outlet end and a head end. The turbine system further includes a joint coupling the aft end of the upstream portion and the head end of the downstream portion together. The joint is configured to allow movement of the upstream portion and the downstream portion relative to each other about or along at least one axis.

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

PubMed

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

PubMed

Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

1994-05-01

Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

Transition duct with divided upstream and downstream portions

DOE Office of Scientific and Technical Information (OSTI.GOV)

McMahan, Kevin Weston; LeBegue, Jeffrey Scott; Maldonado, Jaime Javier

2015-07-14

Turbine systems are provided. In one embodiment, a turbine system includes a transition duct comprising an inlet, an outlet, and a duct passage extending between the inlet and the outlet and defining a longitudinal axis, a radial axis, and a tangential axis. The outlet of the transition duct is offset from the inlet along the longitudinal axis and the tangential axis. The duct passage includes an upstream portion extending from the inlet and a downstream portion extending from the outlet. The turbine system further includes a rib extending from an outer surface of the duct passage, the rib dividing themore » upstream portion and the downstream portion.« less

Irrigation drainage studies of the Angostura Reclamation Unit and the Belle Fourche Reclamation Project, western South Dakota : results of 1994 sampling and comparisons with 1988 data

USGS Publications Warehouse

Sando, Steven K.; Williamson, Joyce E.; Dickerson, Kimberly K.; Wesolowski, Edwin A.

2001-01-01

The U.S. Department of the Interior started the National Irrigation Water Quality Program in 1985 to identify the nature and extent of irrigation-induced water-quality problems that might exist in the western U.S. The Angostura Reclamation Unit (ARU) and Belle Fourche Reclamation Project (BFRP) in western South Dakota were included as part of this program. The ARU and BFRP reconnaissance studies were initiated in 1988, during below-normal streamflow conditions in both study areas. Surface water, bottom sediment, and fish were resampled in 1994 at selected sites in both study areas during generally near-normal streamflow conditions to compare with 1988 study results. Concentrations of major ions in water for both the ARU and BFRP study areas are high relative to national baseline levels. Major-ion concentrations for both areas generally are lower for 1994 than for 1988, when low-flow conditions prevailed, but ionic proportions are similar between years. For ARU, dissolved-solids concentrations probably increase slightly downstream from Angostura Reservoir; however, the available data sets are insufficient to confidently discern effects of ARU operations on dissolved-solids loading. For BFRP, dissolved-solids concentrations are slightly higher at sites that are affected by irrigation drainage; again, however, the data are inconclusive to determine whether BFRP operations increase dissolved-solids loading. Most trace-element concentrations in water samples for both study areas are similar between 1988 and 1994, and do not show strong relations with discharge. ARU operations probably are not contributing discernible additional loads of trace elements to the Cheyenne River. For BFRP, concentrations of some trace elements are slightly higher at sites downstream from irrigation operations than at a site upstream from irrigation operations. BFRP operations might contribute to trace-element concentrations in the Belle Fourche River, but available data are insufficient to quantify increases. For both study areas, concentrations of several trace elements occasionally exceed National Irrigation Water Quality Program guidelines. Selenium routinely occurs in concentrations that could be problematic at sites upstream and downstream from both study areas. Elevated selenium concentrations at sites upstream from irrigation operations indicate that naturally occurring selenium concentrations are relatively high in and near the study areas. While ARU operations probably do not contribute discernible additional loads of selenium to the Cheyenne River, BFRP operations might contribute additional selenium loads to the Belle Fourche River. Concentrations of most trace elements in bottom sediment, except arsenic and selenium, are similar to typical concentrations for western U.S. soils for both study areas. Bottom-sediment arsenic and selenium (1988) concentrations in both study areas can reach levels that might be of concern; however, there is insufficient information to determine whether irrigation operations contribute to these elevated concentrations. Concentrations of most trace elements in fish in both study areas are less than values known to adversely affect fish or birds, although there are occasional exceedances of established criteria. However, selenium concentrations in fish samples routinely are within the National Irrigation Water Quality Program level of concern, and also commonly exceed the dietary guideline for avian consumers for both study areas. Selenium concentrations in fish samples generally are higher at sites downstream from irrigation operations. For BFRP, arsenic and mercury concentrations are elevated in fish samples from site B-18, which is influenced by mine tailings.

75 FR 81957 - Proposed Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-29

... in meters (MSL) Effective Modified Levy County, Florida, and Incorporated Areas Bronson North Ditch... nearest 0.1 meter. ** BFEs to be changed include the listed downstream and upstream BFEs, and include BFEs... upstream of Elliots Run Road. Unnamed Tributary to Shoup Run..... Approximately 400 feet None +1139...

On the role of acoustic feedback in boundary-layer instability.

PubMed

Wu, Xuesong

2014-07-28

In this paper, the classical triple-deck formalism is employed to investigate two instability problems in which an acoustic feedback loop plays an essential role. The first concerns a subsonic boundary layer over a flat plate on which two well-separated roughness elements are present. A spatially amplifying Tollmien-Schlichting (T-S) wave between the roughness elements is scattered by the downstream roughness to emit a sound wave that propagates upstream and impinges on the upstream roughness to regenerate the T-S wave, thereby forming a closed feedback loop in the streamwise direction. Numerical calculations suggest that, at high Reynolds numbers and for moderate roughness heights, the long-range acoustic coupling may lead to absolute instability, which is characterized by self-sustained oscillations at discrete frequencies. The dominant peak frequency may jump from one value to another as the Reynolds number, or the distance between the roughness elements, is varied gradually. The second problem concerns the supersonic 'twin boundary layers' that develop along two well-separated parallel flat plates. The two boundary layers are in mutual interaction through the impinging and reflected acoustic waves. It is found that the interaction leads to a new instability that is absent in the unconfined boundary layer. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

2006-07-07

In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

NASA Astrophysics Data System (ADS)

Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

2016-04-01

The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

Temporary Restoration of Bull Trout Passage at Albeni Falls Dam, 2008 Progress Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bellgraph, Brian J.

2009-03-31

The goal of this project is to provide temporary upstream passage of bull trout around Albeni Falls Dam on the Pend Oreille River, Idaho. Our specific objectives are to capture fish downstream of Albeni Falls Dam, tag them with combination acoustic and radio transmitters, release them upstream of Albeni Falls Dam, and determine if genetic information on tagged fish can be used to accurately establish where fish are located during the spawning season. In 2007, radio receiving stations were installed at several locations throughout the Pend Oreille River watershed to detect movements of adult bull trout; however, no bull troutmore » were tagged during that year. In 2008, four bull trout were captured downstream of Albeni Falls Dam, implanted with transmitters, and released upstream of the dam at Priest River, Idaho. The most-likely natal tributaries of bull trout assigned using genetic analyses were Grouse Creek (N = 2); a tributary of the Pack River, Lightning Creek (N = 1); and Rattle Creek (N = 1), a tributary of Lightning Creek. All four bull trout migrated upstream from the release site in Priest River, Idaho, were detected at monitoring stations near Dover, Idaho, and were presumed to reside in Lake Pend Oreille from spring until fall 2008. The transmitter of one bull trout with a genetic assignment to Grouse Creek was found in Grouse Creek in October 2008; however, the fish was not found. The bull trout assigned to Rattle Creek was detected in the Clark Fork River downstream from Cabinet Gorge Dam (approximately 13 km from the mouth of Lightning Creek) in September but was not detected entering Lightning Creek. The remaining two bull trout were not detected in 2008 after detection at the Dover receiving stations. This report details the progress by work element in the 2008 statement of work, including data analyses of fish movements, and expands on the information reported in the quarterly Pisces status reports.« less

A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

PubMed

Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

1989-12-01

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

Transcriptional activation of Mina by Sp1/3 factors.

PubMed

Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

Transcriptional Activation of Mina by Sp1/3 Factors

PubMed Central

Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617

Transition Experiments on Large Bluntness Cones with Distributed Roughness in Hypersonic Flight

NASA Technical Reports Server (NTRS)

Reda, Daniel. C.; Wilder, Michael C.; Prabhu, Dinesh K.

2012-01-01

Large bluntness cones with smooth nosetips and roughened frusta were flown in the NASA Ames hypersonic ballistic range at a Mach number of 10 through quiescent air environments. Global surface intensity (temperature) distributions were optically measured and analyzed to determine transition onset and progression over the roughened surface. Real-gas Navier-Stokes calculations of model flowfields, including laminar boundary layer development in these flowfields, were conducted to predict values of key dimensionless parameters used to correlate transition on such configurations in hypersonic flow. For these large bluntness cases, predicted axial distributions of the roughness Reynolds number showed (for each specified freestream pressure) that this parameter was a maximum at the physical beginning of the roughened zone and decreased with increasing run length along the roughened surface. Roughness-induced transition occurred downstream of this maximum roughness Reynolds number location, and progressed upstream towards the beginning of the roughened zone as freestream pressure was systematically increased. Roughness elements encountered at the upstream edge of the roughened frusta thus acted like a finite-extent trip array, consistent with published results concerning the tripping effectiveness of roughness bands placed on otherwise smooth surfaces.

Gene expression regulation by upstream open reading frames and human disease.

PubMed

Barbosa, Cristina; Peixeiro, Isabel; Romão, Luísa

2013-01-01

Upstream open reading frames (uORFs) are major gene expression regulatory elements. In many eukaryotic mRNAs, one or more uORFs precede the initiation codon of the main coding region. Indeed, several studies have revealed that almost half of human transcripts present uORFs. Very interesting examples have shown that these uORFs can impact gene expression of the downstream main ORF by triggering mRNA decay or by regulating translation. Also, evidence from recent genetic and bioinformatic studies implicates disturbed uORF-mediated translational control in the etiology of many human diseases, including malignancies, metabolic or neurologic disorders, and inherited syndromes. In this review, we will briefly present the mechanisms through which uORFs regulate gene expression and how they can impact on the organism's response to different cell stress conditions. Then, we will emphasize the importance of these structures by illustrating, with specific examples, how disturbed uORF-mediated translational control can be involved in the etiology of human diseases, giving special importance to genotype-phenotype correlations. Identifying and studying more cases of uORF-altering mutations will help us to understand and establish genotype-phenotype associations, leading to advancements in diagnosis, prognosis, and treatment of many human disorders.

Trace element fluxes in sediments of an environmentally impacted river from a coastal zone of Brazil.

PubMed

da Silva, Yuri Jacques Agra Bezerra; Cantalice, José Ramon Barros; Singh, Vijay P; do Nascimento, Clístenes Williams Araújo; Piscoya, Victor Casimiro; Guerra, Sérgio M S

2015-10-01

Data regarding trace element concentrations and fluxes in suspended sediments and bedload are scarce. To fill this gap and meet the international need to include polluted rivers in future world estimation of trace element fluxes, this study aimed to determine the trace element fluxes in suspended sediment and bedload of an environmentally impacted river in Brazil. Water, suspended sediment, and bedload from both the upstream and the downstream cross sections were collected. To collect both the suspended sediment and water samples, we used the US DH-48. Bedload measurements were carried out using the US BLH 84 sampler. Concentrations of Cd, Cr, Cu, Fe, Mn, Ni, Pb, and Zn were determined by inductively coupled plasma (ICP-OES). As and Hg were determined by an atomic absorption spectrophotometer (AA-FIAS). The suspended sediments contributed more than 99 % of the trace element flux. By far Pb and to a less extent Zn at the downstream site represents major concerns. The yields of Pb and Zn in suspended sediments were 4.20 and 2.93 kg km(2) year(-1), respectively. These yields were higher than the values reported for Pb and Zn for Tuul River (highly impacted by mining activities), 1.60 and 1.30 kg km(2) year(-1), respectively, as well as the Pb yield (suspended + dissolved) to the sea of some Mediterranean rivers equal to 3.4 kg km(2) year(-1). Therefore, the highest flux and yield of Pb and Zn in Ipojuca River highlighted the importance to include medium and small rivers-often overlooked in global and regional studies-in the future estimation of world trace element fluxes in order to protect estuaries and coastal zones.

Untreated urban waste contaminates Indian river sediments with resistance genes to last resort antibiotics.

PubMed

Marathe, Nachiket P; Pal, Chandan; Gaikwad, Swapnil S; Jonsson, Viktor; Kristiansson, Erik; Larsson, D G Joakim

2017-11-01

Efficient sewage treatment is critical for limiting environmental transmission of antibiotic-resistant bacteria. In many low and middle income countries, however, large proportions of sewage are still released untreated into receiving water bodies. In-depth knowledge of how such discharges of untreated urban waste influences the environmental resistome is largely lacking. Here, we highlight the impact of uncontrolled discharge of partially treated and/or untreated wastewater on the structure of bacterial communities and resistome of sediments collected from Mutha river flowing through Pune city in India. Using shotgun metagenomics, we found a wide array (n = 175) of horizontally transferable antibiotic resistance genes (ARGs) including carbapenemases such as NDM, VIM, KPC, OXA-48 and IMP types. The relative abundance of total ARGs was 30-fold higher in river sediments within the city compared to upstream sites. Forty four ARGs, including the tet(X) gene conferring resistance to tigecycline, OXA-58 and GES type carbapenemases, were significantly more abundant in city sediments, while two ARGs were more common at upstream sites. The recently identified mobile colistin resistance gene mcr-1 was detected only in one of the upstream samples, but not in city samples. In addition to ARGs, higher abundances of various mobile genetic elements were found in city samples, including integron-associated integrases and ISCR transposases, as well as some biocide/metal resistance genes. Virulence toxin genes as well as bacterial genera comprising many pathogens were more abundant here; the genus Acinetobacter, which is often associated with multidrug resistance and nosocomial infections, comprised up to 29% of the 16S rRNA reads, which to our best knowledge is unmatched in any other deeply sequenced metagenome. There was a strong correlation between the abundance of Acinetobacter and the OXA-58 carbapenemase gene. Our study shows that uncontrolled discharge of untreated urban waste can contribute to an overall increase of the abundance and diversity of ARGs in the environment, including those conferring resistance to last-resort antibiotics. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Separation of the PROX1 gene from upstream conserved elements in a complex inversion/translocation patient with hypoplastic left heart

PubMed Central

Gill, Harinder K; Parsons, Sian R; Spalluto, Cosma; Davies, Angela F; Knorz, Victoria J; Burlinson, Clare EG; Ng, Bee Ling; Carter, Nigel P; Ogilvie, Caroline Mackie; Wilson, David I; Roberts, Roland G

2009-01-01

Hypoplastic left heart (HLH) occurs in at least 1 in 10 000 live births but may be more common in utero. Its causes are poorly understood but a number of affected cases are associated with chromosomal abnormalities. We set out to localize the breakpoints in a patient with sporadic HLH and a de novo translocation. Initial studies showed that the apparently simple 1q41;3q27.1 translocation was actually combined with a 4-Mb inversion, also de novo, of material within 1q41. We therefore localized all four breakpoints and found that no known transcription units were disrupted. However we present a case, based on functional considerations, synteny and position of highly conserved non-coding sequence elements, and the heterozygous Prox1+/− mouse phenotype (ventricular hypoplasia), for the involvement of dysregulation of the PROX1 gene in the aetiology of HLH in this case. Accordingly, we show that the spatial expression pattern of PROX1 in the developing human heart is consistent with a role in cardiac development. We suggest that dysregulation of PROX1 gene expression due to separation from its conserved upstream elements is likely to have caused the heart defects observed in this patient, and that PROX1 should be considered as a potential candidate gene for other cases of HLH. The relevance of another breakpoint separating the cardiac gene ESRRG from a conserved downstream element is also discussed. PMID:19471316

Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

PubMed

Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

2017-11-01

We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

PubMed Central

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

PubMed

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2008-09-15

Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

Selfish DNA: a pharmaceutical perspective.

PubMed

Winckler, T

2013-07-01

Almost 25 years ago, Theo Dingermann published the discovery of a new mobile genetic element in the unicellular microbe Dictyostelium discoideum in the journal Science. An interesting property of this new molecular parasite, the Dictyostelium Repetitive Element (DRE), was that all integrations were found approximately 50 base pairs (bp) upstream of transfer RNA (tRNA) genes in the D. discoideum genome, thus implying an active targeting mechanism to avoid the disruption of host cell genes by the retrotransposition process. Since then, the facultative multicellular "social amoeba" D. discoideum has become a popular model for analyzing complex cellular functions such as cell movement, chemotaxis, phagocytosis, and cell differentiation, important areas of biomedical research that are often hard to investigate in cells from "higher organisms" including humans. Therefore, progress in the development of methods to study Dictyostelium biology has also provoked research on transposable elements in this organism. Early work on the DRE element suggested that studying its molecular mechanism of site-specific integration might promote human gene therapy technology through the design of integrating gene transfer vectors with low intrinsic genotoxic potential. In this review article, I will briefly review the original research performed on the DRE transposable element in the Dingermann lab and report on how the emergence of genomics technologies and the development of tools to analyze de novo retrotransposition events in D. discoideum cells will expand our knowledge of DRE biology in the future.

Cooperative action of multiple cis-acting elements is required for N-myc expression in branchial arches: specific contribution of GATA3.

PubMed

Potvin, Eric; Beuret, Laurent; Cadrin-Girard, Jean-François; Carter, Marcelle; Roy, Sophie; Tremblay, Michel; Charron, Jean

2010-11-01

The precise expression of the N-myc proto-oncogene is essential for normal mammalian development, whereas altered N-myc gene regulation is known to be a determinant factor in tumor formation. Using transgenic mouse embryos, we show that N-myc sequences from kb -8.7 to kb +7.2 are sufficient to reproduce the N-myc embryonic expression profile in developing branchial arches and limb buds. These sequences encompass several regulatory elements dispersed throughout the N-myc locus, including an upstream limb bud enhancer, a downstream somite enhancer, a branchial arch enhancer in the second intron, and a negative regulatory element in the first intron. N-myc expression in the limb buds is under the dominant control of the limb bud enhancer. The expression in the branchial arches necessitates the interplay of three regulatory domains. The branchial arch enhancer cooperates with the somite enhancer region to prevent an inhibitory activity contained in the first intron. The characterization of the branchial arch enhancer has revealed a specific role of the transcription factor GATA3 in the regulation of N-myc expression. Together, these data demonstrate that correct N-myc developmental expression is achieved via cooperation of multiple positive and negative regulatory elements.

BEHAVIOR OF ARSENIC AND OTHER REDOX-SENSITIVE ELEMENTS IN CROWLEY LAKE, CA: A RESERVOIR IN THE LOS ANGELES AQUEDUCT SYSTEM. (R826202)

EPA Science Inventory

Elevated arsenic concentrations in Crowley Lake derive from upstream geothermal inputs. We examined the water column of Crowley Lake under stratified and unstratified conditions, seeking evidence for algal uptake and transformation of arsenic and its deposition to and release fro...

The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

PubMed

Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

1999-09-24

To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

NASA Trapezoidal Wing Computations Including Transition and Advanced Turbulence Modeling

NASA Technical Reports Server (NTRS)

Rumsey, C. L.; Lee-Rausch, E. M.

2012-01-01

Flow about the NASA Trapezoidal Wing is computed with several turbulence models by using grids from the first High Lift Prediction Workshop in an effort to advance understanding of computational fluid dynamics modeling for this type of flowfield. Transition is accounted for in many of the computations. In particular, a recently-developed 4-equation transition model is utilized and works well overall. Accounting for transition tends to increase lift and decrease moment, which improves the agreement with experiment. Upper surface flap separation is reduced, and agreement with experimental surface pressures and velocity profiles is improved. The predicted shape of wakes from upstream elements is strongly influenced by grid resolution in regions above the main and flap elements. Turbulence model enhancements to account for rotation and curvature have the general effect of increasing lift and improving the resolution of the wing tip vortex as it convects downstream. However, none of the models improve the prediction of surface pressures near the wing tip, where more grid resolution is needed.

Structure of a bacterial RNA polymerase holoenzyme open promoter complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka

2015-09-08

Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less

Structure of a bacterial RNA polymerase holoenzyme open promoter complex

DOE PAGES

Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...

2015-09-08

Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-11-11

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed Central

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-01-01

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

Transcriptional regulation of hepatic lipogenesis.

PubMed

Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

2015-11-01

Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.

Wake Instabilities Behind Discrete Roughness Elements in High Speed Boundary Layers

NASA Technical Reports Server (NTRS)

Choudhari, Meelan; Li, Fei; Chang, Chau-Lyan; Norris, Andrew; Edwards, Jack

2013-01-01

Computations are performed to study the flow past an isolated, spanwise symmetric roughness element in zero pressure gradient boundary layers at Mach 3.5 and 5.9, with an emphasis on roughness heights of less than 55 percent of the local boundary layer thickness. The Mach 5.9 cases include flow conditions that are relevant to both ground facility experiments and high altitude flight ("cold wall" case). Regardless of the Mach number, the mean flow distortion due to the roughness element is characterized by long-lived streamwise streaks in the roughness wake, which can support instability modes that did not exist in the absence of the roughness element. The higher Mach number cases reveal a variety of instability mode shapes with velocity fluctuations concentrated in different localized regions of high base flow shear. The high shear regions vary from the top of a mushroom shaped structure characterizing the centerline streak to regions that are concentrated on the sides of the mushroom. Unlike the Mach 3.5 case with nearly same values of scaled roughness height k/delta and roughness height Reynolds number Re(sub kk), the odd wake modes in both Mach 5.9 cases are significantly more unstable than the even modes of instability. Additional computations for a Mach 3.5 boundary layer indicate that the presence of a roughness element can also enhance the amplification of first mode instabilities incident from upstream. Interactions between multiple roughness elements aligned along the flow direction are also explored.

Form drag in rivers due to small-scale natural topographic features: 1. Regular sequences

USGS Publications Warehouse

Kean, J.W.; Smith, J.D.

2006-01-01

Small-scale topographic features are commonly found on the boundaries of natural rivers, streams, and floodplains. A simple method for determining the form drag on these features is presented, and the results of this model are compared to laboratory measurements. The roughness elements are modeled as Gaussian-shaped features defined in terms of three parameters: a protrusion height, H; a streamwise length scale, ??; and a spacing between crests, ??. This shape is shown to be a good approximation to a wide variety of natural topographic bank features. The form drag on an individual roughness element embedded in a series of identical elements is determined using the drag coefficient of the individual element and a reference velocity that includes the effects of roughness elements further upstream. In addition to calculating the drag on each element, the model determines the spatially averaged total stress, skin friction stress, and roughness height of the boundary. The effects of bank roughness on patterns of velocity and boundary shear stress are determined by combining the form drag model with a channel flow model. The combined model shows that drag on small-scale topographic features substantially alters the near-bank flow field. These methods can be used to improve predictions of flow resistance in rivers and to form the basis for fully predictive (no empirically adjusted parameters) channel flow models. They also provide a foundation for calculating the near-bank boundary shear stress fields necessary for determining rates of sediment transport and lateral erosion.

Diurnal cycles control the fate of contaminants at an Andean river confluence impacted by legacy mining

NASA Astrophysics Data System (ADS)

Pasten, P.; Guerra, P. A.; Simonson, K.; Bonilla, C.; Pizarro, G. E.; Escauriaza, C. R.; González, C.

2014-12-01

The importance of hydrologic-geochemical interactions in arid environments is a controlling factor in quality and quantity of water available for human consumption and agriculture. When acid drainage affects these watersheds, water quality is gravely degraded. Despite its effect on watersheds, the relationship between time changes in hydrological variables and water quality in arid regions has not been studied thoroughly. Temporal variations in acid drainage can control when the transport of toxic elements is increased. We performed field work at the Azufre River (pH 2, E.C~10.9 mS/cm) and Caracarani River (pH 8.7, E.C~1.2 mS/cm) confluence, located in the Northern Chilean Altiplano (at 4000 m asl). We registered stream flowrates (total flowrate~430 L/s), temperature and electric conductivity (E.C) hourly using in-stream data loggers during one year. We also measured turbidity and pH during one field survey at different distances from the junction, as a proxy of the formation of iron-aluminum particles that cycle trace elements in these environments. We found turbidity-pH diurnal cycles were caused by upstream hourly changes in upstream flowrate: when the Caracarani River flowrate reached its daily peak, particle formation occurred, while the dissolution of particles occurred when the Azufre River reached its maximum value. This last process occurred due to upstream freeze-thaw cycles. This study shows how the dynamics of natural confluences determines chemical transport. The formation of particles enriched in toxic elements can promote settling as a natural attenuation process, while their dissolution will produce their release and transport long distances downstream. It is important to consider time as an important variable in water quality monitoring and in water management infrastructure where pulses of contamination can have potentially negative effects in its use. Acknowledgements: Funding was provided by "Proyecto Fondecyt 1130936" and "CONICYT/FONDAP 15110020".

Jovian Plasmas Torus Interaction with Europa. Plasma Wake Structure and Effect of Inductive Magnetic Field: 3D Hybrid Kinetic Simulation

NASA Technical Reports Server (NTRS)

Lipatov, A. S.; Cooper, J F.; Paterson, W. R.; Sittler, E. C., Jr.; Hartle, R. E.; Simpson, David G.

2013-01-01

The hybrid kinetic model supports comprehensive simulation of the interaction between different spatial and energetic elements of the Europa moon-magnetosphere system with respect to a variable upstream magnetic field and flux or density distributions of plasma and energetic ions, electrons, and neutral atoms. This capability is critical for improving the interpretation of the existing Europa flyby measurements from the Galileo Orbiter mission, and for planning flyby and orbital measurements (including the surface and atmospheric compositions) for future missions. The simulations are based on recent models of the atmosphere of Europa (Cassidy et al., 2007; Shematovich et al., 2005). In contrast to previous approaches with MHD simulations, the hybrid model allows us to fully take into account the finite gyroradius effect and electron pressure, and to correctly estimate the ion velocity distribution and the fluxes along the magnetic field (assuming an initial Maxwellian velocity distribution for upstream background ions). Photoionization, electron-impact ionization, charge exchange and collisions between the ions and neutrals are also included in our model. We consider the models with Oþ þ and Sþ þ background plasma, and various betas for background ions and electrons, and pickup electrons. The majority of O2 atmosphere is thermal with an extended non-thermal population (Cassidy et al., 2007). In this paper, we discuss two tasks: (1) the plasma wake structure dependence on the parameters of the upstream plasma and Europa's atmosphere (model I, cases (a) and (b) with a homogeneous Jovian magnetosphere field, an inductive magnetic dipole and high oceanic shell conductivity); and (2) estimation of the possible effect of an induced magnetic field arising from oceanic shell conductivity. This effect was estimated based on the difference between the observed and modeled magnetic fields (model II, case (c) with an inhomogeneous Jovian magnetosphere field, an inductive magnetic dipole and low oceanic shell conductivity).

Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

PubMed

Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

2002-04-24

The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

PubMed Central

Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

1990-01-01

We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

Acoustic wave propagation in heterogeneous structures including experimental validation

NASA Technical Reports Server (NTRS)

Baumeister, Kenneth J.; Dahl, Milo D.

1989-01-01

A finite element model was developed to solve for the acoustic pressure and energy fields in a heterogeneous suppressor. The derivations from the governing equations assumed that the material properties could vary with position resulting in a heterogeneous variable property two-dimensional wave equation. This eliminated the necessity of finding the boundary conditions between different materials. For a two-media region consisting of part air and part bulk absorber, a model was used to describe the bulk absorber properties in two directions. Complex metallic structures inside the air duct are simulated by simply changing element properties from air to the structural material in a pattern to describe the desired shapes. To verify the numerical theory, experiments were conducted without flow in a rectangular duct with a single folded cavity mounted above the duct and absorbing material mounted inside a cavity. Changes in a nearly plane wave sound field were measured on the wall opposite the absorbing cavity. Fairly good agreement was found in the standing wave pattern upstream of the absorber and in the decay of pressure level opposite the absorber, as a function of distance along the duct. The finite element model provides a convenient method for evaluating the acoustic properties of bulk absorbers.

Sedimentation, sediment quality, and upstream channel stability, John Redmond Reservoir, east-central Kansas, 1964-2009

USGS Publications Warehouse

Juracek, Kyle E.

2010-01-01

A combination of available bathymetric-survey information, bottom-sediment coring, and historical streamgage information was used to investigate sedimentation, sediment quality, and upstream channel stability for John Redmond Reservoir, east-central Kansas. Ongoing sedimentation is reducing the ability of the reservoir to serve several purposes including flood control, water supply, and recreation. The total estimated volume and mass of bottom sediment deposited between 1964 and 2009 in the conservation pool of the reservoir was 1.46 billion cubic feet and 55.8 billion pounds, respectively. The estimated sediment volume occupied about 41 percent of the conservation-pool, water-storage capacity of the reservoir. Water-storage capacity in the conservation pool has been lost to sedimentation at a rate of about 1 percent annually. Mean annual net sediment deposition since 1964 in the conservation pool of the reservoir was estimated to be 1.24 billion pounds per year. Mean annual net sediment yield from the reservoir basin was estimated to be 411,000 pounds per square mile per year Information from sediment cores shows that throughout the history of John Redmond Reservoir, total nitrogen concentrations in the deposited sediment generally were uniform indicating consistent nitrogen inputs to the reservoir. Total phosphorus concentrations in the deposited sediment were more variable than total nitrogen indicating the possibility of changing phosphorus inputs to the reservoir. As the principal limiting factor for primary production in most freshwater environments, phosphorus is of particular importance because increased inputs can contribute to accelerated reservoir eutrophication and the production of algal toxins and taste-and-odor compounds. The mean annual net loads of total nitrogen and total phosphorus deposited in the bottom sediment of the reservoir were estimated to be 2,350,000 pounds per year and 1,030,000 pounds per year, respectively. The estimated mean annual net yields of total nitrogen and total phosphorus from the reservoir basin were 779 pounds per square mile per year and 342 pounds per square mile per year, respectively. Trace element concentrations in the bottom sediment of John Redmond Reservoir generally were uniform over time. As is typical for eastern Kansas reservoirs, arsenic, chromium, and nickel concentrations typically exceeded the threshold-effects guidelines, which represent the concentrations above which toxic biological effects occasionally occur. Trace element concentrations did not exceed the probable-effects guidelines (available for eight trace elements), which represent the concentrations above which toxic biological effects usually or frequently occur. Organochlorine compounds either were not detected or were detected at concentrations that were less than the threshold-effects guidelines. Stream channel banks, compared to channel beds, likely are a more important source of sediment to John Redmond Reservoir from the upstream basin. Other sediment sources include surface-soil erosion in the basin and shoreline erosion in the reservoir.

3-D Hybrid Kinetic Modeling of the Interaction Between the Solar Wind and Lunar-like Exospheric Pickup Ions in Case of Oblique/ Quasi-Parallel/Parallel Upstream Magnetic Field

NASA Technical Reports Server (NTRS)

Lipatov, A. S.; Farrell, W. M.; Cooper, J. F.; Sittler, E. C., Jr.; Hartle, R. E.

2015-01-01

The interactions between the solar wind and Moon-sized objects are determined by a set of the solar wind parameters and plasma environment of the space objects. The orientation of upstream magnetic field is one of the key factors which determines the formation and structure of bow shock wave/Mach cone or Alfven wing near the obstacle. The study of effects of the direction of the upstream magnetic field on lunar-like plasma environment is the main subject of our investigation in this paper. Photoionization, electron-impact ionization and charge exchange are included in our hybrid model. The computational model includes the self-consistent dynamics of the light (hydrogen (+), helium (+)) and heavy (sodium (+)) pickup ions. The lunar interior is considered as a weakly conducting body. Our previous 2013 lunar work, as reported in this journal, found formation of a triple structure of the Mach cone near the Moon in the case of perpendicular upstream magnetic field. Further advances in modeling now reveal the presence of strong wave activity in the upstream solar wind and plasma wake in the cases of quasiparallel and parallel upstream magnetic fields. However, little wave activity is found for the opposite case with a perpendicular upstream magnetic field. The modeling does not show a formation of the Mach cone in the case of theta(Sub B,U) approximately equal to 0 degrees.

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

FLUSH - PREDICTION OF FLOW PARAMETERS OF SLUSH HYDROGEN

NASA Technical Reports Server (NTRS)

Hardy, T.

1994-01-01

Slush hydrogen, a mixture of the solid and liquid phases of hydrogen, is a possible source of fuel for the National Aerospace Plane (NASP) Project. Advantages of slush hydrogen over liquid hydrogen include greater heat capacity and greater density. However, practical use of slush hydrogen as a fuel requires systems of lines, valves, etc. which are designed to deliver the fuel in slush form with minimal solid loss as a result of pipe heating or flow friction. Engineers involved with the NASP Project developed FLUSH to calculate the pressure drop and slush hydrogen solid fraction loss for steady-state, one-dimensional flow. FLUSH solves the steady-state, one-dimensional energy equation and the Bernoulli equation for pipe flow. The program performs these calculations for each two-node element--straight pipe length, elbow, valve, fitting, or other part of the piping system--specified by the user. The user provides flow rate, upstream pressure, initial solid hydrogen fraction, element heat leak, and element parameters such as length and diameter. For each element, FLUSH first calculates the pressure drop, then figures the slush solid fraction exiting the element. The code employs GASPLUS routines to calculate thermodynamic properties for the slush hydrogen. FLUSH is written in FORTRAN IV for DEC VAX series computers running VMS. An executable is provided on the tape. The GASPLUS physical properties routines which are required for building the executable are included as one object library on the program media (full source code for GASPLUS is available separately as COSMIC Program Number LEW-15091). FLUSH is available in DEC VAX BACKUP format on a 9-track 1600 BPI magnetic tape (standard media) or on a TK50 tape cartridge. FLUSH was developed in 1989.

Recurrent emergence of structural variants of LTR retrotransposon CsRn1 evolving novel expression strategy and their selective expansion in a carcinogenic liver fluke, Clonorchis sinensis.

PubMed

Kim, Seon-Hee; Kong, Yoon; Bae, Young-An

2017-06-01

Autonomous retrotransposons, in which replication and transcription are coupled, encode the essential gag and pol genes as a fusion or separate overlapping form(s) that are expressed in single transcripts regulated by a common upstream promoter. The element-specific expression strategies have driven development of relevant translational recoding mechanisms including ribosomal frameshifting to satisfy the protein stoichiometry critical for the assembly of infectious virus-like particles. Retrotransposons with different recoding strategies exhibit a mosaic distribution pattern across the diverse families of reverse transcribing elements, even though their respective distributions are substantially skewed towards certain family groups. However, only a few investigations to date have focused on the emergence of retrotransposons evolving novel expression strategy and causal genetic drivers of the structural variants. In this study, the bulk of genomic and transcribed sequences of a Ty3/gypsy-like CsRn1 retrotransposon in Clonorchis sinensis were analyzed for the comprehensive examination of its expression strategy. Our results demonstrated that structural variants with single open reading frame (ORF) have recurrently emerged from precedential CsRn1 copies encoding overlapping gag-pol ORFs by a single-nucleotide insertion in an upstream region of gag stop codon. In the parasite genome, some of the newly evolved variants appeared to undergo proliferative burst as active master lineages together with their ancestral copies. The genetic event was similarly observed in Opisthorchis viverrini, the closest neighbor of C. sinensis, whereas the resulting structural variants might have failed to overcome purifying selection and comprised minor remnant copies in the Opisthorchis genome. Copyright © 2017 Elsevier B.V. All rights reserved.

Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

PubMed

Sweet, D H; Jang, Y K; Sancar, G B

1997-11-01

In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

PubMed Central

Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

1992-01-01

Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

System and method for reducing combustion dynamics and NO.sub.x in a combustor

DOEpatents

Uhm, Jong H.; Johnson, Thomas Edward

2015-11-20

A system for reducing combustion dynamics and NO.sub.x in a combustor includes a tube bundle that extends radially across at least a portion of the combustor, wherein the tube bundle comprises an upstream surface axially separated from a downstream surface. A shroud circumferentially surrounds the upstream and downstream surfaces. A plurality of tubes extends through the tube bundle from the upstream surface through the downstream surface, wherein the downstream surface is stepped to produce tubes having different lengths through the tube bundle. A method for reducing combustion dynamics and NO.sub.x in a combustor includes flowing a working fluid through a plurality of tubes radially arranged between an upstream surface and a downstream surface of an end cap that extends radially across at least a portion of the combustor, wherein the downstream surface is stepped.

Fuel injection assembly for use in turbine engines and method of assembling same

DOEpatents

Uhm, Jong Ho; Johnson, Thomas Edward

2015-03-24

A fuel injection assembly for use in a turbine engine is provided. The fuel injection assembly includes a plurality of tube assemblies, wherein each of the tube assemblies includes an upstream portion and a downstream portion. Each tube assembly includes a plurality of tubes that extend from the upstream portion to the downstream portion or from the upstream portion through the downstream portion. At least one injection system is coupled to at least one tube assembly of the plurality of tube assemblies. The injection system includes a fluid supply member that extends from a fluid source to the downstream portion of the tube assembly. The fluid supply member includes a first end portion located in the downstream portion of the tube assembly, wherein the first end portion has at least one first opening for channeling fluid through the tube assembly to facilitate reducing a temperature therein.

System for reducing combustion dynamics and NO.sub.x in a combustor

DOEpatents

Uhm, Jong Ho; Ziminsky, Willy Steve; Johnson, Thomas Edward; Hughes, Michael John; York, William David

2016-05-31

A combustor includes an end cap that extends radially across at least a portion of the combustor. The end cap includes an upstream surface axially separated from a downstream surface. A plurality of tubes extend from the upstream surface through the downstream surface of the end cap to provide fluid communication through the end cap. Each tube in a first set of the plurality of tubes has an inlet proximate to the upstream surface and an outlet downstream from the downstream surface. Each outlet has a first portion that extends a different axial distance from the inlet than a second portion.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Comparing Experiment and Computation of Hypersonic Laminar Boundary Layers with Isolated Roughness

NASA Technical Reports Server (NTRS)

Bathel, Brett F.; Iyer, Prahladh S.; Mahesh, Krishnan; Danehy, Paul M.; Inman, Jennifer A.; Jones, Stephen B.; Johansen, Craig T.

2014-01-01

Streamwise velocity profile behavior in a hypersonic laminar boundary layer in the presence of an isolated roughness element is presented for an edge Mach number of 8.2. Two different roughness element types are considered: a 2-mm tall, 4-mm diameter cylinder, and a 2-mm radius hemisphere. Measurements of the streamwise velocity behavior using nitric oxide (NO) planar laser-induced fluorescence (PLIF) molecular tagging velocimetry (MTV) have been performed on a 20-degree wedge model. The top surface of this model acts as a flat-plate and is oriented at 5 degrees with respect to the freestream flow. Computations using direct numerical simulation (DNS) of these flows have been performed and are compared to the measured velocity profiles. Particular attention is given to the characteristics of velocity profiles immediately upstream and downstream of the roughness elements. In these regions, the streamwise flow can experience strong deceleration or acceleration. An analysis in which experimentally measured MTV profile displacements are compared with DNS particle displacements is performed to determine if the assumption of constant velocity over the duration of the MTV measurement is valid. This assumption is typically made when reporting MTV-measured velocity profiles, and may result in significant errors when comparing MTV measurements to computations in regions with strong deceleration or acceleration. The DNS computations with the cylindrical roughness element presented in this paper were performed with and without air injection from a rectangular slot upstream of the cylinder. This was done to determine the extent to which gas seeding in the MTV measurements perturbs the boundary layer flowfield.

