The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.
Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R
1982-01-01
The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791
Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin
2015-04-01
This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.
Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.
Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G
1993-01-01
The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231
Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase
Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins
2008-01-01
Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404
Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.
Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins
2008-04-28
In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.
Fleckenstein, E C; Dirks, W G; Drexler, H G
2000-02-01
The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.
Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A
2002-01-01
κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628
Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar
2006-12-01
An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.
Multiple splicing defects in an intronic false exon.
Sun, H; Chasin, L A
2000-09-01
Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J
2014-04-01
The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Onda, M.; Kudo, S.; Fukuda, M.
Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less
Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing
Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin
2012-01-01
Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633
Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark
2006-08-15
The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.
Hearn, Arron; York, Ian A.; Bishop, Courtney; Rock, Kenneth L.
2010-01-01
Many MHC class I binding peptides are generated as N-extended precursors during protein degradation by the proteasome. These peptides can be subsequently trimmed by aminopeptidases in the cytosol and/or the ER to produce mature epitope. However, the contribution and specificity of each of these subcellular compartments in removing N-terminal amino acids for antigen presentation is not well defined. Here we investigate this issue for antigenic precursors that are expressed in the cytosol. By systematically varying the N-terminal flanking sequences of peptides we show that the amino acids upstream of an epitope precursor are a major determinant of the amount of antigen presentation. In many cases MHC class I binding peptides are produced through sequential trimming in both the cytosol and ER. Trimming of flanking residues in the cytosol contributes most to sequences that are poorly trimmed in the ER. Since N-terminal trimming has different specificity in the cytosol and ER, the cleavage of peptides in both of these compartments serves to broaden the repertoire of sequences that are presented. PMID:20351195
The role of heterologous chloroplast sequence elements in transgene integration and expression.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-04-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-01-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...
2016-03-09
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B
1994-01-01
The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427
Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei
2015-01-01
LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444
Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.
Stone, D E; Craig, E A
1990-01-01
To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281
Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.
Hirsh, J; Morgan, B A; Scholnick, S B
1986-01-01
We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170
Link, Gerhard
1984-01-01
A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Neuhaus, H; Link, G
1987-01-01
The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G
1995-01-01
The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W
1995-09-01
Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.
Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.
Sasaki, H; Yokoyama, E; Kuroiwa, A
1990-01-01
The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866
Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.
Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A
2018-05-01
Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.
Kato, Karin; Matsumura, Yasufumi; Yamamoto, Masaki; Nagao, Miki; Takakura, Shunji; Ichiyama, Satoshi
2017-07-01
In this study, we analyzed the molecular epidemiology of extended-spectrum β-lactamase (ESBL)-producing Proteus mirabilis isolates collected from the central region of Japan. Between 2005 and 2012, 820 clinical P. mirabilis isolates were obtained from ten acute care hospitals in Japan. We characterized ESBL confirmatory test-positive isolates by sequencing the ESBL genes and their flanking regions, detecting plasmid replicons, and performing pulsed-field gel electrophoresis (PFGE). Ninety-six isolates (12%) were positive according to the ESBL confirmatory test; all these isolates possessed bla CTX-M-2 with the same flanking structure of upstream ΔISEcp1 and a downstream region identical to downstream bla KLUA-1 . IncT was the prevalent, and only, replicon found in 63 isolates. PFGE analysis detected eight clusters with more than one isolate, among which three included 56 isolates and six included isolates from multiple hospitals. CTX-M-2-producing P. mirabilis with an identical genetic structure flanking bla CTX-M-2 is dominant in this Japanese region, and there is evidence for the clonal spread of isolates.
Chaperones in Polyglutamine Aggregation: Beyond the Q-Stretch
Kuiper, E. F. E.; de Mattos, Eduardo P.; Jardim, Laura B.; Kampinga, Harm H.; Bergink, Steven
2017-01-01
Expanded polyglutamine (polyQ) stretches in at least nine unrelated proteins lead to inherited neuronal dysfunction and degeneration. The expansion size in all diseases correlates with age at onset (AO) of disease and with polyQ protein aggregation, indicating that the expanded polyQ stretch is the main driving force for the disease onset. Interestingly, there is marked interpatient variability in expansion thresholds for a given disease. Between different polyQ diseases the repeat length vs. AO also indicates the existence of modulatory effects on aggregation of the upstream and downstream amino acid sequences flanking the Q expansion. This can be either due to intrinsic modulation of aggregation by the flanking regions, or due to differential interaction with other proteins, such as the components of the cellular protein quality control network. Indeed, several lines of evidence suggest that molecular chaperones have impact on the handling of different polyQ proteins. Here, we review factors differentially influencing polyQ aggregation: the Q-stretch itself, modulatory flanking sequences, interaction partners, cleavage of polyQ-containing proteins, and post-translational modifications, with a special focus on the role of molecular chaperones. By discussing typical examples of how these factors influence aggregation, we provide more insight on the variability of AO between different diseases as well as within the same polyQ disorder, on the molecular level. PMID:28386214
van Hoek, Angela H A M; Mayrhofer, Sigrid; Domig, Konrad J; Flórez, Ana B; Ammor, Mohammed S; Mayo, Baltasar; Aarts, Henk J M
2008-01-01
For the first time, mosaic tetracycline resistance genes were identified in Lactobacillus johnsonii and in Bifidobacterium thermophilum strains. The L. johnsonii strain investigated contains a complex hybrid gene, tet(O/W/32/O/W/O), whereas the five bifidobacterial strains possess two different mosaic tet genes: i.e., tet(W/32/O) and tet(O/W). As reported by others, the crossover points of the mosaic tet gene segments were found at similar positions within the genes, suggesting a hot spot for recombination. Analysis of the sequences flanking these genes revealed that the upstream part corresponds to the 5' end of the mosaic open reading frame. In contrast, the downstream region was shown to be more variable. Surprisingly, in one of the B. thermophilum strains a third tet determinant was identified, coding for the efflux pump Tet(L).
Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.
Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E
2015-09-01
The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.
Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24
Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan
2005-01-01
The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557
Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyamoto, M.M.; Slightom, J.L.; Goodman, M.
Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less
Tissue-specific expression of human CD4 in transgenic mice.
Gillespie, F P; Doros, L; Vitale, J; Blackwell, C; Gosselin, J; Snyder, B W; Wadsworth, S C
1993-01-01
The gene for the human CD4 glycoprotein, which serves as the receptor for human immunodeficiency virus type 1, along with approximately 23 kb of sequence upstream of the translational start site, was cloned. The ability of 5' flanking sequences to direct tissue-specific expression was tested in cell culture and in transgenic mice. A 5' flanking region of 6 kb was able to direct transcription of the CD4 gene in NIH 3T3 cells but did not result in detectable expression in the murine T-cell line EL4 or in four lines of transgenic mice. A larger 5' flanking region of approximately 23 kb directed high-level CD4 transcription in the murine T-cell line EL4 and in three independent lines of transgenic mice. Human CD4 expression in all tissues analyzed was tightly correlated with murine CD4 expression; the highest levels of human CD4 RNA expression were found in the thymus and spleen, with relatively low levels detected in other tissues. Expression of human CD4 protein in peripheral blood mononuclear cells was examined by flow cytometry in these transgenic animals and found to be restricted to the murine CD4+ subset of lymphocytes. Human CD4 protein, detected with an anti-human CD4 monoclonal antibody, was present on the surface of 45 to 50% of the peripheral blood mononuclear cells from all transgenic lines. Images PMID:8474453
Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David
2013-01-01
In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231
Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U
1984-01-01
A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198
Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang
2014-01-01
Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity. PMID:25423449
Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang
2014-01-01
Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity.
A murC gene from coryneform bacteria.
Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K
1999-02-01
The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.
Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan
2016-01-01
Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.
Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F
1994-06-03
An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.
Kumar, V; Wong, D T; Pasion, S G; Biswas, D K
1987-12-08
The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.
Structure and genomic organization of the human B1 receptor gene for kinins (BDKRB1).
Bachvarov, D R; Hess, J F; Menke, J G; Larrivée, J F; Marceau, F
1996-05-01
Two subtypes of mammalian bradykinin receptors, B1 and B2 (BDKRB1 and BDKRB2), have been defined based on their pharmacological properties. The B1 type kinin receptors have weak affinity for intact BK or Lys-BK but strong affinity for kinin metabolites without the C-terminal arginine (e.g., des-Arg9-BK and Lys-des-Arg9-BK, also called des-Arg10-kallidin), which are generated by kininase I. The B1 receptor expression is up-regulated following tissue injury and inflammation (hyperemia, exudation, hyperalgesia, etc.). In the present study, we have cloned and sequenced the gene encoding human B1 receptor from a human genomic library. The human B1 receptor gene contains three exons separated by two introns. The first and the second exon are noncoding, while the coding region and the 3'-flanking region are located entirely on the third exon. The exon-intron arrangement of the human B1 receptor gene shows significant similarity with the genes encoding the B2 receptor subtype in human, mouse, and rat. Sequence analysis of the 5'-flanking region revealed the presence of a consensus TATA box and of numerous candidate transcription factor binding sequences. Primer extension experiments have shown the existence of multiple transcription initiation sites situated downstream and upstream from the consensus TATA box. Genomic Southern blot analysis indicated that the human B1 receptor is encoded by a single-copy gene.
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Nadjar-Boger, Elisabeth; Funkenstein, Bruria
2011-02-01
Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burkhardt E.; Adham, I.M.; Brosig, B.
1994-03-01
Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less
Activity Enhancement of G-Quadruplex/Hemin DNAzyme by Flanking d(CCC).
Chang, Tianjun; Gong, Hongmei; Ding, Pi; Liu, Xiangjun; Li, Weiguo; Bing, Tao; Cao, Zehui; Shangguan, Dihua
2016-03-14
G-quadruplex (G4)/hemin DNAzymes have been extensively applied in bioanalysis and molecular devices. However, their catalytic activity is still much lower than that of proteinous enzymes. The G4/hemin DNAzyme activity is correlated with the G4 conformations and the solution conditions. However, little is known about the effect of the flanking sequences on the activity, though they are important parts of G4s. Here, we report sequences containing d(CCC), flanked on both ends of the G4-core sequences remarkably enhance their DNAzyme activity. By using circular dichroism and UV-visible spectroscopy, the d(CCC) flanking sequences were demonstrated to improve the hemin binding affinity to G4s instead of increasing the parallel G4 formation, which might explain the enhanced DNAzyme activity. Meanwhile, the increased hemin binding ability promoted the degradation of hemin within the DNAzyme by H2O2. Furthermore, the DNAzyme with d(CCC) flanking sequences showed strong tolerance to pH value changes, which makes it more suitable for applications requiring wide pH conditions. The results highlight the influence of the flanking sequences on the DNAzyme activity and provide insightful information for the design of highly active DNAzymes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo
2008-04-30
The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.
1987-11-01
To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less
Lenzmeier, B A; Giebler, H A; Nyborg, J K
1998-02-01
Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.
The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.
Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha
2005-07-01
Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.