Promoter-proximal rDNA terminator augments initiation by preventing disruption of the stable transcription complex caused by polymerase read-in

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henderson, S.L.; Ryan, K.; Sollner-Webb, B.

1989-02-01

We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

PubMed Central

Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

2015-01-01

Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

PubMed

Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

2010-09-01

As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

Concentrations of mercury and other trace elements in walleye, smallmouth bass, and rainbow trout in Franklin D. Roosevelt Lake and the upper Columbia River, Washington, 1994

USGS Publications Warehouse

Munn, M.D.; Cox, S.E.; Dean, C.J.

1995-01-01

Three species of sportfish--walleye, smallmouth bass, and rainbow trout--were collected from Franklin D. Roosevelt Lake and the upstream reach of the Columbia River within the state of Washington, to determine the concentrations of mercury and other selected trace elements in fish tissue. Concentrations of total mercury in walleye fillets ranged from 0.11 to 0.44 milligram per kilogram, with the higher concentrations in the larger fish. Fillets of smallmouth bass and rainbow trout also contained mercury, but generally at lower concentrations. Other selected trace elements were found in fillet samples, but the concentrations were generally low depending on species and the specific trace element. The trace elements cadmium, copper, lead, and zinc were found in liver tissue of these same species with zinc consistently present in the highest concentration.

Functional Architecture of T7 RNA Polymerase Transcription Complexes

PubMed Central

Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

2007-01-01

Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica.

PubMed

Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M

2015-12-01

Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.

Molecular Regulatory Pathways Link Sepsis With Metabolic Syndrome: Non-coding RNA Elements Underlying the Sepsis/Metabolic Cross-Talk.

PubMed

Meydan, Chanan; Bekenstein, Uriya; Soreq, Hermona

2018-01-01

Sepsis and metabolic syndrome (MetS) are both inflammation-related entities with high impact for human health and the consequences of concussions. Both represent imbalanced parasympathetic/cholinergic response to insulting triggers and variably uncontrolled inflammation that indicates shared upstream regulators, including short microRNAs (miRs) and long non-coding RNAs (lncRNAs). These may cross talk across multiple systems, leading to complex molecular and clinical outcomes. Notably, biomedical and RNA-sequencing based analyses both highlight new links between the acquired and inherited pathogenic, cardiac and inflammatory traits of sepsis/MetS. Those include the HOTAIR and MIAT lncRNAs and their targets, such as miR-122, -150, -155, -182, -197, -375, -608 and HLA-DRA. Implicating non-coding RNA regulators in sepsis and MetS may delineate novel high-value biomarkers and targets for intervention.

Compound heterozygous deletions in pseudoautosomal region 1 in an infant with mild manifestations of langer mesomelic dysplasia.

PubMed

Tsuchiya, Takayoshi; Shibata, Minoru; Numabe, Hironao; Jinno, Tomoko; Nakabayashi, Kazuhiko; Nishimura, Gen; Nagai, Toshiro; Ogata, Tsutomu; Fukami, Maki

2014-02-01

Haploinsufficiency of SHOX on the short arm pseudoautosomal region (PAR1) leads to Leri-Weill dyschondrosteosis (LWD), and nullizygosity of SHOX results in Langer mesomelic dysplasia (LMD). Molecular defects of LWD/LMD include various microdeletions in PAR1 that involve exons and/or the putative upstream or downstream enhancer regions of SHOX, as well as several intragenic mutations. Here, we report on a Japanese male infant with mild manifestations of LMD and hitherto unreported microdeletions in PAR1. Clinical analysis revealed mesomelic short stature with various radiological findings indicative of LMD. Molecular analyses identified compound heterozygous deletions, that is, a maternally inherited ∼46 kb deletion involving the upstream region and exons 1-5 of SHOX, and a paternally inherited ∼500 kb deletion started from a position ∼300 kb downstream from SHOX. In silico analysis revealed that the downstream deletion did not affect the known putative enhancer regions of SHOX, although it encompassed several non-coding elements which were well conserved among various species with SHOX orthologs. These results provide the possibility of the presence of a novel enhancer for SHOX in the genomic region ∼300 to ∼800 kb downstream of the start codon. © 2013 Wiley Periodicals, Inc.

Metal loading in Soda Butte Creek upstream of Yellowstone National Park, Montana and Wyoming; a retrospective analysis of previous research; and quantification of metal loading, August 1999

USGS Publications Warehouse

Boughton, G.K.

2001-01-01

Acid drainage from historic mining activities has affected the water quality and aquatic biota of Soda Butte Creek upstream of Yellowstone National Park. Numerous investigations focusing on metals contamination have been conducted in the Soda Butte Creek basin, but interpretations of how metals contamination is currently impacting Soda Butte Creek differ greatly. A retrospective analysis of previous research on metal loading in Soda Butte Creek was completed to provide summaries of studies pertinent to metal loading in Soda Butte Creek and to identify data gaps warranting further investigation. Identification and quantification of the sources of metal loading to Soda Butte Creek was recognized as a significant data gap. The McLaren Mine tailings impoundment and mill site has long been identified as a source of metals but its contribution relative to the total metal load entering Yellowstone National Park was unknown. A tracer-injection and synoptic-sampling study was designed to determine metal loads upstream of Yellowstone National Park.A tracer-injection and synoptic-sampling study was conducted on an 8,511-meter reach of Soda Butte Creek from upstream of the McLaren Mine tailings impoundment and mill site downstream to the Yellowstone National Park boundary in August 1999. Synoptic-sampling sites were selected to divide the creek into discrete segments. A lithium bromide tracer was injected continuously into Soda Butte Creek for 24.5 hours. Downstream dilution of the tracer and current-meter measurements were used to calculate the stream discharge. Stream discharge values, combined with constituent concentrations obtained by synoptic sampling, were used to quantify constituent loading in each segment of Soda Butte Creek.Loads were calculated for dissolved calcium, silica, and sulfate, as well as for dissolved and total-recoverable iron, aluminum, and manganese. Loads were not calculated for cadmium, copper, lead, and zinc because these elements were infrequently detected in mainstem synoptic samples. All of these elements were detected at high concentrations in the seeps draining the McLaren Mine tailings impoundment. The lack of detection of these elements in the downstream mainstem synoptic samples is probably because of sorption (coprecipitation and adsorption) to metal colloids in the stream.Most of the metal load that entered Soda Butte Creek was contributed by the inflows draining the McLaren Mine tailings impoundment (between 505 meters and 760 meters downstream from the tracer-injection site), Republic Creek (1,859 meters), and Unnamed Tributary (8,267 meters). Results indicate that treatment or removal of the McLaren Mine tailings impoundment would greatly reduce metal loading in Soda Butte Creek upstream of Yellowstone National Park. However, removing only that single source may not reduce metal loads to acceptable levels. The sources of metal loading in Republic Creek and Unnamed Tributary merit further investigation.

RHIC Prefire Protection Masks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Drees, A.; Biscardi, C.; Curcio, T.

2015-01-07

The protection of the RHIC experimental detectors from damage due to beam hitting close upstream elements in cases of abort kicker prefires requires some dedicated precautionary measures with two general options: to bring the beam close to a limiting aperture (i.e. the beam pipe wall), as far upstream of the detector components as possible or, alternatively, to bring a limiting aperture close to the circulating beam. During the FY 2014 RHIC Heavy Ion run the first option was chosen because of the limited time available for preparation before the start of the run. For future runs the second option, inmore » this case the installation of dual-sided movable masks, is preferred. The installation of the masks, one per ring, is planned before the start of the FY 2015 run.« less

In-cell SHAPE uncovers dynamic interactions between the untranslated regions of the foot-and-mouth disease virus RNA.

PubMed

Diaz-Toledano, Rosa; Lozano, Gloria; Martinez-Salas, Encarnacion

2017-02-17

The genome of RNA viruses folds into 3D structures that include long-range RNA–RNA interactions relevant to control critical steps of the viral cycle. In particular, initiation of translation driven by the IRES element of foot-and-mouth disease virus is stimulated by the 3΄UTR. Here we sought to investigate the RNA local flexibility of the IRES element and the 3΄UTR in living cells. The SHAPE reactivity observed in vivo showed statistically significant differences compared to the free RNA, revealing protected or exposed positions within the IRES and the 3΄UTR. Importantly, the IRES local flexibility was modified in the presence of the 3΄UTR, showing significant protections at residues upstream from the functional start codon. Conversely, presence of the IRES element in cis altered the 3΄UTR local flexibility leading to an overall enhanced reactivity. Unlike the reactivity changes observed in the IRES element, the SHAPE differences of the 3΄UTR were large but not statistically significant, suggesting multiple dynamic RNA interactions. These results were supported by covariation analysis, which predicted IRES-3΄UTR conserved helices in agreement with the protections observed by SHAPE probing. Mutational analysis suggested that disruption of one of these interactions could be compensated by alternative base pairings, providing direct evidences for dynamic long-range interactions between these distant elements of the viral genome.

Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

PubMed Central

Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

2011-01-01

Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

1999-11-19

As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

Whole body-element composition of Atlantic salmon Salmo salar influenced by migration direction and life stage in three distinct populations.

PubMed

Ebel, J D; Leroux, S J; Robertson, M J; Dempson, J B

2016-11-01

Body-element content was measured for three life stages of wild Atlantic salmon Salmo salar from three distinct Newfoundland populations as individuals crossed between freshwater and marine ecosystems. Life stage explained most of the variation in observed body-element concentration whereas river of capture explained very little variation. Element composition of downstream migrating post-spawn adults (i.e. kelts) and juvenile smolts were similar and the composition of these two life stages strongly differed from adults migrating upstream to spawn. Low variation within life stages and across populations suggests that S. salar may exert rheostatic control of their body-element composition. Additionally, observed differences in trace element concentration between adults and other life stages were probably driven by the high carbon concentration in adults because abundant elements, such as carbon, can strongly influence the observed concentrations of less abundant elements. Thus, understanding variation among individuals in trace elements composition requires the measurement of more abundant elements. Changes in element concentration with ontogeny have important consequences the role of fishes in ecosystem nutrient cycling and should receive further attention. © 2016 The Fisheries Society of the British Isles.

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

Monolithic fuel injector and related manufacturing method

DOEpatents

Ziminsky, Willy Steve [Greenville, SC; Johnson, Thomas Edward [Greenville, SC; Lacy, Benjamin [Greenville, SC; York, William David [Greenville, SC; Stevenson, Christian Xavier [Greenville, SC

2012-05-22

A monolithic fuel injection head for a fuel nozzle includes a substantially hollow vesicle body formed with an upstream end face, a downstream end face and a peripheral wall extending therebetween, an internal baffle plate extending radially outwardly from a downstream end of the bore, terminating short of the peripheral wall, thereby defining upstream and downstream fuel plenums in the vesicle body, in fluid communication by way of a radial gap between the baffle plate and the peripheral wall. A plurality of integral pre-mix tubes extend axially through the upstream and downstream fuel plenums in the vesicle body and through the baffle plate, with at least one fuel injection hole extending between each of the pre-mix tubes and the upstream fuel plenum, thereby enabling fuel in the upstream plenum to be injected into the plurality of pre-mix tubes. The fuel injection head is formed by direct metal laser sintering.

Gas flow meter and method for measuring gas flow rate

DOEpatents

Robertson, Eric P.

2006-08-01

A gas flow rate meter includes an upstream line and two chambers having substantially equal, fixed volumes. An adjustable valve may direct the gas flow through the upstream line to either of the two chambers. A pressure monitoring device may be configured to prompt valve adjustments, directing the gas flow to an alternate chamber each time a pre-set pressure in the upstream line is reached. A method of measuring the gas flow rate measures the time required for the pressure in the upstream line to reach the pre-set pressure. The volume of the chamber and upstream line are known and fixed, thus the time required for the increase in pressure may be used to determine the flow rate of the gas. Another method of measuring the gas flow rate uses two pressure measurements of a fixed volume, taken at different times, to determine the flow rate of the gas.

Efficiency of plasma actuator ionization in shock wave modification in a rarefied supersonic flow over a flat plate

NASA Astrophysics Data System (ADS)

Joussot, Romain; Lago, Viviana; Parisse, Jean-Denis

2014-12-01

This paper describes experimental and numerical investigations focused on the shock wave modification, induced by a dc glow discharge, of a Mach 2 flow under rarefied regime. The model under investigation is a flat plate equipped with a plasma actuator composed of two electrodes. The glow discharge is generated by applying a negative potential to the upstream electrode, enabling the creation of a weakly ionized plasma. The natural flow (i.e. without the plasma) exhibits a thick laminar boundary layer and a shock wave with a hyperbolic shape. Images of the flow obtained with an ICCD camera revealed that the plasma discharge induces an increase in the shock wave angle. Thermal effects (volumetric, and at the surface) and plasma effects (ionization, and thermal non-equilibrium) are the most relevant processes explaining the observed modifications. The effect induced by the heating of the flat plate surface is studied experimentally by replacing the upstream electrode by a heating element, and numerically by modifying the thermal boundary condition of the model surface. The results show that for a similar temperature distribution over the plate surface, modifications induced by the heating element are lower than those produced by the plasma. This difference shows that other effects than purely thermal effects are involved with the plasma actuator. Measurements of the electron density with a Langmuir probe highlight the fact that the ionization degree plays an important role into the modification of the flow. The gas properties, especially the isentropic exponent, are indeed modified by the plasma above the actuator and upstream the flat plate. This leads to a local modification of the flow conditions, inducing an increase in the shock wave angle.

System for tuning a combustor of a gas turbine

DOEpatents

Hughes, Michael John

2016-12-27

A system for tuning a combustor of a gas turbine includes a flow sleeve having an annular main body. The main body includes an upstream end, a downstream end, an inner surface and an outer surface. A cooling channel extends along the inner surface of the main body. The cooling channel extends at least partially between the downstream end and the upstream end of the main body.

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

PubMed

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

PubMed Central

Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

2003-01-01

In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

PubMed

Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

2012-09-01

The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

Complete mitochondrial genome of Chocolate Pansy, Junonia iphita (Lepidoptera: Nymphalidae: Nymphalinae).

PubMed

Vanlalruati, Catherine; Mandal, Surajit De; Gurusubramanian, Guruswami; Senthil Kumar, Nachimuthu

2016-07-01

The complete mitochondrial genome of Junonia iphita was determined to be 15,433 bp in length, including 37 typical mitochondrial genes and an AT-rich region. All the protein coding genes (PCGs) are initiated by typical ATN codons, except cox1 gene that is by CGA codon. Eight genes use complete termination codon (TAA), whereas the cox1, cox2 and nad5 genes end with single T; nad4 and nad1 ends with stop codon TA. All the tRNA show secondary cloverleaf structures except trnS1 (AGN). The A + T rich region is 546 bp in length containing ATAGA motif followed by a 18 bp poly-T stretch, two microsatellite-like (TA)9 elements and 8 bp poly-A stretch immediately upstream of trnM gene.

Applications of numerical methods to simulate the movement of contaminants in groundwater.

PubMed Central

Sun, N Z

1989-01-01

This paper reviews mathematical models and numerical methods that have been extensively used to simulate the movement of contaminants through the subsurface. The major emphasis is placed on the numerical methods of advection-dominated transport problems and inverse problems. Several mathematical models that are commonly used in field problems are listed. A variety of numerical solutions for three-dimensional models are introduced, including the multiple cell balance method that can be considered a variation of the finite element method. The multiple cell balance method is easy to understand and convenient for solving field problems. When the advection transport dominates the dispersion transport, two kinds of numerical difficulties, overshoot and numerical dispersion, are always involved in solving standard, finite difference methods and finite element methods. To overcome these numerical difficulties, various numerical techniques are developed, such as upstream weighting methods and moving point methods. A complete review of these methods is given and we also mention the problems of parameter identification, reliability analysis, and optimal-experiment design that are absolutely necessary for constructing a practical model. PMID:2695327

Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence.

PubMed

Benko, Sabina; Fantes, Judy A; Amiel, Jeanne; Kleinjan, Dirk-Jan; Thomas, Sophie; Ramsay, Jacqueline; Jamshidi, Negar; Essafi, Abdelkader; Heaney, Simon; Gordon, Christopher T; McBride, David; Golzio, Christelle; Fisher, Malcolm; Perry, Paul; Abadie, Véronique; Ayuso, Carmen; Holder-Espinasse, Muriel; Kilpatrick, Nicky; Lees, Melissa M; Picard, Arnaud; Temple, I Karen; Thomas, Paul; Vazquez, Marie-Paule; Vekemans, Michel; Roest Crollius, Hugues; Hastie, Nicholas D; Munnich, Arnold; Etchevers, Heather C; Pelet, Anna; Farlie, Peter G; Fitzpatrick, David R; Lyonnet, Stanislas

2009-03-01

Pierre Robin sequence (PRS) is an important subgroup of cleft palate. We report several lines of evidence for the existence of a 17q24 locus underlying PRS, including linkage analysis results, a clustering of translocation breakpoints 1.06-1.23 Mb upstream of SOX9, and microdeletions both approximately 1.5 Mb centromeric and approximately 1.5 Mb telomeric of SOX9. We have also identified a heterozygous point mutation in an evolutionarily conserved region of DNA with in vitro and in vivo features of a developmental enhancer. This enhancer is centromeric to the breakpoint cluster and maps within one of the microdeletion regions. The mutation abrogates the in vitro enhancer function and alters binding of the transcription factor MSX1 as compared to the wild-type sequence. In the developing mouse mandible, the 3-Mb region bounded by the microdeletions shows a regionally specific chromatin decompaction in cells expressing Sox9. Some cases of PRS may thus result from developmental misexpression of SOX9 due to disruption of very-long-range cis-regulatory elements.

Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

PubMed

Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

2008-12-01

Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

PubMed

Schreiber, T; Tissier, A

2016-01-01

The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerr, J.M.; Fisher, L.W.; Termine, J.D.

The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

Treesearch

Tomas Johansson; Per Olof Nyman; Daniel Cullen

2002-01-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

Identification of hot spot area of sediment contamination in a lake system using texture characteristics.

PubMed

Sheela, A M; Letha, J; Joseph, Sabu; Thomas, Jobin

2013-04-01

Texture plays an important role in the identification of polluted stretch in a lake system. The organic matter as well as toxic elements get accumulated in the finer sediments. The aim of the work is to show the spatio-temporal distribution of texture of the lake sediment (Akkulam-Veli lake, Kerala) and to identify the hot spot areas of contamination. Hot spot areas vary with seasons. During PRM, (premonsoon), the upstream portion of the Akkulam lake is the hot spot. During MON (monsoon), the downstream portion of the Akkulam lake and the upstream portion of the Veli lake are the hot spots. During POM (postmonsoon), hot spot area is the downstream portion of the Akkulam lake. This methodology can be used for the quick identification of hot spots in water bodies.

Protecting LHC components against radiation resulting from an unsynchronized beam abort

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nikolai V. Mokhov et al.

2001-06-26

The effect of possible accidental beam loss in the LHC on the IP5 and IP6 insertion elements is studied via realistic Monte Carlo simulations. The scenario studied is beam loss due to unsynchronized abort at an accidental prefire of one of the abort kicker modules. Simulations show that this beam loss would result in severe heating of the IP5 and IP6 superconducting (SC) quadrupoles. Contrary to the previous considerations with a stationary set of collimators in IP5, collimators in IP6 close to the cause are proposed: a movable collimator upstream of the Q4 quadrupole and a stationary one upstream ofmore » the extraction septumMSD. The calculated temperature rise in the optimal set of collimators is quite acceptable. All SC magnets are protected by these collimators against damage.« less

51F earth observations

NASA Image and Video Library

2009-06-25

51F-37-014 (29 July-6 Aug 1985) --- This Earth view shows Oregon and Washington including metropolitan Portland at the center. The Columbia River can be seen from Goble (upper left) upstream to Bonneville (upper right). The Willamette River is at the lower photo and seen upstream to east of McMinnville.

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

Method of and apparatus for testing the integrity of filters

DOEpatents

Herman, R.L.

1985-05-07

A method of and apparatus are disclosed for testing the integrity of individual filters or filter stages of a multistage filtering system including a diffuser permanently mounted upstream and/or downstream of the filter stage to be tested for generating pressure differentials to create sufficient turbulence for uniformly dispersing trace agent particles within the airstream upstream and downstream of such filter stage. Samples of the particle concentration are taken upstream and downstream of the filter stage for comparison to determine the extent of particle leakage past the filter stage. 5 figs.

Method of and apparatus for testing the integrity of filters

DOEpatents

Herman, Raymond L [Richland, WA

1985-01-01

A method of and apparatus for testing the integrity of individual filters or filter stages of a multistage filtering system including a diffuser permanently mounted upstream and/or downstream of the filter stage to be tested for generating pressure differentials to create sufficient turbulence for uniformly dispersing trace agent particles within the airstream upstream and downstream of such filter stage. Samples of the particle concentration are taken upstream and downstream of the filter stage for comparison to determine the extent of particle leakage past the filter stage.

Methods of and apparatus for testing the integrity of filters

DOEpatents

Herman, R.L.

1984-01-01

A method of and apparatus for testing the integrity of individual filters or filter stages of a multistage filtering system including a diffuser permanently mounted upstream and/or downstream of the filter stage to be tested for generating pressure differentials to create sufficient turbulence for uniformly dispersing trace agent particles within the airstram upstream and downstream of such filter stage. Samples of the particel concentration are taken upstream and downstream of the filter stage for comparison to determine the extent of particle leakage past the filter stage.

Turbine-Driven Pipe-Cleaning Brush

NASA Technical Reports Server (NTRS)

Werlink, Rudy J.; Rowell, David E.

1994-01-01

Simple pipe-cleaning device includes small turbine wheel axially connected, by standoff, to circular brush. Turbine wheel turns on hub bearing attached to end of upstream cable. Turbine-and-brush assembly inserted in pipe with cable trailing upstream and brush facing downstream. Water or cleaning solution pumped through pipe. Cable held at upstream end, so it holds turbine and brush in pipe at location to be cleaned. Flow in pipe turns turbine, which turns wheel, producing desired cleaning action. In addition to brushing action, device provides even mixing of cleaning solution in pipe.

Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.

PubMed

Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C

2010-05-01

Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.

Assessment of sediments in the riverine impoundments of national wildlife refuges in the Souris River Basin, North Dakota

USGS Publications Warehouse

Tangen, Brian A.; Laubhan, Murray K.; Gleason, Robert A.

2014-01-01

Accelerated sedimentation of reservoirs and riverine impoundments is a major concern throughout the United States. Sediments not only fill impoundments and reduce their effective life span, but they can reduce water quality by increasing turbidity and introducing harmful chemical constituents such as heavy metals, toxic elements, and nutrients. U.S. Fish and Wildlife Service national wildlife refuges in the north-central part of the United States have documented high amounts of sediment accretion in some wetlands that could negatively affect important aquatic habitats for migratory birds and other wetland-dependent wildlife. Therefore, information pertaining to sediment accumulation in refuge impoundments potentially is important to guide conservation planning, including future management actions of individual impoundments. Lands comprising Des Lacs, Upper Souris, and J. Clark Salyer National Wildlife Refuges, collectively known as the Souris River Basin refuges, encompass reaches of the Des Lacs and Souris Rivers of northwestern North Dakota. The riverine impoundments of the Souris River Basin refuges are vulnerable to sedimentation because of the construction of in-stream dams that interrupt and slow river flows and because of post-European settlement land-use changes that have increased the potential for soil erosion and transport to rivers. Information regarding sediments does not exist for these refuges, and U.S. Fish and Wildlife Service personnel have expressed interest in assessing refuge impoundments to support refuge management decisions. Sediment cores and surface sediment samples were collected from impoundments within Des Lacs, Upper Souris, and J. Clark Salyer National Wildlife Refuges during 2004–05. Cores were used to estimate sediment accretion rates using radioisotope (cesium-137 [137Cs], lead-210 [210Pb]) dating techniques. Sediment cores and surface samples were analyzed for a suite of elements and agrichemicals, respectively. Examination of core characteristics along the depth profile suggests that there has been regular sediment mixing and removal, as well as non-uniform sediment deposition with time. Estimated mean accretion rates based on the three methods of determination (two time markers for 137Cs, 210Pb) ranged from 0.22–0.35 centimeters per year, and approximately 70 percent of cores had less 137Cs than expected. Concentrations of sediment-associated elements generally were within reported reference ranges, and all agrichemicals analyzed were below detection limits. Results suggest that there does not appear to be widespread sediment accumulation in impoundments of the Souris River Basin refuges. In addition, there were no identifiable patterns among sedimentation rates from the upstream (Des Lacs, Upper Souris) to the downstream (J. Clark Salyer) refuges. There were, however, apparent upstream to downstream patterns of increased concentrations of some elements (for example, aluminum, boron, and vanadium) that may warrant further exploration. Future related monitoring and research efforts should focus on areas with high potential for sediment accumulation, such as upstream areas adjacent to dams, to identify potential sediment problems before they become too severe. Further, assessments of suspended sediments transported in the Des Lacs and Souris Rivers would augment interpretation of sedimentation data by identifying potential sediment sources and areas with the greatest potential for accumulation.

Fast acting multiple element valve

DOEpatents

Yang, Jefferson Y. S.; Wada, James M.

1991-01-01

A plurality of slide valve elements having plural axial-spaced annular parts and an internal slide are inserted into a bulkhead in a fluid conduit from a downstream side of the bulkhead, locked in place by a bayonet coupling and set screw, and project through the bulkhead into the upstream conduit. Pneumatic lines connecting the slide valve element actuator to pilot valves are brought out the throat of the valve element to the downstream side. Pilot valves are radially spaced around the exterior of the valve to permit the pneumatic lines to be made identical, thereby to minimize adverse timing tolerances in operation due to pressure variations. Ring manifolds surround the valve adjacent respective pilot valve arrangements to further reduce adverse timing tolerances due to pressure variations, the manifolds being directly connected to the respective pilot valves. Position sensors are provided the valve element slides to signal the precise time at which a slide reaches or passes through a particular point in its stroke to initiate a calibrated timing function.

Method and apparatus for capturing carbon dioxide during combustion of carbon containing fuel

DOEpatents

Axelbaum, Richard L.; Kumfer, Benjamin M.; Xia, Fei; Gopan, Akshay; Dhungel, Bhupesh

2018-04-10

A boiler system having a series of boilers. Each boiler includes a shell having an upstream end, a downstream end, and a hollow interior. The boilers also have an oxidizer inlet entering the hollow interior adjacent the upstream end of the shell and a fuel nozzle positioned adjacent the upstream end of the shell for introducing fuel into the hollow interior of the shell. Each boiler includes a flue duct connected to the shell adjacent the downstream end for transporting flue gas from the hollow interior. Oxygen is delivered to the oxidizer inlet of the first boiler in the series. Flue gas from the immediately preceding boiler in the series is delivered through the oxidizer inlet of each boiler subsequent to the first boiler in the series.

A faith-based community partnership to address HIV/AIDS in the southern United States: implementation, challenges, and lessons learned.

PubMed

Abara, Winston; Coleman, Jason D; Fairchild, Amanda; Gaddist, Bambi; White, Jacob

2015-02-01

Though race and region are not by themselves risk factors for HIV infection, regional and racial disparities exist in the burden of HIV/AIDS in the US. Specifically, African Americans in the southern US appear to bear the brunt of this burden due to a complex set of upstream factors like structural and cultural influences that do not facilitate HIV/AIDS awareness, HIV testing, or sexual risk-reduction techniques while perpetuating HIV/AIDS-related stigma. Strategies proposed to mitigate the burden among this population have included establishing partnerships and collaborations with non-traditional entities like African American churches and other faith-based organizations. Though efforts to partner with the African American church are not necessarily novel, most of these efforts do not present a model that focuses on building the capacity of the African American church to address these upstream factors and sustain these interventions. This article will describe Project Fostering AIDS Initiatives That Heal (F.A.I.T.H), a faith-based model for successfully developing, implementing, and sustaining locally developed HIV/AIDS prevention interventions in African American churches in South Carolina. This was achieved by engaging the faith community and the provision of technical assistance, grant funding and training for project personnel. Elements of success, challenges, and lessons learned during this process will also be discussed.

Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castanera, Raul; Lopez-Varas, Leticia; Borgognone, Alessandra

Transposable elements (TEs) are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Classmore » I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My) ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation.« less

Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles

DOE PAGES

Castanera, Raul; Lopez-Varas, Leticia; Borgognone, Alessandra; ...

2016-06-13

Transposable elements (TEs) are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Classmore » I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My) ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation.« less

Disruption of the Abdominal-B Promoter Tethering Element Results in a Loss of Long-Range Enhancer-Directed Hox Gene Expression in Drosophila

PubMed Central

Ho, Margaret C. W.; Schiller, Benjamin J.; Akbari, Omar S.; Bae, Esther; Drewell, Robert A.

2011-01-01

There are many examples within gene complexes of transcriptional enhancers interacting with only a subset of target promoters. A number of molecular mechanisms including promoter competition, insulators and chromatin looping are thought to play a role in regulating these interactions. At the Drosophila bithorax complex (BX-C), the IAB5 enhancer specifically drives gene expression only from the Abdominal-B (Abd-B) promoter, even though the enhancer and promoter are 55 kb apart and are separated by at least three insulators. In previous studies, we discovered that a 255 bp cis-regulatory module, the promoter tethering element (PTE), located 5′ of the Abd-B transcriptional start site is able to tether IAB5 to the Abd-B promoter in transgenic embryo assays. In this study we examine the functional role of the PTE at the endogenous BX-C using transposon-mediated mutagenesis. Disruption of the PTE by P element insertion results in a loss of enhancer-directed Abd-B expression during embryonic development and a homeotic transformation of abdominal segments. A partial deletion of the PTE and neighboring upstream genomic sequences by imprecise excision of the P element also results in a similar loss of Abd-B expression in embryos. These results demonstrate that the PTE is an essential component of the regulatory network at the BX-C and is required in vivo to mediate specific long-range enhancer-promoter interactions. PMID:21283702

Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

Regulation of the grapevine polygalacturonase-inhibiting protein encoding gene: expression pattern, induction profile and promoter analysis.

PubMed

Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A

2013-03-01

Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.

Unmasking Upstream Gene Expression Regulators with miRNA-corrected mRNA Data

PubMed Central

Bollmann, Stephanie; Bu, Dengpan; Wang, Jiaqi; Bionaz, Massimo

2015-01-01

Expressed micro-RNA (miRNA) affects messenger RNA (mRNA) abundance, hindering the accuracy of upstream regulator analysis. Our objective was to provide an algorithm to correct such bias. Large mRNA and miRNA analyses were performed on RNA extracted from bovine liver and mammary tissue. Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%). Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%) and four levels of the magnitude of miRNA effect (ME) on mRNA expression (30%, 50%, 75%, and 83% mRNA reduction), we generated 17 different datasets (including the original dataset). For each dataset, we performed upstream regulator analysis using two bioinformatics tools. We detected an increased effect on the upstream regulator analysis with larger miRNA:mRNA pair bins and higher ME. The miRNA correction allowed identification of several upstream regulators not present in the analysis of the original dataset. Thus, the proposed algorithm improved the prediction of upstream regulators. PMID:27279737

Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

PubMed Central

Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

2014-01-01

The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

Water-quality trends for selected sampling sites in the upper Clark Fork Basin, Montana, water years 1996-2010

USGS Publications Warehouse

Sando, Steven K.; Vecchia, Aldo V.; Lorenz, David L.; Barnhart, Elliott P.

2014-01-01

A large-scale trend analysis was done on specific conductance, selected trace elements (arsenic, cadmium, copper, iron, lead, manganese, and zinc), and suspended-sediment data for 22 sites in the upper Clark Fork Basin for water years 1996–2010. Trend analysis was conducted by using two parametric methods: a time-series model (TSM) and multiple linear regression on time, streamflow, and season (MLR). Trend results for 1996–2010 indicate moderate to large decreases in flow-adjusted concentrations (FACs) and loads of copper (and other metallic elements) and suspended sediment in Silver Bow Creek upstream from Warm Springs. Deposition of metallic elements and suspended sediment within Warm Springs Ponds substantially reduces the downstream transport of those constituents. However, mobilization of copper and suspended sediment from floodplain tailings and stream banks in the Clark Fork reach from Galen to Deer Lodge is a large source of metallic elements and suspended sediment, which also affects downstream transport of those constituents. Copper and suspended-sediment loads mobilized from within this reach accounted for about 40 and 20 percent, respectively, of the loads for Clark Fork at Turah Bridge (site 20); whereas, streamflow contributed from within this reach only accounted for about 8 percent of the streamflow at Turah Bridge. Minor changes in FACs and loads of copper and suspended sediment are indicated for this reach during 1996–2010. Clark Fork reaches downstream from Deer Lodge are relatively smaller sources of metallic elements than the reach from Galen to Deer Lodge. In general, small decreases in loads and FACs of copper and suspended sediment are indicated for Clark Fork sites downstream from Deer Lodge during 1996–2010. Thus, although large decreases in FACs and loads of copper and suspended sediment are indicated for Silver Bow Creek upstream from Warm Springs, those large decreases are not translated to the more downstream reaches largely because of temporal stationarity in constituent transport relations in the Clark Fork reach from Galen to Deer Lodge. Unlike metallic elements, arsenic (a metalloid element) in streams in the upper Clark Fork Basin typically is mostly in dissolved phase, has less variability in concentrations, and has weaker direct relations with suspended-sediment concentrations and streamflow. Arsenic trend results for 1996–2010 indicate generally moderate decreases in FACs and loads in Silver Bow Creek upstream from Opportunity. In general, small temporal changes in loads and FACs of arsenic are indicated for Silver Bow Creek and Clark Fork reaches downstream from Opportunity during 1996–2010. Contribution of arsenic (from Warm Springs Ponds, the Mill-Willow bypass, and groundwater sources) in the Silver Bow Creek reach from Opportunity to Warm Springs is a relatively large source of arsenic. Arsenic loads originating from within this reach accounted for about 11 percent of the load for Clark Fork at Turah Bridge; whereas, streamflow contributed from within this reach only accounted for about 2 percent of the streamflow at Turah Bridge.

Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572.

PubMed

Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

2002-04-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO(4) to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology.

Differential Regulation of mnp2, a New Manganese Peroxidase-Encoding Gene from the Ligninolytic Fungus Trametes versicolor PRL 572

PubMed Central

Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

2002-01-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology. PMID:11916737

Hydrodynamic Influence Dabanhu River Bridge Holes Widening Based on Two-Dimensional Finite Element Numerical Model

NASA Astrophysics Data System (ADS)

Li, Dong Feng; Bai, Fu Qing; Nie, Hui

2018-06-01

In order to analyze the influence of bridge holes widening on hydrodynamic such as water level, a two-dimensional mathematical model was used to calculate the hydrodynamic factors, river network flow velocity vector distribution is given, water level and difference of bridge widening before and after is calculated and charted, water surface gradient in seven different river sections near the upper reaches of bridges is counted and revealed. The results of hydrodynamic calculation indicate that The Maximum and the minimum deducing numerical value of the water level after bridge widening is 0.028m, and 0.018m respective. the seven sections water surface gradient becomes smaller until it becomes negative, the influence of bridge widening on the upstream is basically over, the range of influence is about 450m from the bridge to the upstream. reach

Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

PubMed

Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

2015-01-01

We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

XX males SRY negative: a confirmed cause of infertility.

PubMed

Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

2011-10-01

SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

PubMed Central

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Generation of SNCA Cell Models Using Zinc Finger Nuclease (ZFN) Technology for Efficient High-Throughput Drug Screening.

PubMed

Dansithong, Warunee; Paul, Sharan; Scoles, Daniel R; Pulst, Stefan M; Huynh, Duong P

2015-01-01

Parkinson's disease (PD) is a progressive neurodegenerative disorder caused by loss of dopaminergic neurons of the substantia nigra. The hallmark of PD is the appearance of neuronal protein aggregations known as Lewy bodies and Lewy neurites, of which α-synuclein forms a major component. Familial PD is rare and is associated with missense mutations of the SNCA gene or increases in gene copy number resulting in SNCA overexpression. This suggests that lowering SNCA expression could be therapeutic for PD. Supporting this hypothesis, SNCA reduction was neuroprotective in cell line and rodent PD models. We developed novel cell lines expressing SNCA fused to the reporter genes luciferase (luc) or GFP with the objective to enable high-throughput compound screening (HTS) for small molecules that can lower SNCA expression. Because SNCA expression is likely regulated by far-upstream elements (including the NACP-REP1 located at 8852 bp upstream of the transcription site), we employed zinc finger nuclease (ZFN) genome editing to insert reporter genes in-frame downstream of the SNCA gene in order to retain native SNCA expression control. This ensured full retention of known and unknown up- and downstream genetic elements controlling SNCA expression. Treatment of cells with the histone deacetylase inhibitor valproic acid (VPA) resulted in significantly increased SNCA-luc and SNCA-GFP expression supporting the use of our cell lines for identifying small molecules altering complex modes of expression control. Cells expressing SNCA-luc treated with a luciferase inhibitor or SNCA siRNA resulted in Z'-scores ≥ 0.75, suggesting the suitability of these cell lines for use in HTS. This study presents a novel use of genome editing for the creation of cell lines expressing α-synuclein fusion constructs entirely under native expression control. These cell lines are well suited for HTS for compounds that lower SNCA expression directly or by acting at long-range sites to the SNCA promoter and 5'-UTR.

E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

PubMed

Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

2008-08-01

Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

PubMed Central

Robson, Nicole D.; Telesnitsky, Alice

2000-01-01

Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

Strategies for enhancing bioluminescent bacterial sensor performance by promoter region manipulation

PubMed Central

Bilic, Benny; Belkin, Shimshon

2010-01-01

Genetically engineered microbial reporter strains are based upon the fusion of an inducible sensing element upstream of a reporting element, so that the construct emits a dose-dependent signal when exposed to the inducing compound(s) or stress factor(s). In this communication1 we described several general approaches undertaken in order to enhance the sensing performance of such promoter::reporter fusions. Significant improvements in detection sensitivity, response kinetics and signal intensity were achieved by modi fication of the length of the promoter-containing DNA fragment, by random or site-directed mutagenesis and by promoter duplication. The general nature of these genetics manipulations makes them applicable to other types of promoter::reporter fusions. PMID:21326942

SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

PubMed Central

Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

2007-01-01

Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

Marine dispersal determines the genetic population structure of migratory stream fauna of Puerto Rico: evidence for island-scale population recovery processes

Treesearch

Benjamin D. Cook; Sofie Bernays; Catherine M. Pringle; Jane M. Hughes

2009-01-01

Various components of island stream faunas, including caridean shrimps, fish, and gastropods, undertake obligate amphidromous migration, whereby larvae are released in upstream freshwater reaches, drift downstream to estuaries or marine waters, then migrate upstream as postlarvae to freshwater adult habitats. Longitudinal migration from estuaries to headwaters is well...

Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

NASA Technical Reports Server (NTRS)

Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

2012-01-01

The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

OsSLI1, a homeodomain containing transcription activator, involves abscisic acid related stress response in rice (Oryza sativa L.).

PubMed

Huang, Xi; Duan, Min; Liao, Jiakai; Yuan, Xi; Chen, Hui; Feng, Jiejie; Huang, Ji; Zhang, Hong-Sheng

2014-01-01

Homeodomain-leucine zipper type I (HD-Zip I) proteins are involved in the regulation of plant development and response to environmental stresses. In this study, OsSLI1 (Oryza sativa stress largely induced 1), encoding a member of the HD-Zip I subfamily, was isolated from rice. The expression of OsSLI1 was dramatically induced by multiple abiotic stresses and exogenous abscisic acid (ABA). In silico sequence analysis discovered several cis-acting elements including multiple ABREs (ABA-responsive element binding factors) in the upstream promoter region of OsSLI1. The OsSLI1-GFP fusion protein was localized in the nucleus of rice protoplast cells and the transcriptional activity of OsSLI1 was confirmed by the yeast hybrid system. Further, it was found that OsSLI1 expression was enhanced in an ABI5-Like1 (ABL1) deficiency rice mutant abl1 under stress conditions, suggesting that ABL1 probably negatively regulates OsSLI1 gene expression. Moreover, it was found that OsSLI1 was regulated in panicle development. Taken together, OsSLI1 may be a transcriptional activator regulating stress-responsive gene expression and panicle development in rice.

Insulin signalling mechanisms for triacylglycerol storage.

PubMed

Czech, M P; Tencerova, M; Pedersen, D J; Aouadi, M

2013-05-01

Insulin signalling is uniquely required for storing energy as fat in humans. While de novo synthesis of fatty acids and triacylglycerol occurs mostly in liver, adipose tissue is the primary site for triacylglycerol storage. Insulin signalling mechanisms in adipose tissue that stimulate hydrolysis of circulating triacylglycerol, uptake of the released fatty acids and their conversion to triacylglycerol are poorly understood. New findings include (1) activation of DNA-dependent protein kinase to stimulate upstream stimulatory factor (USF)1/USF2 heterodimers, enhancing the lipogenic transcription factor sterol regulatory element binding protein 1c (SREBP1c); (2) stimulation of fatty acid synthase through AMP kinase modulation; (3) mobilisation of lipid droplet proteins to promote retention of triacylglycerol; and (4) upregulation of a novel carbohydrate response element binding protein β isoform that potently stimulates transcription of lipogenic enzymes. Additionally, insulin signalling through mammalian target of rapamycin to activate transcription and processing of SREBP1c described in liver may apply to adipose tissue. Paradoxically, insulin resistance in obesity and type 2 diabetes is associated with increased triacylglycerol synthesis in liver, while it is decreased in adipose tissue. This and other mysteries about insulin signalling and insulin resistance in adipose tissue make this topic especially fertile for future research.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com

Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less

Water Stress in Global Transboundary River Basins: Significance of Upstream Water Use on Downstream Stress

NASA Technical Reports Server (NTRS)

Munia, H.; Guillaume, J. H. A.; Mirumachi, N.; Porkka,M.; Wada, Yoshihide; Kummu, M.

2016-01-01

Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analyzed in many of these international river basins, this has not been systematically done at the global scale using coherent and comparable datasets. In this study, we aim to assess the change in downstream water stress due to upstream water use in the world's transboundary river basins. Water stress was first calculated considering only local water use of each sub-basin based on country-basin mesh, then compared with the situation when upstream water use was subtracted from downstream water availability. Wefound that water stress was generally already high when considering only local water use, affecting 0.95-1.44 billion people or 33%-51% of the population in transboundary river basins. After accounting for upstream water use, stress level increased by at least 1 percentage-point for 30-65 sub-basins, affecting 0.29-1.13 billion people. Altogether 288 out of 298 middle-stream and downstream sub-basin areas experienced some change in stress level. Further, we assessed whether there is a link between increased water stress due to upstream water use and the number of conflictive and cooperative events in the transboundary river basins, as captured by two prominent databases. No direct relationship was found. This supports the argument that conflicts and cooperation events originate from a combination of different drivers, among which upstream-induced water stress may play a role. Our findings contribute to better understanding of upstream-downstream dynamics in water stress to help address water allocation problems.

HSI2/VAL1 Silences AGL15 to Regulate the Developmental Transition from Seed Maturation to Vegetative Growth in Arabidopsis[OPEN

PubMed Central

Abdelmageed, Haggag; Kang, Miyoung

2018-01-01

Gene expression during seed development in Arabidopsis thaliana is controlled by transcription factors including LEAFY COTYLEDON1 (LEC1) and LEC2, ABA INSENSITIVE3 (ABI3), FUSCA3 (FUS3), known as LAFL proteins, and AGAMOUS-LIKE15 (AGL15). The transition from seed maturation to germination and seedling growth requires the transcriptional silencing of these seed maturation-specific factors leading to downregulation of structural genes including those that encode seed storage proteins, oleosins, and dehydrins. During seed germination and vegetative growth, B3-domain protein HSI2/VAL1 is required for the transcriptional silencing of LAFL genes. Here, we report chromatin immunoprecipitation analysis indicating that HSI2/VAL1 binds to the upstream sequences of the AGL15 gene but not at LEC1, ABI3, FUS3, or LEC2 loci. Functional analysis indicates that the HSI2/VAL1 B3 domain interacts with two RY elements upstream of the AGL15 coding region and at least one of them is required for HSI2/VAL1-dependent AGL15 repression. Expression analysis of the major seed maturation regulatory genes LEC1, ABI3, FUS3, and LEC2 in different genetic backgrounds demonstrates that HSI2/VAL1 is epistatic to AGL15 and represses the seed maturation regulatory program through downregulation of AGL15 by deposition of H3K27me3 at this locus. This hypothesis is further supported by results that show that HSI2/VAL1 physically interacts with the Polycomb Repressive Complex 2 component protein MSI1, which is also enriched at the AGL15 locus. PMID:29475938

Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

PubMed

Yoshino, M; Tsutsumi, K; Kanazawa, A

2015-01-01

β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Cooling system having dual suction port compressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Guolian

2017-08-29

A cooling system for appliances, air conditioners, and other spaces includes a compressor, and a condenser that receives refrigerant from the compressor. The system also includes an evaporator that receives refrigerant from the condenser. Refrigerant received from the condenser flows through an upstream portion of the evaporator. A first portion of the refrigerant flows to the compressor without passing through a downstream portion of the evaporator, and a second portion of the refrigerant from the upstream portion of the condenser flows through the downstream portion of the evaporator after passing through the upstream portion of the evaporator. The second portionmore » of the refrigerant flows to the compressor after passing through the downstream portion of the evaporator. The refrigeration system may be configured to cool an appliance such as a refrigerator and/or freezer, or it may be utilized in air conditioners for buildings, motor vehicles, or other such spaces.« less

Refrigeration system having dual suction port compressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Guolian

A cooling system for appliances, air conditioners, and other spaces includes a compressor, and a condenser that receives refrigerant from the compressor. The system also includes an evaporator that receives refrigerant from the condenser. Refrigerant received from the condenser flows through an upstream portion of the evaporator. A first portion of the refrigerant flows to the compressor without passing through a downstream portion of the evaporator, and a second portion of the refrigerant from the upstream portion of the condenser flows through the downstream portion of the evaporator after passing through the upstream portion of the evaporator. The second portionmore » of the refrigerant flows to the compressor after passing through the downstream portion of the evaporator. The refrigeration system may be configured to cool an appliance such as a refrigerator and/or freezer, or it may be utilized in air conditioners for buildings, motor vehicles, or other such spaces.« less

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Big Spring spinedace and associated fish populations and habitat conditions in Condor Canyon, Meadow Valley Wash, Nevada

USGS Publications Warehouse

Jezorek, Ian G.; Connolly, Patrick J.; Munz, Carrie S.; Dixon, Chris

2011-01-01

Executive Summary: This project was designed to document habitat conditions and populations of native and non-native fish within the 8-kilometer Condor Canyon section of Meadow Valley Wash, Nevada, with an emphasis on Big Spring spinedace (Lepidomeda mollispinis pratensis). Other native fish present were speckled dace (Rhinichthys osculus) and desert sucker (Catostomus clarki). Big Spring spinedace were known to exist only within this drainage and were known to have been extirpated from a portion of their former habitat located downstream of Condor Canyon. Because of this extirpation and the limited distribution of Big Spring spinedace, the U.S. Fish and Wildlife Service listed this species as threatened under the Endangered Species Act in 1985. Prior to our effort, little was known about Big Spring spinedace populations or life histories and habitat associations. In 2008, personnel from the U.S. Geological Survey's Columbia River Research Laboratory began surveys of Meadow Valley Wash in Condor Canyon. Habitat surveys characterized numerous variables within 13 reaches, thermologgers were deployed at 9 locations to record water temperatures, and fish populations were surveyed at 22 individual sites. Additionally, fish were tagged with Passive Integrated Transponder (PIT) tags, which allowed movement and growth information to be collected on individual fish. The movements of tagged fish were monitored with a combination of recapture events and stationary in-stream antennas, which detected tagged fish. Meadow Valley Wash within Condor Canyon was divided by a 12-meter (m) waterfall known as Delmue Falls. About 6,100 m of stream were surveyed downstream of the falls and about 2,200 m of stream were surveyed upstream of the falls. Although about three-quarters of the surveyed stream length was downstream of Delmue Falls, the highest densities and abundance of native fish were upstream of the falls. Big Spring spinedace and desert sucker populations were highest near the upper end of Condor Canyon, where a tributary known as Kill Wash, and several springs, contribute flow and moderate high and low water temperature. Kill Wash and the area around its confluence with Meadow Valley Wash appeared important for spawning of all three native species. Detections of PIT-tagged fish indicated that there were substantial movements to this area during the spring. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. A population of non-native rainbow trout (Oncorhynchus mykiss) was found within the 2,000 m of stream immediately downstream of Delmue Falls. Non-native crayfish were very common both upstream and downstream of Delmue Falls. We were not able to quantify crayfish populations, but they compose a significant portion of the biomass of aquatic species in Condor Canyon. There were some distinctive habitat features that may have favored native fish upstream of Delmue Falls. Upstream of the falls, water temperatures were moderated by inputs from springs, turbidity was lower, pool habitat was more prevalent, substrate heterogeneity was higher, and there was less fine sediment than

The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

PubMed Central

Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

1997-01-01

The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

Flow conditioner for fuel injector for combustor and method for low-NO.sub.x combustor

DOEpatents

Dutta, Partha; Smith, Kenneth O.; Ritz, Frank J.

2013-09-10

An injector for a gas turbine combustor including a catalyst coated surface forming a passage for feed gas flow and a channel for oxidant gas flow establishing an axial gas flow through a flow conditioner disposed at least partially within an inner wall of the injector. The flow conditioner includes a length with an interior passage opening into upstream and downstream ends for passage of the axial gas flow. An interior diameter of the interior passage smoothly reduces and then increases from upstream to downstream ends.

A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

PubMed

Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

1995-01-01

Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

PubMed

Fleckenstein, E C; Dirks, W G; Drexler, H G

2000-02-01

The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping

PubMed Central

Schörg, Alexandra; Santambrogio, Sara; Platt, James L.; Schödel, Johannes; Lindenmeyer, Maja T.; Cohen, Clemens D.; Schrödter, Katrin; Mole, David R.; Wenger, Roland H.; Hoogewijs, David

2015-01-01

A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the −82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the −82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the −82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. PMID:26007655

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait.

PubMed

Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi

2014-08-01

Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.

Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

PubMed

Kageyama, R; Merlino, G T; Pastan, I

1989-09-15

Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

Xylem specific activation of 5' upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

PubMed Central

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

Dissolved Strontium and Barium in Fresh and Saltwater: a 2-year Study in the Calcasieu River to the Gulf of Mexico

NASA Astrophysics Data System (ADS)

He, S.; Xu, Y. J.

2016-02-01

Strontium and barium to calcium ratios are often used as proxies for tracking animal movement across salinity gradients. As sea level rise continues, many estuarine rivers face saltwater intrusion, which may cause changes in mobility and distribution of these metals upstream. Despite intensive research on metal adsorption and desorption in marine systems, knowledge of the spatiotemporal distribution of these elements along estuarine rivers is still limited. In this study, we conducted an intensive monitoring of Sr and Ba dynamics along an 88-km long estuary, the Calcasieu River, which has been strongly affected by saltwater intrusion. Over the period from May 2013 to July 2015, we collected monthly water samples and performed in-situ water quality measurements at six sites from the upstream to the river mouth. Water samples were analyzed for dissolved Sr, Ba, and Ca concentrations. In-situ measurements of salinity, pH, water temperature, dissolved oxygen concentration, and specific conductance were taken. Our preliminary data showed that the Sr and Ca concentrations and the Sr/Ca ratio all increased significantly with decreasing distance to the Gulf of Mexico, while the Ba/Ca ratio decreased with decreasing distance to the Gulf. The spatial variation in Ba concentration was marginal. The Sr and Ca concentrations and ratios were positively related to salinity, while Ba/Ca was negatively related to salinity. All the elemental concentrations and ratios had considerable seasonal and interannual variations. There were significant differences among sampling months for all the elemental concentrations and ratios (p<0.05), and there were significant differences among sampling years for the Sr and Ca concentrations and the Ba/Ca ratio (p<0.05).

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

PubMed

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Geochemistry of the suspended sediment in the estuaries of the Mandovi and Zuari rivers, central west coast of India.

PubMed

Kessarkar, Pratima M; Shynu, R; Rao, V Purnachandra; Chong, Feng; Narvekar, Tanuja; Zhang, Jing

2013-05-01

The geochemistry of the suspended particulate matter (SPM) collected during the monsoon was determined to identify the sources of SPM and to understand the physicochemical processes in the Mandovi and Zuari river estuaries. The concentrations of SPM decrease seaward in both estuaries, but are relatively high at bay stations. Kaolinite is the most dominant clay mineral in the upstream of both rivers. Smectite increases seaward in both estuaries and is abundant in the bay. Upstream stations of Mandovi, where ore deposits are stored on the shore, exhibit high Fe, Mn, total rare earth elements (∑REE), and middle REE- and heavy REE-enriched patterns. Channel stations of both estuaries exhibit middle REE- and light REE-enriched patterns, which gradually changed seaward to middle REE- and heavy REE-enriched patterns. Canal stations exhibit the highest concentrations of major and trace metals. High metal/Al ratios occur at stations in the upstream of Zuari and at the confluence of canals in the Mandovi estuary. Enrichment factors of metals indicate that Mn is significantly polluted while other metals are moderately polluted. The δ(13)C and δ(15)N of organic matter indicate that the terrigenous organic matter at the upstream is diluted seaward by marine organic matter. Organic matter at bay stations is largely marine and altered-type. The compositions of SPM are controlled by the particulates from ore dust, the geology of the drainage basins, and the physicochemical processes in the estuaries. Particulates resuspended from the bay are dominated by ore dust, which are advected into the channels of both estuaries during the lull periods of the monsoon.

Reconnaissance investigation of water quality, bottom sediment, and biota associated with irrigation drainage in and near Humboldt Wildlife Management Area, Churchill and Pershing Counties, Nevada, 1990-91

USGS Publications Warehouse

Seiler, R.L.; Ekechukwu, G.A.; Hallock, R.J.

1993-01-01

A reconnaissance investigation was begun in 1990 to determine whether the quality of irrigation drainage in and near the Humboldt Wildlife Management Area, Nevada, has caused or has the potential to cause harmful effects on human health, fish, and wildlife or to impair beneficial uses of water. Samples of surface and ground water, bottom sediment, and biota collected from sites upstream and downstream from the Lovelock agricultural area were analyzed for potentially toxic trace elements. Also analyzed were radioactive substances, major dissolved constitu- ents, and nutrients in water, as well as pesticide residues in bottom sediment and biota. In samples from areas affected by irrigation drainage, the following constituents equaled or exceeded baseline concentrations or recommended standards for protection of aquatic life or propagation of wildlife--in water: arsenic, boron, dissolved solids, mercury, molybdenum, selenium, sodium, and un-ionized ammonia; in bottom sediment; arsenic and uranium; and in biota; arsenic, boron, and selenium. Selenium appears to be biomagnified in the Humboldt Sink wetlands. Biological effects observed during the reconnaissance included reduced insect diversity in sites receiving irrigation drainage and acute toxicity of drain water and sediment to test organisms. The current drought and upstream consumption of water for irrigation have reduced water deliveries to the wetlands and caused habitat degradation at Humboldt Wildlife Management Area. During this investigation. Humboldt and Toulon Lakes evaporated to dryness because of the reduced water deliveries.

Estimated sediment thickness, quality, and toxicity to benthic organisms in selected impoundments in Massachusetts

USGS Publications Warehouse

Breault, Robert F.; Sorenson, Jason R.; Weiskel, Peter K.

2013-01-01

The U.S. Geological Survey and the Massachusetts Department of Fish and Game, Division of Ecological Restoration, collaborated to collect baseline information on the quantity and quality of sediment impounded behind selected dams in Massachusetts, including sediment thickness and the occurrence of contaminants potentially toxic to benthic organisms. The thicknesses of impounded sediments were measured, and cores of sediment were collected from 32 impoundments in 2004 and 2005. Cores were chemically analyzed, and concentrations of 32 inorganic elements and 108 organic compounds were quantified. Sediment thicknesses varied considerably among the 32 impoundments, with an average thickness of 3.7 feet. Estimated volumes also varied greatly, ranging from 100,000 cubic feet to 81 million cubic feet. Concentrations of toxic contaminants as well as the number of contaminants detected above analytical quantification levels (also known as laboratory reporting levels) varied greatly among sampling locations. Based on measured contaminant concentrations and comparison to published screening thresholds, bottom sediments were predicted to be toxic to bottom-dwelling (benthic) organisms in slightly under 30 percent of the impoundments sampled. Statistically significant relations were found between several of the contaminants and individual indicators of urban land use and industrial activity in the upstream drainage areas of the impoundments. However, models developed to estimate contaminant concentrations at unsampled sites from upstream landscape characteristics had low predictive power, consistent with the long and complex land-use history that is typical of many drainage areas in Massachusetts.

Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkhardt E.; Adham, I.M.; Brosig, B.

1994-03-01

Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

PubMed

DeVry, C G; Tsai, W; Clarke, S

1996-11-15

The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

Moving Upstream in U.S. Hospital Care Toward Investments in Population Health.

PubMed

Begun, James W; Potthoff, Sandra

The root causes for most health outcomes are often collectively referred to as the social determinants of health. Hospitals and health systems now must decide how much to "move upstream," or invest in programs that directly affect the social determinants of health. Moving upstream in healthcare delivery requires an acceptance of responsibility for the health of populations. We examine responses of 950 nonfederal, general hospitals in the United States to the 2015 American Hospital Association Population Health Survey to identify characteristics that distinguish those hospitals that are most aligned with population health and most engaged in addressing social determinants of health. Those "upstream" hospitals are significantly more likely to be large, not-for-profit, metropolitan, teaching-affiliated, and members of systems. Internally, the more upstream hospitals are more likely to organize their population health activities with strong executive-level involvement, full-time-equivalent support, and coordination at the system level.The characteristics differentiating hospitals strongly involved in population health and upstream activity are not unlike those characteristics associated with diffusion of many innovations in hospitals. These hospitals may be the early adopters in a diffusion process that will eventually include most hospitals or, at least, most not-for-profit hospitals. Alternatively, the population health and social determinants movements could be transient or could be limited to a small portion of hospitals such as those identified here, with distinctive patient populations, missions, and resources.

EMMPRIN, an upstream regulator of MMPs, in CNS biology.

PubMed

Kaushik, Deepak Kumar; Hahn, Jennifer Nancy; Yong, V Wee

2015-01-01

Matrix metalloproteinases (MMPs) are engaged in pathologies associated with infections, tumors, autoimmune disorders and neurological dysfunctions. With the identification of an upstream regulator of MMPs, EMMPRIN (Extracellular matrix metalloproteinase inducer, CD147), it is relevant to address if EMMPRIN plays a role in the pathology of central nervous system (CNS) diseases. This would enable the possibility of a more upstream and effective therapeutic target. Indeed, conditions including gliomas, Alzheimer's disease (AD), multiple sclerosis (MS), and other insults such as hypoxia/ischemia show elevated levels of EMMPRIN which correlate with MMP production. In contrast, given EMMPRIN's role in CNS homeostasis with respect to regulation of monocarboxylate transporters (MCTs) and interactions with adhesion molecules including integrins, we need to consider that EMMPRIN may also serve important regulatory or protective functions. This review summarizes the current understanding of EMMPRIN's involvement in CNS homeostasis, its possible roles in escalating or reducing neural injury, and the mechanisms of EMMPRIN including and apart from MMP induction. Copyright © 2015 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

Investigation of the Impact of the Upstream Induction Zone on LIDAR Measurement Accuracy for Wind Turbine Control Applications using Large-Eddy Simulation

NASA Astrophysics Data System (ADS)

Simley, Eric; Y Pao, Lucy; Gebraad, Pieter; Churchfield, Matthew

2014-06-01

Several sources of error exist in lidar measurements for feedforward control of wind turbines including the ability to detect only radial velocities, spatial averaging, and wind evolution. This paper investigates another potential source of error: the upstream induction zone. The induction zone can directly affect lidar measurements and presents an opportunity for further decorrelation between upstream wind and the wind that interacts with the rotor. The impact of the induction zone is investigated using the combined CFD and aeroelastic code SOWFA. Lidar measurements are simulated upstream of a 5 MW turbine rotor and the true wind disturbances are found using a wind speed estimator and turbine outputs. Lidar performance in the absence of an induction zone is determined by simulating lidar measurements and the turbine response using the aeroelastic code FAST with wind inputs taken far upstream of the original turbine location in the SOWFA wind field. Results indicate that while measurement quality strongly depends on the amount of wind evolution, the induction zone has little effect. However, the optimal lidar preview distance and circular scan radius change slightly due to the presence of the induction zone.

Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

USGS Publications Warehouse

Juracek, Kyle E.

2011-01-01

Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 691,000 pounds per square mile per year. In general, no pronounced changes in channel width were evident at six streamgage sites located upstream from the reservoir. At the Barnes and Marysville streamgage sites, located upstream from the reservoir, long-term channel-bed degradation followed by stability was indicated. At the Frankfort streamgage site, located upstream from the reservoir, channel-bed aggradation of 1.65 feet from 1969 to 1989 followed by channel-bed degradation of 2.4 feet from 1989 to 2010 was indicated and may represent the passage of a sediment pulse caused by historical disturbances (for example, channelization) in the upstream basin. With the exception of the Frankfort streamgage site, current (2010) conditions at four streamgages located upstream from the reservoir were typified by channel-bed stability. At the Manhattan streamgage site, located downstream from the reservoir, high-flow releases associated with the 1993 flood widened the channel about 60 feet (30 percent). The channel bed at this site degraded 4.2 feet from 1960 to 1998 and since has been relatively stable. For the purpose of computing suspended-sediment concentration and load, the use of turbidity data in a regression model can provide more reliable and reproducible estimates than a regression model that uses discharge as the sole independent variable. Moreover, the use of discharge only to compute suspended-sediment concentration and load may result in overprediction. Stream channel banks, compared to channel beds, likely are a more important source of sediment to Kanopolis and Tuttle Creek Lakes from the upstream basins. Other sediment sources include surface-soil erosion in the basins and shoreline erosion in the reservoirs.

Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity[S

PubMed Central

Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C.; MacPherson, Laura; Ruan, Hai-Bin; Wu, Jing; Pedersen, Thomas Å.; Steffensen, Knut R.; Yang, Xiaoyong; Matthews, Jason; Mandrup, Susanne; Nebb, Hilde I.; Grønning-Wang, Line M.

2015-01-01

Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β+/+ and LXRα/β−/− mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose metabolic sensors upstream of ChREBP by modulating GK expression, nuclear O-GlcNAc signaling, and ChREBP expression and activity. PMID:25724563

System and method for reducing combustion dynamics in a combustor

DOEpatents

Uhm, Jong Ho; Ziminsky, Willy Steve; Johnson, Thomas Edward; Srinivasan, Shiva; York, William David

2016-11-29

A system for reducing combustion dynamics in a combustor includes an end cap that extends radially across the combustor and includes an upstream surface axially separated from a downstream surface. A combustion chamber is downstream of the end cap, and tubes extend from the upstream surface through the downstream surface. Each tube provides fluid communication through the end cap to the combustion chamber. The system further includes means for reducing combustion dynamics in the combustor. A method for reducing combustion dynamics in a combustor includes flowing a working fluid through tubes that extend axially through an end cap that extends radially across the combustor and obstructing at least a portion of the working fluid flowing through a first set of the tubes.

The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

PubMed Central

Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

1989-01-01

Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene. Images PMID:2602141

The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

PubMed

Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

1989-12-11

Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene.

Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

PubMed

Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

2017-03-01

To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

Occurrence and concentrations of selected trace elements and halogenated organic compounds in stream sediments and potential sources of polychlorinated biphenyls, Leon Creek, San Antonio, Texas, 2012–14

USGS Publications Warehouse

Wilson, Jennifer T.

2016-06-23

Sediment samples collected from Leon Creek by the USGS during 2007–9 and 2012–14 at a total of eight sites following identical field and laboratory methods were evaluated to determine if potential PCB sources could be identified. Total PCB concentrations in the sediment samples collected upstream from the Joint Base site were low or nondetections; while concentrations in the samples collected on and downstream from the Joint Base site were greater. Congeners 180 and 138 constituted the greatest proportion of the PCB mixture in samples collected upstream from, on, and downstream from the Joint Base site. Upstream from the Joint Base site, congeners 180 and 138 constituted 50 percent and 35 percent respectively of the PCBs congeners found in the samples. On and downstream from the Joint Base site, congeners 180 and 138 constituted 80 percent and 13 percent respectively of the PCBs congeners found in the samples. Chi-square (C2) tests also indicate that samples collected from the Loop 410 site were statistically different from samples collected from the Joint Base site and sites downstream. The PCB congener pattern in the Leon Creek samples is most like the congener mixture in Aroclor 1260, which is chemically similar to the PCBs detected in the fish samples that resulted in the 2003 fish consumption advisory.

Analysis of an existing experiment on the interaction of acoustic waves with a laminar boundary layer

NASA Technical Reports Server (NTRS)

Schopper, M. R.

1982-01-01

The hot-wire anemometer amplitude data contained in the 1977 report of P. J. Shapiro entitled, ""The Influence of Sound Upon Laminar Boundary'' were reevaluated. Because the low-Reynolds number boundary layer disturbance data were misinterpreted, an effort was made to improve the corresponding disturbance growth rate curves. The data are modeled as the sum of upstream and downstream propagating acoustic waves and a wave representing the Tollmien-Schlichting (TS) wave. The amplitude and phase velocity of the latter wave were then adjusted so that the total signal reasonably matched the amplitude and phase angle hot-wire data along the plate laminar boundary layer. The revised rates show growth occurring further upstream than Shapiro found. It appears that the premature growth is due to the adverse pressure gradient created by the shape of the plate. Basic elements of sound propagation in ducts and the experimental and theoretical acoustic-stability literature are reviewed.

Flow Instabilities in Feather Seals due to Upstream Harmonic Pressure Fluctuations

NASA Technical Reports Server (NTRS)

Deng, D.; Braun, M. J.; Henricks, Robert C.

2008-01-01

Feather seals (also called slot seals) typically found in turbine stators limit leakage from the platform into the core cavities and from the shroud to the case. They are of various geometric shapes, yet all are contoured to fit the aerodynamic shape of the stator and placed as close as thermomechanically reasonable the powerstream flow passage. Oscillations engendered in the compressor or combustor alter the steady leakage characteristics of these sealing elements and in some instances generate flow instabilities downstream of the seal interface. In this study, a generic feather seal geometry was studied numerically by imposing an upstream harmonic pressure disturbance on the simulated stator-blade gap. The flow and thermal characteristics were determined; it was found that for high pressure drops, large fluctuations in flows in the downstream blade-stator gap can occur. These leakages and pulsations in themselves are not all that significant, yet if coupled with cavity parameters, they could set up resonance events. Computationally generated time-dependent flow fields are captured in sequence video streaming.

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belsom, Keith Cletus; McMahan, Kevin Weston; Thomas, Larry Lou

A fuel nozzle for a gas turbine generally includes a main body having an upstream end axially separated from a downstream end. The main body at least partially defines a fuel supply passage that extends through the upstream end and at least partially through the main body. A fuel distribution manifold is disposed at the downstream end of the main body. The fuel distribution manifold includes a plurality of axially extending passages that extend through the fuel distribution manifold. A plurality of fuel injection ports defines a flow path between the fuel supply passage and each of the plurality ofmore » axially extending passages.« less

Method and apparatus for the separation of a gas-solids mixture in a circulating fluidized bed reactor

DOEpatents

Vimalchand, Pannalal; Liu, Guohai; Peng, WanWang

2010-08-10

The system of the present invention includes a centripetal cyclone for separating particulate material from a particulate laden gas solids stream. The cyclone includes a housing defining a conduit extending between an upstream inlet and a downstream outlet. In operation, when a particulate laden gas-solids stream passes through the upstream housing inlet, the particulate laden gas-solids stream is directed through the conduit and at least a portion of the solids in the particulate laden gas-solids stream are subjected to a centripetal force within the conduit.

Ongoing data reduction, theoretical studies and supporting research in magnetospheric physics

NASA Technical Reports Server (NTRS)

Scarf, F. L.; Greenstadt, E. W.

1984-01-01

Data from ISEE-3, Pioneer Venus Orbiter, and Voyager 1 and 2 were analyzed. The predictability of local shock macrostructure at ISEE-1, at the Earth's bow shock, from solar wind measurements made up-stream by ISEE-3, was conducted using computer graphic format. Morphology of quasi-parallel shock was reviewed. The review attempted to interrelate various measurements and computations involving the q-parallel structure and foreshock elements connected to it. A new classification for q-parallel morphology was suggested.

Monolithically integrated fiber-to-the-home diplexers and triplexers using a bilevel etched 2 x 2 optical coupler.

PubMed

Zhang, Li; Wang, Lei; He, Jian-Jun

2009-09-01

A novel design of monolithically integrated diplexers and triplexers for fiber-to-the-home applications is presented. A bilevel etched asymmetrical 2 x 2 optical coupler is analyzed for efficient couplings of both upstream and downstream signals. The design of the diplexer is extended to a triplexer by adding an etched diffraction grating as an additional downstream demultiplexing element. The total size of the integrated diplexer and triplexer is smaller than 500 microm x 500 microm.

Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis

NASA Astrophysics Data System (ADS)

Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

2015-09-01

An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.

HIV-1 and M-PMV RNA Nuclear Export Elements Program Viral Genomes for Distinct Cytoplasmic Trafficking Behaviors.

PubMed

Pocock, Ginger M; Becker, Jordan T; Swanson, Chad M; Ahlquist, Paul; Sherer, Nathan M

2016-04-01

Retroviruses encode cis-acting RNA nuclear export elements that override nuclear retention of intron-containing viral mRNAs including the full-length, unspliced genomic RNAs (gRNAs) packaged into assembling virions. The HIV-1 Rev-response element (RRE) recruits the cellular nuclear export receptor CRM1 (also known as exportin-1/XPO1) using the viral protein Rev, while simple retroviruses encode constitutive transport elements (CTEs) that directly recruit components of the NXF1(Tap)/NXT1(p15) mRNA nuclear export machinery. How gRNA nuclear export is linked to trafficking machineries in the cytoplasm upstream of virus particle assembly is unknown. Here we used long-term (>24 h), multicolor live cell imaging to directly visualize HIV-1 gRNA nuclear export, translation, cytoplasmic trafficking, and virus particle production in single cells. We show that the HIV-1 RRE regulates unique, en masse, Rev- and CRM1-dependent "burst-like" transitions of mRNAs from the nucleus to flood the cytoplasm in a non-localized fashion. By contrast, the CTE derived from Mason-Pfizer monkey virus (M-PMV) links gRNAs to microtubules in the cytoplasm, driving them to cluster markedly to the centrosome that forms the pericentriolar core of the microtubule-organizing center (MTOC). Adding each export element to selected heterologous mRNAs was sufficient to confer each distinct export behavior, as was directing Rev/CRM1 or NXF1/NXT1 transport modules to mRNAs using a site-specific RNA tethering strategy. Moreover, multiple CTEs per transcript enhanced MTOC targeting, suggesting that a cooperative mechanism links NXF1/NXT1 to microtubules. Combined, these results reveal striking, unexpected features of retroviral gRNA nucleocytoplasmic transport and demonstrate roles for mRNA export elements that extend beyond nuclear pores to impact gRNA distribution in the cytoplasm.

HIV-1 and M-PMV RNA Nuclear Export Elements Program Viral Genomes for Distinct Cytoplasmic Trafficking Behaviors

PubMed Central

Pocock, Ginger M.; Becker, Jordan T.; Swanson, Chad M.; Ahlquist, Paul; Sherer, Nathan M.

2016-01-01

Retroviruses encode cis-acting RNA nuclear export elements that override nuclear retention of intron-containing viral mRNAs including the full-length, unspliced genomic RNAs (gRNAs) packaged into assembling virions. The HIV-1 Rev-response element (RRE) recruits the cellular nuclear export receptor CRM1 (also known as exportin-1/XPO1) using the viral protein Rev, while simple retroviruses encode constitutive transport elements (CTEs) that directly recruit components of the NXF1(Tap)/NXT1(p15) mRNA nuclear export machinery. How gRNA nuclear export is linked to trafficking machineries in the cytoplasm upstream of virus particle assembly is unknown. Here we used long-term (>24 h), multicolor live cell imaging to directly visualize HIV-1 gRNA nuclear export, translation, cytoplasmic trafficking, and virus particle production in single cells. We show that the HIV-1 RRE regulates unique, en masse, Rev- and CRM1-dependent “burst-like” transitions of mRNAs from the nucleus to flood the cytoplasm in a non-localized fashion. By contrast, the CTE derived from Mason-Pfizer monkey virus (M-PMV) links gRNAs to microtubules in the cytoplasm, driving them to cluster markedly to the centrosome that forms the pericentriolar core of the microtubule-organizing center (MTOC). Adding each export element to selected heterologous mRNAs was sufficient to confer each distinct export behavior, as was directing Rev/CRM1 or NXF1/NXT1 transport modules to mRNAs using a site-specific RNA tethering strategy. Moreover, multiple CTEs per transcript enhanced MTOC targeting, suggesting that a cooperative mechanism links NXF1/NXT1 to microtubules. Combined, these results reveal striking, unexpected features of retroviral gRNA nucleocytoplasmic transport and demonstrate roles for mRNA export elements that extend beyond nuclear pores to impact gRNA distribution in the cytoplasm. PMID:27070420

An experimental and numerical study of wave motion and upstream influence in a stratified fluid

NASA Technical Reports Server (NTRS)

Hurdis, D. A.

1974-01-01

A system consisting of two superimposed layers of liquid of different densities, with a thin transition layer at the interface, provides a good laboratory model of an ocean thermocline or of an atmospheric inversion layer. This research was to gain knowledge about the propagation of disturbances within these two geophysical systems. The technique used was to observe the propagation of internal waves and of upstream influence within the density-gradient region between the two layers of liquid. The disturbances created by the motion of a vertical flat plate, which was moved longitudinally through this region, were examined both experimentally and numerically. An upstream influence, which resulted from a balance of inertial and gravitational forces, was observed, and it was possible to predict the behavior of this influence with the numerical model. The prediction included a description of the propagation of the upstream influence to steadily increasing distances from the flat plate and the shapes and magnitudes of the velocity profiles.

DYNAMICS OF HIGH ENERGY IONS AT A STRUCTURED COLLISIONLESS SHOCK FRONT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gedalin, M.; Dröge, W.; Kartavykh, Y. Y., E-mail: gedalin@bgu.ac.il

2016-07-10

Ions undergoing first-order Fermi acceleration at a shock are scattered in the upstream and downstream regions by magnetic inhomogeneities. For high energy ions this scattering is efficient at spatial scales substantially larger than the gyroradius of the ions. The transition from one diffusive region to the other occurs via crossing the shock, and the ion dynamics during this crossing is mainly affected by the global magnetic field change between the upstream and downstream region. We study the effects of the fine structure of the shock front, such as the foot-ramp-overshoot profile and the phase-standing upstream and downstream magnetic oscillations. Wemore » also consider time dependent features, including reformation and large amplitude coherent waves. We show that the influence of the spatial and temporal structure of the shock front on the dependence of the transition and reflection on the pitch angle of the ions is already weak at ion speeds five times the speed of the upstream flow.« less

Cyclic nucleotide-gated ion channel gene family in rice, identification, characterization and experimental analysis of expression response to plant hormones, biotic and abiotic stresses.