Finnigan, Gregory C; Thorner, Jeremy
2016-07-07
Genome editing exploiting CRISPR/Cas9 has been adopted widely in academia and in the biotechnology industry to manipulate DNA sequences in diverse organisms. Molecular engineering of Cas9 itself and its guide RNA, and the strategies for using them, have increased efficiency, optimized specificity, reduced inappropriate off-target effects, and introduced modifications for performing other functions (transcriptional regulation, high-resolution imaging, protein recruitment, and high-throughput screening). Moreover, Cas9 has the ability to multiplex, i.e., to act at different genomic targets within the same nucleus. Currently, however, introducing concurrent changes at multiple loci involves: (i) identification of appropriate genomic sites, especially the availability of suitable PAM sequences; (ii) the design, construction, and expression of multiple sgRNA directed against those sites; (iii) potential difficulties in altering essential genes; and (iv) lingering concerns about "off-target" effects. We have devised a new approach that circumvents these drawbacks, as we demonstrate here using the yeast Saccharomyces cerevisiae First, any gene(s) of interest are flanked upstream and downstream with a single unique target sequence that does not normally exist in the genome. Thereafter, expression of one sgRNA and cotransformation with appropriate PCR fragments permits concomitant Cas9-mediated alteration of multiple genes (both essential and nonessential). The system we developed also allows for maintenance of the integrated, inducible Cas9-expression cassette or its simultaneous scarless excision. Our scheme-dubbed mCAL for " M: ultiplexing of C: as9 at A: rtificial L: oci"-can be applied to any organism in which the CRISPR/Cas9 methodology is currently being utilized. In principle, it can be applied to install synthetic sequences into the genome, to generate genomic libraries, and to program strains or cell lines so that they can be conveniently (and repeatedly) manipulated at multiple loci with extremely high efficiency. Copyright © 2016 Finnigan and Thorner.
Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I
2004-03-01
We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.
Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn
2005-01-01
Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016
Bian, Yue-Hong; Xu, Cheng; Li, Junling; Xu, Jin; Zhang, Hongwei; Du, Shao Jun
2011-08-01
Hemojuvelin, also known as RGMc, is encoded by hfe2 gene that plays an important role in iron homeostasis. hfe2 is specifically expressed in the notochord, developing somite and skeletal muscles during development. The molecular regulation of hfe2 expression is, however, not clear. We reported here the characterization of hfe2 gene expression and the regulation of its tissue-specific expression in zebrafish embryos. We demonstrated that the 6 kb 5'-flanking sequence upstream of the ATG start codon in the zebrafish hfe2 gene could direct GFP specific expression in the notochord, somites, and skeletal muscle of zebrafish embryos, recapitulating the expression pattern of the endogenous gene. However, the Tg(hfe2:gfp) transgene is also expressed in the liver of fish embryos, which did not mimic the expression of the endogenous hfe2 at the early stage. Nevertheless, the Tg(hfe2:gfp) transgenic zebrafish provides a useful model to study liver development. Treating Tg(hfe2:gfp) transgenic zebrafish embryos with valproic acid, a liver development inhibitor, significantly inhibited GFP expression in zebrafish. Together, these data indicate that the tissue specific expression of hfe2 in the notochord, somites and muscles is regulated by regulatory elements within the 6 kb 5'-flanking sequence of the hfe2 gene. Moreover, the Tg(hfe2:gfp) transgenic zebrafish line provides a useful model system for analyzing liver development in zebrafish.
Length and sequence dependence in the association of Huntingtin protein with lipid membranes
NASA Astrophysics Data System (ADS)
Jawahery, Sudi; Nagarajan, Anu; Matysiak, Silvina
2013-03-01
There is a fundamental gap in our understanding of how aggregates of mutant Huntingtin protein (htt) with overextended polyglutamine (polyQ) sequences gain the toxic properties that cause Huntington's disease (HD). Experimental studies have shown that the most important step associated with toxicity is the binding of mutant htt aggregates to lipid membranes. Studies have also shown that flanking amino acid sequences around the polyQ sequence directly affect interactions with the lipid bilayer, and that polyQ sequences of greater than 35 glutamine repeats in htt are a characteristic of HD. The key steps that determine how flanking sequences and polyQ length affect the structure of lipid bilayers remain unknown. In this study, we use atomistic molecular dynamics simulations to study the interactions between lipid membranes of varying compositions and polyQ peptides of varying lengths and flanking sequences. We find that overextended polyQ interactions do cause deformation in model membranes, and that the flanking sequences do play a role in intensifying this deformation by altering the shape of the affected regions.
A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.
Mehmood, Tahir; Bohlin, Jon; Snipen, Lars
2015-01-01
The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.
Zhang, Lihua; Chen, Xianzhong; Chen, Zhen; Wang, Zezheng; Jiang, Shan; Li, Li; Pötter, Markus; Shen, Wei; Fan, You
2016-11-01
The diploid yeast Candida tropicalis, which can utilize n-alkane as a carbon and energy source, is an attractive strain for both physiological studies and practical applications. However, it presents some characteristics, such as rare codon usage, difficulty in sequential gene disruption, and inefficiency in foreign gene expression, that hamper strain improvement through genetic engineering. In this work, we present a simple and effective method for sequential gene disruption in C. tropicalis based on the use of an auxotrophic mutant host defective in orotidine monophosphate decarboxylase (URA3). The disruption cassette, which consists of a functional yeast URA3 gene flanked by a 0.3 kb gene disruption auxiliary sequence (gda) direct repeat derived from downstream or upstream of the URA3 gene and of homologous arms of the target gene, was constructed and introduced into the yeast genome by integrative transformation. Stable integrants were isolated by selection for Ura + and identified by PCR and sequencing. The important feature of this construct, which makes it very attractive, is that recombination between the flanking direct gda repeats occurs at a high frequency (10 -8 ) during mitosis. After excision of the URA3 marker, only one copy of the gda sequence remains at the recombinant locus. Thus, the resulting ura3 strain can be used again to disrupt a second allelic gene in a similar manner. In addition to this effective sequential gene disruption method, a codon-optimized green fluorescent protein-encoding gene (GFP) was functionally expressed in C. tropicalis. Thus, we propose a simple and reliable method to improve C. tropicalis by genetic manipulation.
Li, Hu; Zhang, Li; Ren, Hong; Hu, Peng
2018-01-01
Viral diversity seems to predict treatment outcomes in certain viral infections. The aim of this study was to evaluate the association between baseline intra-patient viral diversity and hepatitis B surface antigen (HBsAg) decline following PEGylated interferon-alpha (Peg-IFN-α) therapy. Twenty-six HBeAg-positive patients who were treated with Peg-IFN-α were enrolled. Nested polymerase chain reaction (PCR), cloning, and sequencing of the hepatitis B virus S gene were performed on baseline samples, and normalized Shannon entropy (Sn) was calculated as a measure of small hepatitis B surface protein (SHBs) diversity. Multiple regression analysis was used to estimate the association between baseline Sn and HBsAg decline. Of the 26 patients enrolled in the study, 65.4% were male and 61.5% were infected with hepatitis B virus genotype B. The median HBsAg level at baseline was 4.5 log 10 IU/mL (interquartile range: 4.1-4.9) and declined to 3.0 log 10 IU/mL (interquartile range: 1.7-3.9) after 48 weeks of Peg-IFN-α treatment. In models adjusted for baseline alanine aminotransferase (ALT) and HBsAg, the adjusted coefficients (95% CI) for ΔHBsAg and relative percentage HBsAg decrease were -1.3 (-2.5, -0.2) log 10 IU/mL for higher SHBs diversity (Sn≥0.58) patients and -26.4% (-50.2%, -2.5%) for lower diversity (Sn<0.58) patients. Further analysis showed that the "a" determinant upstream flanking region and the first loop of the "a" determinant (nucleotides 341-359, 371-389, and 381-399) were the main sources of higher SHBs diversity. Baseline intra-patient SHBs diversity was inverse to HBsAg decline in HBeAg-positive chronic hepatitis B (CHB) patients receiving Peg-IFN-α monotherapy. Also, more sequence variations within the "a" determinant upstream flanking region and the first loop of the "a" determinant were the main sources of the higher SHBs diversity.
Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.
Cox, J M; Sloan, L S; Schepartz, A
1995-12-01
HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.
Brander, Christian; Yang, Otto O.; Jones, Norman G.; Lee, Yun; Goulder, Philip; Johnson, R. Paul; Trocha, Alicja; Colbert, David; Hay, Christine; Buchbinder, Susan; Bergmann, Cornelia C.; Zweerink, Hans J.; Wolinsky, Steven; Blattner, William A.; Kalams, Spyros A.; Walker, Bruce D.
1999-01-01
Immune escape from cytotoxic T-lymphocyte (CTL) responses has been shown to occur not only by changes within the targeted epitope but also by changes in the flanking sequences which interfere with the processing of the immunogenic peptide. However, the frequency of such an escape mechanism has not been determined. To investigate whether naturally occurring variations in the flanking sequences of an immunodominant human immunodeficiency virus type 1 (HIV-1) Gag CTL epitope prevent antigen processing, cells infected with HIV-1 or vaccinia virus constructs encoding different patient-derived Gag sequences were tested for recognition by HLA-A*0201-restricted, p17-specific CTL. We found that the immunodominant p17 epitope (SL9) and its variants were efficiently processed from minigene expressing vectors and from six HIV-1 Gag variants expressed by recombinant vaccinia virus constructs. Furthermore, SL9-specific CTL clones derived from multiple donors efficiently inhibited virus replication when added to HLA-A*0201-bearing cells infected with primary or laboratory-adapted strains of virus, despite the variability in the SL9 flanking sequences. These data suggest that escape from this immunodominant CTL response is not frequently accomplished by changes in the epitope flanking sequences. PMID:10559335
Hunt, C; Morimoto, R I
1985-01-01
We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075
Energies of backstreaming protons in the foreshock
NASA Technical Reports Server (NTRS)
Greenstadt, E. W.
1976-01-01
A predicted pattern of energy vs detector location in the cislunar region is displayed for protons of zero pitch angle traveling upstream away from the quasi-parallel bow shock. The pattern is implied by upstream wave boundary properties. In the solar ecliptic, protons are estimated to have a minimum of 1.1 times the solar wind bulk energy E sub SW when the wave boundary is in the early morning sector and a maximum of 8.2 E sub SW when the boundary is near the predawn flank.
Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U
1999-11-19
As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.
Wong, S W; Schaffer, P A
1991-05-01
Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.
Müller, P
2004-04-01
The DNA regions upstream and downstream of the Bradyrhizobium japonicum gene sipF were cloned by in vivo techniques and subsequently sequenced. In order to study the function of the predicted genes, a new transposon for in vitro mutagenesis, Tn KPK2, was constructed. This mutagenesis system has a number of advantages over other transposons. Tn KPK2 itself has no transposase gene, making transposition events stable. Extremely short inverted repeats minimize the length of the transposable element and facilitate the determination of the nucleotide sequence of the flanking regions. Since the transposable element carries a promoterless ' phoA reporter gene, the appearance of functional PhoA fusion proteins indicates that Tn KPK2 has inserted in a gene encoding a periplasmic or secreted protein. Although such events are extremely rare, because the transposon has to insert in-frame, in the correct orientation, and at an appropriate location in the target molecule, a direct screening procedure on agar indicator plates permits the identification of candidate clones from large numbers of colonies. In this study, Tn KPK2 was used for the construction of various symbiotic mutants of B. japonicum. One of the mutant strains, A2-10, which is defective in a gene encoding a protein that comigrates with bacterioferritin ( bcpB), was found to induce the formation of small and ineffective nodules.