PubMed

Nawaz, Zarqa; Kakar, Kaleem Ullah; Saand, Mumtaz A; Shu, Qing-Yao

2014-10-04

Cyclic nucleotide-gated channels (CNGCs) are Ca2+-permeable cation transport channels, which are present in both animal and plant systems. They have been implicated in the uptake of both essential and toxic cations, Ca2+ signaling, pathogen defense, and thermotolerance in plants. To date there has not been a genome-wide overview of the CNGC gene family in any economically important crop, including rice (Oryza sativa L.). There is an urgent need for a thorough genome-wide analysis and experimental verification of this gene family in rice. In this study, a total of 16 full length rice CNGC genes distributed on chromosomes 1-6, 9 and 12, were identified by employing comprehensive bioinformatics analyses. Based on phylogeny, the family of OsCNGCs was classified into four major groups (I-IV) and two sub-groups (IV-A and IV- B). Likewise, the CNGCs from all plant lineages clustered into four groups (I-IV), where group II was conserved in all land plants. Gene duplication analysis revealed that both chromosomal segmentation (OsCNGC1 and 2, 10 and 11, 15 and 16) and tandem duplications (OsCNGC1 and 2) significantly contributed to the expansion of this gene family. Motif composition and protein sequence analysis revealed that the CNGC specific domain "cyclic nucleotide-binding domain (CNBD)" comprises a "phosphate binding cassette" (PBC) and a "hinge" region that is highly conserved among the OsCNGCs. In addition, OsCNGC proteins also contain various other functional motifs and post-translational modification sites. We successively built a stringent motif: (LI-X(2)-[GS]-X-[FV]-X-G-[1]-ELL-X-W-X(12,22)-SA-X(2)-T-X(7)-[EQ]-AF-X-L) that recognizes the rice CNGCs specifically. Prediction of cis-acting regulatory elements in 5' upstream sequences and expression analyses through quantitative qPCR demonstrated that OsCNGC genes were highly responsive to multiple stimuli including hormonal (abscisic acid, indoleacetic acid, kinetin and ethylene), biotic (Pseudomonas fuscovaginae and Xanthomonas oryzae pv. oryzae) and abiotic (cold) stress. There are 16 CNGC genes in rice, which were probably expanded through chromosomal segmentation and tandem duplications and comprise a PBC and a "hinge" region in the CNBD domain, featured by a stringent motif. The various cis-acting regulatory elements in the upstream sequences may be responsible for responding to multiple stimuli, including hormonal, biotic and abiotic stresses.

Cooling system with compressor bleed and ambient air for gas turbine engine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marsh, Jan H.; Marra, John J.

A cooling system for a turbine engine for directing cooling fluids from a compressor to a turbine blade cooling fluid supply and from an ambient air source to the turbine blade cooling fluid supply to supply cooling fluids to one or more airfoils of a rotor assembly is disclosed. The cooling system may include a compressor bleed conduit extending from a compressor to the turbine blade cooling fluid supply that provides cooling fluid to at least one turbine blade. The compressor bleed conduit may include an upstream section and a downstream section whereby the upstream section exhausts compressed bleed airmore » through an outlet into the downstream section through which ambient air passes. The outlet of the upstream section may be generally aligned with a flow of ambient air flowing in the downstream section. As such, the compressed air increases the flow of ambient air to the turbine blade cooling fluid supply.« less

Multiple enhancers located in a 1-Mb region upstream of POU3F4 promote expression during inner ear development and may be required for hearing

PubMed Central

Naranjo, Silvia; Voesenek, Krysta; de la Calle-Mustienes, Elisa; Robert-Moreno, Alex; Kokotas, Haris; Grigoriadou, Maria; Economides, John; Van Camp, Guy; Hilgert, Nele; Moreno, Felipe; Alsina, Berta; Petersen, Michael B.; Kremer, Hannie

2010-01-01

POU3F4 encodes a POU-domain transcription factor required for inner ear development. Defects in POU3F4 function are associated with X-linked deafness type 3 (DFN3). Multiple deletions affecting up to ~900-kb upstream of POU3F4 are found in DFN3 patients, suggesting the presence of essential POU3F4 enhancers in this region. Recently, an inner ear enhancer was reported that is absent in most DFN3 patients with upstream deletions. However, two indications suggest that additional enhancers in the POU3F4 upstream region are required for POU3F4 function during inner ear development. First, there is at least one DFN3 deletion that does not eliminate the reported enhancer. Second, the expression pattern driven by this enhancer does not fully recapitulate Pou3f4 expression in the inner ear. Here, we screened a 1-Mb region upstream of the POU3F4 gene for additional cis-regulatory elements and searched for novel DFN3 mutations in the identified POU3F4 enhancers. We found several novel enhancers for otic vesicle expression. Some of these also drive expression in kidney, pancreas and brain, tissues that are known to express Pou3f4. In addition, we report a new and smallest deletion identified so far in a DFN3 family which eliminates 3.9 kb, comprising almost exclusively the previous reported inner ear enhancer. We suggest that multiple enhancers control the expression of Pou3f4 in the inner ear and these may contribute to the phenotype observed in DFN3 patients. In addition, the novel deletion demonstrates that the previous reported enhancer, although not sufficient, is essential for POU3F4 function during inner ear development. Electronic supplementary material The online version of this article (doi:10.1007/s00439-010-0864-x) contains supplementary material, which is available to authorized users. PMID:20668882

Regulatory network involving miRNAs and genes in serous ovarian carcinoma

PubMed Central

Zhao, Haiyan; Xu, Hao; Xue, Luchen

2017-01-01

Serous ovarian carcinoma (SOC) is one of the most life-threatening types of gynecological malignancy, but the pathogenesis of SOC remains unknown. Previous studies have indicated that differentially expressed genes and microRNAs (miRNAs) serve important functions in SOC. However, genes and miRNAs are identified in a disperse form, and limited information is known about the regulatory association between miRNAs and genes in SOC. In the present study, three regulatory networks were hierarchically constructed, including a differentially-expressed network, a related network and a global network to reveal associations between each factor. In each network, there were three types of factors, which were genes, miRNAs and transcription factors that interact with each other. Focus was placed on the differentially-expressed network, in which all genes and miRNAs were differentially expressed and therefore may have affected the development of SOC. Following the comparison and analysis between the three networks, a number of signaling pathways which demonstrated differentially expressed elements were highlighted. Subsequently, the upstream and downstream elements of differentially expressed miRNAs and genes were listed, and a number of key elements (differentially expressed miRNAs, genes and TFs predicted using the P-match method) were analyzed. The differentially expressed network partially illuminated the pathogenesis of SOC. It was hypothesized that if there was no differential expression of miRNAs and genes, SOC may be prevented and treatment may be identified. The present study provided a theoretical foundation for gene therapy for SOC. PMID:29113276

Evolution of Advection Upstream Splitting Method Schemes

NASA Technical Reports Server (NTRS)

Liou, Meng-Sing

2010-01-01

This paper focuses on the evolution of advection upstream splitting method(AUSM) schemes. The main ingredients that have led to the development of modern computational fluid dynamics (CFD) methods have been reviewed, thus the ideas behind AUSM. First and foremost is the concept of upwinding. Second, the use of Riemann problem in constructing the numerical flux in the finite-volume setting. Third, the necessity of including all physical processes, as characterised by the linear (convection) and nonlinear (acoustic) fields. Fourth, the realisation of separating the flux into convection and pressure fluxes. The rest of this review briefly outlines the technical evolution of AUSM and more details can be found in the cited references. Keywords: Computational fluid dynamics methods, hyperbolic systems, advection upstream splitting method, conservation laws, upwinding, CFD

The genomic structure of the human UFO receptor.

PubMed

Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W

1993-02-01

Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.

Multidimensional directional flux weighted upwind scheme for multiphase flow modeling in heterogeneous porous media

NASA Astrophysics Data System (ADS)

Jin, G.

2012-12-01

Multiphase flow modeling is an important numerical tool for a better understanding of transport processes in the fields including, but not limited to, petroleum reservoir engineering, remedy of ground water contamination, and risk evaluation of greenhouse gases such as CO2 injected into deep saline reservoirs. However, accurate numerical modeling for multiphase flow remains many challenges that arise from the inherent tight coupling and strong non-linear nature of the governing equations and the highly heterogeneous media. The existence of counter current flow which is caused by the effect of adverse relative mobility contrast and gravitational and capillary forces will introduce additional numerical instability. Recently multipoint flux approximation (MPFA) has become a subject of extensive research and has been demonstrated with great success in reducing considerable grid orientation effects compared to the conventional single point upstream (SPU) weighting scheme, especially in higher dimensions. However, the present available MPFA schemes are mathematically targeted to certain types of grids in two dimensions, a more general form of MPFA scheme is needed for both 2-D and 3-D problems. In this work a new upstream weighting scheme based on multipoint directional incoming fluxes is proposed which incorporates full permeability tensor to account for the heterogeneity of the porous media. First, the multiphase governing equations are decoupled into an elliptic pressure equation and a hyperbolic or parabolic saturation depends on whether the gravitational and capillary pressures are presented or not. Next, a dual secondary grid (called finite volume grid) is formulated from a primary grid (called finite element grid) to create interaction regions for each grid cell over the entire simulation domain. Such a discretization must ensure the conservation of mass and maintain the continuity of the Darcy velocity across the boundaries between neighboring interaction regions. The pressure field is then implicitly calculated from the pressure equation, which in turn results in the derived velocity field for directional flux calculation at each grid node. Directional flux at the center of each interaction surface is also calculated by interpolation from the element nodal fluxes using shape functions. The MPFA scheme is performed by a specific linear combination of all incoming fluxes into the upstream cell represented by either nodal fluxes or interpolated surface boundary fluxes to produce an upwind directional fluxed weighted relative mobility at the center of the interaction region boundary. Such an upwind weighted relative mobility is then used for calculating the saturations of each fluid phase explicitly. The proposed upwind weighting scheme has been implemented into a mixed finite element-finite volume (FE-FV) method, which allows for handling complex reservoir geometry with second-order accuracies in approximating primary variables. The numerical solver has been tested with several bench mark test problems. The application of the proposed scheme to migration path analysis of CO2 injected into deep saline reservoirs in 3-D has demonstrated its ability and robustness in handling multiphase flow with adverse mobility contrast in highly heterogeneous porous media.

Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

PubMed Central

Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

2007-01-01

Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be needed to test whether the observed differences are extrapolatable to monocots and dicots in general, and to understand how they contribute to the fine-tuning of the hormonal response. The outcome of our investigation can now be used to direct future experimentation designed to further dissect the ABA-dependent regulatory networks. PMID:17672917

Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

PubMed

Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

2007-08-01

In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be needed to test whether the observed differences are extrapolatable to monocots and dicots in general, and to understand how they contribute to the fine-tuning of the hormonal response. The outcome of our investigation can now be used to direct future experimentation designed to further dissect the ABA-dependent regulatory networks.

Diesel particulate filter regeneration via resistive surface heating

DOEpatents

Gonze, Eugene V; Ament, Frank

2013-10-08

An exhaust system that processes exhaust generated by an engine is provided. The system includes: a particulate filter (PF) that filters particulates from the exhaust wherein an upstream end of the PF receives exhaust from the engine; and a grid of electrically resistive material that is applied to an exterior upstream surface of the PF and that selectively heats exhaust passing through the grid to initiate combustion of particulates within the PF.

Transition Induced by a Streamwise Array of Roughness Elements on a Supersonic Flat Plate

NASA Technical Reports Server (NTRS)

Chou, Amanda; Kegerise, Michael A.

2017-01-01

Roughness is unavoidable on practical high-speed vehicles, so it is critical to determine its impact on boundary layer transition. The flow field downstream of a streamwise array of cylindrical roughness elements is probed with hot-wire anemometry in this experiment. Mean flow distortion is examined in several measurement planes in the wake of the cylindrical roughness using the streak strength profiles and contour plots of the mass flux and total temperature. The roughness element heights and spacings were varied and their instability modes were examined. Cylindrical roughness elements approximately 140 micron tall produce an odd instability mode that grows weakly with downstream distance in the measurement range of this experiment. Cylindrical roughness elements approximately 280 micron tall produce an even instability mode that grows, becomes nonlinear, and then breaks down. Transition onset remains constant relative to the most downstream roughness in the streamwise array when the 280 micron roughness elements are spaced 2 diameters apart. Transition onset occurs at an earlier upstream location relative to the most downstream roughness in the streamwise array when the roughness elements are spaced 4 diameters appear to recover before the next downstream roughness element, so the location of transition shifts with the location of the most downstream roughness element in the array. When the rough- apart. The wake behind roughness elements spaced 2 diameters apart do not ness elements are spaced 4 diameters apart, the flow behind the first roughness element has enough space to recover before feeding into the second roughness element, and thus, moves transition forward.

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.

PubMed

Dale, Rodney M; Topczewski, Jacek

2011-09-15

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

PubMed Central

Dale, Rodney M.; Topczewski, Jacek

2011-01-01

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274

Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kass, D.H.; Batzer, M.A.; Deininger, P.L.

The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome.more » However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.« less

Uranium hydrogeochemical and stream sediment reconnaissance of the Arminto NTMS quadrangle, Wyoming, including concentrations of forty-three additional elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morgan, T.L.

1979-11-01

During the summers of 1976 and 1977, 570 water and 1249 sediment samples were collected from 1517 locations within the 18,000-km/sup 2/ area of the Arminto NTMS quadrangle of central Wyoming. Water samples were collected from wells, springs, streams, and artifical ponds; sediment samples were collected from wet and dry streams, springs, and wet and dry ponds. All water samples were analyzed for 13 elements, including uranium, and each sediment sample was analyzed for 43 elements, including uranium and thorium. Uranium concentrations in water samples range from below the detection limit to 84.60 parts per billion (ppb) with a meanmore » of 4.32 ppb. All water sample types except pond water samples were considered as a single population in interpreting the data. Pond water samples were excluded due to possible concentration of uranium by evaporation. Most of the water samples containing greater than 20 ppb uranium grouped into six clusters that indicate possible areas of interest for further investigation. One cluster is associated with the Pumpkin Buttes District, and two others are near the Kaycee and Mayoworth areas of uranium mineralization. The largest cluster is located on the west side of the Powder River Basin. One cluster is located in the central Big Horn Basin and another is in the Wind River Basin; both are in areas underlain by favorable host units. Uranium concentrations in sediment samples range from 0.08 parts per million (ppm) to 115.50 ppm with a mean of 3.50 ppm. Two clusters of sediment samples over 7 ppm were delineated. The first, containing the two highest-concentration samples, corresponds with the Copper Mountain District. Many of the high uranium concentrations in samples in this cluster may be due to contamination from mining or prospecting activity upstream from the sample sites. The second cluster encompasses a wide area in the Wind River Basin along the southern boundary of the quadrangle.« less

Numerical Modeling of Sliding Stability of RCC dam

NASA Astrophysics Data System (ADS)

Mughieda, O.; Hazirbaba, K.; Bani-Hani, K.; Daoud, W.

2017-06-01

Stability and stress analyses are the most important elements that require rigorous consideration in design of a dam structure. Stability of dams against sliding is crucial due to the substantial horizontal load that requires sufficient and safe resistance to develop by mobilization of adequate shearing forces along the base of the dam foundation. In the current research, the static sliding stability of a roller-compacted-concrete (RCC) dam was modelled using finite element method to investigate the stability against sliding. A commercially available finite element software (SAP 2000) was used to analyze stresses in the body of the dam and foundation. A linear finite element static analysis was performed in which a linear plane strain isoperimetric four node elements was used for modelling the dam-foundation system. The analysis was carried out assuming that no slip will occur at the interface between the dam and the foundation. Usual static loading condition was applied for the static analysis. The greatest tension was found to develop in the rock adjacent to the toe of the upstream slope. The factor of safety against sliding along the entire base of the dam was found to be greater than 1 (FS>1), for static loading conditions.

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

PubMed

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

Flow Structure Comparison for Two 7-Point LDI Configurations

NASA Technical Reports Server (NTRS)

Hicks, Yolanda R.; Tacina, Kathleen M.

2017-01-01

This paper presents a comparison primarily of the 2-D velocity profiles in the non-burning system; and for the luminescent flame structure for a 7-point Lean Direct Injector (LDI). This circular LDI array consists of a center element surrounded by six outer elements spaced 60 degrees apart; the spacing between all adjacent elements is the same. Each element consists of simplex atomizer that injects at the throat of a converging-diverging venturi, and an axial swirler upstream of the venturi throat to generate swirl. The two configurations were: 1) one which consists of all 60 co-swirling axial air swirlers, and; 2) one configuration which uses a 60 swirler in the center, surrounded by counter-swirling 45 swirlers. Testing was done at 5 atm and an inlet temperature of 800F. Two air reference velocities were considered in the cold flow measurements and one common air flow condition for the burning case.The 2D velocity profiles were determined using particle image velocimetry and the flame structure was determined using high speed photography.

Evidence of Asian carp spawning upstream of a key choke point in the Mississippi River

USGS Publications Warehouse

Larson, James H.; Knights, Brent C.; McCalla, S. Grace; Monroe, Emy; Tuttle-Lau, Maren T.; Chapman, Duane C.; George, Amy E.; Vallazza, Jon; Amberg, Jon J.

2017-01-01

Bighead Carp Hypophthalmichthys nobilis, Silver Carp H. molitrix, and Grass Carp Ctenopharyngodon idella(collectively termed “Asian carp”) were introduced into North America during the 1960s and 1970s and have become established in the lower Mississippi River basin. Previously published evidence for spawning of these species in the upper Mississippi River has been limited to an area just downstream of Dam 22 (near Saverton, Missouri). In 2013 and 2014, we sampled ichthyoplankton at 18 locations in the upper Mississippi River main stem from Dam 9 through Dam 19 and in four tributaries of the Mississippi River (Des Moines, Skunk, Iowa, and Wisconsin rivers). We identified eggs and larvae by using morphological techniques and then used genetic tools to confirm species identity. The spawning events we observed often included more than one species of Asian carp and in a few cases included eggs that must have been derived from more than one upstream spawning event. The upstream extent of genetically confirmed Grass Carp ichthyoplankton was the Wisconsin River, while Bighead Carp and Silver Carp ichthyoplankton were observed in Pool 16. In all these cases, ichthyoplankton likely drifted downstream for several hours prior to collection. Higher water velocities (and, to a lesser extent, higher temperatures) were associated with an increased likelihood of observing eggs or larvae, although the temperature range we encountered was mostly above 17°C. Several major spawning events were detected in 2013, but no major spawning events were observed in 2014. The area between Dam 15 and Dam 19 appears to be the upstream edge of spawning activity for both Silver Carp and Bighead Carp, suggesting that this area could be a focal point for management efforts designed to limit further upstream movement of these species..

Water-quality investigation, Salinas River, California

USGS Publications Warehouse

Irwin, G.A.

1976-01-01

Concentrations of dissolved solids in the Salinas River, California, are variable and range from 164 to 494 milligrams per liter near Bradley and from 170 to 1,090 milligrams per liter near Spreckels. Higher concentrations near Spreckels are caused mainly by sewage inflow about 150 feet (50 meters) upstream. Concentrations of nitrogen, phosphorus, total organic carbon, selected trace elements, and pesticides also generally increase downstream from Pozo to Spreckels and are related to sewage effluent; however, high concentrations occur elsewhere in the river. Specific conductance and water discharge regression results indicate that relations were all significant at the 1-percent probability level at Paso Robles, Bradley, and Spreckels with the explained variance ranging from 66 to 74 percent. Concentations of nitrogen, phosphorus, total organic carbon, and trace elements are only infrequently related to water discharge. (Woodard-USGS)

Use of the multipurpose transposon Tn KPK2 for the mutational analysis of chromosomal regions upstream and downstream of the sipF gene in Bradyrhizobium japonicum.

PubMed

Müller, P

2004-04-01

The DNA regions upstream and downstream of the Bradyrhizobium japonicum gene sipF were cloned by in vivo techniques and subsequently sequenced. In order to study the function of the predicted genes, a new transposon for in vitro mutagenesis, Tn KPK2, was constructed. This mutagenesis system has a number of advantages over other transposons. Tn KPK2 itself has no transposase gene, making transposition events stable. Extremely short inverted repeats minimize the length of the transposable element and facilitate the determination of the nucleotide sequence of the flanking regions. Since the transposable element carries a promoterless ' phoA reporter gene, the appearance of functional PhoA fusion proteins indicates that Tn KPK2 has inserted in a gene encoding a periplasmic or secreted protein. Although such events are extremely rare, because the transposon has to insert in-frame, in the correct orientation, and at an appropriate location in the target molecule, a direct screening procedure on agar indicator plates permits the identification of candidate clones from large numbers of colonies. In this study, Tn KPK2 was used for the construction of various symbiotic mutants of B. japonicum. One of the mutant strains, A2-10, which is defective in a gene encoding a protein that comigrates with bacterioferritin ( bcpB), was found to induce the formation of small and ineffective nodules.

Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping.

PubMed

Schörg, Alexandra; Santambrogio, Sara; Platt, James L; Schödel, Johannes; Lindenmeyer, Maja T; Cohen, Clemens D; Schrödter, Katrin; Mole, David R; Wenger, Roland H; Hoogewijs, David

2015-07-13

A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the -82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the -82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the -82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.

PubMed

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong

2012-09-01

The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.

Upstream CREs participate in the basal activity of minute virus of mice promoter P4 and in its stimulation in ras-transformed cells.

PubMed Central

Perros, M; Deleu, L; Vanacker, J M; Kherrouche, Z; Spruyt, N; Faisst, S; Rommelaere, J

1995-01-01

The activity of the P4 promoter of the parvovirus minute virus of mice (prototype strain MVMp) is stimulated in ras-transformed FREJ4 cells compared with the parental FR3T3 line. This activation may participate in the oncolytic effect of parvoviruses, given that P4 drives a transcriptional unit encoding cytotoxic nonstructural proteins. Our results suggest that the higher transcriptional activity of promoter P4 in FREJ4 cells is mediated at least in part by upstream CRE elements. Accordingly, mutations in the CRE motifs impair P4 function more strongly in the FREJ4 derivative than in its FR3T3 parent. Further evidence that these elements contribute to hyperactivity of the P4 promoter in the ras transformant is the fact that they form distinct complexes with proteins from FREJ4 and FR3T3 cell extracts. This difference can be abolished by treating the FREJ4 cell extracts with cyclic AMP-dependent protein kinase (PKA) or treating original cultures with a PKA activator. These findings can be linked with two previously reported features of ras-transformed cells: the activation of a PKA-inhibited protein kinase cascade and the reduction of PKA-induced protein phosphorylation. In keeping with these facts, P4-directed gene expression can be up- or downmodulated in vivo by exposing cells to known inhibitors or activators of PKA, respectively. PMID:7636996

Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

PubMed Central

van der Ploeg, Jan R.

2005-01-01

In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Overexpression of the CYP51A1 Gene and Repeated Elements are Associated with Differential Sensitivity to DMI Fungicides in Venturia inaequalis.

PubMed

Villani, Sara M; Hulvey, Jon; Hily, Jean-Michel; Cox, Kerik D

2016-06-01

The involvement of overexpression of the CYP51A1 gene in Venturia inaequalis was investigated for isolates exhibiting differential sensitivity to the triazole demethylation inhibitor (DMI) fungicides myclobutanil and difenoconazole. Relative expression (RE) of the CYP51A1 gene was significantly greater (P < 0.0001) for isolates with resistance to both fungicides (MRDR phenotype) or with resistance to difenoconazole only (MSDR phenotype) compared with isolates that were resistant only to myclobutanil (MRDS phenotype) or sensitive to both fungicides (MSDS phenotype). An average of 9- and 13-fold increases in CYP51A1 RE were observed in isolates resistant to difenoconazole compared with isolates with MRDS and MSDS phenotypes, respectively. Linear regression analysis between isolate relative growth on myclobutanil-amended medium and log10 RE revealed that little to no variability in sensitivity to myclobutanil could be explained by CYP51A1 overexpression (R(2) = 0.078). To investigate CYP51A1 upstream anomalies associated with CYP51A1 overexpression or resistance to difenoconazole, Illumina sequencing was conducted for three isolates with resistance to difenoconazole and one baseline isolate. A repeated element, "EL 3,1,2", with the properties of a transcriptional enhancer was identified two to four times upstream of CYP51A1 in difenoconazole-resistant isolates but was not found in isolates with the MRDS phenotype. These results suggest that different mechanisms may govern resistance to different DMI fungicides in the triazole group.

Informativeness of patient initial reports of adverse drug reactions. Can it be improved by a pharmacovigilance centre?

PubMed

Kheloufi, F; Default, A; Rouby, F; Laugier-Castellan, D; Boyer, M; Rodrigues, B; Ponte-Astoul, J; Jean-Pastor, M J; Blin, O; Micallef, J

2017-08-01

Little is known about the informativeness of initial patient reports before they are reviewed by a pharmacovigilance centre (PVC). We aim to describe the patterns of patient adverse drug reaction (ADR) reporting in France and estimate the contribution of a review by a PVC assessor on the informativeness of these reports. A retrospective study was conducted on patient reports between July 2011 and July 2015. Informativeness of 16 key elements of information (including drug start and end date, duration of treatment, time to onset and duration of the ADR, outcome, medical history and concomitant medication) was assessed in initial reports before and after review by a pharmacovigilance assessor. Overall, 240 reports concerning 522 ADR and involving 278 drugs were reported over this 4-year period. Mean number of available key elements of information in initial reports was increased from 11/16 to 15/16 after review of reports by the PVC. Time to onset and duration of the ADR were respectively available in only 51 and 58% of the reports before review compared to 83 and 90% after review. Medical history and concomitant medication were missing in 75% of the initial reports compared to less than 30% of the reports after review. Contacting the reporter enabled an increase of informativeness of most elements of information for more than 90% of the reports. Patient reports often need to be completed on key elements of information that are required to assess reports. Both upstream education of patients and downstream intervention of a pharmacovigilance assessor to complete missing information could help to enhance the informativeness of such reports.

Mapping of Human FOXP2 Enhancers Reveals Complex Regulation.

PubMed

Becker, Martin; Devanna, Paolo; Fisher, Simon E; Vernes, Sonja C

2018-01-01

Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators - FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2 . Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders.

Mapping of Human FOXP2 Enhancers Reveals Complex Regulation

PubMed Central

Becker, Martin; Devanna, Paolo; Fisher, Simon E.; Vernes, Sonja C.

2018-01-01

Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators – FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2. Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders. PMID:29515369

A Catharanthus roseus BPF-1 homologue interacts with an elicitor-responsive region of the secondary metabolite biosynthetic gene Str and is induced by elicitor via a JA-independent signal transduction pathway.

PubMed

van der Fits, L; Zhang, H; Menke, F L; Deneka, M; Memelink, J

2000-11-01

Plants respond to pathogen attack by induction of various defence responses, including the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the elicitor-induced expression of the terpenoid indole alkaloid biosynthetic gene Strictosidine synthase (Str) is mediated via the plant stress hormonejasmonate. In the promoters of several defence-related genes, cis-acting elements have been identified that are important for transcriptional regulation upon stress signals. Here we show that an upstream region in the Str promoter confers responsiveness to partially purified yeast elicitor and jasmonate. Yeast one-hybrid screening with this element as a bait identified a MYB-like protein, which shows high homology to parsley box P-binding factor-1 (PcBPF-1). In vitro analyses showed that the Str promoter fragment contained a novel binding site for BPF-1-like proteins with higher binding affinity than the previously described box P. CrBPF-1 mRNA accumulated rapidly in elicitor-treated C. roseus suspension cells, whereas no induction was observed with jasmonate. Inhibitor studies indicated that CrBPF-1 plays a role in an elicitor-responsive but jasmonate-independent signal transduction pathway, acting downstream of protein phosphorylation and calcium influx.

Translation initiation events on structured eukaryotic mRNAs generate gene expression noise

PubMed Central

Dacheux, Estelle; Malys, Naglis; Meng, Xiang; Ramachandran, Vinoy; Mendes, Pedro

2017-01-01

Abstract Gene expression stochasticity plays a major role in biology, creating non-genetic cellular individuality and influencing multiple processes, including differentiation and stress responses. We have addressed the lack of knowledge about posttranscriptional contributions to noise by determining cell-to-cell variations in the abundance of mRNA and reporter protein in yeast. Two types of structural element, a stem–loop and a poly(G) motif, not only inhibit translation initiation when inserted into an mRNA 5΄ untranslated region, but also generate noise. The noise-enhancing effect of the stem–loop structure also remains operational when combined with an upstream open reading frame. This has broad significance, since these elements are known to modulate the expression of a diversity of eukaryotic genes. Our findings suggest a mechanism for posttranscriptional noise generation that will contribute to understanding of the generally poor correlation between protein-level stochasticity and transcriptional bursting. We propose that posttranscriptional stochasticity can be linked to cycles of folding/unfolding of a stem–loop structure, or to interconversion between higher-order structural conformations of a G-rich motif, and have created a correspondingly configured computational model that generates fits to the experimental data. Stochastic events occurring during the ribosomal scanning process can therefore feature alongside transcriptional bursting as a source of noise. PMID:28521011

Effects of urbanization on water quality in the Kansas River, Shunganunga Creek Basin, and Soldier Creek, Topeka, Kansas, October 1993 through September 1995

USGS Publications Warehouse

Pope, L.M.; Putnam, J.E.

1997-01-01

A study of urban-related water-qulity effects in the Kansas River, Shunganunga Creek Basin, and Soldier Creek in Topeka, Kansas, was conducted from October 1993 through September 1995. The purpose of this report is to assess the effects of urbanization on instream concentrations of selected physical and chemical constituents within the city of Topeka. A network of seven sampling sites was established in the study area. Samples principally were collected at monthly intervals from the Kansas River and from the Shunganunga Creek Basin, and at quarterly intervals from Soldier Creek. The effects of urbanization werestatistically evaluated from differences in constituent concentrations between sites on the same stream. No significant differences in median concentrations of dissolved solids, nutrients, or metals and trace elements, or median densities offecal bacteria were documented between sampling sites upstream and downstream from the major urbanized length of the Kansas River in Topeka.Discharge from the city's primary wastewater- treatment plant is the largest potential source of contamination to the Kansas River. This discharge increased concentrations of dissolved ammonia, totalphosphorus, and densities of fecal bacteria.Calculated dissolved ammonia as nitrogen concentrations in water from the Kansas River ranged from 0.03 to 1.1 milligrams per liter after receiving treatment-plant discharge. However, most of the calculated concentrations wereconsiderably less than 50 percent of Kansas Department of Health and Environment water- quality criteria, with a median value of 20 percent.Generally, treatment-plant discharge increased calculated total phosphorus concentrations in water from the Kansas River by 0.01 to 0.04 milligrams per liter, with a median percentage increase of 7.6 percent. The calculated median densities of fecal coliform and fecal Streptococci bacteria in water from the Kansas River increased from 120 and 150colonies per 100 milliliters of water, respectively, before treatment-plant discharge to a calculated 4,900 and 4,700 colonies per 100 milliliters of water, respectively, after discharge. Median concentrations of dissolved solids were not significantly different between three sampling sites in the Shunganunga Creek Basin. Median concentrations of dissolved nitrate as nitrogen, total phosphorus, and dissolved orthophosphate were significantly larger in water from the upstream- most Shunganunga Creek sampling site than in water from either of the other sampling sites in the Shunganunga Creek Basin probably because of the site's proximity to a wastewater-treatment plant.Median concentrations of dissolved nitrate as nitrogen and total phosphorus during 1993-95 at upstream sampling sites were either significantlylarger than during 1979-81 in response to increase of wastewater-treatment plant discharge or smaller because of the elimination of wastewater-treatment plant discharge. Median concentrations of dissolved ammonia as nitrogen were significantly less during 1993-95 than during 1979-81. Median concentrations of total aluminum, iron, maganese, and molybdenum were significantly larger in water from the downstream-mostShunganunga Creek sampling site than in water from the upstream-most sampling site. This probably reflects their widespread use in the urbanenvironment between the upstream and downstream Shunganunga Creek sampling sites. Little water-quality effect from the urbanization was indicated by results from the Soldier Creek sampling site. Median concentrations of most water-quality constituents in water from this sampling site were the smallest in water from any sampling site in the study area. Herbicides were detected in water from all sampling sites. Some of the more frequently detected herbicides included acetochlor, alachlor,atrazine, cyanazine, EPTC, metolachlor, prometon, simazine, and tebuthiuron. Detected insecticides including chlordane,

Synthesis of natural flows at selected sites in the upper Missouri River basin, Montana, 1928-89

USGS Publications Warehouse

Cary, L.E.; Parrett, Charles

1996-01-01

Natural monthly streamflows were synthesized for the years 1928-89 for 43 sites in the upper Missouri River Basin upstream from Fort Peck Lake in Montana. The sites are represented as nodes in a streamflow accounting model being developed by the Bureau of Reclamation. Recorded and historical flows at most sites have been affected by human activities including reservoir storage, diversions for irrigation, and municipal use. Natural flows at the sites were synthesized by eliminating the effects of these activities. Recorded data at some sites do not include the entire study period. The missing flows at these sites were estimated using a statistical procedure. The methods of synthesis varied, depending on upstream activities and information available. Recorded flows were transferred to nodes that did not have streamflow-gaging stations from the nearest station with a sufficient length of record. The flows at one node were computed as the sum of flows from three upstream tributaries. Monthly changes in reservoir storage were computed from monthend contents. The changes in storage were corrected for the effects of evaporation and precipitation using pan-evaporation and precipitation data from climate stations. Irrigation depletions and consumptive use by the three largest municipalities were computed. Synthesized natural flow at most nodes was computed by adding algebraically the upstream depletions and changes in reservoir storage to recorded or historical flow at the nodes.

Exposure of insects and insectivorous birds to metals and other elements from abandoned mine tailings in three Summit County drainages, Colorado

USGS Publications Warehouse

Custer, Christine M.; Yang, C.; Crock, J.G.; Shearn-Bochsler, V.; Smith, K.S.; Hageman, P.L.

2009-01-01

Concentrations of 31 metals, metalloids, and other elements were measured in insects and insectivorous bird tissues from three drainages with different geochemistry and mining histories in Summit Co., Colorado, in 2003, 2004, and 2005. In insect samples, all 25 elements that were analyzed in all years increased in both Snake and Deer Creeks in the mining impacted areas compared to areas above and below the mining impacted areas. This distribution of elements was predicted from known or expected sediment contamination resulting from abandoned mine tailings in those drainages. Element concentrations in avian liver tissues were in concordance with levels in insects, that is with concentrations higher in mid-drainage areas where mine tailings were present compared to both upstream and downstream locations; these differences were not always statistically different, however. The lack of statistically significant differences in liver tissues, except for a few elements, was due to relatively small sample sizes and because many of these elements are essential and therefore well regulated by the bird's homeostatic processes. Most elements were at background concentrations in avian liver tissue except for Pb which was elevated at mid-drainage sites to levels where ??-aminolevulinic acid dehydratase activity was inhibited at other mining sites in Colorado. Lead exposure, however, was not at toxic levels. Fecal samples were not a good indication of what elements birds ingested and were potentially exposed to. ?? Springer Science+Business Media B.V. 2008.

Identification and characterization of novel and potent transcription promoters of Francisella tularensis.

PubMed

Zaide, Galia; Grosfeld, Haim; Ehrlich, Sharon; Zvi, Anat; Cohen, Ofer; Shafferman, Avigdor

2011-03-01

Two alternative promoter trap libraries, based on the green fluorescence protein (gfp) reporter and on the chloramphenicol acetyltransferase (cat) cassette, were constructed for isolation of potent Francisella tularensis promoters. Of the 26,000 F. tularensis strain LVS gfp library clones, only 3 exhibited visible fluorescence following UV illumination and all appeared to carry the bacterioferritin promoter (Pbfr). Out of a total of 2,000 chloramphenicol-resistant LVS clones isolated from the cat promoter library, we arbitrarily selected 40 for further analysis. Over 80% of these clones carry unique F. tularensis DNA sequences which appear to drive a wide range of protein expression, as determined by specific chloramphenicol acetyltransferase (CAT) Western dot blot and enzymatic assays. The DNA sequence information for the 33 unique and novel F. tularensis promoters reported here, along with the results of in silico and primer extension analyses, suggest that F. tularensis possesses classical Escherichia coli σ(70)-related promoter motifs. These motifs include the -10 (TATAAT) and -35 [TTGA(C/T)A] domains and an AT-rich region upstream from -35, reminiscent of but distinct from the E. coli upstream region that is termed the UP element. The most efficient promoter identified (Pbfr) appears to be about 10 times more potent than the F. tularensis groEL promoter and is probably among the strongest promoters in F. tularensis. The battery of promoters identified in this work will be useful, among other things, for genetic manipulation in the background of F. tularensis intended to gain better understanding of the mechanisms involved in pathogenesis and virulence, as well as for vaccine development studies.

Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

PubMed

Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

2009-01-01

Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

Sequencing and diversity analyses reveal extensive similarities between some epsilon-toxin-encoding plasmids and the pCPF5603 Clostridium perfringens enterotoxin plasmid.

PubMed

Miyamoto, Kazuaki; Li, Jihong; Sayeed, Sameera; Akimoto, Shigeru; McClane, Bruce A

2008-11-01

Clostridium perfringens type B and D isolates produce epsilon-toxin, the third most potent clostridial toxin. The epsilon-toxin gene (etx) is plasmid borne in type D isolates, but etx genetics have been poorly studied in type B isolates. This study reports the first sequencing of any etx plasmid, i.e., pCP8533etx, from type B strain NCTC8533. This etx plasmid is 64.7 kb, carries tcp conjugative transfer genes, and encodes additional potential virulence factors including beta2-toxin, sortase, and collagen adhesin but not beta-toxin. Interestingly, nearly 80% of pCP8533etx open reading frames (ORFs) are also present on pCPF5603, an enterotoxin-encoding plasmid from type A isolate F5603. Pulsed-field gel electrophoresis and overlapping PCR indicated that a pCP8533etx-like etx plasmid is also present in most, if not all, other type B isolates and some beta2-toxin-positive, cpe-negative type D isolates, while other type D isolates carry different etx plasmids. Sequences upstream of the etx gene vary between type B isolates and some type D isolates that do not carry a pCP8533etx-like etx plasmid. However, nearly all type B and D isolates have an etx locus with an upstream IS1151, and those etx loci typically reside near a dcm ORF. These results suggest that pCPF5603 and pCP8533etx evolved from insertion of mobile genetic elements carrying enterotoxin or etx genes, respectively, onto a common progenitor plasmid.

Southwest Greenland's Alpine Glacier History: Recent Glacier Change in the Context of the Holocene Geologic Record

NASA Astrophysics Data System (ADS)

Larocca, L. J.; Axford, Y.; Lasher, G. E.; Lee, C. W.

2017-12-01

Due to anthropogenic climate change, the Arctic region is currently undergoing major transformation, and is expected to continue warming much faster than the global average. To put recent and future changes into context, a longer-term understanding of this region's past response to natural climate variability is needed. Given their sensitivity to modest climate change, small alpine glaciers and ice caps on Greenland's coastal margin (beyond the Greenland Ice Sheet) represent ideal features to record climate variability through the Holocene. Here we investigate the Holocene history of a small ( 160 square km) ice cap and adjacent alpine glaciers, located in southwest Greenland approximately 50 km south of Nuuk. We employ measurements on sediment cores from a glacier-fed lake in combination with geospatial analysis of satellite images spanning the past several decades. Sedimentary indicators of sediment source and thus glacial activity, including organic matter abundance, inferred chlorophyll-a content, sediment major element abundances, grain size, and magnetic susceptibility are presented from cores collected from a distal glacier-fed lake (informally referred to here as Per's Lake) in the summer of 2015. These parameters reflect changes in the amount and character of inorganic detrital input into the lake, which may be linked to the size of the upstream glaciers and ice cap and allow us to reconstruct their status through the Holocene. Additionally, we present a complementary record of recent changes in Equilibrium Line Altitude (ELA) for the upstream alpine glaciers. Modern ELAs are inferred using the accumulation area ratio (AAR) method in ArcGIS via Landsat and Worldview-2 satellite imagery, along with elevation data obtained from digital elevation models (DEMs). Paleo-ELAs are inferred from the positions of moraines and trim lines marking the glaciers' most recent expanded state, which we attribute to the Little Ice Age (LIA). This approach will allow us to explore the possibility of quantitatively or qualitatively linking changes in ELA (and thus the size of upstream glaciers) to specific sediment parameters. Ultimately, we aim to reconstruct glacier variability through the entire Holocene epoch, and to compare this history with 20th and 21st Century changes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benson, Stephen V.; Marhauser, Frank; Douglas, David R.

A method for the suppression of upstream-directed field emission in RF accelerators. The method is not restricted to a certain number of cavity cells, but requires similar operating field levels in all cavities to efficiently annihilate the once accumulated energy. Such a field balance is desirable to minimize dynamic RF losses, but not necessarily achievable in reality depending on individual cavity performance, such as early Q.sub.0-drop or quench field. The method enables a significant energy reduction for upstream-directed electrons within a relatively short distance. As a result of the suppression of upstream-directed field emission, electrons will impact surfaces at rathermore » low energies leading to reduction of dark current and less issues with heating and damage of accelerator components as well as radiation levels including neutron generation and thus radio-activation.« less

Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka

2016-08-29

Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-familymore » replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.« less

Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

PubMed

Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

1999-08-01

Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

The Asian clam Corbicula fluminea as a biomonitor of trace element contamination: Accounting for different sources of variation using an hierarchical linear model

USGS Publications Warehouse

Shoults-Wilson, W. A.; Peterson, J.T.; Unrine, J.M.; Rickard, J.; Black, M.C.

2009-01-01

In the present study, specimens of the invasive clam, Corbicula fluminea, were collected above and below possible sources of potentially toxic trace elements (As, Cd, Cr, Cu, Hg, Pb, and Zn) in the Altamaha River system (Georgia, USA). Bioaccumulation of these elements was quantified, along with environmental (water and sediment) concentrations. Hierarchical linear models were used to account for variability in tissue concentrations related to environmental (site water chemistry and sediment characteristics) and individual (growth metrics) variables while identifying the strongest relations between these variables and trace element accumulation. The present study found significantly elevated concentrations of Cd, Cu, and Hg downstream of the outfall of kaolin-processing facilities, Zn downstream of a tire cording facility, and Cr downstream of both a nuclear power plant and a paper pulp mill. Models of the present study indicated that variation in trace element accumulation was linked to distance upstream from the estuary, dissolved oxygen, percentage of silt and clay in the sediment, elemental concentrations in sediment, shell length, and bivalve condition index. By explicitly modeling environmental variability, the Hierarchical linear modeling procedure allowed the identification of sites showing increased accumulation of trace elements that may have been caused by human activity. Hierarchical linear modeling is a useful tool for accounting for environmental and individual sources of variation in bioaccumulation studies. ?? 2009 SETAC.

Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

2010-10-15

Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

Connections between meteorological and hydrological droughts in a semi-arid basin of the middle Yellow River

NASA Astrophysics Data System (ADS)

Li, Binquan; Zhu, Changchang; Liang, Zhongmin; Wang, Guoqing; Zhang, Yu

2018-06-01

Differences between meteorological and hydrological droughts could reflect the regional water consumption by both natural elements and human water-use. The connections between these two drought types were analyzed using the Standardized Precipitation Evapotranspiration Index (SPEI) and Standardized Streamflow Index (SSI), respectively. In a typical semi-arid basin of the middle Yellow River (Qingjianhe River basin), annual precipitation and air temperature showed significantly downward and upward trends, respectively, with the rates of -2.37 mm yr-1 and 0.03 °C yr-1 (1961-2007). Under their synthetic effects, water balance variable (represented by SPEI) showed obviously downward (drying) trend at both upstream and whole basin areas. For the spatial variability of precipitation, air temperature and the calculated SPEI, both upstream and downstream areas experienced very similar change characteristics. Results also suggested that the Qingjianhe River basin experienced near normal condition during the study period. As a whole, this semi-arid basin mainly had the meteorological drought episodes in the mid-1960s, late-1990s and the 2000s depicted by 12-month SPEI. The drying trend could also be depicted by the hydrological drought index (12-month SSI) at both upstream and downstream stations (Zichang and Yanchuan), but the decreasing trends were not significant. A correlation analysis showed that hydrological system responds rapidly to the change of meteorological conditions in this semi-arid region. This finding could be an useful implication to drought research for those semi-arid basins with intensive human activities.

Steady film flow over a substrate with rectangular trenches forming air inclusions

NASA Astrophysics Data System (ADS)

Varchanis, S.; Dimakopoulos, Y.; Tsamopoulos, J.

2017-12-01

Film flow along an inclined, solid substrate featuring periodic rectangular trenches may either completely wet the trench floor (Wenzel state) or get pinned on the entrance and exit corners of the trench (Cassie state) or assume other configurations in between these two extremes. Such intermediate configurations are examined in the present study. They are bounded by a second gas-liquid interface inside the trench, which adheres to its walls forming two three-phase contact lines, and encloses a different amount of air under different physical conditions. The Galerkin finite-element method is used to solve the Navier-Stokes equations in a physical domain, which is adaptively remeshed. Multiple steady solutions, connected by turning points and transcritical bifurcations as well as isolated solution branches, are revealed by pseudo-arc-length continuation. Two possible configurations of a single air inclusion inside the trench are examined: the inclusion either surrounds the upstream convex corner or is attached to the upstream trench wall. The penetration of the liquid inside the trench is enhanced primarily by increasing either the wettability of the substrate or capillary over viscous forces or by decreasing the flow rate. Flow hysteresis may occur when the liquid wetting of the upstream wall decreases abruptly, leading to drastically different flow patterns for the same parameter values. The interplay of inertia, viscous, gravity, and capillary forces along with substrate wettability determines the volume of the air encapsulated in the trench and the extent of deformation of the outer free surface.

Molecular characterization of Ambler class A to D β-lactamases, ISAba1, and integrons reveals multidrug-resistant Acinetobacter spp. isolates in northeastern China.

PubMed

Sun, Xiaoyu; Liu, Bin; Chen, Yan; Huang, Honglan; Wang, Guoqing; Li, Fan; Ni, Zhaohui

2016-12-01

The prevalence of various Ambler class A to D β-lactamases, ISAba1, and class 1 and 2 integrons as well as the clonal relatedness in 105 Acinetobacter spp. isolates found in northeastern China was investigated. All 105 Acinetobacter spp. isolates were determined to be multidrug resistant (MDR), and the resistance rates to carbapenem agents were approximately 50%. PER, IMP, AmpC, and OXA-23 were found to be dominant β-lactamases belonging to different classes, respectively. This is the first report of the coexistence of bla PER , bla IMP , bla AmpC , and bla OXA-23-like genes in Acinetobacter spp. isolates from northeastern China. ISAba1 was found upstream of the bla OXA-23-like gene in 87.8% (36/41) strains and upstream of the bla OXA-51-like gene in 26.5% (13/49) strains. ISAba3-like element was found upstream of the bla OXA-58-like gene in one bla OXA-58-like -positive strain. The presence of IntI1 was detected in 63.8% (67/105) of the isolates and the most prevalent gene cassettes were aacA4, aadA1, and catB8. The highly prevalent isolates belong to international clonal lineage (ICL)-II. These results indicate that the wide horizontal and clonal spread of MDR Acinetobacter spp. isolates harbouring multiple β-lactamase genes has become a serious problem in northeastern China.

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

Effect of wakes from moving upstream rods on boundary layer separation from a high lift airfoil

NASA Astrophysics Data System (ADS)

Volino, Ralph J.

2011-11-01

Highly loaded airfoils in turbines allow power generation using fewer airfoils. High loading, however, can cause boundary layer separation, resulting in reduced lift and increased aerodynamic loss. Separation is affected by the interaction between rotating blades and stationary vanes. Wakes from upstream vanes periodically impinge on downstream blades, and can reduce separation. The wakes include elevated turbulence, which can induce transition, and a velocity deficit, which results in an impinging flow on the blade surface known as a ``negative jet.'' In the present study, flow through a linear cascade of very high lift airfoils is studied experimentally. Wakes are produced with moving rods which cut through the flow upstream of the airfoils, simulating the effect of upstream vanes. Pressure and velocity fields are documented. Wake spacing and velocity are varied. At low Reynolds numbers without wakes, the boundary layer separates and does not reattach. At high wake passing frequencies separation is largely suppressed. At lower frequencies, ensemble averaged velocity results show intermittent separation and reattachment during the wake passing cycle. Supported by NASA.

New threats of an old enemy: the distribution of the shipworm Teredo navalis L. (Bivalvia: Teredinidae) related to climate change in the Port of Rotterdam area, the Netherlands.

PubMed

Paalvast, Peter; van der Velde, Gerard

2011-08-01

The effects of four climate change scenarios for the Netherlands on the distribution of the shipworm upstream of the Rhine-Meuse estuary are described. Global warming will cause dry and warmer summers and decreased river discharges. This will extend the salinity gradient upstream in summer and fall and may lead to attacks on wooden structures by the shipworm. Scenarios including one or two degree temperature increases by 2050 compared to 1990 with a weak change in the air circulation over Europe will lead to an increased chance of shipworm damage upstream from once in 36 years to once in 27 or 22 years, respectively; however, under a strong change in air circulation, the chance of shipworm damage increases to once in 6 or 3 years, respectively. The upstream expansion of the distribution of the shipworm will also be manifested in other northwest European estuaries and will be even stronger in southern Europe. Copyright © 2011 Elsevier Ltd. All rights reserved.

Electrically heated particulate filter regeneration using hydrocarbon adsorbents

DOEpatents

Gonze, Eugene V [Pinckney, MI; Ament, Frank [Troy, MI

2011-02-01

An exhaust system that processes exhaust generated by an engine is provided. The system generally includes a particulate filter (PF) that filters particulates from the exhaust wherein an upstream end of the PF receives exhaust from the engine. A grid of electrically resistive material selectively heats exhaust passing through the upstream end to initiate combustion of particulates within the PF. A hydrocarbon adsorbent coating applied to the PF releases hydrocarbons into the exhaust to increase a temperature of the combustion of the particulates within the PF.

Splicing-factor alterations in cancers

PubMed Central

Anczuków, Olga; Krainer, Adrian R.

2016-01-01

Tumor-associated alterations in RNA splicing result either from mutations in splicing-regulatory elements or changes in components of the splicing machinery. This review summarizes our current understanding of the role of splicing-factor alterations in human cancers. We describe splicing-factor alterations detected in human tumors and the resulting changes in splicing, highlighting cell-type-specific similarities and differences. We review the mechanisms of splicing-factor regulation in normal and cancer cells. Finally, we summarize recent efforts to develop novel cancer therapies, based on targeting either the oncogenic splicing events or their upstream splicing regulators. PMID:27530828

Distributing Characteristics of Heavy Metal Elements in A Tributary of Zhedong River in Laowangzhai Gold Deposit, Yunnan (China): An Implication to Environmentology from Sediments

NASA Astrophysics Data System (ADS)

Yang, Shuran; Danĕk, Tomáš; Yang, Xiaofeng; Cheng, Xianfeng

2016-10-01

Five heavy metal contents from five sediments and seven sediment profiles in an upstream reach of Zhedong river in Laowangzhai gold deposit were investigated in this research, along with analysis of the horizontal distribution, the surface distribution, the vertical distribution and the interlayer distribution of five heavy metal contents: arsenic (As), mercury (Hg), copper (Cu), lead (Pb) and zinc (Zn). The potential ecological risk of five heavy metals was evaluated to help understanding pollution control of Laowangzhai deposit.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, D.P.; Richardson, C.F.

Three mercury measurement techniques were performed on synthesis gas streams before and after an amine-based sulfur removal system. The syngas was sampled using (1) gas impingers containing a nitric acid-hydrogen peroxide solution, (2) coconut-based charcoal sorbent, and (3) an on-line atomic absorption spectrophotometer equipped with a gold amalgamation trap and cold vapor cell. Various impinger solutions were applied upstream of the gold amalgamation trap to remove hydrogen sulfide and isolate oxidized and elemental species of mercury. The results from these three techniques are compared to provide an assessment of these measurement techniques in reducing gas atmospheres.

Evolution of a behavior-linked microsatellite-containing element in the 5' flanking region of the primate AVPR1A gene

PubMed Central

2008-01-01

Background The arginine vasopressin V1a receptor (V1aR) modulates social cognition and behavior in a wide variety of species. Variation in a repetitive microsatellite element in the 5' flanking region of the V1aR gene (AVPR1A) in rodents has been associated with variation in brain V1aR expression and in social behavior. In humans, the 5' flanking region of AVPR1A contains a tandem duplication of two ~350 bp, microsatellite-containing elements located approximately 3.5 kb upstream of the transcription start site. The first block, referred to as DupA, contains a polymorphic (GT)25 microsatellite; the second block, DupB, has a complex (CT)4-(TT)-(CT)8-(GT)24 polymorphic motif, known as RS3. Polymorphisms in RS3 have been associated with variation in sociobehavioral traits in humans, including autism spectrum disorders. Thus, evolution of these regions may have contributed to variation in social behavior in primates. We examined the structure of these regions in six ape, six monkey, and one prosimian species. Results Both tandem repeat blocks are present upstream of the AVPR1A coding region in five of the ape species we investigated, while monkeys have only one copy of this region. As in humans, the microsatellites within DupA and DupB are polymorphic in many primate species. Furthermore, both single (lacking DupB) and duplicated alleles (containing both DupA and DupB) are present in chimpanzee (Pan troglodytes) populations with allele frequencies of 0.795 and 0.205 for the single and duplicated alleles, respectively, based on the analysis of 47 wild-caught individuals. Finally, a phylogenetic reconstruction suggests two alternate evolutionary histories for this locus. Conclusion There is no obvious relationship between the presence of the RS3 duplication and social organization in primates. However, polymorphisms identified in some species may be useful in future genetic association studies. In particular, the presence of both single and duplicated alleles in chimpanzees provides a unique opportunity to assess the functional role of this duplication in contributing to variation in social behavior in primates. While our initial studies show no signs of directional selection on this locus in chimps, pharmacological and genetic association studies support a potential role for this region in influencing V1aR expression and social behavior. PMID:18573213

Evolution of a behavior-linked microsatellite-containing element in the 5' flanking region of the primate AVPR1A gene.

PubMed

Donaldson, Zoe R; Kondrashov, Fyodor A; Putnam, Andrea; Bai, Yaohui; Stoinski, Tara L; Hammock, Elizabeth A D; Young, Larry J

2008-06-23

The arginine vasopressin V1a receptor (V1aR) modulates social cognition and behavior in a wide variety of species. Variation in a repetitive microsatellite element in the 5' flanking region of the V1aR gene (AVPR1A) in rodents has been associated with variation in brain V1aR expression and in social behavior. In humans, the 5' flanking region of AVPR1A contains a tandem duplication of two approximately 350 bp, microsatellite-containing elements located approximately 3.5 kb upstream of the transcription start site. The first block, referred to as DupA, contains a polymorphic (GT)25 microsatellite; the second block, DupB, has a complex (CT)4-(TT)-(CT)8-(GT)24 polymorphic motif, known as RS3. Polymorphisms in RS3 have been associated with variation in sociobehavioral traits in humans, including autism spectrum disorders. Thus, evolution of these regions may have contributed to variation in social behavior in primates. We examined the structure of these regions in six ape, six monkey, and one prosimian species. Both tandem repeat blocks are present upstream of the AVPR1A coding region in five of the ape species we investigated, while monkeys have only one copy of this region. As in humans, the microsatellites within DupA and DupB are polymorphic in many primate species. Furthermore, both single (lacking DupB) and duplicated alleles (containing both DupA and DupB) are present in chimpanzee (Pan troglodytes) populations with allele frequencies of 0.795 and 0.205 for the single and duplicated alleles, respectively, based on the analysis of 47 wild-caught individuals. Finally, a phylogenetic reconstruction suggests two alternate evolutionary histories for this locus. There is no obvious relationship between the presence of the RS3 duplication and social organization in primates. However, polymorphisms identified in some species may be useful in future genetic association studies. In particular, the presence of both single and duplicated alleles in chimpanzees provides a unique opportunity to assess the functional role of this duplication in contributing to variation in social behavior in primates. While our initial studies show no signs of directional selection on this locus in chimps, pharmacological and genetic association studies support a potential role for this region in influencing V1aR expression and social behavior.

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

PubMed Central

Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

2014-01-01

The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

Impact of hydrological alterations on river-groundwater exchange and water quality in a semi-arid area: Nueces River, Texas.

PubMed

Murgulet, Dorina; Murgulet, Valeriu; Spalt, Nicholas; Douglas, Audrey; Hay, Richard G

2016-12-01

There is a lack of understanding and methods for assessing the effects of anthropogenic disruptions, (i.e. river fragmentation due to dam construction) on the extent and degree of groundwater-surface water interaction and geochemical processes affecting the quality of water in semi-arid, coastal catchments. This study applied a novel combination of electrical resistivity tomography (ERT) and elemental and isotope geochemistry in a coastal river disturbed by extended drought and periodic flooding due to the operation of multiple dams. Geochemical analyses show that the saltwater barrier causes an increase in salinity in surface water in the downstream river as a result of limited freshwater inflows, strong evaporation effects on shallow groundwater and mostly stagnant river water, and is not due to saltwater intrusion by tidal flooding. Discharge from bank storage is dominant (~84%) in the downstream fragment and its contribution could increase salinity levels within the hyporheic zone and surface water. When surface water levels go up due to upstream freshwater releases the river temporarily displaces high salinity water trapped in the hyporheic zone to the underlying aquifer. Geochemical modeling shows a higher contribution of distant and deeper groundwater (~40%) in the upstream river and lower discharge from bank storage (~13%) through the hyporheic zone. Recharge from bank storage is a source of high salt to both upstream and downstream portions of the river but its contribution is higher below the dam. Continuous ERT imaging of the river bed complements geochemistry findings and indicate that while lithologically similar, downstream of the dam, the shallow aquifer is affected by salinization while fresher water saturates the aquifer in the upstream fragment. The relative contribution of flows (i.e. surface water releases or groundwater discharge) as related to the river fragmentation control changes of streamwater chemistry and likely impact the interpretation of seasonal trends. Copyright © 2016 Elsevier B.V. All rights reserved.

Characterization of Stormflows and Wastewater Treatment-Plant Effluent Discharges on Water Quality, Suspended Sediment, and Stream Morphology for Fountain and Monument Creek Watersheds, Colorado, 1981-2006

USGS Publications Warehouse

Mau, David P.; Stogner, Sr., Robert W.; Edelmann, Patrick

2007-01-01

In 1998, the U.S. Geological Survey, in cooperation with Colorado Springs City Engineering, began a study of the Fountain and Monument Creek watersheds to characterize water quality and suspended-sediment conditions in the watershed for different flow regimes, with an emphasis on characterizing water quality during storm runoff. Water-quality and suspended-sediment samples were collected in the Fountain and Monument Creek watersheds from 1981 through 2006 to evaluate the effects of stormflows and wastewater-treatment effluent on Fountain and Monument Creeks in the Colorado Springs, Colorado, area. Water-quality data were collected at 11 sites between 1981 and 2001, and 14 tributary sites were added in 2003 to increase spatial coverage and characterize water quality throughout the watersheds. Suspended-sediment samples collected daily at 7 sites from 1998 through 2001, 6 sites daily from 2003 through 2006, and 13 tributary sites intermittently from 2003 through 2006 were used to evaluate the effects of stormflow on suspended-sediment concentrations, discharges, and yields. Data were separated into three flow regimes: base flow, normal flow, and stormflow. Stormflow concentrations from 1998 through 2006 were compared to Colorado acute instream standards and, with the exception of a few isolated cases, did not exceed water-quality standards for inorganic constituents that were analyzed. However, stormflow concentrations of both fecal coliform and Escherichia coli (E. coli) frequently exceeded water-quality standards during 1998 through 2006 on main-stem and tributary sites by more than an order of magnitude. There were two sites on Cottonwood Creek, a tributary to Monument Creek, with elevated concentrations of dissolved nitrite plus nitrate: site 07103985 (TbCr), a tributary to Cottonwood Creek and site 07103990 (lower_CoCr), downstream from site 07103985 (TbCr), and near the confluence with Monument Creek. During base-flow and normal-flow conditions, the median concentrations of dissolved nitrite plus nitrate ranged from 5.1 to 6.1 mg/L and were 4 to 7 times larger than concentrations at the nearest upstream site on Monument Creek, site 07103970 (MoCr_Woodmen). The source of these larger dissolved nitrite plus nitrate concentrations has not been identified, but the fact that all measurements had elevated dissolved nitrite plus nitrate concentrations indicates a relatively constant source. Most stormflow concentrations of dissolved trace elements were smaller than concentrations from base-flow or normal-flow samples. However, median concentrations of total arsenic, copper, lead, manganese, nickel, and zinc generally were much larger during periods of stormflow than during base flow or normal flow. Concentrations of dissolved and total copper, total manganese, total nickel, dissolved and total selenium, and dissolved and total zinc ranged from 3 to 27 times larger at site 07103707 (FoCr_8th) than site 07103700 (FoCr_Manitou) during base flow, indicating a large source of trace elements between these two sites. Both of these sites are located on Fountain Creek, upstream from the confluence with Monument Creek. The likely source area is Gold Hill Mesa, a former tailings pile for a gold refinery located just upstream from the confluence with Monument Creek, and upstream from site 07103707 (FoCr_8th). Farther downstream in Fountain Creek, stormflow samples for total copper, manganese, lead, nickel, and zinc were larger at the downstream site near the city of Security, site 07105800 (FoCr_Security), than at the upstream site near Janitell Road, site 07105530 (FoCr_Janitell), compared with other main-stem sites and indicated a relatively large source of these metals between the two sites. Nitrogen, phosphorus, and trace-element loads substantially increased during stormflow. Suspended-sediment concentrations, discharges, and yields associated with stormflow were significantly larger than those associated with normal flow. The Apr

Hereditary mixed polyposis syndrome is caused by a 40-kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1.

PubMed

Jaeger, Emma; Leedham, Simon; Lewis, Annabelle; Segditsas, Stefania; Becker, Martin; Cuadrado, Pedro Rodenas; Davis, Hayley; Kaur, Kulvinder; Heinimann, Karl; Howarth, Kimberley; East, James; Taylor, Jenny; Thomas, Huw; Tomlinson, Ian

2012-05-06

Hereditary mixed polyposis syndrome (HMPS) is characterized by apparent autosomal dominant inheritance of multiple types of colorectal polyp, with colorectal carcinoma occurring in a high proportion of affected individuals. Here, we use genetic mapping, copy-number analysis, exclusion of mutations by high-throughput sequencing, gene expression analysis and functional assays to show that HMPS is caused by a duplication spanning the 3' end of the SCG5 gene and a region upstream of the GREM1 locus. This unusual mutation is associated with increased allele-specific GREM1 expression. Whereas GREM1 is expressed in intestinal subepithelial myofibroblasts in controls, GREM1 is predominantly expressed in the epithelium of the large bowel in individuals with HMPS. The HMPS duplication contains predicted enhancer elements; some of these interact with the GREM1 promoter and can drive gene expression in vitro. Increased GREM1 expression is predicted to cause reduced bone morphogenetic protein (BMP) pathway activity, a mechanism that also underlies tumorigenesis in juvenile polyposis of the large bowel.

Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

PubMed Central

Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

2005-01-01

Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

Three-Dimensional, Laminar Flow Past a Short, Surface-Mounted Cylinder

NASA Astrophysics Data System (ADS)

Liakos, Anastasios; Malamataris, Nikolaos

2016-11-01

The topology and evolution of three-dimensional flow past a cylinder of slenderness ratio SR = 1 mounted in a wind tunnel is examined for 0 . 1 <= Re <= 325 (based on the diameter of the cylinder) where steady-state solutions have been obtained. Direct numerical simulations were computed using an in-house parallel finite element code. Results indicate that symmetry breaking occurs at Re = 1 , while the first prominent structure is a horseshoe vortex downstream from the cylinder. At Re = 150 , two foci are observed, indicating the formation of two tornadolike vortices downstream. Concurrently, another horseshoe vortex is formed upstream from the cylinder. For higher Reynolds numbers, the flow downstream is segmented to upper and lower parts, whereas the topology of the flow on the solid boundaries remains unaltered. Pressure distributions show that pressure, the key physical parameter in the flow, decreases everywhere except immediately upstream from the cylinder. In addition, creation of critical points from saddle-node-type bifurcations occur when the streamwise component of the pressure gradient changes sign. Finally, at Re = 325 , an additional horseshoe vorrtex is formed at the wake of the cylinder

Discrete modelling of front propagation in backward piping erosion

NASA Astrophysics Data System (ADS)

Tran, Duc-Kien; Prime, Noémie; Froiio, Francesco; Callari, Carlo; Vincens, Eric

2017-06-01

A preliminary discrete numerical model of a REV at the front region of an erosion pipe in a cohesive granular soil is briefly presented. The results reported herein refer to a simulation carried out by coupling the Discrete Element Method (DEM) with the Lattice Boltzmann Method (LBM) for the representation of the granular and fluid phases, respectively. The numerical specimen, consisiting of bonded grains, is tested under fully-saturated conditions and increasing pressure difference between the inlet (confined) and the outlet (unconfined) flow regions. The key role of compression arches of force chains that transversely cross the sample and carry most part of the hydrodynamic actions is pointed out. These arches partition the REV into an upstream region that remains almost intact and a downstream region that gradually degrades and is subsequently eroded in the form of a cluster. Eventually, the collapse of the compression arches causes the upstream region to be also eroded, abruptly, as a whole. A complete presentation of the numerical model and of the results of the simulation can be found in [12].

The control of lambda DNA terminase synthesis.

PubMed Central

Murialdo, H; Davidson, A; Chow, S; Gold, M

1987-01-01

Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

Long-term memory deficits in Pavlovian fear conditioning in Ca2+/calmodulin kinase kinase alpha-deficient mice.

PubMed

Blaeser, Frank; Sanders, Matthew J; Truong, Nga; Ko, Shanelle; Wu, Long Jun; Wozniak, David F; Fanselow, Michael S; Zhuo, Min; Chatila, Talal A

2006-12-01

Signaling by the Ca(2+)/calmodulin kinase (CaMK) cascade has been implicated in neuronal gene transcription, synaptic plasticity, and long-term memory consolidation. The CaM kinase kinase alpha (CaMKKalpha) isoform is an upstream component of the CaMK cascade whose function in different behavioral and learning and memory paradigms was analyzed by targeted gene disruption in mice. CaMKKalpha mutants exhibited normal long-term spatial memory formation and cued fear conditioning but showed deficits in context fear during both conditioning and long-term follow-up testing. They also exhibited impaired activation of the downstream kinase CaMKIV/Gr and its substrate, the transcription factor cyclic AMP-responsive element binding protein (CREB) upon fear conditioning. Unlike CaMKIV/Gr-deficient mice, the CaMKKalpha mutants exhibited normal long-term potentiation and normal levels of anxiety-like behavior. These results demonstrate a selective role for CaMKKalpha in contextual fear memory and suggest that different combinations of upstream and downstream components of the CaMK cascade may serve distinct physiological functions.

Eukaryotic Elongation Factor 1A Interacts with the Upstream Pseudoknot Domain in the 3′ Untranslated Region of Tobacco Mosaic Virus RNA

PubMed Central

Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas

2002-01-01

The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996

[Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

PubMed

Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

2015-04-01

This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

Structural studies of the nudix hydrolase DR1025 from deinococcus radiodurans and its ligand complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ranatunga, Wasantha; Hill, Emma E.; Mooster, Jana L.

We have determined the crystal structure, at 1.4, of the Nudix hydrolase DR1025 from the extremely radiation resistant bacterium Deinococcus radiodurans. The protein forms an intertwined homodimer by exchanging N-terminal segments between chains. We have identified additional conserved elements of the Nudix fold, including the metal-binding motif, a kinked b-strand characterized by a proline two positions upstream of the Nudix consensus sequence, and participation of the N-terminal extension in the formation of the substrate-binding pocket. Crystal structures were also solved of DR1025 crystallized in the presence of magnesium and either a GTP analog or Ap4A (both at 1.6 resolution). Inmore » the Ap4Aco-crystal, the electron density indicated that the product of asymmetric hydrolysis, ATP, was bound to the enzyme. The GTP analog bound structure showed that GTP was bound almost identically as ATP. Neither nucleoside triphosphate was further cleaved.« less

Isolation and characterization of a novel pollen-specific promoter in maize (Zea mays L.).

PubMed

Wang, He; Fan, Mingxia; Wang, Guohong; Zhang, Chunyu; Shi, Lei; Wei, Zhengyi; Ma, Wenjuan; Chang, Jing; Huang, Senxin; Lin, Feng

2017-06-01

ZmSTK2_USP, located on the long arm of chromosome 4, belongs to the serine/threonine kinase gene in maize. The sequence analysis of 2100 bp upstream from the start codon ATG has shown that it contains cis-element motifs and two types of anther/pollen-specific promoter elements (GTGA and AGAAA), suggesting that it is the pollen-specific promoter. To investigate the function of ZmSTK2_USP promoter, the GUS gene fusion system was employed. In proZmSTK2_USP-GUS genetically modified plants, GUS activity was detected in mature pollen grains and pollen tubes but not found in other floral and vegetative tissues. These results show that proZmSTK2_USP is the pollen-specific promoter and drives pollen-specific activity during the middle stage of pollen development until pollen maturation.

Characterization of New Otic Enhancers of the Pou3f4 Gene Reveal Distinct Signaling Pathway Regulation and Spatio-Temporal Patterns

PubMed Central

Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta

2010-01-01

POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840

Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

PubMed

Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

1999-01-01

In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

Proteome and phosphoproteome analysis of commensally induced dendritic cell maturation states.

PubMed

Korkmaz, Ali Giray; Popov, Todor; Peisl, Loulou; Codrea, Marius Cosmin; Nahnsen, Sven; Steimle, Alexander; Velic, Ana; Macek, Boris; von Bergen, Martin; Bernhardt, Joerg; Frick, Julia-Stefanie

2018-05-30

Dendritic cells (DCs) can shape the immune system towards an inflammatory or tolerant state depending on the bacterial antigens and the environment they encounter. In this study we provide a proteomic catalogue of differentially expressed proteins between distinct DC maturation states, brought about by bacteria that differ in their endotoxicity. To achieve this, we have performed proteomics and phosphoproteomics on murine DC cultures. Symbiont and pathobiont bacteria were used to direct dendritic cells into a semi-mature and fully-mature state, respectively. The comparison of semi-mature and fully-mature DCs revealed differential expression in 103 proteins and differential phosphorylation in 118 phosphosites, including major regulatory factors of central immune processes. Our analyses predict that these differences are mediated by upstream elements such as SOCS1, IRF3, ABCA1, TLR4, and PTGER4. Our analyses indicate that the symbiont bacterial strain affects DC proteome in a distinct way, by downregulating inflammatory proteins and activating anti-inflammatory upstream regulators. Biological significance In this study we have investigated the responses of immune cells to distinct bacterial stimuli. We have used the symbiont bacterial strain B. vulgatus and the pathobiont E. coli strain to stimulate cultured primary dendritic cells and performed a shotgun proteome analysis to investigate the protein expression and phosphorylation level differences on a genome level. We have observed expression and phosphorylation level differences in key immune regulators, transcription factors and signal transducers. Moreover, our subsequent bioinformatics analysis indicated regulation at several signaling pathways such as PPAR signaling, LXR/RXR activation and glucocorticoid signaling pathways, which are not studied in detail in an inflammation and DC maturation context. Our phosphoproteome analysis showed differential phosphorylation in 118 phosphosites including those belonging to epigenetic regulators, transcription factors and major cell cycle regulators. We anticipate that our study will facilitate further investigation of immune cell proteomes under different inflammatory and non-inflammatory conditions. Copyright © 2017. Published by Elsevier B.V.

Hepatocyte nuclear factor-4alpha is a central transactivator of the mouse Ntcp gene.

PubMed

Geier, Andreas; Martin, Ina V; Dietrich, Christoph G; Balasubramaniyan, Natarajan; Strauch, Sonja; Suchy, Frederick J; Gartung, Carsten; Trautwein, Christian; Ananthanarayanan, Meenakshisundaram

2008-08-01

Sodium taurocholate cotransporting polypeptide (Ntcp) is the major uptake system for conjugated bile acids. Deletions of hepatocyte nuclear factor (HNF)-1alpha and retinoid X receptor-alpha:retinoic acid receptor-alpha binding sites in the mouse 5'-flanking region corresponding to putatively central regulatory elements of rat Ntcp do not significantly reduce promoter activity. We hypothesized that HNF-4alpha, which is increasingly recognized as a central regulator of hepatocyte function, may directly transactivate mouse (mNtcp). A 1.1-kb 5'-upstream region including the mouse Ntcp promoter was cloned and compared with the rat promoter. In contrast to a moderate 3.5-fold activation of mNtcp by HNF-1alpha, HNF-4alpha cotransfection led to a robust 20-fold activation. Deletion analysis of mouse and rat Ntcp promoters mapped a conserved HNF-4alpha consensus site at -345/-326 and -335/-316 bp, respectively. p-475bpmNtcpLUC is not transactivated by HNF-1alpha but shows a 50-fold enhanced activity upon cotransfection with HNF-4alpha. Gel mobility shift assays demonstrated a complex of the HNF-4alpha-element formed with liver nuclear extracts that was blocked by an HNF-4alpha specific antibody. HNF-4alpha binding was confirmed by chromatin immunoprecipitation. Using Hepa 1-6 cells, HNF-4alpha-knockdown resulted in a significant 95% reduction in NTCP mRNA. In conclusion, mouse Ntcp is regulated by HNF-4alpha via a conserved distal cis-element independently of HNF-1alpha.

Environmental correlates of upstream migration of yellow-phase American eels in the Potomac River drainage

USGS Publications Warehouse

Welsh, Stuart A.; Heather L. Liller,

2013-01-01

Assessing the relationships between upstream migration and environmental variables is important to understanding the ecology of yellow-phase American Eels Anguilla rostrata. During an American Eel migration study within the lower Shenandoah River (Potomac River drainage), we counted and measured American Eels at the Millville Dam eel ladder for three periods: 14 May–23 July 2004, 7–30 September 2004, and 1 June–31 July 2005. Using generalized estimating equations, we modeled each time series of daily American Eel counts by fitting time-varying environmental covariates of lunar illumination (LI), river discharge (RD), and water temperature (WT), including 1-d and 2-d lags of each covariate. Information-theoretic approaches were used for model selection and inference. A total of 4,847 American Eels (19–74 cm total length) used the ladder during the three periods, including 2,622 individuals during a 2-d span following a hurricane-induced peak in river discharge. Additive-effects models of RD + WT, a 2-d lag of LI + RD, and LI + RD were supported for the three periods, respectively. Parameter estimates were positive for river discharge for each time period, negative for lunar illumination for two periods and positive for water temperature during one period. Additive-effects models supported synergistic influences of environmental variables on the upstream migration of yellow-phase American Eels, although river discharge was consistently supported as an influential correlate of upstream migration.

Influence of Wastewater Discharge on the Metabolic Potential of the Microbial Community in River Sediments.

PubMed

Li, Dong; Sharp, Jonathan O; Drewes, Jörg E

2016-01-01

To reveal the variation of microbial community functions during water filtration process in river sediments, which has been utilized widely in natural water treatment systems, this study investigates the influence of municipal wastewater discharge to streams on the phylotype and metabolic potential of the microbiome in upstream and particularly various depths of downstream river sediments. Cluster analyses based on both microbial phylogenetic and functional data collectively revealed that shallow upstream sediments grouped with those from deeper subsurface downstream regions. These sediment samples were distinct from those found in shallow downstream sediments. Functional genes associated with carbohydrate, xenobiotic, and certain amino acid metabolisms were overrepresented in upstream and deep downstream samples. In contrast, the more immediate contact with wastewater discharge in shallow downstream samples resulted in an increase in the relative abundance of genes associated with nitrogen, sulfur, purine and pyrimidine metabolisms, as well as restriction-modification systems. More diverse bacterial phyla were associated with upstream and deep downstream sediments, mainly including Actinobacteria, Planctomycetes, and Firmicutes. In contrast, in shallow downstream sediments, genera affiliated with Betaproteobacteria and Gammaproteobacteria were enriched with putative functions that included ammonia and sulfur oxidation, polyphosphate accumulation, and methylotrophic bacteria. Collectively, these results highlight the enhanced capabilities of microbial communities residing in deeper stream sediments for the transformation of water contaminants and thus provide a foundation for better design of natural water treatment systems to further improve the removal of contaminants.

The genomic view of genes responsive to the antagonistic phytohormones, abscisic acid, and gibberellin.

PubMed

Yazaki, Junshi; Kikuchi, Shoshi

2005-01-01

We now have the various genomics tools for monocot (Oryza sativa) and a dicot (Arabidopsis thaliana) plant. Plant is not only a very important agricultural resource but also a model organism for biological research. It is important that the interaction between ABA and GA is investigated for controlling the transition from embryogenesis to germination in seeds using genomics tools. These studies have investigated the relationship between dormancy and germination using genomics tools. Genomics tools identified genes that had never before been annotated as ABA- or GA-responsive genes in plant, detected new interactions between genes responsive to the two hormones, comprehensively characterized cis-elements of hormone-responsive genes, and characterized cis-elements of rice and Arabidopsis. In these research, ABA- and GA-regulated genes have been classified as functional proteins (proteins that probably function in stress or PR tolerance) and regulatory proteins (protein factors involved in further regulation of signal transduction). Comparison between ABA and/or GA-responsive genes in rice and those in Arabidopsis has shown that the cis-element has specificity in each species. cis-Elements for the dehydration-stress response have been specified in Arabidopsis but not in rice. cis-Elements for protein storage are remarkably richer in the upstream regions of the rice gene than in those of Arabidopsis.

Multiple circadian transcriptional elements cooperatively regulate cell-autonomous transcriptional oscillation of Period3, a mammalian clock gene.