NASA Astrophysics Data System (ADS)
Gresh, Nohad; Perrée-fauvet, Martine
1999-03-01
On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.
Namciu, Stephanie J.; Fournier, R. E. K.
2004-01-01
Human matrix attachment regions (MARs) can insulate transgene expression from chromosomal position effects in Drosophila melanogaster. To gain insight into the mechanism(s) by which chromosomal insulation occurs, we studied the expression phenotypes of Drosophila transformants expressing mini-white transgenes in which MAR sequences from the human apoB gene were arranged in a variety of ways. In agreement with previous reports, we found that a single copy of the insulating element was not sufficient for position-independent transgene expression; rather, two copies were required. However, the arrangement of the two elements within the transgene was unimportant, since chromosomal insulation was equally apparent when both copies of the insulator were upstream of the mini-white reporter as when the transcription unit was flanked by insulator elements. Moreover, experiments in which apoB 3′ MAR sequences were removed from integrated transgenes in vivo by site-specific recombination demonstrated that MAR sequences were required for the establishment but not for the maintenance of chromosomal insulation. These observations are not compatible with the chromosomal loop model in its simplest form. Alternate mechanisms for MAR function in this system are proposed. PMID:15542833
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Molecular analysis of the glucocerebrosidase gene locus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Winfield, S.L.; Martin, B.M.; Fandino, A.
1994-09-01
Gaucher disease is due to a deficiency in the activity of the lysosomal enzyme glucocerebrosidase. Both the functional gene for this enzyme and a pseudogene are located in close proximity on chromosome 1q21. Analysis of the mutations present in patient samples has suggested interaction between the functional gene and the pseudogene in the origin of mutant genotypes. To investigate the involvement of regions flanking the functional gene and pseudogene in the origin of mutations found in Gaucher disease, a YAC clone containing DNA from this locus has been subcloned and characterized. The original YAC containing {approximately}360 kb was truncated withmore » the use of fragmentation plasmids to about 85 kb. A lambda library derived from this YAC was screened to obtain clones containing glucocerebrosidase sequences. PCR amplification was used to identify subclones containing 5{prime}, central, or 3{prime} sequences of the functional gene or of the pseudogene. Clones spanning the entire distance from the last exon of the functional gene to intron 1 of the pseudogene, the 5{prime} end of the functional gene and 16 kb of 5{prime} flanking region and approximately 15 kb of 3{prime} flanking region of the pseudogene were sequenced. Sequence data from 48 kb of intergenic and flanking regions of the glucocerebrosidase gene and its pseudogene has been generated. A large number of Alu sequences and several simple repeats have been found. Two of these repeats exhibit fragment length polymorphism. There is almost 100% homology between the 3{prime} flanking regions of the functional gene and the pseudogene, extending to about 4 kb past the termination codons. A much lower degree of homology is observed in the 5{prime} flanking region. Patient samples are currently being screened for polymorphisms in these flanking regions.« less
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zezza, D.J.; Stewart, S.E.; Steiner, L.A.
1992-12-15
Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less
Gaji, Rajshekhar Y; Howe, Daniel K
2009-07-01
The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.
1994-12-31
Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less
Yoshino, T P; Wu, X J; Liu, H D
1998-09-01
Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable integration and expression of snail genes of interest into the Bge cell line.
Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W
1992-01-01
Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.
Carlson, M; Celenza, J L; Eng, F J
1985-01-01
The SUC gene family of Saccharomyces contains six structural genes for invertase (SUC1 through SUC5 and SUC7) which are located on different chromosomes. Most yeast strains do not carry all six SUC genes and instead carry natural negative (suc0) alleles at some or all SUC loci. We determined the physical structures of SUC and suc0 loci. Except for SUC2, which is an unusual member of the family, all of the SUC genes are located very close to telomeres and are flanked by homologous sequences. On the centromere-proximal side of the gene, the conserved region contains X sequences, which are sequences found adjacent to telomeres (C. S. M. Chan and B.-K. Tye, Cell 33:563-573, 1983). On the other side of the gene, the homology includes about 4 kilobases of flanking sequence and then extends into a Y' element, which is an element often found distal to the X sequence at telomeres (Chan and Tye, Cell 33:563-573, 1983). Thus, these SUC genes and flanking sequences are embedded in telomere-adjacent sequences. Chromosomes carrying suc0 alleles (except suc20) lack SUC structural genes and portions of the conserved flanking sequences. The results indicate that the dispersal of SUC genes to different chromosomes occurred by rearrangements of chromosome telomeres. Images PMID:3018485
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first experimental evidence of a pseudogene with stronger promoter activity than its parental gene. © 2013.
Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.
Vieille-Grosjean, I; Huber, P
1995-03-03
The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.
Bacterio-opsin mutants of Halobacterium halobium
Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.
1983-01-01
The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Guimond, A; Moss, T
1999-02-01
We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.
Jurka, Jerzy W.
1997-01-01
Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.
Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan
2018-01-01
CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.
1988-01-01
Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less
Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.
Eriani, G; Dirheimer, G; Gangloff, J
1989-01-01
The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891
Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kass, D.H.; Batzer, M.A.; Deininger, P.L.
The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome.more » However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.« less
Dunn, R. C.; Laurie, C. C.
1995-01-01
Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745
Pelsy, F.; Merdinoglu, D.
2002-09-01
A chromosome-walking strategy was used to sequence and characterize retrotransposons in the grapevine genome. The reconstitution of a family of retroelements, named Tvv1, was achieved by six successive steps. These elements share a single, highly conserved open reading frame 4,153 nucleotides-long, putatively encoding the gag, pro, int, rt and rh proteins. Comparison of the Tvv1 open reading frame coding potential with those of drosophila copia and tobacco Tnt1, revealed that Tvv1 is closely related to Ty 1 copia-like retrotransposons. A highly variable untranslated leader region, upstream of the open reading frame, allowed us to differentiate Tvv1 variants, which represent a family of at least 28 copies, in varying sizes. This internal region is flanked by two long terminal repeats in direct orientation, sized between 149 and 157 bp. Among elements theoretically sized from 4,970 to 5,550 bp, we describe the full-length sequence of a reference element Tvv1-1, 5,343 nucleotides-long. The full-length sequence of Tvv1-1 compared to pea PDR1 shows a 53.3% identity. In addition, both elements contain long terminal repeats of nearly the same size in which the U5 region could be entirely absent. Therefore, we assume that Tvv1 and PDR1 could constitute a particular class of short LTRs retroelements.
NASA Astrophysics Data System (ADS)
Gong, Qianhong; Yu, Wengong; Dai, Jixun; Liu, Hongquan; Xu, Rifu; Guan, Huashi; Pan, Kehou
2007-01-01
Endogenous tubulin promoter has been widely used for expressing foreign genes in green algae, but the efficiency and feasibility of endogenous tubulin promoter in the economically important Porphyra yezoensis (Rhodophyta) are unknown. In this study, the flanking sequences of beta-tubulin gene from P. yezoensis were amplified and two transient expression vectors were constructed to determine their transcription promoting feasibility for foreign gene gusA. The testing vector pATubGUS was constructed by inserting 5'-and 3'-flanking regions ( Tub5' and Tub3') up-and down-stream of β-glucuronidase (GUS) gene ( gusA), respectively, into pA, a derivative of pCAT®3-enhancer vector. The control construct, pAGUSTub3, contains only gusA and Tub3'. These constructs were electroporated into P. yezoensis protoplasts and the GUS activities were quantitatively analyzed by spectrometry. The results demonstrated that gusA gene was efficiently expressed in P. yezoensis protoplasts under the regulation of 5'-flanking sequence of the beta-tubulin gene. More interestingly, the pATubGUS produced stronger GUS activity in P. yezoensis protoplasts when compared to the result from pBI221, in which the gusA gene was directed by a constitutive CaMV 35S promoter. The data suggest that the integration of P. yezoensis protoplast and its endogenous beta-tubulin flanking sequences is a potential novel system for foreign gene expression.
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa
2018-01-01
Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225
Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice.
Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun
2015-12-11
As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice.
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick
1982-01-01
The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262
Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T
1992-03-24
P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.
Drögemüller, Cord; Jagannathan, Vidhya; Keller, Irene; Wüthrich, Daniel; Bruggmann, Rémy; Schütz, Ekkehard; Demmel, Steffi; Moser, Simon; Signer-Hasler, Heidi; Pieńkowska-Schelling, Aldona; Schelling, Claude; Sande, Marcos; Rongen, Ronald
2017-01-01
Belted cattle have a circular belt of unpigmented hair and skin around their midsection. The belt is inherited as a monogenic autosomal dominant trait. We mapped the causative variant to a 37 kb segment on bovine chromosome 3. Whole genome sequence data of 2 belted and 130 control cattle yielded only one private genetic variant in the critical interval in the two belted animals. The belt-associated variant was a copy number variant (CNV) involving the quadruplication of a 6 kb non-coding sequence located approximately 16 kb upstream of the TWIST2 gene. Increased copy numbers at this CNV were strongly associated with the belt phenotype in a cohort of 333 cases and 1322 controls. We hypothesized that the CNV causes aberrant expression of TWIST2 during neural crest development, which might negatively affect melanoblasts. Functional studies showed that ectopic expression of bovine TWIST2 in neural crest in transgenic zebrafish led to a decrease in melanocyte numbers. Our results thus implicate an unsuspected involvement of TWIST2 in regulating pigmentation and reveal a non-coding CNV underlying a captivating Mendelian character. PMID:28658273
Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia
Kojima, Kenji K.
2015-01-01
Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an “archaeal” RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes. PMID:26556480
Exaptation of Bornavirus-Like Nucleoprotein Elements in Afrotherians
Kobayashi, Yuki; Horie, Masayuki; Nakano, Ayumi; Murata, Koichi; Itou, Takuya; Suzuki, Yoshiyuki
2016-01-01
Endogenous bornavirus-like nucleoprotein elements (EBLNs), the nucleotide sequence elements derived from the nucleoprotein gene of ancient bornavirus-like viruses, have been identified in many animal genomes. Here we show evidence that EBLNs encode functional proteins in their host. Some afrotherian EBLNs were observed to have been maintained for more than 83.3 million years under negative selection. Splice variants were expressed from the genomic loci of EBLNs in elephant, and some were translated into proteins. The EBLN proteins appeared to be localized to the rough endoplasmic reticulum in African elephant cells, in contrast to the nuclear localization of bornavirus N. These observations suggest that afrotherian EBLNs have acquired a novel function in their host. Interestingly, genomic sequences of the first exon and its flanking regions in these EBLN loci were homologous to those of transmembrane protein 106B (TMEM106B). The upstream region of the first exon in the EBLN loci exhibited a promoter activity, suggesting that the ability of these EBLNs to be transcribed in the host cell was gained through capturing a partial duplicate of TMEM106B. In conclusion, our results strongly support for exaptation of EBLNs to encode host proteins in afrotherians. PMID:27518265
Zahn-Zabal, M.; Lehmann, E.; Kohli, J.