PubMed

Matsumura, Ritsuko; Akashi, Makoto

2017-09-29

Cell-autonomous oscillation in clock gene expression drives circadian rhythms. The development of comprehensive analytical techniques, such as bioinformatics and ChIP-sequencing, has enabled the genome-wide identification of potential circadian transcriptional elements that regulate the transcriptional oscillation of clock genes. However, detailed analyses using traditional biochemical and molecular-biological approaches, such as binding and reporter assays, are still necessary to determine whether these potential circadian transcriptional elements are actually functional and how significantly they contribute to driving transcriptional oscillation. Here, we focused on the molecular mechanism of transcriptional oscillations in the mammalian clock gene Period3 ( Per3 ). The PER3 protein is essential for robust peripheral clocks and is a key component in circadian output processes. We found three E box-like elements located upstream of human Per3 transcription start sites that additively contributed to cell-autonomous transcriptional oscillation. However, we also found that Per3 is still expressed in a circadian manner when all three E box-like elements are functionally impaired. We noted that Per3 transcription was activated by the synergistic actions of two D box-like elements and the three E box-like elements, leading to a drastic increase in circadian amplitude. Interestingly, circadian expression of Per3 was completely disrupted only when all five transcriptional elements were functionally impaired. These results indicate that three E box-like and two D box-like elements cooperatively and redundantly regulate cell-autonomous transcriptional oscillation of Per3 . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Hydrochemical study of an arsenic-contaminated plain in Guandu, north Taiwan

NASA Astrophysics Data System (ADS)

Hsiao, Yu-Hsiang

2015-04-01

Arsenic pollution in Guandu Plain, north Taiwan is a critical issue due to highly developed anthropogenic activities. It was considered that arsenic was carried in by surface water system. Two major rivers, Huanggang Creek and South Huang Greek, flow through Guandu Plain. Both creeks originate from Tatung Volcano Group, which is extensively active in post-volcanic activities. In this study, the hydrochemistry along the two major rivers was studied for tracing the source of arsenic pollution in Guandu Plain. The pH values in the upstream water are in the range from 6 to 8 but dramatically decrease down to 2-4.5 in the downstream area. It can be concluded that the creeks are recharged with very low pH geothermal water. In addition, arsenic shows a different spatial distribution. In Huanggang Creek, arsenic concentration is much higher, about 200 ppb to 500 ppb, in the downstream than in the upstream while arsenic concentration is extremely low, below 1 ppb, in the downstream of South Huang Greek. The geochemical results show that rare earth elements (REEs) are depleted in the upstream both in Huanggang creek and South Huang creek, and the NASC-normalized ratios of heavy to light REE (Lu/La) in the upstream are very close to 1. This demonstrates that the upstream water is geochemically dominated by the interaction between water and sedimentary rock. In the downstream, the NASC-normalized REE pattern shows a quit different type which is depleted in light REEs (much higher Lu/La ratio). It is well known that igneous rock is depleted in light REEs; therefore, arsenic is possibly volcanic origin. In this study, PHREEQC, a thermodynamic modeling program, was also utilized to calculate the saturation index (SI) of hydrous ferric oxide (HFO), which can effectively scavenge arsenic in water. The results demonstrate that SI of HFO is mainly controlled by pH in this study. When pH is greater than 3.5, HFO start to precipitate and remove arsenic from water. Therefore, it is believed that the arsenic pollution in Guandu Plain could result from HFO co-precipitation due to the increase of pH when Huanggang creek and South Huang creek flow through the land.

[Bacteriophage λ: electrostatic properties of the genome and its elements].

PubMed

Krutinina, G G; Krutinin, E A; Kamzolova, S G; Osypov, A A

2015-01-01

Bacteriophage λ is a classical model object in molecular biology, but little is still known on the physical properties of its DNA and regulatory elements. A study was made of the electrostatic properties of phage λ DNA and regulatory elements. A global electrostatic potential distribution along the phage genome was found to be nonuniform with main regulatory elements being located in a limited region with a high potential. The RNA polymerase binding frequency on the linearized phage chromosome directly correlates with its local potential. Strong promoters of the phage and its host Escherichia coli have distinct electrostatic upstream elements, which differ in nucleotide sequence. Attachment and recombination sites of phage λ and its host have a higher potential, which possibly facilitates their recognition by integrase. Phage λ and host Rho-independent terminators have a symmetrical M-shaped potential profile, which only slightly depends on the annotated terminator palindrome length, and occur in a region with a substantially higher potential, which may cause polymerase retention, facilitating the formation of a terminator hairpin in RNA. It was concluded that virtually all elements of phage λ genome have potential distribution specifics, which are related to their structural properties and may play a role in their biological function. The global potential distribution along the phage genome reflects the architecture of the regulation of its transcription and integration in the host genome.

Modeling strategic competition in hydro-thermal electricity generation markets with cascaded reservoir-hydroelectric generation plants

NASA Astrophysics Data System (ADS)

Uluca, Basak

This dissertation aims to achieve two goals. The first is to model the strategic interactions of firms that own cascaded reservoir-hydro plants in oligopolistic and mixed oligopolistic hydrothermal electricity generation markets. Although competition in thermal generation has been extensively modeled since the beginning of deregulation, the literature on competition in hydro generation is still limited; in particular, equilibrium models of oligopoly that study the competitive behavior of firms that own reservoir-hydro plants along the same river in hydrothermal electricity generation markets are still under development. In competitive markets, when the reservoirs are located along the same river, the water released from an upstream reservoir for electricity generation becomes input to the immediate downstream reservoir, which may be owned by a competitor, for current or future use. To capture the strategic interactions among firms with cascaded reservoir-hydro plants, the Upstream-Conjecture approach is proposed. Under the Upstream-Conjecture approach, a firm with an upstream reservoir-hydro plant assumes that firms with downstream reservoir-hydro plants will respond to changes in the upstream firm's water release by adjusting their water release by the same amount. The results of the Upstream Conjecture experiments indicate that firms that own upstream reservoirs in a cascade may have incentive to withhold or limit hydro generation, forcing a reduction in the utilization of the downstream hydro generation plants that are owned by competitors. Introducing competition to hydroelectricity generation markets is challenging and ownership allocation of the previously state-owned cascaded reservoir-hydro plants through privatization can have significant impact on the competitiveness of the generation market. The second goal of the dissertation is to extract empirical guidance about best policy choices for the ownership of the state-owned generation plants, including the cascaded reservoir-hydro plants. Specifically, an equilibrium model of oligopoly, where only private firms compete for electricity supply is proposed. Since some electricity generation markets are better characterized as mixed oligopolies, where the public firm coexists with the private firms for electricity supply, and not as oligopolies, another equilibrium model of mixed oligopoly is proposed. The proposed mixed oligopoly equilibrium model is the first implementation of such market structure in electricity markets. The mathematical models developed in this research are applied to the simplified representation of the Turkish electricity generation market to investigate the impact of various ownership allocation scenarios that may result from the privatization of the state owned generation plants, including the cascaded reservoir-hydro plants, on the competitive market outcomes.

Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

NASA Technical Reports Server (NTRS)

Frudakis, T. N.; Wilt, F.

1995-01-01

The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation

PubMed Central

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G.; Xie, Jiuyong

2012-01-01

The molecular basis of cell signal-regulated alternative splicing at the 3′ splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3′ splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3′ splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3′ splice site usage. PMID:22684629

Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.

PubMed

Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N

1999-01-01

The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.

Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

PubMed

Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

2016-01-15

Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

PubMed Central

Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

2015-01-01

Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

Application of direct-reading and elemental carbon analysis methods to measure mass-based penetration of carbon nanotubes through elastomeric half-face and filtering facepiece respirators.

PubMed

Vo, Evanly; Zhuang, Ziqing; Birch, Eileen; Birch, Quinn

2016-01-01

The aim of this study was to apply a direct-reading aerosol instrument method and an elemental carbon (EC) analysis method to measure the mass-based penetration of single-walled carbon nanotubes (SWCNTs) and multi-walled carbon nanotubes (MWCNTs) through elastomeric half-mask respirators (EHRs) and filtering facepiece respirators (FFRs). For the direct-reading aerosol instrument method, two scanning mobility particle sizer/aerodynamic particle sizer systems were used to simultaneously determine the upstream (outside respirator) and downstream (inside respirator) test aerosols. For the EC analysis method, upstream and downstream CNTs were collected on filter cassettes and then analyzed using a thermal-optical technique. CNT mass penetrations were found in both methods to be within the associated efficiency requirements for each type and class of the respirator models that were tested. Generally, the penetrations of SWCNTs and MWCNTs had a similar trend with penetration being the highest for the N95 EHRs, followed by N95 FFRs, P100 EHRs, and P100 FFRs. This trend held true for both methods; however, the CNT penetration determined by the direct-reading aerosol instrument method (0.009-1.09% for SWCNTs and 0.005-0.21% for MWCNTs) was greater relative to the penetration values found through EC analysis method (0.007-0.69% for SWCNTs and 0.004-0.13% for MWCNTs). The results of this study illustrate considerations for how the methods can be used to evaluate penetration of morphologically complex materials through FFRs and EHRs.

Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

1987-11-01

To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

PubMed

Wang, F; Samudio, I; Safe, S

2001-01-01

The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

Prototyping phase of the high heat flux scraper element of Wendelstein 7-X

DOE PAGES

Boscary, Jean; Greuner, Henri; Ehrke, G.; ...

2016-03-24

The water-cooled high heat flux scraper element aims to reduce excessive heat loads on the target element ends of the actively cooled divertor of Wendelstein 7-X. Its purpose is to intercept some of the plasma fluxes both upstream and downstream before they reach the divertor surface. The scraper element has 24 identical plasma facing components (PFCs) divided into 6 modules. One module has 4 PFCs hydraulically connected in series by 2 water boxes. A PFC, 247 mm long and 28 mm wide, has 13 monoblocks made of CFC NB31 bonded by hot isostatic pressing onto a CuCrZr cooling tube equippedmore » with a copper twisted tape. 4 full-scale prototypes of PFCs have been successfully tested in the GLADIS facility up to 20 MW/m 2. The difference observed between measured and calculated surface temperatures is probably due to the inhomogeneity of CFC properties. The design of the water box prototypes has been detailed to allow the junction between the cooling pipe of the PFCs and the water boxes by internal orbital welding. In conclusion, the prototypes are presently under fabrication.« less

Two ABREs, two redundant root-specific and one W-box cis-acting elements are functional in the sunflower HAHB4 promoter.

PubMed

Manavella, Pablo A; Dezar, Carlos A; Ariel, Federico D; Chan, Raquel L

2008-10-01

HAHB4 is a sunflower gene encoding a homeodomain-leucine zipper (HD-Zip) transcription factor. It was previously demonstrated that this gene is regulated at the transcriptional level by several abiotic factors and hormones. A previous analysis in the PLACE database revealed the presence of four putative ABREs. In this work these four elements and also one W-box and two root-specific expression elements were characterized as functional. Site-directed mutagenesis on the promoter, stable transformation of Arabidopis plants as well as transient transformation of sunflower leaves, were performed. The analysis of the transformants was carried out by histochemistry and real time RT-PCR. The results indicate that just one ABRE out of the four is responsible for ABA, NaCl and drought regulation. However, NaCl induction occurs also by an additional ABA-independent way involving another two overlapped ABREs. On the other hand, it was determined that the W-box located 5' upstream is responsive to ethylene and only two root-specific expression elements, among the several detected, are functional but redundant. Conservation of molecular mechanisms between sunflower and Arabidopsis is strongly supported by this experimental work.

The KRAS Promoter Responds to Myc-associated Zinc Finger and Poly(ADP-ribose) Polymerase 1 Proteins, Which Recognize a Critical Quadruplex-forming GA-element*

PubMed Central

Cogoi, Susanna; Paramasivam, Manikandan; Membrino, Alexandro; Yokoyama, Kazunari K.; Xodo, Luigi E.

2010-01-01

The murine KRAS promoter contains a G-rich nuclease hypersensitive element (GA-element) upstream of the transcription start site that is essential for transcription. Pulldown and chromatin immunoprecipitation assays demonstrate that this GA-element is bound by the Myc-associated zinc finger (MAZ) and poly(ADP-ribose) polymerase 1 (PARP-1) proteins. These proteins are crucial for transcription, because when they are knocked down by short hairpin RNA, transcription is down-regulated. This is also the case when the poly(ADP-ribosyl)ation activity of PARP-1 is inhibited by 3,4-dihydro-5-[4-(1-piperidinyl) butoxyl]-1(2H) isoquinolinone. We found that MAZ specifically binds to the duplex and quadruplex conformations of the GA-element, whereas PARP-1 shows specificity only for the G-quadruplex. On the basis of fluorescence resonance energy transfer melting and polymerase stop assays we saw that MAZ stabilizes the KRAS quadruplex. When the capacity of folding in the GA-element is abrogated by specific G → T or G → A point mutations, KRAS transcription is down-regulated. Conversely, guanidine-modified phthalocyanines, which specifically interact with and stabilize the KRAS G-quadruplex, push the promoter activity up to more than double. Collectively, our data support a transcription mechanism for murine KRAS that involves MAZ, PARP-1 and duplex-quadruplex conformational changes in the promoter GA-element. PMID:20457603

Piloted rich-catalytic lean-burn hybrid combustor

DOEpatents

Newburry, Donald Maurice

2002-01-01

A catalytic combustor assembly which includes, an air source, a fuel delivery means, a catalytic reactor assembly, a mixing chamber, and a means for igniting a fuel/air mixture. The catalytic reactor assembly is in fluid communication with the air source and fuel delivery means and has a fuel/air plenum which is coated with a catalytic material. The fuel/air plenum has cooling air conduits passing therethrough which have an upstream end. The upstream end of the cooling conduits is in fluid communication with the air source but not the fuel delivery means.

Electrically heated particulate filter using catalyst striping

DOEpatents

Gonze, Eugene V; Paratore, Jr., Michael J; Ament, Frank

2013-07-16

An exhaust system that processes exhaust generated by an engine is provided. The system generally includes a particulate filter (PF) that filters particulates from the exhaust wherein an upstream end of the PF receives exhaust from the engine. A grid of electrically resistive material is applied to an exterior upstream surface of the PF and selectively heats exhaust passing through the grid to initiate combustion of particulates within the PF. A catalyst coating is applied to the PF that increases a temperature of the combustion of the particulates within the PF.

View looking south from sidewalk includes halfthrough west girder on ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

View looking south from sidewalk includes half-through west girder on left and raging river (upstream) on right. - Raging River Bridge No. 234A, Preston-Fall City Road & Southeast Forty-fourth Place, Fall City, King County, WA

Reducing Urban Greenhouse Gas Footprints.

PubMed

Pichler, Peter-Paul; Zwickel, Timm; Chavez, Abel; Kretschmer, Tino; Seddon, Jessica; Weisz, Helga

2017-11-07

Cities are economically open systems that depend on goods and services imported from national and global markets to satisfy their material and energy requirements. Greenhouse Gas (GHG) footprints are thus a highly relevant metric for urban climate change mitigation since they not only include direct emissions from urban consumption activities, but also upstream emissions, i.e. emissions that occur along the global production chain of the goods and services purchased by local consumers. This complementary approach to territorially-focused emission accounting has added critical nuance to the debate on climate change mitigation by highlighting the responsibility of consumers in a globalized economy. Yet, city officials are largely either unaware of their upstream emissions or doubtful about their ability to count and control them. This study provides the first internationally comparable GHG footprints for four cities (Berlin, Delhi NCT, Mexico City, and New York metropolitan area) applying a consistent method that can be extended to other global cities using available data. We show that upstream emissions from urban household consumption are in the same order of magnitude as cities' overall territorial emissions and that local policy leverage to reduce upstream emissions is larger than typically assumed.

Upstream migratory behaviour of wild and ranched Atlantic salmon Salmo salar at a natural obstacle in a coastal spate river.

PubMed

Kennedy, R J; Moffett, I; Allen, M M; Dawson, S M

2013-09-01

The upstream migratory behaviour of wild and ranched Atlantic salmon Salmo salar in a small Irish coastal spate river was investigated using acoustic telemetry. Prespawning migratory behaviour was investigated including movement patterns at a large natural waterfall in the lower reaches of the river. A strong diurnal pattern was observed for upstream migrants at the waterfall indicative of the need for daylight to ascend this complex natural obstacle to migration. Successful passage of the waterfall was also associated with distinct environmental conditions and no difference in migratory ability was detected between wild and ranched origin S. salar. Wild S. salar tended to exhibit a non-erratic, stepwise upstream migration pattern after ascending the waterfall while ranched S. salar had an increased probability of displaying more erratic migratory behaviour. Wild S. salar penetrated further into the river catchment than ranched S. salar, although male ranched S. salar exhibited the greatest cumulative distance moved prior to the spawning period. The management implications of escaped or released ranched S. salar and movement at natural obstacles are discussed. © 2013 The Fisheries Society of the British Isles.

Genome-wide analyses implicate 33 loci in heritable dog osteosarcoma, including regulatory variants near CDKN2A/B

PubMed Central

2013-01-01

Background Canine osteosarcoma is clinically nearly identical to the human disease, but is common and highly heritable, making genetic dissection feasible. Results Through genome-wide association analyses in three breeds (greyhounds, Rottweilers, and Irish wolfhounds), we identify 33 inherited risk loci explaining 55% to 85% of phenotype variance in each breed. The greyhound locus exhibiting the strongest association, located 150 kilobases upstream of the genes CDKN2A/B, is also the most rearranged locus in canine osteosarcoma tumors. The top germline candidate variant is found at a >90% frequency in Rottweilers and Irish wolfhounds, and alters an evolutionarily constrained element that we show has strong enhancer activity in human osteosarcoma cells. In all three breeds, osteosarcoma-associated loci and regions of reduced heterozygosity are enriched for genes in pathways connected to bone differentiation and growth. Several pathways, including one of genes regulated by miR124, are also enriched for somatic copy-number changes in tumors. Conclusions Mapping a complex cancer in multiple dog breeds reveals a polygenic spectrum of germline risk factors pointing to specific pathways as drivers of disease. PMID:24330828

75 FR 31361 - Proposed Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-03

... source(s) elevation ground [caret] Elevation Communities affected in meters (MSL) Effective Modified... meter. ** BFEs to be changed include the listed downstream and upstream BFEs, and include BFEs located... Sea Level, rounded to the nearest 0.1 meter. ** BFEs to be changed include the listed downstream and...

REINTERPRETATION OF SLOWDOWN OF SOLAR WIND MEAN VELOCITY IN NONLINEAR STRUCTURES OBSERVED UPSTREAM OF EARTH'S BOW SHOCK

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parks, G. K.; Lin, N.; Lee, E.

2013-07-10

Two of the many features associated with nonlinear upstream structures are (1) the solar wind (SW) mean flow slows down and deviates substantially and (2) the temperature of the plasma increases in the structure. In this Letter, we show that the SW beam can be present throughout the entire upstream event maintaining a nearly constant beam velocity and temperature. The decrease of the velocity is due to the appearance of new particles moving in the opposite direction that act against the SW beam and reduce the mean velocity as computed via moments. The new population, which occupies a larger velocitymore » space, also contributes to the second moment, increasing the temperature. The new particles include the reflected SW beam at the bow shock and another population of lower energies, accelerated nearby at the shock or at the boundary of the nonlinear structures.« less

Composition and energy spectra of low energy ions observed upstream of the earth's bow shock on ISEE-1

NASA Technical Reports Server (NTRS)

Ipavich, F. M.; Galvin, A. B.; Gloeckler, G.; Hovestadt, D.; Klecker, B.; Scholer, M.; Fan, C. Y.; Fisk, L. A.; Ogallagher, J. J.

1980-01-01

The characteristics of eleven locally accelerated particle events in the energy range from 30 to 125 keV/Q observed upstream of the earth's bow shock have been determined, including composition, energy spectra, and intensity versus time profiles. The measurements were made with the Ultra Low Energy Charge Analyzer sensor on ISEE-1. The composition in these events is similar to that of the solar wind, with a He to proton ratio of 8% and a CNO to He ratio of 6%. The composition is reasonably constant only when evaluated at equal energy per charge. The energy spectra cannot be adequately fit by a single power law in energy; an exponential or Maxwellian in energy per charge gives a satisfactory representation of the spectra. The time-intensity profiles of these upstream events show an inverse velocity dispersion, which may provide clues to the responsible acceleration mechanism.

On-line soft sensing in upstream bioprocessing.

PubMed

Randek, Judit; Mandenius, Carl-Fredrik

2018-02-01

This review provides an overview and a critical discussion of novel possibilities of applying soft sensors for on-line monitoring and control of industrial bioprocesses. Focus is on bio-product formation in the upstream process but also the integration with other parts of the process is addressed. The term soft sensor is used for the combination of analytical hardware data (from sensors, analytical devices, instruments and actuators) with mathematical models that create new real-time information about the process. In particular, the review assesses these possibilities from an industrial perspective, including sensor performance, information value and production economy. The capabilities of existing analytical on-line techniques are scrutinized in view of their usefulness in soft sensor setups and in relation to typical needs in bioprocessing in general. The review concludes with specific recommendations for further development of soft sensors for the monitoring and control of upstream bioprocessing.

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

PubMed

Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

2012-07-01

The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

Design of microfluidic channels for magnetic separation of malaria-infected red blood cells

PubMed Central

Wu, Wei-Tao; Martin, Andrea Blue; Gandini, Alberto; Aubry, Nadine; Massoudi, Mehrdad; Antaki, James F.

2016-01-01

This study is motivated by the development of a blood cell filtration device for removal of malaria-infected, parasitized red blood cells (pRBCs). The blood was modeled as a multi-component fluid using the computational fluid dynamics discrete element method (CFD-DEM), wherein plasma was treated as a Newtonian fluid and the red blood cells (RBCs) were modeled as soft-sphere solid particles which move under the influence of drag, collisions with other RBCs, and a magnetic force. The CFD-DEM model was first validated by a comparison with experimental data from Han et al. 2006 (Han and Frazier 2006) involving a microfluidic magnetophoretic separator for paramagnetic deoxygenated blood cells. The computational model was then applied to a parametric study of a parallel-plate separator having hematocrit of 40% with a 10% of the RBCs as pRBCs. Specifically, we investigated the hypothesis of introducing an upstream constriction to the channel to divert the magnetic cells within the near-wall layer where the magnetic force is greatest. Simulations compared the efficacy of various geometries upon the stratification efficiency of the pRBCs. For a channel with nominal height of 100 µm, the addition of an upstream constriction of 80% improved the proportion of pRBCs retained adjacent to the magnetic wall (separation efficiency) by almost 2 fold, from 26% to 49%. Further addition of a downstream diffuser reduced remixing, hence improved separation efficiency to 72%. The constriction introduced a greater pressure drop (from 17 to 495 Pa), which should be considered when scaling-up this design for a clinical-sized system. Overall, the advantages of this design include its ability to accommodate physiological hematocrit and high throughput – which is critical for clinical implementation as a blood-filtration system. PMID:27761107

Minimizing the threat of pandemic emergence from avian influenza in poultry systems.

PubMed

Pepin, Kim M; Lloyd-Smith, James O; Webb, Colleen T; Holcomb, Karen; Zhu, Huachen; Guan, Yi; Riley, Steven

2013-12-16

Live-animal markets are a culturally important feature of meat distribution chains in many populations, yet they provide an opportunity for the maintenance and transmission of potentially emergent zoonotic pathogens. The ongoing human outbreak of avian H7N9 in China highlights the need for increased surveillance and control in these live-bird markets (LBMs). Closure of retail markets in affected areas rapidly decreased human cases to rare, sporadic occurrence, but little attention has been paid thus far to the role of upstream elements of the poultry distribution chain such as wholesale markets. This could partly explain why transmission in poultry populations has not been eliminated more broadly. We present surveillance data from both wholesale live-bird markets (wLBMs) and rLBMs in Shantou, China (from 2004-2006), and call on disease-dynamic theory to illustrate why closing rLBMs has only minor effects on the overall volume of transmission. We show that the length of time birds stay in rLBMs can severely limit transmission there, but that the system-wide effect may be reduced substantially by high levels of transmission upstream of retail markets. Management plans that minimize transmission throughout the entire poultry supply chain are essential for minimizing exposure to the public. These include reducing stay-time of birds in markets to 1 day, standardizing poultry supply chains to limit transmission in pre-retail settings, and monitoring strains with epidemiological traits that pose a high risk of emergence. These actions will further limit human exposure to extant viruses and reduce the likelihood of the emergence of novel strains by decreasing the overall volume of transmission.

Suppression of HPV-16 late L1 5′-splice site SD3632 by binding of hnRNP D proteins and hnRNP A2/B1 to upstream AUAGUA RNA motifs

PubMed Central

Li, Xiaoze; Johansson, Cecilia; Glahder, Jacob; Mossberg, Ann-Kristin; Schwartz, Stefan

2013-01-01

Human papillomavirus type 16 (HPV-16) 5′-splice site SD3632 is used exclusively to produce late L1 mRNAs. We identified a 34-nt splicing inhibitory element located immediately upstream of HPV-16 late 5′-splice site SD3632. Two AUAGUA motifs located in these 34 nt inhibited SD3632. Two nucleotide substitutions in each of the HPV-16 specific AUAGUA motifs alleviated splicing inhibition and induced late L1 mRNA production from episomal forms of the HPV-16 genome in primary human keratinocytes. The AUAGUA motifs bind specifically not only to the heterogeneous nuclear RNP (hnRNP) D family of RNA-binding proteins including hnRNP D/AUF, hnRNP DL and hnRNP AB but also to hnRNP A2/B1. Knock-down of these proteins induced HPV-16 late L1 mRNA expression, and overexpression of hnRNP A2/B1, hnRNP AB, hnRNP DL and the two hnRNP D isoforms hnRNP D37 and hnRNP D40 further suppressed L1 mRNA expression. This inhibition may allow HPV-16 to hide from the immune system and establish long-term persistent infections with enhanced risk at progressing to cancer. There is an inverse correlation between expression of hnRNP D proteins and hnRNP A2/B1 and HPV-16 L1 production in the cervical epithelium, as well as in cervical cancer, supporting the conclusion that hnRNP D proteins and A2/B1 inhibit HPV-16 L1 mRNA production. PMID:24013563

Non-additive interactions involving two distinct elements mediate sloppy-paired regulation by pair-rule transcription factors

PubMed Central

Prazak, Lisa; Fujioka, Miki; Gergen, J. Peter

2010-01-01

The relatively simple combinatorial rules responsible for establishing the initial metameric expression of sloppy-paired-1 (slp1) in the Drosophila blastoderm embryo make this system an attractive model for investigating the mechanism of regulation by pair rule transcription factors. This investigation of slp1 cis-regulatory architecture identifies two distinct elements, a proximal early stripe element (PESE) and a distal early stripe element (DESE) located from −3.1 kb to −2.5 kb and from −8.1 kb to −7.1 kb upstream of the slp1 promoter, respectively, that mediate this early regulation. The proximal element expresses only even-numbered stripes and mediates repression by Even-skipped (Eve) as well as by the combination of Runt and Fushi-tarazu (Ftz). A 272 basepair sub-element of PESE retains Eve-dependent repression, but is expressed throughout the even-numbered parasegments due to the loss of repression by Runt and Ftz. In contrast, the distal element expresses both odd and even-numbered stripes and also drives inappropriate expression in the anterior half of the odd-numbered parasegments due to an inability to respond to repression by Eve. Importantly, a composite reporter gene containing both early stripe elements recapitulates pair-rule gene-dependent regulation in a manner beyond what is expected from combining their individual patterns. These results indicate interactions involving distinct cis-elements contribute to the proper integration of pair-rule regulatory information. A model fully accounting for these results proposes that metameric slp1 expression is achieved through the Runt-dependent regulation of interactions between these two pair-rule response elements and the slp1 promoter. PMID:20435028

Energetic-ion acceleration and transport in the upstream region of Jupiter: Voyager 1 and 2

NASA Technical Reports Server (NTRS)

Baker, D. N.; Zwickl, R. D.; Carbary, J. F.; Krimigis, S. M.; Lepping, R. P.

1982-01-01

Long-lived upstream energetic ion events at Jupiter appear to be very similar in nearly all respects to upstream ion events at Earth. A notable difference between the two planetary systems is the enhanced heavy ion compositional signature reported for the Jovian events. This compositional feature has suggested that ions escaping from the Jovian magnetosphere play an important role in forming upstream ion populations at Jupiter. In contrast, models of energetic upstream ions at Earth emphasize in situ acceleration of reflected solar wind ions within the upstream region itself. Using Voyager 1 and 2 energetic ( approximately 30 keV) ion measurements near the magnetopause, in the magnetosheath, and immediately upstream of the bow shock, the compositional patterns are examined together with typical energy spectra in each of these regions. A model involving upstream Fermi acceleration early in events and emphasizing energetic particle escape in the prenoon part of the Jovian magnetosphere late in events is presented to explain many of the features in the upstream region of Jupiter.

Design and performance of a 427-meter-per-second-tip-speed two-stage fan having a 2.40 pressure ratio

NASA Technical Reports Server (NTRS)

Cunnan, W. S.; Stevans, W.; Urasek, D. C.

1978-01-01

The aerodynamic design and the overall and blade-element performances are presented of a 427-meter-per-second-tip-speed two-stage fan designed with axially spaced blade rows to reduce noise transmitted upstream of the fan. At design speed the highest recorded adiabatic efficiency was 0.796 at a pressure of 2.30. Peak efficiency was not established at design speed because of a damper failure which terminated testing prematurely. The overall efficiencies, at 60 and 80 percent of design speed, peaked at approximately 0.83.

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

Genome-wide DNA methylation map of human neutrophils reveals widespread inter-individual epigenetic variation

PubMed Central

Chatterjee, Aniruddha; Stockwell, Peter A.; Rodger, Euan J.; Duncan, Elizabeth J.; Parry, Matthew F.; Weeks, Robert J.; Morison, Ian M.

2015-01-01

The extent of variation in DNA methylation patterns in healthy individuals is not yet well documented. Identification of inter-individual epigenetic variation is important for understanding phenotypic variation and disease susceptibility. Using neutrophils from a cohort of healthy individuals, we generated base-resolution DNA methylation maps to document inter-individual epigenetic variation. We identified 12851 autosomal inter-individual variably methylated fragments (iVMFs). Gene promoters were the least variable, whereas gene body and upstream regions showed higher variation in DNA methylation. The iVMFs were relatively enriched in repetitive elements compared to non-iVMFs, and were associated with genome regulation and chromatin function elements. Further, variably methylated genes were disproportionately associated with regulation of transcription, responsive function and signal transduction pathways. Transcriptome analysis indicates that iVMF methylation at differentially expressed exons has a positive correlation and local effect on the inclusion of that exon in the mRNA transcript. PMID:26612583

The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat.

PubMed Central

Lu, X; Welsh, T M; Peterlin, B M

1993-01-01

The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708

A coupled agronomic-economic model to consider allocation of brackish irrigation water

NASA Astrophysics Data System (ADS)

Ben-Gal, Alon; Weikard, Hans-Peter; Shah, Syed Hamid Hussain; van der Zee, Sjoerd E. A. T. M.

2013-05-01

In arid and semiarid regions, irrigation water is scarce and often contains high concentrations of salts. To reduce negative effects on crop yields, the irrigated amounts must include water for leaching and therefore exceed evapotranspiration. The leachate (drainage) water returns to water sources such as rivers or groundwater aquifers and increases their level of salinity and the leaching requirement for irrigation water of any sequential user. We develop a conceptual sequential (upstream-downstream) model of irrigation that predicts crop yields and water consumption and tracks the water flow and level of salinity along a river dependent on irrigation management decisions. The model incorporates an agro-physical model of plant response to environmental conditions including feedbacks. For a system with limited water resources, the model examines the impacts of water scarcity, salinity and technically inefficient application on yields for specific crop, soil, and climate conditions. Moving beyond the formulation of a conceptual frame, we apply the model to the irrigation of Capsicum annum on Arava Sandy Loam soil. We show for this case how water application could be distributed between upstream and downstream plots or farms. We identify those situations where it is beneficial to trade water from upstream to downstream farms (assuming that the upstream farm holds the water rights). We find that water trade will improve efficiency except when loss levels are low. We compute the marginal value of water, i.e., the price water would command on a market, for different levels of water scarcity, salinity and levels of water loss.

The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

PubMed

Gaji, Rajshekhar Y; Howe, Daniel K

2009-07-01

The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

Mycobacterium tuberculosis Exploits a Molecular Off Switch of the Immune System for Intracellular Survival.

PubMed

von Both, Ulrich; Berk, Maurice; Agapow, Paul-Michael; Wright, Joseph D; Git, Anna; Hamilton, Melissa Shea; Goldgof, Greg; Siddiqui, Nazneen; Bellos, Evangelos; Wright, Victoria J; Coin, Lachlan J; Newton, Sandra M; Levin, Michael

2018-01-12

Mycobacterium tuberculosis (M. tuberculosis) survives and multiplies inside human macrophages by subversion of immune mechanisms. Although these immune evasion strategies are well characterised functionally, the underlying molecular mechanisms are poorly understood. Here we show that during infection of human whole blood with M. tuberculosis, host gene transcriptional suppression, rather than activation, is the predominant response. Spatial, temporal and functional characterisation of repressed genes revealed their involvement in pathogen sensing and phagocytosis, degradation within the phagolysosome and antigen processing and presentation. To identify mechanisms underlying suppression of multiple immune genes we undertook epigenetic analyses. We identified significantly differentially expressed microRNAs with known targets in suppressed genes. In addition, after searching regions upstream of the start of transcription of suppressed genes for common sequence motifs, we discovered novel enriched composite sequence patterns, which corresponded to Alu repeat elements, transposable elements known to have wide ranging influences on gene expression. Our findings suggest that to survive within infected cells, mycobacteria exploit a complex immune "molecular off switch" controlled by both microRNAs and Alu regulatory elements.

Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

PubMed Central

Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

1993-01-01

Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

New insights into replication origin characteristics in metazoans

PubMed Central

Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

2012-01-01

We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

Effects of aquifer storage and recovery activities on water quality in the Little Arkansas River and Equus Beds Aquifer, south-central Kansas, 2011–14

USGS Publications Warehouse

Stone, Mandy L.; Garrett, Jessica D.; Poulton, Barry C.; Ziegler, Andrew C.

2016-07-18

The Equus Beds aquifer in south-central Kansas is aprimary water source for the city of Wichita. The Equus Beds aquifer storage and recovery (ASR) project was developed to help the city of Wichita meet increasing current (2016) and future water demands. The Equus Beds ASR project pumps water out of the Little Arkansas River during above-base flow conditions, treats it using drinking-water quality standards as a guideline, and recharges it into the Equus Beds aquifer for later use. Phase II of the Equus Beds ASR project currently (2016) includes a river intake facility and a surface-water treatment facility with a 30 million gallon per day capacity. Water diverted from the Little Arkansas River is delivered to an adjacent presedimentation basin for solids removal. Subsequently, waste from the surface-water treatment facility and the presedimentation basin is returned to the Little Arkansas River through a residuals return line. The U.S. Geological Survey, in cooperation with the city of Wichita, developed and implemented a hydrobiological monitoring program as part of the ASR project to characterize and quantify the effects of aquifer storage and recovery activities on the Little Arkansas River and Equus Beds aquifer water quality.Data were collected from 2 surface-water sites (one upstream and one downstream from the residuals return line), 1 residuals return line site, and 2 groundwater well sites (each having a shallow and deep part): the Little Arkansas River upstream from the ASR facility near Sedgwick, Kansas (upstream surface-water site 375350097262800), about 0.03 mile (mi) upstream from the residuals return line site; the Little Arkansas River near Sedgwick, Kans. (downstream surface-water site 07144100), about 1.68 mi downstream from the residuals return line site; discharge from the Little Arkansas River ASR facility near Sedgwick, Kansas (residuals return line site 375348097262800); 25S 01 W 07BCCC01 SMW–S11 near CW36 (MW–7 shallow groundwater well site 375327097285401); 25S01 W 07BCCC02 DMW–S10 near CW36 (MW–7 deep groundwater well site 375327097285402); 25S 01W 07BCCA01 SMW–S13 near CW36 (MW–8 shallow groundwater well site 375332097284801); and 25S 01W 07BCCA02 DMW–S14 near CW36 (MW–8 deep groundwater well site 375332097284802). The U.S. Geological Survey, in cooperation with the city of Wichita, assessed the effects of the ASR Phase II facility residuals return line discharges on stream quality of the Little Arkansas River by measuring continuous physicochemical properties and collecting discrete water-quality and sediment samples for about 2 years pre- (January 2011 through April 2013) and post-ASR (May 2013 through December 2014) Phase II facility operation upstream and downstream from the ASR Phase II facility. Additionally, habitat variables were quantified and macroinvertebrate and fish communities were sampled upstream and downstream from the ASR Phase II facility during the study period. To assess the effects of aquifer recharge on Equus Beds groundwater quality, continuous physicochemical properties were measured and discrete water-quality samples were collected before and during the onset of Phase II aquifer recharge in two (shallow and deep) groundwater wells.Little Arkansas River streamflow was about 10 times larger after the facility began operating because of greater rainfall. Residuals return line release volumes were a very minimal proportion (0.06 percent) of downstream streamflow volume during the months the ASR facility was operating. Upstream and downstream continuously measured water temperature and dissolved oxygen median differences were smaller post-ASR than pre-ASR. Turbidity generally was smaller at the downstream site throughout the study period and decreased at both sites after the ASR Phase II facility began discharging despite a median residuals return line turbidity that was about an order of magnitude larger than the median turbidity at the downstream site. Upstream and downstream continuously measured turbidity median differences were larger post-ASR than pre-ASR. Median post-ASR continuously measured nitrite plus nitrate and continuously computed total suspended solids and suspended-sediment concentrations were smaller than pre-ASR likely because of higher streamflows and dilution; whereas, median continuously computed dissolved and total organic carbon concentrations were larger likely because of higher streamflows and runoff conditions.None of the discretely measured water-quality constituents (dissolved and suspended solids, primary ions, suspended sediment, nutrients, carbon, trace elements, viral and bacterial indicators, and pesticides) in surface water were significantly different between the upstream and downstream sites after the ASR Phase II facility began discharging; however, pre-ASR calcium, sodium, hardness, manganese, and arsenate concentrations were significantly larger at the upstream site, which indicates that some water-quality conditions at the upstream and downstream sites were more similar post-ASR. Most of the primary constituents that make up dissolved solids decreased at both sites after the ASR Phase II facility began operation. Discretely collected total suspended solids concentrations were similar between the upstream and downstream sites before the facility began operating but were about 27 percent smaller at the downstream site after the facility began operating, despite the total suspended solids concentrations in the residuals return line being 15 times larger than the downstream site.Overall habitat scores were indicative of suboptimal conditions upstream and downstream from the ASR Phase II facility throughout the study period. Substrate fouling and sediment deposition mean scores indicated marginal conditions at the upstream and downstream sites during the study period, demonstrating that sediment deposition was evident pre- and post-ASR and no substantial changes in these habitat characteristics were noted after the ASR Phase II facility began discharging. Macroinvertebrate community composition (evaluated using functional feeding, behavioral, and tolerance metrics) generally was similar between sites during the study period. Fewer macroinvertebrate metrics were significant between the upstream and downstream sites post-ASR (6) than pre-ASR (14), which suggests that macroinvertebate communities were more similar after the ASR facility began discharging. Upstream-downstream comparisons in macroinvertebrate aquatic-life-support metrics had no significant differences for the post-ASR time period and neither site was fully supporting for any of the Kansas Department of Health and Environment aquatic-life-support metrics (Macroinvertebrate Biotic Index; Kansas Biotic Index with tolerances for nutrients and oxygen-demanding substances; Ephemeroptera, Plecoptera, and Trichoptera [EPT] richness; and percentage of EPT species). Overall, using macroinvertebrate aquatic life-support criteria from the Kansas Department of Health and Environment, upstream and downstream sites were classified as partially supporting before and after the onset of ASR facility operations. Fish community trophic status and tolerance groups generally were similar among sites during the study period. Fish community Little Arkansas River Basin Index of Biotic Integrity scores at the upstream and downstream sites were indicative of fair-to-good conditions before the facility began operating and decreased to fair conditions after the facility began operating.Groundwater physicochemical changes concurrent with the beginning of recharge operations at the Sedgwick basin were more pronounced in shallow groundwater. No constituent concentrations in the pre-recharge period in comparison to the post-recharge period increased to concentrations exceeding drinking water regulations; however, nitrate decreased significantly from a pre-recharge exceedance of the U.S. Environmental Protection Agency maximum contaminant level to a post recharge nonexceedance. Shallow groundwater chemical concentrations or rates of detection increased after artificial recharge began for the ions potassium, chloride, and fluoride; phosphorus and organic carbon species; trace elements barium, manganese, nickel, arsenate, arsenic, and boron; agricultural pesticides atrazine, metolachlor, metribuzin, and simazine; organic disinfection byproducts bromodichloromethane and trichloromethane; and gross beta levels. Additionally, water temperature, and pH were larger after recharge began; and total solids and slime-forming bacteria concentrations and densities were smaller. Total solids, nitrate, and selenium significantly decreased; and potassium, chloride, nickel, arsenic, fluoride, phosphorus and carbon species, and gross beta levels significantly increased in shallow groundwater after artificial recharge. Results of biological activity reaction tests indicated that water quality microbiology was different before and after artificial recharge began; at times, these differences may lead to changes in dominant bacterial populations that, in turn, may lead to formation and expansion in populations that may cause bioplugging and other unwanted effects. Calcite, iron (II) hydroxide, hydroxyapatite, and similar minerals, had shifts in saturation indices that generally were from undersaturation toward equilibrium and, in some cases, toward oversaturation. These shifts toward neutral saturation indices might suggest reduced weathering of the minerals present in the Equus Beds aquifer. Chemical weathering in the shallow parts of the aquifer may be accelerated because of the increased water temperatures and the system is more vulnerable to clogged pores and mineral dissolution as the equilibrium state is affected by recharge and withdrawal. When oversaturation is indicated for iron minerals, plugging of aquifer materials may happen.

Upstream Passage, Spawning, and Stock Identification of Fall Chinook in the Snake River, 1992 and 1993 : Final Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, H. Lee; Mendel, Glen W.

This final report of the 3-year study summarizes activities and results for 1993. Study objectives were to: (1) determine the source of losses (or accounting errors) for adult chinook salmon between Ice Harbor Dam (IHR) and Lower Granite Dam (LGR), and upstream of LGR in the Snake River; (2) identify spawning locations upstream of LGR for calibration of aerial redd surveys, redd habitat mapping, carcass recovery for genetic stock profile analysis, and correction of estimated adult/redd ratios; and (3) estimate passage and migration times at Snake River. 200 fall chinook salmon were radio tagged and tracked with aerial, fixed-site, andmore » ground mobile tracking. Fish were released upstream of IHR at Charbonneau Park (CHAR). 190 of the fish were tracked or relocated away from CHAR. 59 fish descended to below IHR without crossing Lower Monumental Dam (LMO). Another 128 salmon passed upstream of LMO without falling back at IHR. Only 80 salmon passed Little Goose Dam (LGO) without falling back at a downstream dam; 66 of these fish passed LGR. Many fish that fell back reascended the dams. A total of 72 salmon released at CHAR passed upstream of LGR, including fish that had fallen back and reascended a dam. Over 80 percent of the salmon that entered Lyons Ferry Hatchery each year had reached LGO before descending to the hatchery. Extensive wandering was documented between LMO and upstream of LGR before salmon entered Lyons Ferry Hatchery or the Tucannon River. In 1993, 41 salmon were found to be of hatchery origin when recovered. These fish entered Lyons Ferry Hatchery with similar movements to unmarked salmon. Each year a few salmon have remained near the hatchery without entering, which suggests the hatchery may have inadequate attraction flows. Fall chinook passed lower Snake River dams in 2-5 days each on average. Median travel times through LMO and LGO were 1.0-1.3 days each, which was slower than for spring chinook or steelhead in 1993. 5 refs., 21 figs., 20 tabs.« less

Detections, concentrations, and distributional patterns of compounds of emerging concern in the San Antonio River Basin, Texas, 2011-12

USGS Publications Warehouse

Opsahl, Stephen P.; Lambert, Rebecca B.

2013-01-01

The distributional patterns of detections and concentrations of individual compounds and compound classes show the influence of wastewater-treatment plant (WWTP) outfalls on the quality of water in the San Antonio River Basin. In the Medina River Subbasin, the minimal influence of wastewater is evident as far downstream as the Macdona site. Downstream from the Macdona site, the Medina River receives treated municipal wastewater from both the Medio Creek Water Recycling Center site from an unnamed tributary at the plant and the Leon Creek Water Recycling Center site from Comanche Creek at the plant, and corresponding increases in both the number of detections and the total concentrations of all measured compounds at all downstream sampling sites were evident. Similarly, the San Antonio River receives treated municipal wastewater as far upstream as the SAR Witte site (San Antonio River at Witte Museum, San Antonio, Tex.) and additional WWTP outfalls along the Medina River upstream from the confluence of the Medina and San Antonio Rivers. Consequently, all samples collected along the main stem of the San Antonio River had higher concentrations of CECs in comparison to sites without upstream WWTPs. Sites in urbanized areas without upstream WWTPs include the Leon 35 site (Leon Creek at Interstate Highway 35, San Antonio, Tex.), the Alazan site (Alazan Creek at Tampico Street, San Antonio, Tex.), and the San Pedro site (San Pedro Creek at Probandt Street, at San Antonio, Tex.). The large number of detections at sites with no upstream wastewater source demonstrated that CECs can be detected in streams flowing through urbanized areas without a large upstream source of treated municipal wastewater. A general lack of detection of pharmaceuticals in streams without upstream outfalls of treated wastewater appears to be typical for streams throughout the San Antonio River Basin and may be a useful indicator of point-source versus nonpoint-source contributions of these compounds in urban streams. Observations of lower concentrations of compounds at the furthest downstream sampling sites in the basin indicate some natural attenuation of these compounds during transport; however, a more focused assessment is needed to make this determination.

Eco-Design of River Fishways for Upstream Passage: Application for Hanfeng Dam, Pengxi River, China

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Gary E.; Rainey, William S.

2012-05-20

This paper provides a scientific approach to eco-design of river fishways to allow upstream movement of fish past new and existing dams in China. This eco-design approach integrates principles of fish ecology/behavior and engineering, a scientific field also known as bio-engineering or eco-hydraulics. We define a fishway as a structure or mechanism to convey fish upstream past a dam. Man-made or natural stream beds can be part of the fishway mechanism. Fish include bony and non-bony fishes, and upstream passage is the concern here, not downstream passage. The problem is dams block access to upstream habitat used for spawning, rearing,more » and refuge, i.e., dams decrease habitat connectivity. A solution to alleviate this problem is to design fishways, preferably while the dam is being designed, but if necessary, as retrofits afterward to provide a route that fish can and will use to pass safely upstream without undue delay. Our eco-design approach for fishways involves eight steps: 1) identify the primary species of importance; 2) understand basic ecology and behavior of these fish; 3) characterize the environmental conditions where passage is or will be blocked; 4 identify fishway alternatives and select a preferred alternative; 5) establish eco-design criteria for the fishway, either from management agencies or, if necessary, developed specifically for the given site; 6) where needed, identify and perform research required to resolve critical uncertainties and finalize the eco-design criteria; 7) apply the eco-design criteria and site-specific considerations to design the fishway, involving peer-review by local stakeholders in the process; 8) build the fishway, monitor its effectiveness, and apply the lessons learned. Example fishways are described showing a range of eco-designs depending on the dam site and fish species of concern. We apply the eco-design principles to recommend an approach and next steps for a fishway to pass fish upstream at Hanfeng Dam, an existing regulating dam forming Hanfeng Lake on the Pengxi River near Kaixian, China.« less

Concentric tube support assembly

DOEpatents

Rubio, Mark F.; Glessner, John C.

2012-09-04

An assembly (45) includes a plurality of separate pie-shaped segments (72) forming a disk (70) around a central region (48) for retaining a plurality of tubes (46) in a concentrically spaced apart configuration. Each segment includes a support member (94) radially extending along an upstream face (96) of the segment and a plurality of annularly curved support arms (98) transversely attached to the support member and radially spaced apart from one another away from the central region for receiving respective upstream end portions of the tubes in arc-shaped spaces (100) between the arms. Each segment also includes a radial passageway (102) formed in the support member for receiving a fluid segment portion (106) and a plurality of annular passageways (104) formed in the support arms for receiving respective arm portions (108) of the fluid segment portion from the radial passageway and for conducting the respective arm portions into corresponding annular spaces (47) formed between the tubes retained by the disk.

Turbine exhaust diffuser with a gas jet producing a coanda effect flow control

DOEpatents

Orosa, John; Montgomery, Matthew

2014-02-11

An exhaust diffuser system and method for a turbine engine includes an inner boundary and an outer boundary with a flow path defined therebetween. The inner boundary is defined at least in part by a hub structure that has an upstream end and a downstream end. The outer boundary may include a region in which the outer boundary extends radially inward toward the hub structure and may direct at least a portion of an exhaust flow in the diffuser toward the hub structure. The hub structure includes at least one jet exit located on the hub structure adjacent to the upstream end of the tail cone. The jet exit discharges a flow of gas substantially tangential to an outer surface of the tail cone to produce a Coanda effect and direct a portion of the exhaust flow in the diffuser toward the inner boundary.

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

Long-term Records of Trace Metal Elements in Core Sediments: Anthropogenic Impacts in The Eure River Watershed

NASA Astrophysics Data System (ADS)

Gardes, T.; Debret, M.; Copard, Y.; Patault, E.; Deloffre, J.; Marcotte, S.; Develle, A. L.; Sabatier, P.; Chaumillon, E.; Coulombier, T.; Revillon, S.; Nizou, J.; Laberdesque, Y.; Koltalo, F.

2017-12-01

The Martot Dam is located in the Eure River Watershed (Normandy, France), few hundred meters upstream the Eure-Seine Rivers confluence. In the context of the European Water Framework Directive (2000/60/EC), the French Authorities planned to remove this dam in 2017. Nevertheless, impacts of the removal remain poorly studied. Classically, dam blocked sedimentary transfers downstream, but here, sediments are not blocked behind the dam but stored three hundred meters upstream in a hydraulic annex, called the Martot Pond. Furthermore, this pond is submitted to the tidal flow from the Seine Estuary despite the Martot Dam. The aim of the study is to evaluate the dam removal impacts on sedimentary transfers and re-suspension of contaminated sediments stored in the Martot Pond and the Eure River's channel. Concerning past transfers and sediments accumulation in the Eure River Watershed, sedimentary archives have been cored, before dam removal, at the Martot Pond and the Les Damps Pond (located 10km upstream the latter). Dating of sedimentary cores for both ponds indicates a sedimentation rate around 1 cm y-1. Trace metal elements quantification showed a wide metallic contamination with highest concentrations evidenced during the 1950-1960's (As: 13-22 mg kg-1; Cd: 40-55 mg kg-1; Cr: 170-210 mg kg-1; Cu: 400-490 mg kg-1; Hg: 2.3 mg kg-1; Mn: 1,280-2,200 mg kg-1; Ni: 64-75 mg kg-1; Zn: 905-990 mg kg-1) and the 1990-2000's (Cr: 95-215 mg kg-1; Ni: 100 mg kg-1; Pb: 670-855 mg kg-1). These variations of concentrations along cores can be associated with industrial past of the Eure River Watershed and sources of contamination can be identified. Thereby, Zn, Ni or Hg contamination could be associated with wastes of battery factory released in the Eure River during the economic recovery, while Pb contamination is linked to the activities of a cathode-ray tubes factory. Metals quantification in core materials highlighted anthropogenic impacts in the Eure River Watershed. These contaminated sediments could be re-suspended and transferred to the Seine River in case of remobilization in Martot Pond and the Eure River's channel after dam removal.

The control of the upstream movement of fish with pulsated direct current

USGS Publications Warehouse

McLain, Alberton L.

1957-01-01

In the Silver River, 78,648 fish comprising 21 species were taken from the trap of the direct-current diversion device. The total kill of fish moving upstream, including 289 sea lampreys, was 1,016, or 1.3 percent. This river had presented a serious problem in the operation of an alternating-current control device during previous seasons. In 1955, 85.5 percent of three important species of fish were killed at the control structure. During 1956, this mortality was reduced to 8.1 percent by the operation of the direct-current equipment.

Modifications to the Langley 8-foot transonic pressure tunnel for the laminar flow control experiment

NASA Technical Reports Server (NTRS)

Harris, Charles D.; Brooks, Cuyler W., Jr.

1988-01-01

Modifications to the NASA Langley 8 Foot Transonic Pressure Tunnel in support of the Lamina Flow Control (LFC) Experiment included the installation of a honeymoon and five screens in the settling chamber upstream of the test section 41-long test section liner that extended from the upstream end of the test section contraction region, through the best section, and into the diffuser. The honeycomb and screens were installed as permanent additions to the facility, and the liner was a temporary addition to be removed at the conclusion of the LFC Experiment. These modifications are briefly described.

Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation.

PubMed

Naville, Magali; Gautheret, Daniel

2010-01-01

Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.

Spatial characterization, risk assessment, and statistical source identification of the dissolved trace elements in the Ganjiang River-feeding tributary of the Poyang Lake, China.

PubMed

Zhang, Hua; Jiang, Yinghui; Wang, Min; Wang, Peng; Shi, Guangxun; Ding, Mingjun

2017-01-01

Surface water samples were collected from 20 sampling sites throughout the Ganjiang River during pre-monsoon, monsoon, and post-monsoon seasons, and the concentrations of dissolved trace elements were determined by inductively coupled plasma-mass spectrometry (ICP-MS) for the spatial and seasonal variations, risk assessment, source identification, and categorization for risk area. The result demonstrated that concentrations of the elements exhibited significant seasonality. The high total element concentrations were detected at sites close to the intensive mining and urban activities. The concentrations of the elements were under the permissible limits as prescribed by related standards with a few exceptions. The most of heavy metal pollution index (HPI) values were lower than the critical index limit, indicating the basically clean water used as habitat for aquatic life. As was identified as the priority pollutant of non-carcinogenic and carcinogenic concerns, and the inhabitants ingesting the surface water at particular site might be subjected to the integrated health risks for exposure to the mixed trace elements. Multivariate statistical analyses confirmed that Zn, As, Cd, and Tl were derived from mining and urban activities; V, Cd, and Pb exhibited mixed origin; and Co, Ni, and Cu mainly resulted from natural processes. Three categorized risk areas corresponded to high, moderate, and low risks, respectively. As a whole, the upstream of the Ganjiang River was identified as the high-risk area relatively.

An empirical investigation of methods for nonsymmetric linear systems

NASA Technical Reports Server (NTRS)

Sherman, A. H.

1981-01-01

The present investigation is concerned with a comparison of methods for solving linear algebraic systems which arise from finite difference discretizations of the elliptic convection-diffusion equation in a planar region Omega with Dirichlet boundary conditions. Such linear systems are typically of the form Ax = b where A is an N x N sparse nonsymmetric matrix. In a discussion of discretizations, it is assumed that a regular rectilinear mesh of width h has been imposed on Omega. The discretizations considered include central differences, upstream differences, and modified upstream differences. Six methods for solving Ax = b are considered. Three variants of Gaussian elimination have been chosen as representatives of state-of-the-art software for direct methods under different assumptions about pivoting. Three iterative methods are also included.

Investigating the Control of Chlorophyll Degradation by Genomic Correlation Mining.

PubMed

Ghandchi, Frederick P; Caetano-Anolles, Gustavo; Clough, Steven J; Ort, Donald R

2016-01-01

Chlorophyll degradation is an intricate process that is critical in a variety of plant tissues at different times during the plant life cycle. Many of the photoactive chlorophyll degradation intermediates are exceptionally cytotoxic necessitating that the pathway be carefully coordinated and regulated. The primary regulatory step in the chlorophyll degradation pathway involves the enzyme pheophorbide a oxygenase (PAO), which oxidizes the chlorophyll intermediate pheophorbide a, that is eventually converted to non-fluorescent chlorophyll catabolites. There is evidence that PAO is differentially regulated across different environmental and developmental conditions with both transcriptional and post-transcriptional components, but the involved regulatory elements are uncertain or unknown. We hypothesized that transcription factors modulate PAO expression across different environmental conditions, such as cold and drought, as well as during developmental transitions to leaf senescence and maturation of green seeds. To test these hypotheses, several sets of Arabidopsis genomic and bioinformatic experiments were investigated and re-analyzed using computational approaches. PAO expression was compared across varied environmental conditions in the three separate datasets using regression modeling and correlation mining to identify gene elements co-expressed with PAO. Their functions were investigated as candidate upstream transcription factors or other regulatory elements that may regulate PAO expression. PAO transcript expression was found to be significantly up-regulated in warm conditions, during leaf senescence, and in drought conditions, and in all three conditions significantly positively correlated with expression of transcription factor Arabidopsis thaliana activating factor 1 (ATAF1), suggesting that ATAF1 is triggered in the plant response to these processes or abiotic stresses and in result up-regulates PAO expression. The proposed regulatory network includes the freezing, senescence, and drought stresses modulating factor ATAF1 and various other transcription factors and pathways, which in turn act to regulate chlorophyll degradation by up-regulating PAO expression.

Detection of DNA polymerase λ activity during seed germination and enhancement after salinity stress and dehydration in the plumules of indica rice (Oryza sativa L.

PubMed

Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan

2015-02-01

DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars.

Structural and functional analysis of myostatin-2 promoter alleles from the marine fish Sparus aurata: evidence for strong muscle-specific promoter activity and post-transcriptional regulation.

PubMed

Nadjar-Boger, Elisabeth; Hinits, Yaniv; Funkenstein, Bruria

2012-09-25

Myostatin (MSTN) is a negative regulator of skeletal muscle growth. In contrast to mammals, fish possess at least two paralogs of MSTN: MSTN-1 and MSTN-2. In this study, we analyzed the structural-functional features of the four variants of Sparus aurata MSTN-2 5'-flanking region: saMSTN-2a, saMSTN-2as, saMSTN-2b and saMSTN-2c. In silico analysis revealed numerous putative cis regulatory elements including several E-boxes known as binding sites to myogenic transcription factors. Transient transfection experiments using non-muscle and muscle cell lines showed surprisingly high transcriptional activity in muscle cells, suggesting the presence of regulatory elements unique to differentiated myotubes. These observations were confirmed by in situ intramuscular injections of promoter DNA followed by reporter gene assays. Moreover, high promoter activity was found in differentiated neural cell, in agreement with MSTN-2 expression in brain. Progressive 5'-deletion analysis, using reporter gene assays, showed that the core promoter is located within the first -127 bp upstream of the ATG, and suggested the presence of regulatory elements that either repress or induce transcriptional activity. Transient transgenic zebrafish provided evidence for saMSTN-2 promoter ability to direct GFP expression to myofibers. Finally, our data shows that although no mature saMSTN-2 mRNA is observed in muscle; unspliced forms accumulate, confirming high level of transcription. In conclusion, our study shows for the first time that MSTN-2 promoter is a very robust promoter, especially in muscle cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development.

PubMed

Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G

2010-12-01

The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. © 2010 Blackwell Publishing Ltd.

Geochemical baseline studies and relations between water quality and streamflow in the upper Blackfoot Watershed, Montana: data for July 1997-December 1998

USGS Publications Warehouse

Nagorski, Sonia A.; Moore, Johnnie N.; Smith, David B.

2001-01-01

We used ultraclean sampling techniques to study the solute (operationally defined as <0.2 ?m) surface water geochemistry at five sites along the Upper Blackfoot River and four sites along the Landers Fork, some in more detail and more regularly than others. We collected samples also from Hogum Creek, a tributary to the Blackfoot, from Copper Creek, a tributary to the Landers Fork, and from ground water seeps contributing to the flow along the Landers Fork. To better define the physical dynamics of the hydrologic system and to determine geochemical loads, we measured streamflow at all the sites where we took samples for water quality analysis. The Upper Blackfoot River, which drains historic mines ca. 20 Km upstream of the study area, had higher trace metal concentrations than did the Landers Fork, which drains the pristine Scapegoat Wilderness area. In both rivers, many of the major elements were inversely related to streamflow, and at some sites, several show a hysteresis effect in which the concentrations were lower on the rising limb of the hydrograph than on the falling limb. However, many of the trace elements followed far more irregular trends, especially in the Blackfoot River. Elements such as As, Cu, Fe, Mn, S, and Zn exhibited complex and variable temporal patterns, which included almost no response to streamflow differences, increased concentrations following a summer storm and at the start of snowmelt in the spring, and/or increased concentrations throughout the course of spring runoff. In summary, complex interactions between the timing and magnitude of streamflow with physical and chemical processes within the watershed appeared to greatly influence the geochemistry at the sites, and streamflow values alone were not good predictors of solute concentrations in the rivers.

Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

PubMed

Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

2017-12-01

Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors.

PubMed

López-Lastra, M; Gabus, C; Darlix, J L

1997-11-01

The murine leukemia virus (MLV)-related type C viruses constitute a major class of retroviruses that includes numerous endogenous and exogenous mammalian viruses and the related avian spleen necrosis virus (SNV). The MLV-related viruses possess a long and multifunctional 5' untranslated leader involved in key steps of the viral life cycle--splicing, translation, RNA dimerization, encapsidation, and reverse transcription. Recent studies have shown that the 5' leader of Friend murine leukemia virus and Moloney murine leukemia virus can direct cap independent translation of gag precursor proteins (Berlioz et al., 1995; Vagner et al., 1995b). These data, together with structural homology studies (Koning et al., 1992), prompted us to undertake a search for new internal ribosome entry segment (IRES) of retroviral origin. Here we describe an IRES element within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. Data show that the REV-A 5' IRES element maps downstream of the packaging/dimerization (E/DLS) sequence (Watanabe and Temin, 1982; Darlix et al., 1992) and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452-580) of the 5' leader, immediately upstream of the gag AUG codon. The REV-A IRES has been successfully utilized in the construction of novel high titer MLV-based retroviral vectors, containing one or more IRES elements of retroviral origin. These retroviral constructs, which represent a starting point for the design of novel vectors suitable for gene therapy, are also of interest as a model system of internal translation initiation and its possible regulation during development, cancer, or virus infection.

Defining fish nursery habitats: an application of otolith elemental fingerprinting in Tampa Bay, Florida

USGS Publications Warehouse

Ley, Janet A.; McIvor, Carole C.; Peebles, Ernst B; Rolls, Holly; Cooper, Suzanne T.

2009-01-01

Fishing in Tampa Bay enhances the quality of life of the area's residents and visitors. However, people's desire to settle along the Bay's shorelines and tributaries has been detrimental to the very habitat believed to be crucial to prime target fishery species. Common snook (Centropomus undecimalis) and red drum (Sciaenops ocellatus) are part of the suite of estuarine fishes that 1) are economically or ecologically prominent, and 2) have complex life cycles involving movement between open coastal waters and estuarine nursery habitats, including nursery habitats that are located within upstream, low-salinity portions of the Bay?s tidal tributaries. We are using an emerging microchemical technique -- elemental fingerprinting of fish otoliths -- to determine the degree to which specific estuarine locations contribute to adult fished populations in Tampa Bay. In ongoing monitoring surveys, over 1,000 young-of-the-year common snook and red drum have already been collected from selected Tampa Bay tributaries. Using laser ablation-inductively coupled plasma - mass spectrometry (LA-ICP-MS), we are currently processing a subsample of these archived otoliths to identify location-specific fingerprints based on elemental microchemistry. We will then analyze older fish from the local fishery in order to match them to their probable nursery areas, as defined by young-of-the-year otoliths. We expect to find that some particularly favorable nursery locations contribute disproportionately to the fished population. In contrast, other nursery areas may be degraded, or act as 'sinks', thereby decreasing their contribution to the fish population. Habitat managers can direct strategic efforts to protect any nursery locations that are found to be of prime importance in contributing to adult stocks.

The genome of the yellow potato cyst nematode, Globodera rostochiensis, reveals insights into the basis of parasitism and virulence.

PubMed

Eves-van den Akker, Sebastian; Laetsch, Dominik R; Thorpe, Peter; Lilley, Catherine J; Danchin, Etienne G J; Da Rocha, Martine; Rancurel, Corinne; Holroyd, Nancy E; Cotton, James A; Szitenberg, Amir; Grenier, Eric; Montarry, Josselin; Mimee, Benjamin; Duceppe, Marc-Olivier; Boyes, Ian; Marvin, Jessica M C; Jones, Laura M; Yusup, Hazijah B; Lafond-Lapalme, Joël; Esquibet, Magali; Sabeh, Michael; Rott, Michael; Overmars, Hein; Finkers-Tomczak, Anna; Smant, Geert; Koutsovoulos, Georgios; Blok, Vivian; Mantelin, Sophie; Cock, Peter J A; Phillips, Wendy; Henrissat, Bernard; Urwin, Peter E; Blaxter, Mark; Jones, John T

2016-06-10

The yellow potato cyst nematode, Globodera rostochiensis, is a devastating plant pathogen of global economic importance. This biotrophic parasite secretes effectors from pharyngeal glands, some of which were acquired by horizontal gene transfer, to manipulate host processes and promote parasitism. G. rostochiensis is classified into pathotypes with different plant resistance-breaking phenotypes. We generate a high quality genome assembly for G. rostochiensis pathotype Ro1, identify putative effectors and horizontal gene transfer events, map gene expression through the life cycle focusing on key parasitic transitions and sequence the genomes of eight populations including four additional pathotypes to identify variation. Horizontal gene transfer contributes 3.5 % of the predicted genes, of which approximately 8.5 % are deployed as effectors. Over one-third of all effector genes are clustered in 21 putative 'effector islands' in the genome. We identify a dorsal gland promoter element motif (termed DOG Box) present upstream in representatives from 26 out of 28 dorsal gland effector families, and predict a putative effector superset associated with this motif. We validate gland cell expression in two novel genes by in situ hybridisation and catalogue dorsal gland promoter element-containing effectors from available cyst nematode genomes. Comparison of effector diversity between pathotypes highlights correlation with plant resistance-breaking. These G. rostochiensis genome resources will facilitate major advances in understanding nematode plant-parasitism. Dorsal gland promoter element-containing effectors are at the front line of the evolutionary arms race between plant and parasite and the ability to predict gland cell expression a priori promises rapid advances in understanding their roles and mechanisms of action.

Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, C.H.; Wei, Li-Na; Copeland, N.G.

We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

Influence of gene dosage and autoregulation of the regulatory genes INO2 and INO4 on inositol/choline-repressible gene transcription in the yeast Saccharomyces cerevisiae.

PubMed

Schwank, S; Hoffmann, B; Sch-uller, H J

1997-06-01

Expression of structural genes of phospholipid biosynthesis in yeast is mediated by the inositol/choline-responsive element (ICRE). ICRE-dependent gene activation, requiring the regulatory genes INO2 and INO4, is repressed in the presence of the phospholipid precursors inositol and choline. INO2 and, to a less extent, INO4 are positively autoregulated by functional ICRE sequences in the respective upstream regions. However, an INO2 allele devoid of its ICRE functionally complemented an ino2 mutation and completely restored inositol/choline regulation of Ino2p-dependent reporter genes. Low-level expression of INO2 and INO4 genes, each under control of the heterologous MET25 promoter, did not alter the regulatory pattern of target genes. Thus, upstream regions of INO2 and INO4 are not crucial for transcriptional control of ICRE-dependent genes by inositol and choline. Interestingly, over-expression of INO2, but not of INO4, counteracted repression by phospholipid precursors. Possibly, a functional antagonism between INO2 and a negative regulator is the key event responsible for repression or de-repression.

Upstream oversight assessment for agrifood nanotechnology: a case studies approach.

PubMed

Kuzma, Jennifer; Romanchek, James; Kokotovich, Adam

2008-08-01

Although nanotechnology is broadly receiving attention in public and academic circles, oversight issues associated with applications for agriculture and food remain largely unexplored. Agrifood nanotechnology is at a critical stage in which informed analysis can help shape funding priorities, risk assessment, and oversight activities. This analysis is designed to help society and policymakers anticipate and prepare for challenges posed by complicated, convergent applications of agrifood nanotechnology. The goal is to identify data, risk assessment, regulatory policy, and engagement needs for overseeing these products so they can be addressed prior to market entry. Our approach, termed upstream oversight assessment (UOA), has potential as a key element of anticipatory governance. It relies on distinct case studies of proposed applications of agrifood nanotechnology to highlight areas that need study and attention. As a tool for preparation, UOA anticipates the types and features of emerging applications; their endpoints of use in society; the extent to which users, workers, ecosystems, or consumers will be exposed; the nature of the material and its safety; whether and where the technologies might fit into current regulatory system(s); the strengths and weaknesses of the system(s) in light of these novel applications; and the possible social concerns related to oversight for them.

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

PubMed Central

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-01-01

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

The nT1 translocation separates vulval regulatory elements from the egl-18 and elt-6 GATA factor genes.

PubMed

Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V

2004-03-01

egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.

Seasonal variability of the hydrogen exosphere of Mars

NASA Astrophysics Data System (ADS)

Halekas, J. S.

2017-05-01

The Mars Atmosphere and Volatile EvolutioN (MAVEN) mission measures both the upstream solar wind and collisional products from energetic neutral hydrogen atoms that precipitate into the upper atmosphere after their initial formation by charge exchange with exospheric hydrogen. By computing the ratio between the densities of these populations, we derive a robust measurement of the column density of exospheric hydrogen upstream of the Martian bow shock. By comparing with Chamberlain-type model exospheres, we place new constraints on the structure and escape rates of exospheric hydrogen, derived from observations sensitive to a different and potentially complementary column from most scattered sunlight observations. Our observations provide quantitative estimates of the hydrogen exosphere with nearly complete temporal coverage, revealing order of magnitude seasonal changes in column density and a peak slightly after perihelion, approximately at southern summer solstice. The timing of this peak suggests either a lag in the response of the Martian atmosphere to solar inputs or a seasonal effect driven by lower atmosphere dynamics. The high degree of seasonal variability implied by our observations suggests that the Martian atmosphere and the thermal escape of light elements depend sensitively on solar inputs.

The human oxytocin gene promoter is regulated by estrogens.

PubMed

Richard, S; Zingg, H H

1990-04-15

Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be restricted to a subpopulation of OT neurons.

Structural features of diverse Pin-II proteinase inhibitor genes from Capsicum annuum.

PubMed

Mahajan, Neha S; Dewangan, Veena; Lomate, Purushottam R; Joshi, Rakesh S; Mishra, Manasi; Gupta, Vidya S; Giri, Ashok P

2015-02-01

The proteinase inhibitor (PI) genes from Capsicum annuum were characterized with respect to their UTR, introns and promoter elements. The occurrence of PIs with circularly permuted domain organization was evident. Several potato inhibitor II (Pin-II) type proteinase inhibitor (PI) genes have been analyzed from Capsicum annuum (L.) with respect to their differential expression during plant defense response. However, complete gene characterization of any of these C. annuum PIs (CanPIs) has not been carried out so far. Complete gene architectures of a previously identified CanPI-7 (Beads-on-string, Type A) and a member of newly isolated Bracelet type B, CanPI-69 are reported in this study. The 5' UTR (untranslated region), 3'UTR, and intronic sequences of both the CanPI genes were obtained. The genomic sequence of CanPI-7 exhibited, exon 1 (49 base pair, bp) and exon 2 (740 bp) interrupted by a 294-bp long type I intron. We noted the occurrence of three multi-domain PIs (CanPI-69, 70, 71) with circularly permuted domain organization. CanPI-69 was found to possess exon 1 (49 bp), exon 2 (551 bp) and a 584-bp long type I intron. The upstream sequence analysis of CanPI-7 and CanPI-69 predicted various transcription factor-binding sites including TATA and CAAT boxes, hormone-responsive elements (ABRELATERD1, DOFCOREZM, ERELEE4), and a defense-responsive element (WRKY71OS). Binding of transcription factors such as zinc finger motif MADS-box and MYB to the promoter regions was confirmed using electrophoretic mobility shift assay followed by mass spectrometric identification. The 3' UTR analysis for 25 CanPI genes revealed unique/distinct 3' UTR sequence for each gene. Structures of three domain CanPIs of type A and B were predicted and further analyzed for their attributes. This investigation of CanPI gene architecture will enable the better understanding of the genetic elements present in CanPIs.

Geological nominations at UNESCO World Heritage, an upstream struggle

NASA Astrophysics Data System (ADS)

Olive-Garcia, Cécile; van Wyk de Vries, Benjamin

2017-04-01

Using my 10 years experience in setting up and defending a UNESCO world Heritage Geological nomination, this presentation aims to give a personal insight into this international process and the differential use of science, subjective perception (aesthetic and 'naturality'), and politics. At this point in the process, new protocols have been tested in order to improve the dialogue, accountability and transparency between the different stake-holders. These are, the State parties, the IUCN, the scientific community, and UNESCO itself. Our proposal is the Chaîne des Puys-Limagne fault ensemble, which combines tectonic, geomorphological evolution and volcanology. The project's essence is a conjunction of inseparable geological features and processes, set in the context of plate tectonics. This very unicit yof diverse forms and processes creates the value of the site. However, it is just this that has caused a problem, as the advisory body has a categorical approach of nominations that separates items to assess them in an unconnected manner.From the start we proposed a combined approach, where a property is seen in its entirety, and the constituent elements seen as interlinked elements reflecting the joint underlying phenomena. At this point, our project has received the first ever open review by an independent technical mission (jointly set up by IUCN, UNESCO and the State party). The subsequent report was broadly supportive of the project's approach and of the value of the ensemble of features. The UNESCO committee in 2016, re-referred the nomination, acknowledging the potential Outstanding Universal Value of the site and requesting the parties to continue the upstream process (e.g. collaborative work), notably on the recommendations and conclusions of the Independent Technical mission report. Meetings are continuing, and I shall provide you with the hot-off-the-press news as this ground breaking nomination progresses.

A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H2O2 content.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-03-01

MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.

Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

PubMed

Calonge, María Julia; Seoane, Joan; Massagué, Joan

2004-05-28

A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

PubMed

Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

2017-06-29

Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

Concomitant expression of far upstream element (FUSE) binding protein (FBP) interacting repressor (FIR) and its splice variants induce migration and invasion of non-small cell lung cancer (NSCLC) cells.

PubMed

Müller, Benedikt; Bovet, Michael; Yin, Yi; Stichel, Damian; Malz, Mona; González-Vallinas, Margarita; Middleton, Alistair; Ehemann, Volker; Schmitt, Jennifer; Muley, Thomas; Meister, Michael; Herpel, Esther; Singer, Stephan; Warth, Arne; Schirmacher, Peter; Drasdo, Dirk; Matthäus, Franziska; Breuhahn, Kai

2015-11-01

Transcription factors integrate a variety of oncogenic input information, facilitate tumour growth and cell dissemination, and therefore represent promising therapeutic target structures. Because over-expression of DNA-interacting far upstream element binding protein (FBP) supports non-small cell lung cancer (NSCLC) migration, we asked whether its repressor, FBP-interacting repressor (FIR) is functionally inactivated and how FIR might affect NSCLC cell biology. Different FIR splice variants were highly expressed in the majority of NSCLCs, with the highest levels in tumours carrying genomic gains of chromosome 8q24.3, which contained the FIR gene locus. Nuclear FIR expression was significantly enriched at the invasion front of primary NSCLCs, but this did not correlate with tumour cell proliferation. FIR accumulation was associated with worse patient survival and tumour recurrence; in addition, FIR over-expression significantly correlated with lymph node metastasis in squamous cell carcinomas (SCCs). In vitro, we applied newly developed methods and modelling approaches for the quantitative and time-resolved description of the pro-migratory and pro-invasive capacities of SCC cells. siRNA-mediated silencing of all FIR variants significantly reduced the speed and directional movement of tumour cells in all phases of migration. Furthermore, sprouting efficiency and single cell invasiveness were diminished following FIR inhibition. Interestingly, the silencing of FIR isoforms lacking exon 2 (FIR(Δexon2)) alone was sufficient to reduce lateral migration and invasion. In summary, by using scale-spanning data derived from primary human tissues, quantitative cellular analyses and mathematical modelling, we have demonstrated that concomitant over-expression of FIR and its splice variants drives NSCLC migration and dissemination. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Efficient activation of transcription in yeast by the BPV1 E2 protein.