1995-01-01
The M26 mutation in the ade6 gene of Schizosaccharomyces pombe creates a hot spot of meiotic recombination. A single base substitution, the M26 mutation is situated within the open reading frame, near the 5' end. It has previously been shown that the heptanucleotide sequence 5' ATGACGT 3', which includes the M26 mutation, is required for hot spot activity. The 510-bp ade6-delXB deletion encompasses the promoter and the first 23 bp of the open reading frame, ending 112 bp upstream of M26. Deletion of the promoter in cis to M26 abolishes hot spot activity, while deletion in trans to M26 has no effect. Homozygous deletion of the promoter also eliminates M26 hot spot activity, indicating that the heterology created through deletion of the promoter per se is not responsible for the loss of hot spot activity. Thus, DNA sequences other than the heptanucleotide 5' ATGACGT 3', which must be located at the 5' end of the ade6 gene, appear to be required for hot spot activity. While the M26 hotspot stimulates crossovers associated with M26 conversion, it does not affect the crossover frequency in the intervals adjacent to ade6. The flanking marker ura4-aim, a heterology created by insertion of the ura4(+) gene upstream of ade6, turned out to be a hot spot itself. It shows disparity of conversion with preferential loss of the insertion. The frequency of conversion at ura4-aim is reduced when the M26 hot spot is active 15 kb away, indicating competition for recombination factors by hot spots in close proximity. PMID:7498729
Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain
2017-01-01
ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037
Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar
2017-07-01
Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.
L'Homme, Y; Brown, G G
1993-01-01
Comparison of the physical maps of male fertile (cam) and male sterile (pol) mitochondrial genomes of Brassica napus indicates that structural differences between the two mtDNAs are confined to a region immediately upstream of the atp6 gene. Relative to cam mtDNA, pol mtDNA possesses a 4.5 kb segment at this locus that includes a chimeric gene that is cotranscribed with atp6 and lacks an approximately 1kb region located upstream of the cam atp6 gene. The 4.5 kb pol segment is present and similarly organized in the mitochondrial genome of the common nap B.napus cytoplasm; however, the nap and pol DNA regions flanking this segment are different and the nap sequences are not expressed. The 4.5 kb CMS-associated pol segment has thus apparently undergone transposition during the evolution of the nap and pol cytoplasms and has been lost in the cam genome subsequent to the pol-cam divergence. This 4.5 kb segment comprises the single DNA region that is expressed differently in fertile, pol CMS and fertility restored pol cytoplasm plants. The finding that this locus is part of the single mtDNA region organized differently in the fertile and male sterile mitochondrial genomes provides strong support for the view that it specifies the pol CMS trait. Images PMID:8388101
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.
Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian
2018-03-12
ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter
Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian
2018-01-01
ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529
Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing
2009-11-25
Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.
Arsenic loads in Spearfish Creek, western South Dakota, water years 1989-91
Driscoll, Daniel G.; Hayes, Timothy S.
1995-01-01
Numerous small tributaries on the eastern flank of Spearfish Creek originate within a mineralized area with a long history of gold-mining activity. Some streams draining this area are known to have elevated concentrations of arsenic. One such tributary is Annie Creek, where arsenic concentrations regularly approach the Maximum Contaminant Level of 50 mg/L (micrograms per liter) established by the U.S. Environmental Protection Agency. A site on Annie Creek was proposed for inclusion on the National Priorities List by the Environmental Protection Agency in 1991. This report presents information about arsenic loads and concentrations in Spearfish Creek and its tributaries, including Annie Creek. Stream types were classified according to geologic characteris- tics and in-stream arsenic concentrations. The first type includes streams that lack significant arsenic sources and have low in-stream arsenic concentra- tions. The second type has abundant arsenic sources and high in-stream concentrations. The third type has abundant arsenic sources but only moderate in-stream concentrations. The fourth type is a mixture of the first three types. Annual loads of dissolved arsenic were calculated for two reaches of Spearfish Creek to quantify arsenic loads at selected gaging stations during water years 1989-91. Mass-balance calculations also were performed to estimate arsenic concentrations for ungaged inflows to Spearfish Creek. The drainage area of the upstream reach includes significant mineralized areas, whereas the drainage area of the downstream reach generally is without known arsenic sources. The average load of dissolved arsenic transported from the upstream reach of Spearfish Creek, which is representative of a type 4 stream, was 158 kilograms per year, calculated for station 06430900, Spearfish Creek above Spearfish. Gaged headwater tributaries draining unmineralized areas (type 1) contributed only 16 percent of the arsenic load in 63 percent of the discharge. Annie Creek (type 2), which has the highest measured arsenic concentra- tions in the Spearfish Creek drainage, contributed about 15 percent of the arsenic load in about 2 percent of the discharge of the upstream reach. Squaw Creek, which drains another mineralized area, but has only moderate in-stream concentrations (type 3), contributed 4 percent of the arsenic load in 5 percent of the discharge. Ungaged inflows to the reach contributed the remaining 65 percent of the arsenic load in 30 percent of the discharge. The calculated loads from ungaged inflows include all arsenic contributed by surface- and ground-water sources, as well as any additions of arsenic from dissolution of arsenic-bearing solid phases, or from desorption of arsenic from solid surfaces, within the streambed of the upstream reach. Mass-balance calculations indicate that dissolved arsenic concentrations of the ungaged inflows in the upstream reach averaged about 9 mg/L. In-stream arsenic concentrations of ungaged inflows from the unmineralized western flank of Spearfish Creek probably are generally low (type 1). Thus, in-stream arsenic concentrations for ungaged inflows draining the mineralized eastern flank of Spearfish probably average almost twice that level, or about 18 mg/L. Some ungaged, eastern-flank inflows probably are derived from type 3 drainages, with only moderate arsenic concentrations. If so, other ungaged, eastern-flank inflows could have in-stream arsenic concentrations similar to those of Annie Creek. No significant arsenic sources were apparent in the downstream reach of Spearfish Creek. Over the course of the downstream reach, arsenic concentrations decreased somewhat, probably resulting from dilution, as well as from possible chemical adsorption to sediment surfaces or arsenic-phase precipitation. A decrease in arsenic loads resulted from various diversions from the creek and from the potential chemical removal processes. Because of a large margin of error associated with calculation o
Amplification and chromosomal dispersion of human endogenous retroviral sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Steele, P.E.; Martin, M.A.; Rabson, A.B.
1986-09-01
Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification andmore » dispersion events may be linked.« less
phiC31 Integrase-Mediated Site-Specific Recombination in Barley
Rubtsova, Myroslava; Kumlehn, Jochen; Gils, Mario
2012-01-01
The Streptomyces phage phiC31 integrase was tested for its feasibility in excising transgenes from the barley genome through site-specific recombination. We produced transgenic barley plants expressing an active phiC31 integrase and crossed them with transgenic barley plants carrying a target locus for recombination. The target sequence involves a reporter gene encoding green fluorescent protein (GFP), which is flanked by the attB and attP recognition sites for the phiC31 integrase. This sequence disruptively separates a gusA coding sequence from an upstream rice actin promoter. We succeeded in producing site-specific recombination events in the hybrid progeny of 11 independent barley plants carrying the above target sequence after crossing with plants carrying a phiC31 expression cassette. Some of the hybrids displayed fully executed recombination. Excision of the GFP gene fostered activation of the gusA gene, as visualized in tissue of hybrid plants by histochemical staining. The recombinant loci were detected in progeny of selfed F1, even in individuals lacking the phiC31 transgene, which provides evidence of stability and generative transmission of the recombination events. In several plants that displayed incomplete recombination, extrachromosomal excision circles were identified. Besides the technical advance achieved in this study, the generated phiC31 integrase-expressing barley plants provide foundational stock material for use in future approaches to barley genetic improvement, such as the production of marker-free transgenic plants or switching transgene activity. PMID:23024817
Jong, M T; Raaka, B M; Samuels, H H
1994-10-01
The 5'-flanking region of the gene for Pit-1, a pituitary-specific transcription factor, was isolated from a rat liver genomic library and sequenced. Expression of a reporter construct containing Pit-1 promoter sequences linked to the bacterial chloramphenicol acetyltransferase (CAT) gene was assessed by transient transfection in rat pituitary GH4C1 cells. Treatment of transfected cells with either dexamethasone (DEX) for 48 h or the phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA) for the final 20 h of the 48-h posttransfection period had minimal effects on CAT expression. However, CAT activity was elevated about 20-fold when transfected cells were treated with both DEX and TPA. This apparent synergistic activation was lost when DEX treatment was also limited to the final 20 h of the 48-h posttransfection period, suggesting that a time-dependent accumulation of a DEX-induced gene product might be involved. This putative DEX-induced product appeared to be relatively stable, because synergistic activation was observed in cells treated with DEX alone for 36 h, followed by a 10-h incubation without DEX before the addition of TPA. The Pit-1 gene promoter region between -210 and -142 from the transcription start site conferred synergistic regulation by DEX and TPA when placed upstream of position -105 in the herpes viral thymidine kinase promoter.(ABSTRACT TRUNCATED AT 250 WORDS)
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Surface waves on the tailward flanks of the Earth's magnetopause
NASA Technical Reports Server (NTRS)
Seon, J.; Frank, L. A.; Lazarus, A. J.; Lepping, R. P.
1995-01-01
Forty-three examples of ISEE 1 tailward flank side magnetopause crossings are examined and directly compared with upstream solar wind parameters. The crossings are classified into two groups. In the first group, a few sudden magnetopause crossings are observed, whereas repeated magnetopause crossings and oscillatory motions, often with boundary layer signatures, are observed in the second group. These distinctive characteristics of the two groups are interpreted in terms of the surface waves due to the Kelvin-Helmholtz instability. It is found that low solar wind speed tends to favor characteristics of the first group, whereas high solar wind speed yields those of the second group. However, no evident correlations between the groups and the interplanetary magnetic field directions are found.
Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N
2003-09-01
Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.
Dean, C; Jones, J; Favreau, M; Dunsmuir, P; Bedbrook, J
1988-01-01
The petunia rbcS gene SSU301 was introduced into tobacco using Agrobacterium tumefaciens-mediated transformation. The time at which rbcS expression was maximal after transfer of the tobacco plants to the greenhouse was determined. The expression level of the SSU301 gene varied up to 9 fold between individual tobacco plants which had been standardized physiologically as much as possible. The presence of adjacent pUC plasmid sequences did not affect the expression of the SSU301 gene. In an attempt to reduce the between-transformant variability in expression, the SSU301 gene was introduced into tobacco surrounded by 10kb of 5' and 13 kb of 3' DNA sequences which normally flank SSU301 in petunia. The longer flanking regions did not reduce the between-transformant variability of SSU301 gene expression. Images PMID:3174450
Walker, Andreas; Skibbe, Kathrin; Steinmann, Eike; Pfaender, Stephanie; Kuntzen, Thomas; Megger, Dominik A; Groten, Svenja; Sitek, Barbara; Lauer, Georg M; Kim, Arthur Y; Pietschmann, Thomas; Allen, Todd M; Timm, Joerg
2016-01-01
Antiviral CD8(+) T cells are a key component of the adaptive immune response against HCV, but their impact on viral control is influenced by preexisting viral variants in important target epitopes and the development of viral escape mutations. Immunodominant epitopes highly conserved across genotypes therefore are attractive for T cell based prophylactic vaccines. Here, we characterized the CD8(+) T cell response against the highly conserved HLA-B*51-restricted epitope IPFYGKAI1373-1380 located in the helicase domain of NS3 in people who inject drugs (PWID) exposed predominantly to HCV genotypes 1a and 3a. Despite this epitope being conserved in both genotypes, the corresponding CD8(+) T cell response was detected only in PWID infected with genotype 3a and HCV-RNA negative PWID, but not in PWID infected with genotype 1a. In genotype 3a, the detection of strong CD8(+) T cell responses was associated with epitope variants in the autologous virus consistent with immune escape. Analysis of viral sequences from multiple cohorts confirmed HLA-B*51-associated escape mutations inside the epitope in genotype 3a, but not in genotype 1a. Here, a distinct substitution in the N-terminal flanking region located 5 residues upstream of the epitope (S1368P; P = 0.00002) was selected in HLA-B*51-positive individuals. Functional assays revealed that the S1368P substitution impaired recognition of target cells presenting the endogenously processed epitope. The results highlight that, despite an epitope being highly conserved between two genotypes, there are major differences in the selected viral escape pathways and the corresponding T cell responses. HCV is able to evolutionary adapt to CD8(+) T cell immune pressure in multiple ways. Beyond selection of mutations inside targeted epitopes, this study demonstrates that HCV inhibits epitope processing by modification of the epitope flanking region under T cell immune pressure. Selection of a substitution five amino acids upstream of the epitope underlines that efficient antigen presentation strongly depends on its larger sequence context and that blocking of the multistep process of antigen processing by mutation is exploited also by HCV. The pathways to mutational escape of HCV are to some extent predictable but are distinct in different genotypes. Importantly, the selected escape pathway of HCV may have consequences for the destiny of antigen-specific CD8(+) T cells. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Method to amplify variable sequences without imposing primer sequences
Bradbury, Andrew M.; Zeytun, Ahmet
2006-11-14
The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.
Regional centromeres in the yeast Candida lusitaniae lack pericentromeric heterochromatin
Kapoor, Shivali; Zhu, Lisha; Froyd, Cara; Liu, Tao; Rusche, Laura N.
2015-01-01
Point centromeres are specified by a short consensus sequence that seeds kinetochore formation, whereas regional centromeres lack a conserved sequence and instead are epigenetically inherited. Regional centromeres are generally flanked by heterochromatin that ensures high levels of cohesin and promotes faithful chromosome segregation. However, it is not known whether regional centromeres require pericentromeric heterochromatin. In the yeast Candida lusitaniae, we identified a distinct type of regional centromere that lacks pericentromeric heterochromatin. Centromere locations were determined by ChIP-sequencing of two key centromere proteins, Cse4 and Mif2, and are consistent with bioinformatic predictions. The centromeric DNA sequence was unique for each chromosome and spanned 4–4.5 kbp, consistent with regional epigenetically inherited centromeres. However, unlike other regional centromeres, there was no evidence of pericentromeric heterochromatin in C. lusitaniae. In particular, flanking genes were expressed at a similar level to the rest of the genome, and a URA3 reporter inserted adjacent to a centromere was not repressed. In addition, regions flanking the centromeric core were not associated with hypoacetylated histones or a sirtuin deacetylase that generates heterochromatin in other yeast. Interestingly, the centromeric chromatin had a distinct pattern of histone modifications, being enriched for methylated H3K79 and H3R2 but lacking methylation of H3K4, which is found at other regional centromeres. Thus, not all regional centromeres require flanking heterochromatin. PMID:26371315
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lane, H.R.; Frye, M.W.; Couples, G.D.
1992-01-01
Biothems are regional wedge- or lens-shaped bodies of strata that are bounded shelfward or cratonward by paleontologically recognizable unconformities; generally thicken on marine shelves, where they are typically conformable with underlying and overlying biothems; are commonly thinner or represent starved sequences further basinward; and in their most basinward extent, are either bounded by biostratigraphically recognizable unconformities or are conformable with underlying and overlying biothems. As recognized to date, biothems have a logical distribution of faunal and floral components, as well as facies groupings that represent internally consistent and logical sequences of depositional environments. A west-to-east transect within the North Americanmore » Mississippian System which extends from the Basin and Range Province, across the Transcontinental Arch (TA), into the Anadarko Basin, was constructed to demonstrate the regional distribution and tectono-stratigraphic significance of biothems relative to the axis of the TA. The relationships portrayed on the transect, tied to an understanding of North American Mississippian paleogeography, imply that biothems deposited during relative highstand events on one flank of the TA are time-equivalent to biothems deposited during relative lowstand events on the opposite flank of the TA. This distribution is interpreted to have been controlled by intraplate tectonic events that formed piano key basins along the flanks of the TA. The spatial patterns of these basins are not consistent with published models of basin evolution. A further conclusion is that the lack of coincident, transgressive or regressive Mississippian biothems on either flank of the TA suggests that it is inadvisable to impose the Mississippi Valley-derived eustasy curve on western flank depositional sequences.« less
Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T
1993-12-01
CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.
Molecular analysis of the human SLC13A4 sulfate transporter gene promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland
2013-03-29
Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Microhomology-mediated end joining induces hypermutagenesis at breakpoint junctions
Li, Fuyang; Villarreal, Diana; Shim, Jae Hoon; Myung, Kyungjae; Shim, Eun Yong; Lee, Sang Eun
2017-01-01
Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of a DSB accumulates mutations in the reporter gene situated up to 14-kb distal to the 15-bp MH, but more modestly to those carrying 18- and 203-bp or no homology. Increased mutagenesis in MH-mediated end joining (MMEJ) appears coupled to its slower repair kinetics and the extensive resection occurring at flanking DNA. Chromosomal translocations via MMEJ also elevate mutagenesis of the flanking DNA sequences 7.1 kb distal to the breakpoint junction as compared to those without MH. The results suggest that MMEJ could destabilize genomes by triggering structural alterations and increasing mutation burden. PMID:28419093
Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.
Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A
2016-03-18
Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.
Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh
2011-04-29
Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.
Synthetic Promoters Functional in Francisella novicida and Escherichia coli
McWhinnie, Ralph L.
2014-01-01
In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126
Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T
1997-02-07
An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.
Small Deletion Variants Have Stable Breakpoints Commonly Associated with Alu Elements
Coin, Lachlan J. M.; Steinfeld, Israel; Yakhini, Zohar; Sladek, Rob; Froguel, Philippe; Blakemore, Alexandra I. F.
2008-01-01
Copy number variants (CNVs) contribute significantly to human genomic variation, with over 5000 loci reported, covering more than 18% of the euchromatic human genome. Little is known, however, about the origin and stability of variants of different size and complexity. We investigated the breakpoints of 20 small, common deletions, representing a subset of those originally identified by array CGH, using Agilent microarrays, in 50 healthy French Caucasian subjects. By sequencing PCR products amplified using primers designed to span the deleted regions, we determined the exact size and genomic position of the deletions in all affected samples. For each deletion studied, all individuals carrying the deletion share identical upstream and downstream breakpoints at the sequence level, suggesting that the deletion event occurred just once and later became common in the population. This is supported by linkage disequilibrium (LD) analysis, which has revealed that most of the deletions studied are in moderate to strong LD with surrounding SNPs, and have conserved long-range haplotypes. Analysis of the sequences flanking the deletion breakpoints revealed an enrichment of microhomology at the breakpoint junctions. More significantly, we found an enrichment of Alu repeat elements, the overwhelming majority of which intersected deletion breakpoints at their poly-A tails. We found no enrichment of LINE elements or segmental duplications, in contrast to other reports. Sequence analysis revealed enrichment of a conserved motif in the sequences surrounding the deletion breakpoints, although whether this motif has any mechanistic role in the formation of some deletions has yet to be determined. Considered together with existing information on more complex inherited variant regions, and reports of de novo variants associated with autism, these data support the presence of different subgroups of CNV in the genome which may have originated through different mechanisms. PMID:18769679
Identification of the promoter of the myelomonocytic leukocyte integrin CD11b.
Hickstein, D D; Baker, D M; Gollahon, K A; Back, A L
1992-01-01
The CD11b (or macrophage-1 antigen; MAC-1) subunit of the leukocyte integrin family forms a noncovalently associated heterodimeric structure with the CD18 (beta) subunit on the surface of human granulocytes and monocyte/macrophages, where it enables these myeloid cells to participate in a variety of adherence-related activities. Expression of the CD11b subunit is restricted to cells of the myelomonocytic lineage and depends upon the stage of differentiation with the most mature myeloid cells expressing the highest levels of CD11b. To study the regulation of CD11b expression, a genomic clone corresponding to the 5' region of the CD11b gene was isolated from a human chromosome 16 library. Primer extension and RNase protection assays identified two major transcriptional start sites, located 90 base pairs and 54 base pairs upstream from the initiation methionine. DNA sequence analysis of 1.7 kilobases of the 5' flanking sequence of the CD11b gene indicated the absence of a "CAAT" or "TATA" box; however, potential binding sites for the transcription activators Sp1, PU.1, ets, and AP-2 are present, as well as retinoic acid response elements. The 1.7-kilobase CD11b promoter sequence displayed functional activity in transient transfection assays in the monocytic cell line THP-1 and the myeloid cell line HL-60. In contrast, this 1.7-kilobase promoter sequence did not display functional activity in the Jurkat T-lymphoid cell line. Detailed characterization of the CD11b promoter sequence should provide insight into the molecular events regulating the tissue-specific and developmental stage-specific expression of the CD11b molecule in myelomonocytic cells. Images PMID:1347945
Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins
Manzel, Lori J.; Chin, Cecilia L.; Behlke, Mark A.; Look, Dwight C.