PubMed Central

Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M

1989-01-01

The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584

Differential Effects of Ethanol on c-Jun N-Terminal Kinase, 14-3-3 Proteins, and Bax in Postnatal Day 4 and Postnatal Day 7 Rat Cerebellum

PubMed Central

Heaton, Marieta Barrow; Paiva, Michael; Kubovic, Stacey; Kotler, Alexandra; Rogozinski, Jonathan; Swanson, Eric; Madorsky, Vladimir; Posados, Michelle

2011-01-01

These studies investigated ethanol effects on upstream cellular elements and interactions which contribute to Bax-related apoptosis in neonatal rat cerebellum at ages of peak ethanol sensitivity (postnatal day 4 [P4]), compared to later ages of relative resistance (P7). Analyses were made of basal levels of the pro-apoptotic c-jun N-termimal kinase (JNK), Bax, and the 14-3-3 anchoring proteins, as well as the responsiveness of these substances to ethanol at P4 versus P7. Dimerization of Bax with 14-3-3 was also investigated at the two ages following ethanol treatment, a process which sequesters Bax in the cytosol, thus inhibiting its mitochondrial translocation and disruption of the mitochondrial membrane potential. Cultured cerebellar granule cells were used to examine the protective potential of JNK inhibition on ethanol-mediated cell death. Basal levels of JNK were significantly higher at P4 than P7, but no differences in the other proteins were found. Activated JNK, and cytosolic and mitochondrially-translocated Bax were increased in P4 but not P7 animals following ethanol exposure, while protective 14-3-3 proteins were increased only at P7. Ethanol treatment resulted in decreases in Bax:14-3-3 heterodimers at P4, but not at P7. Inhibition of JNK activity in vitro provided partial protection against ethanol neurotoxicity. Thus, differential temporal vulnerability to ethanol in this CNS region correlates with differences in both levels of apoptosis-related substances (e.g., JNK), and differential cellular responsiveness, favoring apoptosis at the most sensitive age and survival at the resistant age. The upstream elements contributing to this vulnerability can be targets for future therapeutic strategies. PMID:22169498

The SXT conjugative element and linear prophage N15 encode toxin-antitoxin-stabilizing systems homologous to the tad-ata module of the Paracoccus aminophilus plasmid pAMI2.

PubMed

Dziewit, Lukasz; Jazurek, Magdalena; Drewniak, Lukasz; Baj, Jadwiga; Bartosik, Dariusz

2007-03-01

A group of proteic toxin-antitoxin (TA) cassettes whose representatives are widely distributed among bacterial genomes has been identified. These cassettes occur in chromosomes, plasmids, bacteriophages, and noncomposite transposons, as well as in the SXT conjugative element of Vibrio cholerae. The following four homologous loci were subjected to detailed comparative studies: (i) tad-ata from plasmid pAMI2 of Paracoccus aminophilus (the prototype of this group), (ii) gp49-gp48 from the linear bacteriophage N15 of Escherichia coli, (iii) s045-s044 from SXT, and (iv) Z3230-Z3231 from the genomic island of enterohemorrhagic Escherichia coli O157:H7 strain EDL933. Functional analysis revealed that all but one of these loci (Z3230-Z3231) are able to stabilize heterologous replicons, although the host ranges varied. The TA cassettes analyzed have the following common features: (i) the toxins are encoded by the first gene of each operon; (ii) the antitoxins contain a predicted helix-turn-helix motif of the XRE family; and (iii) the cassettes have two promoters that are different strengths, one which is located upstream of the toxin gene and one which is located upstream of the antitoxin gene. All four toxins tested are functional in E. coli; overexpression of the toxins (in the absence of antitoxin) results in a bacteriostatic effect manifested by elongation of bacterial cells and growth arrest. The toxins have various effects on cell viability, which suggests that they may recognize different intracellular targets. Preliminary data suggest that different cellular proteases are involved in degradation of antitoxins encoded by the loci analyzed.

Effects of an oil spill on leafpack-inhabiting macroinvertebrates in the Chariton river, Missouri

USGS Publications Warehouse

Poulton, B.C.; Callahan, E.V.; Hurtubise, R.D.; Mueller, B.G.

1998-01-01

Artificial leaf packs were used to determine the effects of an oil spill on stream macroinvertebrate communities in the Chariton River, Missouri. Plastic mesh leaf retainers with approximately 10 g of leaves from five tree species were deployed at five sites (two upstream of the spill and three downstream) immediately after the spill and one year later. Four macroinvertebrate species dominating the community at upstream sites were virtually eliminated below the spill, including the stonefly Isoperla bilineata, the caddisfly Potamyia flava, the midge Thienemanniella xena, and blackfly larvae (Simulium sp.). Density of collector and shredder functional groups, and number of shredder taxa differed between upstream sites and the two furthest downstream sites during the 1990 sample period (Kruskal-Wallis w/Bonferroni paired comparisons, experiment wise error rate = 0.05). With one exception, no differences between sites were detected in the 1991-1992 sample period, indicating that the benthic community had at least partially recovered from the oil spill after one year. The odds of obtaining a sample with a small abundance of shredders (abundance < median) in 1990 was significantly greater downstream of the spill than upstream, and the odds of obtaining a sample with a small abundance of shredders at downstream sites was greater in 1990 than in 1991-1992. A similar pattern was observed in abundance and taxa richness of the collector functional group. No significant differences between the two sampling periods were detected at upstream sites. Observed effects appeared to be associated with oil sorption and substrate coating, creating conditions unsuitable for successful colonization.

Numerical investigation of roughness effects in aircraft icing calculations

NASA Astrophysics Data System (ADS)

Matheis, Brian Daniel

2008-10-01

Icing codes are playing a role of increasing significance in the design and certification of ice protected aircraft surfaces. However, in the interest of computational efficiency certain small scale physics of the icing problem are grossly approximated by the codes. One such small scale phenomena is the effect of ice roughness on the development of the surface water film and on the convective heat transfer. This study uses computational methods to study the potential effect of ice roughness on both of these small scale phenomena. First, a two-dimensional condensed layer code is used to examine the effect of roughness on surface water development. It is found that the Couette approximation within the film breaks down as the wall shear goes to zero, depending on the film thickness. Roughness elements with initial flow separation in the air induce flow separation in the water layer at steady state, causing a trapping of the film. The amount of trapping for different roughness configurations is examined. Second, a three-dimensional incompressible Navier-Stokes code is developed to examine large scale ice roughness on the leading edge. The effect on the convective heat transfer and potential effect on the surface water dynamics is examined for a number of distributed roughness parameters including Reynolds number, roughness height, streamwise extent, roughness spacing and roughness shape. In most cases the roughness field increases the net average convective heat transfer on the leading edge while narrowing surface shear lines, indicating a choking of the surface water flow. Both effects show significant variation on the scale of the ice roughness. Both the change in heat transfer as well as the potential change in surface water dynamics are presented in terms of the development of singularities in the surface shear pattern. Of particular interest is the effect of the smooth zone upstream of the roughness which shows both a relatively large increase in convective heat transfer as well as excessive choking of the surface shear lines at the upstream end of the roughness field. A summary of the heat transfer results is presented for both the averaged heat transfer as well as the maximum heat transfer over each roughness element, indicating that the roughness Reynolds number is the primary parameter which characterizes the behavior of the roughness for the problem of interest.

Water quality in the Little Sac River basin near Springfield, Missouri, 1999-2001

USGS Publications Warehouse

Smith, Brenda J.

2002-01-01

The Little Sac River, north of Springfield, Missouri, flows through mainly agricultural and forest land. However, the quality of the river water is a concern because the river flows into Stockton Lake, which is a supplemental drinking water source for Springfield. Large bacterial densities and nutrient concentrations are primary concerns to the water quality of the river.A 29-river mile reach of the Little Sac River is on the 1998 list of waters of Missouri designated under section 303(d) of the Federal Clean Water Act because of fecal coliform densities larger than the Missouri Department of Natural Resources standard (hereinafter referred to as Missouri standard) of 200 colonies per 100 milliliters for whole-body contact recreation. During an investigation of the water quality in the Little Sac River by the U.S. Geological Survey, in cooperation with the Watershed Committee of the Ozarks, fecal coliform bacteria densities exceeded the Missouri standard (the standard applies from April 1 through October 31) in one sample from a site near Walnut Grove. At other sites on the Little Sac River, the Missouri standard was exceeded in two samples and equalled in one sample upstream from the Northwest Wastewater Treatment Plant (NW WTP) and in one sample immediately downstream from the NW WTP.Effluent from the NW WTP flows into the Little Sac River. Annually from April 1 through October 31, the effluent is disinfected to meet the Missouri standard for whole-body contact recreation. Fecal coliform bacteria densities in samples collected during this period generally were less than 100 colonies per 100 milliliters. For the rest of the year when the effluent was not disinfected, the bacteria densities in samples ranged from 50 (sample collected on November 1, 2000) to 10,100 colonies per 100 milliliters (both counts were non-ideal). When the effluent was disinfected and the fecal coliform bacteria density was small, samples from sites upstream and downstream from the NW WTP had a bacteria density larger than the density in the effluent. Other sources of bacteria are likely to be present in the study area in addition to the NW WTP. These potential sources include effluent from domestic septic systems and animal wastes.Nutrient concentrations in the Little Sac River immediately downstream from the NW WTP were affected by effluent from the NW WTP and possibly other sources. At two sites upstream from the NW WTP, median nitrite plus nitrate concentrations were 1.1 and 1.4 milligrams per liter. The median nitrite plus nitrate concentration for the effluent from the NW WTP was 6.4 milligrams per liter, and the median concentration decreased downstream in the Little Sac River to 2.2, 1.2, and 0.56 milligrams per liter.The effects of the effluent from the NW WTP on the water quality of the Little Sac River downstream from the NW WTP were reflected in an increase in discharge (effluent from the NW WTP can be as much as 50 percent of the flow at the site about 1.5 river miles downstream from the NW WTP), an increase in specific conductance values, an increase in several inorganic constituent concentrations, including calcium, magnesium, and sulfate, and a large increase in sodium and chloride concentrations. The effluent from the NW WTP seemed to have no effect on the pH value, temperature, and dissolved oxygen concentrations in the Little Sac River.Results of repetitive element polymerase chain reaction (rep-PCR) pattern analysis indicated that most Escherichia coli (E. coli) bacteria in water samples probably were from nonhuman sources, such as horses and cattle. The rep-PCR pattern analysis indicated that horses were an important source of E. coli downstream from the NW WTP, which was consistent with horses pastured adjacent to the sampling site. Fecal coliform bacteria loads increased upstream from the NW WTP from the most upstream site to the site immediately upstream from the NW WTP. Loads in the effluent from the NW WTP and also tho

Spatial and temporal patterns of micropollutants upstream and downstream of 24 WWTPs across Switzerland

NASA Astrophysics Data System (ADS)

Spycher, Barbara; Deuber, Fabian; Kistler, David; Burdon, Frank; Reyes, Marta; Alder, Alfredo C.; Joss, Adriano; Eggen, Rik; Singer, Heinz; Stamm, Christian

2015-04-01

Treated wastewater is an important source of micropollutants in many streams. These chemicals consist of very diverse set of compounds that may vary in space and time. In order to improve our understanding of such spatio-temporal patterns of micropollutants in surface waters, we compared upstream and downstream locations at 24 sites across the Swiss Plateau and Jura (12 sites in the 2013 campaign, 12 sites during the 2014 campaign). Each site represents the most upstream treatment plant in the corresponding catchment. This survey is part of the interdisciplinary, Eawag-wide research project EcoImpact that aims at elucidating the ecological effects of micropollutants on stream ecosystems. In 2013, a broad analytical screening was applied to samples collected during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 were analysed for a set of about 60 selected organic micropollutants and 10 heavy metals. The screening results demonstrate that generally pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest part of the organic micropollutants. Pesticides including biocides and plant protection products are also regularly found but at lower concentrations. This presentation will analyse the variability of the micropollutant patterns across the different sites and how upstream conditions and the wastewater composition changes with season.

Responses of riparian reptile communities to damming and urbanization

USGS Publications Warehouse

Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.

2013-01-01

Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.

Flow separation in a computational oscillating vocal fold model

NASA Astrophysics Data System (ADS)

Alipour, Fariborz; Scherer, Ronald C.

2004-09-01

A finite-volume computational model that solves the time-dependent glottal airflow within a forced-oscillation model of the glottis was employed to study glottal flow separation. Tracheal input velocity was independently controlled with a sinusoidally varying parabolic velocity profile. Control parameters included flow rate (Reynolds number), oscillation frequency and amplitude of the vocal folds, and the phase difference between the superior and inferior glottal margins. Results for static divergent glottal shapes suggest that velocity increase caused glottal separation to move downstream, but reduction in velocity increase and velocity decrease moved the separation upstream. At the fixed frequency, an increase of amplitude of the glottal walls moved the separation further downstream during glottal closing. Increase of Reynolds number caused the flow separation to move upstream in the glottis. The flow separation cross-sectional ratio ranged from approximately 1.1 to 1.9 (average of 1.47) for the divergent shapes. Results suggest that there may be a strong interaction of rate of change of airflow, inertia, and wall movement. Flow separation appeared to be ``delayed'' during the vibratory cycle, leading to movement of the separation point upstream of the glottal end only after a significant divergent angle was reached, and to persist upstream into the convergent phase of the cycle.

Evolutionary divergence of vertebrate Hoxb2 expression patterns and transcriptional regulatory loci.

PubMed

Scemama, Jean-Luc; Hunter, Michael; McCallum, Jeff; Prince, Victoria; Stellwag, Edmund

2002-10-15

Hox gene expression is regulated by a complex array of cis-acting elements that control spatial and temporal gene expression in developing embryos. Here, we report the isolation of the striped bass Hoxb2a gene, comparison of its expression to the orthologous gene from zebrafish, and comparative genomic analysis of the upstream regulatory region to that of other vertebrates. Comparison of the Hoxb2a gene expression patterns from striped bass to zebrafish revealed similar expression patterns within rhombomeres 3, 4, and 5 of the hindbrain but a notable absence of expression in neural crest tissues of striped bass while neural crest expression is observed in zebrafish and common to other vertebrates. Comparative genomic analysis of the striped bass Hoxb2a-b3a intergenic region to those from zebrafish, pufferfish, human, and mouse demonstrated the presence of common Meis, Hox/Pbx, Krox-20, and Box 1 elements, which are necessary for rhombomere 3, 4, and 5 expression. Despite their common occurrence, the location and orientation of these transcription elements differed among the five species analyzed, such that Krox-20 and Box 1 elements are located 3' to the Meis, Hox/Pbx elements in striped bass, pufferfish, and human while they are located 5' of this r4 enhancer in zebrafish and mouse. Our results suggest that the plasticity exhibited in the organization of key regulatory elements responsible for rhombomere-specific Hoxb2a expression may reflect the effects of stabilizing selection in the evolution cis-acting elements. Copyright 2002 Wiley-Liss, Inc.

Reductions in fish-community contamination following lowhead dam removal linked more to shifts in food-web structure than sediment pollution.

PubMed

Davis, Robert P; Sullivan, S Mažeika P; Stefanik, Kay C

2017-12-01

Recent increases in dam removals have prompted research on ecological and geomorphic river responses, yet contaminant dynamics following dam removals are poorly understood. We investigated changes in sediment concentrations and fish-community body burdens of mercury (Hg), selenium (Se), polychlorinated biphenyls (PCB), and chlorinated pesticides before and after two lowhead dam removals in the Scioto and Olentangy Rivers (Columbus, Ohio). These changes were then related to documented shifts in fish food-web structure. Seven study reaches were surveyed from 2011 to 2015, including controls, upstream and downstream of the previous dams, and upstream restored vs. unrestored. For most contaminants, fish-community body burdens declined following dam removal and converged across study reaches by the last year of the study in both rivers. Aldrin and dieldrin body burdens in the Olentangy River declined more rapidly in the upstream-restored vs. the upstream-unrestored reach, but were indistinguishable by year three post dam removal. No upstream-downstream differences were observed in body burdens in the Olentangy River, but aldrin and dieldrin body burdens were 138 and 148% higher, respectively, in downstream reaches than in upstream reaches of the Scioto River following dam removal. The strongest relationships between trophic position and body burdens were observed with PCBs and Se in the Scioto River, and with dieldrin in the Olentangy River. Food-chain length - a key measure of trophic structure - was only weakly related to aldrin body burdens, and unrelated to other contaminants. Overall, we demonstrate that lowhead dam removal may effectively reduce ecosystem contamination, largely via shifts in fish food-web dynamics versus sediment contaminant concentrations. This study presents some of the first findings documenting ecosystem contamination following dam removal and will be useful in informing future dam removals. Copyright © 2017 Elsevier Ltd. All rights reserved.

75 FR 68714 - Final Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-09

... mile +683 Village of Mayfield. upstream of Rogers Road. Chagrin River Approximately 40 feet +786 Village of Moreland upstream of Woodland Hills. Road. Approximately 1,200 feet +789 upstream of Woodland... Miles Road. Countrymans Creek Upstream of I-71......... +721 Village of Lindale. Downstream of Bellaire...

The 'upstream wake' of swimming and flying animals and its correlation with propulsive efficiency.

PubMed

Peng, Jifeng; Dabiri, John O

2008-08-01

The interaction between swimming and flying animals and their fluid environments generates downstream wake structures such as vortices. In most studies, the upstream flow in front of the animal is neglected. In this study, we demonstrate the existence of upstream fluid structures even though the upstream flow is quiescent or possesses a uniform incoming velocity. Using a computational model, the flow generated by a swimmer (an oscillating flexible plate) is simulated and a new fluid mechanical analysis is applied to the flow to identify the upstream fluid structures. These upstream structures show the exact portion of fluid that is going to interact with the swimmer. A mass flow rate is then defined based on the upstream structures, and a metric for propulsive efficiency is established using the mass flow rate and the kinematics of the swimmer. We propose that the unsteady mass flow rate defined by the upstream fluid structures can be used as a metric to measure and objectively compare the efficiency of locomotion in water and air.

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.

PubMed

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-02-11

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase

PubMed Central

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-01-01

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727

The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

PubMed Central

Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

1986-01-01

The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

Flow Structure Comparison for Two 7-Point LDI Configurations

NASA Technical Reports Server (NTRS)

Hicks, Yolanda R.; Tacina, Kathleen M.

2017-01-01

This paper presents a comparison primarily of the cold flow 2-D velocity profiles; and describes flame tube combusting flow operability for a 7-point Lean Direct Injector (LDI). This circular LDI array consists of a center element surrounded by six outer elements spaced 60 degrees apart; the spacing between all adjacent elements is the same. Each element consists of a simplex atomizer that injects at the throat of a converging-diverging venturi, and an axial swirler upstream of the venturi throat to generate swirl. The two configurations were: 1) one which consists of all 60 deg co-swirling axial air swirlers, and; 2) one configuration which uses a 60 deg swirler in the center, surrounded by counter-swirling 45 deg swirlers. Testing was done at 5- bar and at an inlet temperature of 700K. Two air reference velocities were considered in the cold flow measurements. The 2D velocity profiles were determined using particle image velocimetry. Results indicate the configuration using all 60 deg swirlers generates a field that moderates to a more uniform distribution at a shorter distance downstream and is more easily operable than the second configuration, which produces recirculation regions at the edges of the outer 45 deg swirlers, and results in a more stratified velocity field at any given axial location.

A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization

PubMed Central

Vilaboa, Nuria; Bermejo, Rodrigo; Martinez, Pilar; Bornstein, Rafael; Calés, Carmela

2004-01-01

Cdc6 is a key regulator of the strict alternation of S and M phases during the mitotic cell cycle. In mammalian and plant cells that physiologically become polyploid, cdc6 is transcriptionally and post-translationally regulated. We have recently reported that Cdc6 levels are maintained in megakaryoblastic HEL cells, but severely downregulated by ectopic expression of transcriptional repressor Drosophila melanogaster escargot. Here, we show that cdc6 promoter activity is upregulated during megakaryocytic differentiation of HEL endoreplicating cells, and that Escargot interferes with such activation. Transactivation experiments showed that a 1.7 kb region located at 2800 upstream cdc6 transcription initiation site behaved as a potent enhancer in endoreplicating cells only. This activity was mainly dependent on a novel cis-regulatory element composed by an E2 box overlapping a GATA motif. Ectopic Escargot could bind this regulatory element in vitro and endogenous GATA-1 and E2A formed specific complexes in megakaryoblastic cells as well as in primary megakaryocytes. Chromatin Immunoprecipitation analysis revealed that both transcription factors were occupying the E2 box/GATA site in vivo. Altogether, these data suggest that cdc6 expression could be actively maintained during megakaryocytic differentiation through transcriptional mechanisms involving specific cis- and trans-regulatory elements. PMID:15590906

Analysis of key thresholds leading to upstream dependencies in global transboundary water bodies

NASA Astrophysics Data System (ADS)

Munia, Hafsa Ahmed; Guillaume, Joseph; Kummu, Matti; Mirumachi, Naho; Wada, Yoshihide

2017-04-01

Transboundary water bodies supply 60% of global fresh water flow and are home to about 1/3 of the world's population; creating hydrological, social and economic interdependencies between countries. Trade-offs between water users are delimited by certain thresholds, that, when crossed, result in changes in system behavior, often related to undesirable impacts. A wide variety of thresholds are potentially related to water availability and scarcity. Scarcity can occur because of the country's own water use, and that is potentially intensified by upstream water use. In general, increased water scarcity escalates the reliance on shared water resources, which increases interdependencies between riparian states. In this paper the upstream dependencies of global transboundary river basins are examined at the scale of sub-basin areas. We aim to assess how upstream water withdrawals cause changes in the scarcity categories, such that crossing thresholds is interpreted in terms of downstream dependency on upstream water availability. The thresholds are defined for different types of water availability on which a sub-basin relies: - reliable local runoff (available even in a dry year), - less reliable local water (available in the wet year), - reliable dry year inflows from possible upstream area, and - less reliable wet year inflows from upstream. Possible upstream withdrawals reduce available water downstream, influencing the latter two water availabilities. Upstream dependencies have then been categorized by comparing a sub-basin's scarcity category across different water availability types. When population (or water consumption) grows, the sub-basin satisfies its needs using less reliable water. Thus, the factors affecting the type of water availability being used are different not only for each type of dependency category, but also possibly for every sub- basin. Our results show that, in the case of stress (impacts from high use of water), in 104 (12%) sub- basins out of 886 sub-basins are dependent on upstream water, while in the case of shortage (impacts from insufficient water availability per person), 79 (9%) sub-basins out of 886 sub-basins dependent on upstream water. Categorization of the upstream dependency of the sub-basins helps to differentiate between areas where i) there is currently no dependency on upstream water, ii) upstream water withdrawals are sufficiently high that they alter the scarcity and dependency status, and iii) which are always dependent on upstream water regardless of upstream water withdrawals. Our dependency assessment is expected to considerably support the studies and discussions of hydro-political power relations and management practices in transboundary basins.

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.)

PubMed Central

2012-01-01

Background Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication. PMID:23241244

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

PubMed

Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

2012-12-15

Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication.

Effects of backpacker use, pack stock trail use, and pack stock grazing on water-quality indicators, including nutrients, E. coli, hormones, and pharmaceuticals, in Yosemite National Park, USA

USGS Publications Warehouse

Forrester, Harrison; Clow, David W.; Roche, James W.; Heyvaert, Alan C.; Battaglin, William A.

2017-01-01

We investigated how visitor-use affects water quality in wilderness in Yosemite National Park. During the summers of 2012–2014, we collected and analyzed surface-water samples for water-quality indicators, including fecal indicator bacteria Escherichia coli, nutrients (nitrogen, phosphorus, carbon), suspended sediment concentration, pharmaceuticals, and hormones. Samples were collected upstream and downstream from different types of visitor use at weekly to biweekly intervals and during summer storms. We conducted a park-wide synoptic sampling campaign during summer 2014, and sampled upstream and downstream from meadows to evaluate the mitigating effect of meadows on water quality. At pack stock stream crossings, Escherichia coli concentrations were greater downstream from crossings than upstream (median downstream increase in Escherichia coli of three colony forming units 100 mL−1), with the greatest increases occurring during storms (median downstream increase in Escherichia coli of 32 CFU 100 mL−1). At backpacker use sites, hormones, and pharmaceuticals (e.g., insect repellent) were detected at downstream sites, and Escherichia coli concentrations were greater at downstream sites (median downstream increase in Escherichia coli of 1 CFU 100 mL−1). Differences in water quality downstream vs. upstream from meadows grazed by pack stock were not detectable for most water-quality indicators, however, Escherichia coli concentrations decreased downstream, suggesting entrapment and die-off of fecal indicator bacteria in meadows. Our results indicate that under current-use levels pack stock trail use and backpacker use are associated with detectable, but relatively minor, effects on water quality, which are most pronounced during storms.

Effects of Backpacker Use, Pack Stock Trail Use, and Pack Stock Grazing on Water-Quality Indicators, Including Nutrients, E. coli, Hormones, and Pharmaceuticals, in Yosemite National Park, USA

NASA Astrophysics Data System (ADS)

Forrester, Harrison; Clow, David; Roche, James; Heyvaert, Alan; Battaglin, William

2017-09-01

We investigated how visitor-use affects water quality in wilderness in Yosemite National Park. During the summers of 2012-2014, we collected and analyzed surface-water samples for water-quality indicators, including fecal indicator bacteria Escherichia coli, nutrients (nitrogen, phosphorus, carbon), suspended sediment concentration, pharmaceuticals, and hormones. Samples were collected upstream and downstream from different types of visitor use at weekly to biweekly intervals and during summer storms. We conducted a park-wide synoptic sampling campaign during summer 2014, and sampled upstream and downstream from meadows to evaluate the mitigating effect of meadows on water quality. At pack stock stream crossings, Escherichia coli concentrations were greater downstream from crossings than upstream (median downstream increase in Escherichia coli of three colony forming units 100 mL-1), with the greatest increases occurring during storms (median downstream increase in Escherichia coli of 32 CFU 100 mL-1). At backpacker use sites, hormones, and pharmaceuticals (e.g., insect repellent) were detected at downstream sites, and Escherichia coli concentrations were greater at downstream sites (median downstream increase in Escherichia coli of 1 CFU 100 mL-1). Differences in water quality downstream vs. upstream from meadows grazed by pack stock were not detectable for most water-quality indicators, however, Escherichia coli concentrations decreased downstream, suggesting entrapment and die-off of fecal indicator bacteria in meadows. Our results indicate that under current-use levels pack stock trail use and backpacker use are associated with detectable, but relatively minor, effects on water quality, which are most pronounced during storms.

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

PubMed Central

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

PubMed

Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

1996-10-01

Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

Two alternative ways of start site selection in human norovirus reinitiation of translation.

PubMed

Luttermann, Christine; Meyers, Gregor

2014-04-25

The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

Nutrient (N, P) budgets for the Red River basin (Vietnam and China)

NASA Astrophysics Data System (ADS)

Quynh, Le Thi Phuong; Billen, Gilles; Garnier, Josette; ThéRy, Sylvain; FéZard, CéDric; Minh, Chau Van

2005-06-01

In order to examine the degree of human-induced alteration of the nitrogen and phosphorus cycles at the scale of a tropical watershed of regional dimension, the budgets of these two elements were estimated in the four main sub-basins (Da, Lo, Thao, and Delta) of the Red River system (156 448 km2, Vietnam and China). The four sub-basins differ widely in population density (from 101 inhabitants km-2 in the upstream basins to more than 1000 inhabitants km-2 in the delta), land use, and agricultural practices. In terms of agricultural production, on the one hand, and consumption of food and feed on the other, the upstream sub-basins are autotrophic systems, exporting agricultural goods, while the delta is a heterotrophic system, depending on agricultural goods imports. The budget of the agricultural soils reveals great losses of nitrogen, mostly attributable to denitrification in rice paddy fields and of phosphorus, mostly caused by erosion. The budget of the drainage network shows high retention/elimination of nitrogen (from 62 to 77% in the upstream basins and 59% in the delta), and of phosphorus, with retention rates as high as 80% in the Da and Lo sub-basins which have large reservoirs in their downstream course (Hoa Binh on the Da and Thac Ba on the Lo). The total specific delivery estimated at the outlet of the whole Red River System is 855 kg km-2 yr-1 total N and 325 kg km-2 yr-1 total P. Nitrogen rather than phosphorus seems to be the potential limiting factor of algal growth in the plume of the Red River in Tonkin Bay.

Concentrations and ratios of Sr, Ba and Ca along an estuarine river to the Gulf of Mexico - implication for sea level rise effects on trace metal distribution

NASA Astrophysics Data System (ADS)

He, S.; Xu, Y. J.

2015-11-01

Strontium and barium to calcium ratios are often used as proxies for tracking animal movement across salinity gradients. As sea level rise continues, many estuarine rivers in the world face saltwater intrusion, which may cause changes in mobility and distribution of these metals upstream. Despite intensive research on metal adsorption and desorption in marine systems, knowledge of the spatiotemporal distribution of these elements along estuarine rivers is still limited. In this study, we conducted an intensive monitoring of Sr and Ba dynamics along an 88 km long estuary, the Calcasieu River in South Louisiana, USA, which has been strongly affected by saltwater intrusion. Over the period from May 2013 to August 2015, we collected monthly water samples and performed in-situ water quality measurements at six sites from the upstream to the river mouth, with a salinity range from 0.02 to 29.50 ppt. Water samples were analyzed for Sr, Ba, and Ca concentrations. In-situ measurements were made on salinity, pH, water temperature, dissolved oxygen concentration, and specific conductance. We found that the Sr and Ca concentrations and the Sr / Ca ratio all increased significantly with increasing salinity. The average Sr concentration at the site closest to the Gulf of Mexico (site 6) was 46.21 μmol L-1, which was about 130 times higher than that of the site furthest upstream (site 1, 0.35 μmol L-1). The average Ca concentration at site 6 was 8.19 mmol L-1, which was about 60 times higher than that of site 1 (0.13 mmol L-1). The average Sr / Ca ratio at site 6 (8.41 mmol mol-1) was about 3 times the average Sr / Ca ratio at site 1 (2.89 mmol mol-1). However, the spatial variation in Ba concentration was marginal, varying from 0.36 μmol L-1 at site 6 to 0.47 at site 5. The average Ba / Ca ratio at site 1 (4.82 mmol mol-1) was about 54 times the average Ba / Ca ratio at site 6 (0.09 mmol mol-1), showing a clear negative relation between the Ba / Ca ratio and increasing salinity. All the elemental concentrations and ratios had considerable seasonal variations, with significant differences among sampling months for the Sr, Ba concentrations and the Ba / Ca ratio (p < 0.01). The results from this study suggest that concentrations of Sr and Ca in the world's estuaries will very likely increase in the future as sea level rise continues. For low-gradient estuarine rivers such as the Calcasieu River in South Louisiana, USA, water chemistry upstream would experience substantial Sr and Ca enrichment, which could affect aquatic environments and biological communities.

Cause and solution for false upstream boat velocities measured with a StreamPro acoustic doppler current profiler

USGS Publications Warehouse

Mueller, David S.; Rehmel, Mike S.; Wagner, Chad R.

2007-01-01

In 2003, Teledyne RD Instruments introduced the StreamPro acoustic Doppler current profiler which does not include an internal compass. During stationary moving-bed tests the StreamPro often tends to swim or kite from the end of the tether (the instrument rotates then moves laterally in the direction of the rotation). Because the StreamPro does not have an internal compass, it cannot account for the rotation. This rotation and lateral movement of the StreamPro on the end of the tether generates a false upstream velocity, which cannot be easily distinguished from a moving-bed bias velocity. A field test was completed to demonstrate that this rotation and lateral movement causes a false upstream boat velocity. The vector dot product of the boat velocity and the unit vector of the depth-averaged water velocity is shown to be an effective method to account for the effect of the rotation and lateral movement.

Full equations utilities (FEQUTL) model for the approximation of hydraulic characteristics of open channels and control structures during unsteady flow

USGS Publications Warehouse

Franz, Delbert D.; Melching, Charles S.

1997-01-01

The Full EQuations UTiLities (FEQUTL) model is a computer program for computation of tables that list the hydraulic characteristics of open channels and control structures as a function of upstream and downstream depths; these tables facilitate the simulation of unsteady flow in a stream system with the Full Equations (FEQ) model. Simulation of unsteady flow requires many iterations for each time period computed. Thus, computation of hydraulic characteristics during the simulations is impractical, and preparation of function tables and application of table look-up procedures facilitates simulation of unsteady flow. Three general types of function tables are computed: one-dimensional tables that relate hydraulic characteristics to upstream flow depth, two-dimensional tables that relate flow through control structures to upstream and downstream flow depth, and three-dimensional tables that relate flow through gated structures to upstream and downstream flow depth and gate setting. For open-channel reaches, six types of one-dimensional function tables contain different combinations of the top width of flow, area, first moment of area with respect to the water surface, conveyance, flux coefficients, and correction coefficients for channel curvilinearity. For hydraulic control structures, one type of one-dimensional function table contains relations between flow and upstream depth, and two types of two-dimensional function tables contain relations among flow and upstream and downstream flow depths. For hydraulic control structures with gates, a three-dimensional function table lists the system of two-dimensional tables that contain the relations among flow and upstream and downstream flow depths that correspond to different gate openings. Hydraulic control structures for which function tables containing flow relations are prepared in FEQUTL include expansions, contractions, bridges, culverts, embankments, weirs, closed conduits (circular, rectangular, and pipe-arch shapes), dam failures, floodways, and underflow gates (sluice and tainter gates). The theory for computation of the hydraulic characteristics is presented for open channels and for each hydraulic control structure. For the hydraulic control structures, the theory is developed from the results of experimental tests of flow through the structure for different upstream and downstream flow depths. These tests were done to describe flow hydraulics for a single, steady-flow design condition and, thus, do not provide complete information on flow transitions (for example, between free- and submerged-weir flow) that may result in simulation of unsteady flow. Therefore, new procedures are developed to approximate the hydraulics of flow transitions for culverts, embankments, weirs, and underflow gates.

Eukaryotic initiation factor 3 (eIF3) and 5’ mRNA leader sequences as agents of translational regulation in Arabidopsis. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

von Arnim, Albrecht G.

2015-02-04

Protein synthesis, or translation, consumes a sizable fraction of the cell’s energy budget, estimated at 5% and up to 50% in differentiated and growing cells, respectively. Plants also invest significant energy and biomass to construct and maintain the translation apparatus. Translation is regulated by a variety of external stimuli. Compared to transcriptional control, attributes of translational control include reduced sensitivity to stochastic fluctuation, a finer gauge of control, and more rapid responsiveness to environmental stimuli. Yet, our murky understanding of translational control allows few generalizations. Consequently, translational regulation is underutilized in the context of transgene regulation, although synthetic biologists aremore » now beginning to appropriate RNA-level gene regulation into their regulatory circuits. We also know little about how translational control contributes to the diversity of plant form and function. This project explored how an emerging regulatory mRNA sequence element, upstream open reading frames (uORFs), is integrated with the general translation initiation machinery to permit translational regulation on specific mRNAs.« less

HRGFish: A database of hypoxia responsive genes in fishes

NASA Astrophysics Data System (ADS)

Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo

2017-02-01

Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.

Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

PubMed

Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

2018-04-10

Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Characteristics of surface roughness associated with leading edge ice accretion

NASA Technical Reports Server (NTRS)

Shin, Jaiwon

1994-01-01

Detailed size measurements of surface roughness associated with leading edge ice accretions are presented to provide information on characteristics of roughness and trends of roughness development with various icing parameters. Data was obtained from icing tests conducted in the Icing Research Tunnel (IRT) at NASA Lewis Research Center (LeRC) using a NACA 0012 airfoil. Measurements include diameters, heights, and spacing of roughness elements along with chordwise icing limits. Results confirm the existence of smooth and rough ice zones and that the boundary between the two zones (surface roughness transition region) moves upstream towards stagnation region with time. The height of roughness grows as the air temperature and the liquid water content increase, however, the airspeed has little effect on the roughness height. Results also show that the roughness in the surface roughness transition region grows during a very early stage of accretion but reaches a critical height and then remains fairly constant. Results also indicate that a uniformly distributed roughness model is only valid at a very initial stage of the ice accretion process.

Evolutionary change in the structure of the regulatory region that drives tissue and temporally regulated expression of alcohol dehydrogenase gene in Drosophila funebris.

PubMed

Amador, A; Papaceit, M; Juan, E

2001-06-01

The Adh locus of Drosophilidae is organized as a single gene transcribed from two spatially and temporally regulated promoters except in species of the repleta group, which have two single promoter genes. Here we show that in Drosophila funebris the Adh gene is transcribed from a single promoter, in both larva and adult, with qualitative and quantitative species specific-differences in tissue distribution. The gene is expressed in larval fat body but in other tissues such as gastric caeca, midgut and Malpighian tubules its expression is reduced compared to most Drosophilidae species, and in adults it is almost limited to the fat body. The comparative analysis of gene expression of two strains, which differ by a duplication, indicates that the cis elements necessary for this pattern of expression in larvae are included in the region of 1.55 kb upstream of the transcription initiation site. This new organization reveals the evolution of a different regulatory strategy to express the Adh gene in the subgenus Drosophila.

Regulation of zebrafish CYP3A65 transcription by AHR2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting

2013-07-15

CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenicmore » lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in mammalian CYP3 genes.« less

DNA methylation and transcription in a distal region upstream from the bovine AlphaS1 casein gene after once or twice daily milking.

PubMed

Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve

2014-01-01

Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.

Hydraulic analysis of the Schoharie Creek bridge

USGS Publications Warehouse

Froehlich, David C.; Trent, Roy E.

1989-01-01

Ten people died on April 5, 1987 as a result of the collapse of two spans of a New York State Thruway bridge into the floodwaters of Schoharie Creek. The cause of the bridge failure was determined to be scour of bed material from under the foundations of piers supporting the bridge. To evaluate the hydraulic conditions that produced the scour, a two-dimensional finite element surface-water flow model was constructed. The model was used to obtain a detailed description of water-surface elevations and depth-averaged velocities within a reach that extends from about 4000 ft downstream of the bridge to about 6000 ft upstream of the bridge.

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

Low-carbon, low-water scenarios with life cycle water factors for ES&T paper

EPA Pesticide Factsheets

The dataset includes all data used in the creation of figures and graphs in the paper: Scenarios for low carbon and low water electric power plant operations: implications for upstream water use. Data includes regional electricity mixes, full life cycle water use, and water use for each life cycle stage. These encompass a range of scenarios out to 2050, and should not be used as predictions, forecasts or official baselines. The scenarios and results are for research purposes only, and do not represent current or future U.S. EPA policies or regulations.This dataset is associated with the following publication:Dodder , R., J. Barnwell , and W. Yelverton. Scenarios for low carbon and low water electric power plant operations: implications for upstream water use. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 50(21): 11460-11470, (2016).

System and method for reducing combustion dynamics in a combustor

DOEpatents

Uhm, Jong Ho; Johnson, Thomas Edward; Zuo, Baifang; York, William David

2015-09-01

A system for reducing combustion dynamics in a combustor includes an end cap having an upstream surface axially separated from a downstream surface, and tube bundles extend from the upstream surface through the downstream surface. A divider inside a tube bundle defines a diluent passage that extends axially through the downstream surface, and a diluent supply in fluid communication with the divider provides diluent flow to the diluent passage. A method for reducing combustion dynamics in a combustor includes flowing a fuel through tube bundles, flowing a diluent through a diluent passage inside a tube bundle, wherein the diluent passage extends axially through at least a portion of the end cap into a combustion chamber, and forming a diluent barrier in the combustion chamber between the tube bundle and at least one other adjacent tube bundle.