2009-01-01
Direct interaction between bacteria and epithelial cells may initiate or amplify the airway response through induction of epithelial defense gene expression by nuclear factor-κB (NF-κB). However, multiple signaling pathways modify NF-κB effects to modulate gene expression. In this study, the effects of CCAAT/enhancer binding protein (C/EBP) family members on induction of the leukocyte adhesion glycoprotein intercellular adhesion molecule-1 (ICAM-1) was examined in primary cultures of human tracheobronchial epithelial cells incubated with nontypeable Haemophilus influenzae. Increased ICAM-1 gene transcription in response to H. influenzae required gene sequences located at −200 to −135 in the 5′-flanking region that contain a C/EBP-binding sequence immediately upstream of the NF-κB enhancer site. Constitutive C/EBPβ was found to have an important role in epithelial cell ICAM-1 regulation, while the adjacent NF-κB sequence binds the RelA/p65 and NF-κB1/p50 members of the NF-κB family to induce ICAM-1 expression in response to H. influenzae. The expression of C/EBP proteins is not regulated by p38 mitogen-activated protein kinase activation, but p38 affects gene transcription by increasing the binding of TATA-binding protein to TATA-box–containing gene sequences. Epithelial cell ICAM-1 expression in response to H. influenzae was decreased by expressing dominant-negative protein or RNA interference against C/EBPβ, confirming its role in ICAM-1 regulation. Although airway epithelial cells express multiple constitutive and inducible C/EBP family members that bind C/EBP sequences, the results indicate that C/EBPβ plays a central role in modulation of NF-κB–dependent defense gene expression in human airway epithelial cells after exposure to H. influenzae. PMID:18703796
Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László
2005-01-01
DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291
Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László
2005-01-01
DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.
Briney, Bryan S; Willis, Jordan R; Hicar, Mark D; Thomas, James W; Crowe, James E
2012-09-01
Antibody heavy-chain recombination that results in the incorporation of multiple diversity (D) genes, although uncommon, contributes substantially to the diversity of the human antibody repertoire. Such recombination allows the generation of heavy chain complementarity determining region 3 (HCDR3) regions of extreme length and enables junctional regions that, because of the nucleotide bias of N-addition regions, are difficult to produce through normal V(D)J recombination. Although this non-classical recombination process has been observed infrequently, comprehensive analysis of the frequency and genetic characteristics of such events in the human peripheral blood antibody repertoire has not been possible because of the rarity of such recombinants and the limitations of traditional sequencing technologies. Here, through the use of high-throughput sequencing of the normal human peripheral blood antibody repertoire, we analysed the frequency and genetic characteristics of V(DD)J recombinants. We found that these recombinations were present in approximately 1 in 800 circulating B cells, and that the frequency was severely reduced in memory cell subsets. We also found that V(DD)J recombination can occur across the spectrum of diversity genes, indicating that virtually all recombination signal sequences that flank diversity genes are amenable to V(DD)J recombination. Finally, we observed a repertoire bias in the diversity gene repertoire at the upstream (5') position, and discovered that this bias was primarily attributable to the order of diversity genes in the genomic locus. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.
Gene Deletion in Barley Mediated by LTR-retrotransposon BARE
Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao
2017-01-01
A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053
Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene.
Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen
2016-01-01
The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5'-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5'-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5'-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle.
Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene
Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen
2016-01-01
The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5’-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5’-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5’-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle. PMID:27379520
Wang, Y J; Liu, T; Hou, J M; Zuo, Y H
2013-09-01
In this report, 156 hygromycin-resistant mutants were generated via restriction enzyme-mediated insertional (REMI) mutagenesis. All mutants were subjected to a bioassay on detached leaves. Five mutants (T4, T39, T71, T91, and T135) showed reduced symptom development, whereas one mutant (T120) did not exhibit any symptoms on the leaves compared with the wild type. The pathogenicity of these mutants was further assayed through the spray inoculation of whole seedlings. The results demonstrated that the pathogenicity of the T4, T39, T71, T91, and T135 mutants was reduced, whereas the T120 mutant lost its pathogenicity. Southern blot analysis revealed that the plasmids were inserted at different sites in the genome with different copy numbers. Flanking sequences approximately 550, 860, and 150 bp were obtained from T7, T91, and T120, respectively through plasmids rescue. Sequence analysis of the flanking sequences from T7 and T91 showed no homology to any known sequences in GenBank. The flanking sequence from the T120 mutant was highly homologous to MAPKK kinases, which regulates sexual/asexual development, melanization, pathogenicity from Cochliobolus heterostrophus. These results indicate that REMI and plasmids rescue have great potential for finding pathogenicity genes.
Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M
1989-10-05
We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.
Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M
1984-01-01
Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178
Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U
2000-01-01
Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.
Nowacka-Woszuk, Joanna; Switonski, Marek
2009-01-01
The sex determination process is under the control of several genes of which two (SRY and SOX9), encoding transcription factors, play a crucial role. It is well-known that mutations at these genes may cause the development of an intersexual phenotype. The aim of this study was to conduct a comparative analysis of the coding sequence and 5'-flanking regions of both genes in four species of the family Canidae (the dog, red fox, arctic fox and Chinese raccoon dog). Similarity of the coding sequence of the SOX9 gene among the studied species was higher (99.7-99.9%) than in the case of the SRY gene (96.7-97.3%). Only single nucleotide changes were found in the compared coding sequences, whereas in the 5'-flanking region of both genes nucleotide substitutions, as well as insertions and deletions were observed. None of the changes detected in the 5'-flanking region occurred within the potential consensus sequences for transcription factors. No polymorphism was found for either of these genes in any of the analyzed species.
Human renin 5'-flanking DNA to nucleotide-2750.
Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J
1995-01-01
Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.
Lian, Kaiqi; Yang, Fan; Zhu, Zixiang; Cao, Weijun; Jin, Ye; Li, Dan; Zhang, Keshan; Guo, Jianhong; Zheng, Haixue; Liu, Xiangtao
2015-10-02
We developed an RNA polymerase (pol) I- and II-driven plasmid-based reverse genetics system to rescue infectious foot-and-mouth disease virus (FMDV) from cloned cDNA. In this plasmid-based transfection, the full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta ribozyme (HdvRz) sequences, which were arranged downstream of the two promoters (cytomegalovirus (CMV) and pol I promoter) and upstream of the terminators and polyadenylation signal, respectively. The utility of this method was demonstrated by the recovery of FMDV Asia1 HN/CHA/06 in BHK-21 cells transfected with cDNA plasmids. Furthermore, infectious FMDV Asia1 HN/CHA/06 could be rescued from suckling mice directly inoculated with cDNA plasmids. Thus, this reverse genetics system can be applied to fundamental research and vaccine studies, most notably to rescue those viruses for which there is currently an absence of a suitable cell culture system. Copyright © 2015 Elsevier B.V. All rights reserved.
Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui
2015-10-26
Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null mutant makes an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium and Rhodotorula genera. The system will be a valuable tool for metabolic engineering and enzyme expression in these yeast hosts.
Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P
2007-08-01
To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.
Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism
USDA-ARS?s Scientific Manuscript database
Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...
Thieme, Frank; Marillonnet, Sylvestre
2014-01-01
Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.
Characterization of genetic sequence variation of 58 STR loci in four major population groups.
Novroski, Nicole M M; King, Jonathan L; Churchill, Jennifer D; Seah, Lay Hong; Budowle, Bruce
2016-11-01
Massively parallel sequencing (MPS) can identify sequence variation within short tandem repeat (STR) alleles as well as their nominal allele lengths that traditionally have been obtained by capillary electrophoresis. Using the MiSeq FGx Forensic Genomics System (Illumina), STRait Razor, and in-house excel workbooks, genetic variation was characterized within STR repeat and flanking regions of 27 autosomal, 7 X-chromosome and 24 Y-chromosome STR markers in 777 unrelated individuals from four population groups. Seven hundred and forty six autosomal, 227 X-chromosome, and 324 Y-chromosome STR alleles were identified by sequence compared with 357 autosomal, 107 X-chromosome, and 189 Y-chromosome STR alleles that were identified by length. Within the observed sequence variation, 227 autosomal, 156 X-chromosome, and 112 Y-chromosome novel alleles were identified and described. One hundred and seventy six autosomal, 123 X-chromosome, and 93 Y-chromosome sequence variants resided within STR repeat regions, and 86 autosomal, 39 X-chromosome, and 20 Y-chromosome variants were located in STR flanking regions. Three markers, D18S51, DXS10135, and DYS385a-b had 1, 4, and 1 alleles, respectively, which contained both a novel repeat region variant and a flanking sequence variant in the same nucleotide sequence. There were 50 markers that demonstrated a relative increase in diversity with the variant sequence alleles compared with those of traditional nominal length alleles. These population data illustrate the genetic variation that exists in the commonly used STR markers in the selected population samples and provide allele frequencies for statistical calculations related to STR profiling with MPS data. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Kardinal, C; Selmayr, M; Mocikat, R
1996-01-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041
Kardinal, C; Selmayr, M; Mocikat, R
1996-11-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.
Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M
1980-01-01
Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156
Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.
1990-01-01
Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764
Agarwal, Sorabh
2018-01-01
Abstract Overexpression of the proinflammatory cytokine macrophage migration inhibitory factor (MIF) is linked to a number of autoimmune diseases and cancer. MIF production has been correlated to the number of CATT repeats in a microsatellite region upstream of the MIF gene. We have characterized the interaction of pituitary-specific positive transcription factor 1 (Pit-1) with a portion of the MIF promoter region flanking a microsatellite polymorphism (−794 CATT5–8). Using fluorescence anisotropy, we quantified tight complex formation between Pit-1 and an oligonucleotide consisting of eight consecutive CATT repeats (8xCATT) with an apparent Kd of 35 nM. Using competition experiments we found a 23 base pair oligonucleotide with 4xCATT repeats to be the minimum DNA sequence necessary for high affinity interaction with Pit-1. The stoichiometry of the Pit-1 DNA interaction was determined to be 2:1 and binding is cooperative in nature. We subsequently structurally characterized the complex and discovered a completely novel binding mode for Pit-1 in contrast to previously described Pit-1 complex structures. The affinity of Pit-1 for the CATT target sequence was found to be highly dependent on cooperativity. This work lays the groundwork for understanding transcriptional regulation of MIF and pursuing Pit-1 as a therapeutic target to treat MIF-mediated inflammatory disorders. PMID:29186613
Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D
2014-01-01
The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841
Chowdari, K V; Northup, A; Pless, L; Wood, J; Joo, Y H; Mirnics, K; Lewis, D A; Levitt, P R; Bacanu, S-A; Nimgaonkar, V L
2007-04-01
Many candidate gene association studies have evaluated incomplete, unrepresentative sets of single nucleotide polymorphisms (SNPs), producing non-significant results that are difficult to interpret. Using a rapid, efficient strategy designed to investigate all common SNPs, we tested associations between schizophrenia and two positional candidate genes: ACSL6 (Acyl-Coenzyme A synthetase long-chain family member 6) and SIRT5 (silent mating type information regulation 2 homologue 5). We initially evaluated the utility of DNA sequencing traces to estimate SNP allele frequencies in pooled DNA samples. The mean variances for the DNA sequencing estimates were acceptable and were comparable to other published methods (mean variance: 0.0008, range 0-0.0119). Using pooled DNA samples from cases with schizophrenia/schizoaffective disorder (Diagnostic and Statistical Manual of Mental Disorders edition IV criteria) and controls (n=200, each group), we next sequenced all exons, introns and flanking upstream/downstream sequences for ACSL6 and SIRT5. Among 69 identified SNPs, case-control allele frequency comparisons revealed nine suggestive associations (P<0.2). Each of these SNPs was next genotyped in the individual samples composing the pools. A suggestive association with rs 11743803 at ACSL6 remained (allele-wise P=0.02), with diminished evidence in an extended sample (448 cases, 554 controls, P=0.062). In conclusion, we propose a multi-stage method for comprehensive, rapid, efficient and economical genetic association analysis that enables simultaneous SNP detection and allele frequency estimation in large samples. This strategy may be particularly useful for research groups lacking access to high throughput genotyping facilities. Our analyses did not yield convincing evidence for associations of schizophrenia with ACSL6 or SIRT5.
Melano, Roberto; Petroni, Alejandro; Garutti, Alicia; Saka, Héctor Alex; Mange, Laura; Pasterán, Fernando; Rapoport, Melina; Rossi, Alicia; Galas, Marcelo
2002-01-01
In a previous study, an analysis of 77 ampicillin-nonsusceptible (resistant plus intermediate categories) strains of Vibrio cholerae non-O1, non-O139, isolated from aquatic environment and diarrheal stool, showed that all of them produced a β-lactamase with a pI of 5.4. Hybridization or amplification by PCR with a probe for blaTEM or primers for blaCARB gene families was negative. In this work, an environmental ampicillin-resistant strain from this sample, ME11762, isolated from a waterway in the west region of Argentina, was studied. The nucleotide sequence of the structural gene of the β-lactamase was determined by bidirectional sequencing of a Sau3AI fragment belonging to this isolate. The gene encodes a new 288-amino-acid protein, designated CARB-7, that shares 88.5% homology with the CARB-6 enzyme; an overall 83.2% homology with PSE-4, PSE-1, CARB-3, and the Proteus mirabilis N29 enzymes; and 79% homology with CARB-4 enzyme. The gene for this β-lactamase could not be transferred to Escherichia coli by conjugation. The nucleotide sequence of the flanking regions of the blaCARB-7 gene showed the occurrence of three 123-bp V. cholerae repeated sequences, all of which were found outside the predicted open reading frame. The upstream fragment of the blaCARB-7 gene shared 93% identity with a locus situated inside V. cholerae's chromosome 2. These results strongly suggest the chromosomal location of the blaCARB-7 gene, making this the first communication of a β-lactamase gene located on the VCR island of the V. cholerae genome. PMID:12069969
Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J
1989-11-25
Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids encoding PKI(1-31) inhibit the expression that is stimulated by the addition of cAMP analogs in both cell lines; basal expression, however, is inhibited by PKI(1-31) only in the JEG-3 cell line and not in the CV-1 cells. These observations indicate that, in JEG-3 cells, PKI(1-31) is a specific inhibitor of kinase A-mediated gene transcription, but it does not modify kinase C-directed transcription.(ABSTRACT TRUNCATED AT 400 WORDS)
Seabream ghrelin: cDNA cloning, genomic organization and promoter studies.
Yeung, Chung-Man; Chan, Chi-Bun; Woo, Norman Y S; Cheng, Christopher H K
2006-05-01
Recent studies have indicated that ghrelin stimulates growth hormone release from the pituitary via the growth hormone secretagogue receptor (GHSR). We have previously isolated two GHSR subtypes from the pituitary of the black seabream Acanthopagrus schlegeli. In the present study, we have cloned and characterized ghrelin from the same fish species at both the cDNA and gene levels. The full-length seabream ghrelin cDNA, isolated from sea-bream stomach using a novel approach by exploiting a single conserved region in the coding region, was found to encode a prepropeptide of 107 amino acids, with the predicted mature ghrelin peptide consisting of 20 amino acids (GSSFLSPSQKPQNRGKSSRV). Embedded in this full-length cDNA is a putative fish orthologue of the recently reported mammalian obestatin peptide. The ghrelin gene in black seabream, obtained by genomic PCR, was found to encompass four exons and three introns, possessing the same structural organization as in tilapia and goldfish, but different from that in rainbow trout. In addition, a 2230-bp 5'-flanking region of the seabream ghrelin gene was obtained by genome walking. Sequence analysis revealed that, as in the case of the human ghrelin gene, there is neither a GC box nor a CAAT box present in the isolated 5'-flanking region. However, a number of putative transcription factor-binding sites different from the human counterpart were found in the 5'-flanking region of the seabream ghrelin gene, suggesting that different cis- and trans-acting elements are involved in controlling their gene expression. Functional activity of this 5'-flanking region was examined by cloning it into the pGL3-Basic vector upstream of the luciferase reporter gene and transfected into various cell lines. Positive promoter activity could only be recorded in the colon-derived Caco-2 cells, suggesting that the cloned 5'-flanking region represents the functional promoter of the seabream ghrelin gene, which exhibits tissue-specific promoter activity. Using reverse transcriptase PCR analysis, expression of ghrelin was detected only in the seabream stomach, but not in the other tissues examined, including the brain, gill, intestine, kidney, liver and spleen. This stomach-specific expression of ghrelin in seabream is subject to regulation, as administration of growth hormone or ipamorelin to the fish in vivo was demonstrated to enhance its expression. Reminiscent of the homologous upregulation found in the transcriptional control of the seabream GHSR gene, a similar homologous regulatory mechanism might also exist in controlling the expression of seabream ghrelin. The identification of both GHSR and ghrelin from a single fish species would facilitate our subsequent studies on the elucidation of the physiological functions of the ghrelin/GHSR system in teleost. The possible existence of obestatin in teleost opens up new research avenues on the somatotropic axis in fish.
Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui
2017-06-01
The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.
Molin, William T; Wright, Alice A; Lawton-Rauh, Amy; Saski, Christopher A
2017-01-17
The expanding number and global distributions of herbicide resistant weedy species threaten food, fuel, fiber and bioproduct sustainability and agroecosystem longevity. Amongst the most competitive weeds, Amaranthus palmeri S. Wats has rapidly evolved resistance to glyphosate primarily through massive amplification and insertion of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene across the genome. Increased EPSPS gene copy numbers results in higher titers of the EPSPS enzyme, the target of glyphosate, and confers resistance to glyphosate treatment. To understand the genomic unit and mechanism of EPSPS gene copy number proliferation, we developed and used a bacterial artificial chromosome (BAC) library from a highly resistant biotype to sequence the local genomic landscape flanking the EPSPS gene. By sequencing overlapping BACs, a 297 kb sequence was generated, hereafter referred to as the "EPSPS cassette." This region included several putative genes, dense clusters of tandem and inverted repeats, putative helitron and autonomous replication sequences, and regulatory elements. Whole genome shotgun sequencing (WGS) of two biotypes exhibiting high and no resistance to glyphosate was performed to compare genomic representation across the EPSPS cassette. Mapping of sequences for both biotypes to the reference EPSPS cassette revealed significant differences in upstream and downstream sequences relative to EPSPS with regard to both repetitive units and coding content between these biotypes. The differences in sequence may have resulted from a compounded-building mechanism such as repetitive transpositional events. The association of putative helitron sequences with the cassette suggests a possible amplification and distribution mechanism. Flow cytometry revealed that the EPSPS cassette added measurable genomic content. The adoption of glyphosate resistant cropping systems in major crops such as corn, soybean, cotton and canola coupled with excessive use of glyphosate herbicide has led to evolved glyphosate resistance in several important weeds. In Amaranthus palmeri, the amplification of the EPSPS cassette, characterized by a complex array of repetitive elements and putative helitron sequences, suggests an adaptive structural genomic mechanism that drives amplification and distribution around the genome. The added genomic content not found in glyphosate sensitive plants may be driving evolution through genome expansion.
A genetic switch controls the production of flagella and toxins in Clostridium difficile.
Anjuwon-Foster, Brandon R; Tamayo, Rita
2017-03-01
In the human intestinal pathogen Clostridium difficile, flagella promote adherence to intestinal epithelial cells. Flagellar gene expression also indirectly impacts production of the glucosylating toxins, which are essential to diarrheal disease development. Thus, factors that regulate the expression of the flgB operon will likely impact toxin production in addition to flagellar motility. Here, we report the identification a "flagellar switch" that controls the phase variable production of flagella and glucosylating toxins. The flagellar switch, located upstream of the flgB operon containing the early stage flagellar genes, is a 154 bp invertible sequence flanked by 21 bp inverted repeats. Bacteria with the sequence in one orientation expressed flagellum and toxin genes, produced flagella, and secreted the toxins ("flg phase ON"). Bacteria with the sequence in the inverse orientation were attenuated for flagellar and toxin gene expression, were aflagellate, and showed decreased toxin secretion ("flg phase OFF"). The orientation of the flagellar switch is reversible during growth in vitro. We provide evidence that gene regulation via the flagellar switch occurs post-transcription initiation and requires a C. difficile-specific regulatory factor to destabilize or degrade the early flagellar gene mRNA when the flagellar switch is in the OFF orientation. Lastly, through mutagenesis and characterization of flagellar phase locked isolates, we determined that the tyrosine recombinase RecV, which catalyzes inversion at the cwpV switch, is also responsible for inversion at the flagellar switch in both directions. Phase variable flagellar motility and toxin production suggests that these important virulence factors have both advantageous and detrimental effects during the course of infection.
U6 small nuclear RNA is transcribed by RNA polymerase III.
Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T
1986-01-01
A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970
Redmond, Catherine J.; Dooley, Katharine E.; Fu, Haiqing; Gillison, Maura L.; Akagi, Keiko; Symer, David E.; Aladjem, Mirit I.
2018-01-01
Integration of human papillomavirus (HPV) genomes into cellular chromatin is common in HPV-associated cancers. Integration is random, and each site is unique depending on how and where the virus integrates. We recently showed that tandemly integrated HPV16 could result in the formation of a super-enhancer-like element that drives transcription of the viral oncogenes. Here, we characterize the chromatin landscape and genomic architecture of this integration locus to elucidate the mechanisms that promoted de novo super-enhancer formation. Using next-generation sequencing and molecular combing/fiber-FISH, we show that ~26 copies of HPV16 are integrated into an intergenic region of chromosome 2p23.2, interspersed with 25 kb of amplified, flanking cellular DNA. This interspersed, co-amplified viral-host pattern is frequent in HPV-associated cancers and here we designate it as Type III integration. An abundant viral-cellular fusion transcript encoding the viral E6/E7 oncogenes is expressed from the integration locus and the chromatin encompassing both the viral enhancer and a region in the adjacent amplified cellular sequences is strongly enriched in the super-enhancer markers H3K27ac and Brd4. Notably, the peak in the amplified cellular sequence corresponds to an epithelial-cell-type specific enhancer. Thus, HPV16 integration generated a super-enhancer-like element composed of tandem interspersed copies of the viral upstream regulatory region and a cellular enhancer, to drive high levels of oncogene expression. PMID:29364907
Lunar Surface Electric Potential Changes Associated with Traversals through the Earth's Foreshock
NASA Technical Reports Server (NTRS)
Collier, Michael R.; Hills, H. Kent; Stubbs, Timothy J.; Halekas, Jasper S.; Delory, Gregory T.; Espley, Jared; Farrell, William M.; Freeman, John W.; Vondrak, Richard
2011-01-01
We report an analysis of one year of Suprathermal Ion Detector Experiment (SIDE) Total Ion Detector (TID) resonance events observed between January 1972 and January 1973. The study includes only those events during which upstream solar wind conditions were readily available. The analysis shows that these events are associated with lunar traversals through the dawn flank of the terrestrial magnetospheric bow shock. We propose that the events result from an increase in lunar surface electric potential effected by secondary electron emission due to primary electrons in the Earth's foreshock region (although primary ions may play a role as well). This work establishes (1) the lunar surface potential changes as the Moon moves through the terrestrial bow shock, (2) the lunar surface achieves potentials in the upstream foreshock region that differ from those in the downstream magnetosheath region, (3) these differences can be explained by the presence of energetic electron beams in the upstream foreshock region and (4) if this explanation is correct, the location of the Moon with respect to the terrestrial bow shock influences lunar surface potential.
Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta
2000-01-01
Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136
Fritsch, Leonie; Fischer, Rainer; Wambach, Christoph; Dudek, Max; Schillberg, Stefan; Schröper, Florian
2015-08-01
Simple and reliable, high-throughput techniques to detect the zygosity of transgenic events in plants are valuable for biotechnology and plant breeding companies seeking robust genotyping data for the assessment of new lines and the monitoring of breeding programs. We show that next-generation sequencing (NGS) applied to short PCR products spanning the transgene integration site provides accurate zygosity data that are more robust and reliable than those generated by PCR-based methods. The NGS reads covered the 5' border of the transgenic events (incorporating part of the transgene and the flanking genomic DNA), or the genomic sequences flanking the unfilled transgene integration site at the wild-type locus. We compared the NGS method to competitive real-time PCR with transgene-specific and wild-type-specific primer/probe pairs, one pair matching the 5' genomic flanking sequence and 5' part of the transgene and the other matching the unfilled transgene integration site. Although both NGS and real-time PCR provided useful zygosity data, the NGS technique was favorable because it needed fewer optimization steps. It also provided statistically more-reliable evidence for the presence of each allele because each product was often covered by more than 100 reads. The NGS method is also more suitable for the genotyping of large panels of plants because up to 80 million reads can be produced in one sequencing run. Our novel method is therefore ideal for the rapid and accurate genotyping of large numbers of samples.
White, J H; Johnson, A L; Lowndes, N F; Johnston, L H
1991-01-01
By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644
Dai, Jianjun; Wang, Shaohui; Guerlebeck, Doreen; Laturnus, Claudia; Guenther, Sebastian; Shi, Zhenyu; Lu, Chengping; Ewers, Christa
2010-09-09
Extraintestinal pathogenic E. coli (ExPEC) represent a phylogenetically diverse group of bacteria which are implicated in a large range of infections in humans and animals. Although subgroups of different ExPEC pathotypes, including uropathogenic, newborn meningitis causing, and avian pathogenic E. coli (APEC) share a number of virulence features, there still might be factors specifically contributing to the pathogenesis of a certain subset of strains or a distinct pathotype. Thus, we made use of suppression subtractive hybridization and compared APEC strain IMT5155 (O2:K1:H5; sequence type complex 95) with human uropathogenic E. coli strain CFT073 (O6:K2:H5; sequence type complex 73) to identify factors which may complete the currently existing model of APEC pathogenicity and further elucidate the position of this avian pathotype within the whole ExPEC group. Twenty-eight different genomic loci were identified, which are present in IMT5155 but not in CFT073. One of these loci contained a gene encoding a putative autotransporter adhesin. The open reading frame of the gene spans a 3,498 bp region leading to a putative 124-kDa adhesive protein. A specific antibody was raised against this protein and expression of the adhesin was shown under laboratory conditions. Adherence and adherence inhibition assays demonstrated a role for the corresponding protein in adhesion to DF-1 chicken fibroblasts. Sequence analyses revealed that the flanking regions of the chromosomally located gene contained sequences of mobile genetic elements, indicating a probable spread among different strains by horizontal gene transfer. In accordance with this hypothesis, the adhesin was found to be present not only in different phylogenetic groups of extraintestinal pathogenic but also of commensal E. coli strains, yielding a significant association with strains of avian origin. We identified a chromosomally located autotransporter gene in a highly virulent APEC strain which confers increased adherence of a non-fimbriated E. coli K-12 strain to a chicken fibroblast cell line. Even though flanked by mobile genetic elements and three different genetic regions upstream of the gene, most probably indicating horizontal gene transfer events, the adhesin gene was significantly linked with strains of avian origin. Due to the nucleotide sequence similarity of 98% to a recently published adhesin-related gene, located on plasmid pAPEC-O1-ColBM, the name aatA (APEC autotransporter adhesin A) was adopted from that study.Our data substantiate that AatA might not only be of relevance in APEC pathogenicity but also in facilitating their reservoir life style in the chicken intestine, which might pave the way for future intestinal preventive strategies.
FARME DB: a functional antibiotic resistance element database
Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.
2017-01-01
Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: http://staff.washington.edu/jwallace/farme PMID:28077567
Transcriptional insulation of the human keratin 18 gene in transgenic mice.
Neznanov, N; Thorey, I S; Ceceña, G; Oshima, R G
1993-01-01
Expression of the 10-kb human keratin 18 (K18) gene in transgenic mice results in efficient and appropriate tissue-specific expression in a variety of internal epithelial organs, including liver, lung, intestine, kidney, and the ependymal epithelium of brain, but not in spleen, heart, or skeletal muscle. Expression at the RNA level is directly proportional to the number of integrated K18 transgenes. These results indicate that the K18 gene is able to insulate itself both from the commonly observed cis-acting effects of the sites of integration and from the potential complications of duplicated copies of the gene arranged in head-to-tail fashion. To begin to identify the K18 gene sequences responsible for this property of transcriptional insulation, additional transgenic mouse lines containing deletions of either the 5' or 3' distal end of the K18 gene have been characterized. Deletion of 1.5 kb of the distal 5' flanking sequence has no effect upon either the tissue specificity or the copy number-dependent behavior of the transgene. In contrast, deletion of the 3.5-kb 3' flanking sequence of the gene results in the loss of the copy number-dependent behavior of the gene in liver and intestine. However, expression in kidney, lung, and brain remains efficient and copy number dependent in these transgenic mice. Furthermore, herpes simplex virus thymidine kinase gene expression is copy number dependent in transgenic mice when the gene is located between the distal 5'- and 3'-flanking sequences of the K18 gene. Each adult transgenic male expressed the thymidine kinase gene in testes and brain and proportionally to the number of integrated transgenes. We conclude that the characteristic of copy number-dependent expression of the K18 gene is tissue specific because the sequence requirements for transcriptional insulation in adult liver and intestine are different from those for lung and kidney. In addition, the behavior of the transgenic thymidine kinase gene in testes and brain suggests that the property of transcriptional insulation of the K18 gene may be conferred by the distal flanking sequences of the K18 gene and, additionally, may function for other genes. Images PMID:7681143
Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P
1984-01-01
We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950
USDA-ARS?s Scientific Manuscript database
Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Zhang, Fan; Zhang, Bing; Xiang, Hua; Hu, Songnian
2009-11-01
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a widespread system that provides acquired resistance against phages in bacteria and archaea. Here we aim to genome-widely analyze the CRISPR in extreme halophilic archaea, of which the whole genome sequences are available at present time. We used bioinformatics methods including alignment, conservation analysis, GC content and RNA structure prediction to analyze the CRISPR structures of 7 haloarchaeal genomes. We identified the CRISPR structures in 5 halophilic archaea and revealed a conserved palindromic motif in the flanking regions of these CRISPR structures. In addition, we found that the repeat sequences of large CRISPR structures in halophilic archaea were greatly conserved, and two types of predicted RNA secondary structures derived from the repeat sequences were likely determined by the fourth base of the repeat sequence. Our results support the proposal that the leader sequence may function as recognition site by having palindromic structures in flanking regions, and the stem-loop secondary structure formed by repeat sequences may function in mediating the interaction between foreign genetic elements and CAS-encoded proteins.
Gould, Virginia C; Okazaki, Aki; Howe, Robin A; Avison, Matthew B
2004-08-01
To determine the level of variation in the smeDEF efflux pump and smeT transcriptional regulator genes among three defined 16S rRNA sequence subgroups of clinical Stenotrophomonas maltophilia isolates. smeDEF sequencing used a PCR genome walking approach. Determination of the sequence surrounding smeDEF used a flanking primer PCR method and specific primers anchored in smeD or smeF together with random primers. smeDEF is chromosomal and located in the same position in the chromosome in all three subgroups of isolates. Flanking smeD is a gene, smeT, encoding a putative transcriptional repressor for smeDEF. Variation at these loci among the isolates is considerably lower (up to 10%) than at intrinsic beta-lactamase loci (up to 30%) in the same isolates, implying greater functional constraint. The smeD-smeT intergenic region contains a highly conserved section, which maps with previously predicted promoter/operator regions, and a hypervariable untranslated region, which can be used to subgroup clinical isolates. These data provide further evidence that it is possible to group clinical isolates of the inherently variable species, S. maltophilia, based on genotypic properties. Isolate D457, in which most work concerning smeDEF expression has been performed, does not fall into S. maltophilia subgroup A, which is the most typical.
Radioresistance of GGG Sequences to Prompt Strand Break Formation from Direct-Type Radiation Damage
Black, Paul J.; Miller, Adam S.; Hayes, Jeffrey J.
2016-01-01
Purpose As humans, we are constantly exposed to ionizing radiation from natural, man-made and cosmic sources which can damage DNA, leading to deleterious effects including cancer incidence. In this work we introduce a method to monitor strand breaks resulting from damage due to the direct effect of ionizing radiation and provide evidence for sequence-dependent effects leading to strand breaks. Materials and methods To analyze only DNA strand breaks caused by radiation damage due to the direct effect of ionizing radiation, we combined an established technique to generate dehydrated DNA samples with a technique to analyze single strand breaks on short oligonucleotide sequences via denaturing gel electrophoresis. Results We find that direct damage primarily results in a reduced number of strand breaks in guanine triplet regions (GGG) when compared to isolated guanine (G) bases with identical flanking base context. In addition, we observe strand break behavior possibly indicative of protection of guanine bases when flanked by pyrimidines, and sensitization of guanine to strand break when flanked by adenine (A) bases in both isolated G and GGG cases. Conclusions These observations provide insight into the strand break behavior in GGG regions damaged via the direct effect of ionizing radiation. In addition, this could be indicative of DNA sequences that are naturally more susceptible to strand break due to the direct effect of ionizing radiation. PMID:27349757
Feng, X; Happ, G M
1996-11-14
The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.
Robson, Nicole D.; Telesnitsky, Alice
2000-01-01
Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073
Evidence for the Concerted Evolution between Short Linear Protein Motifs and Their Flanking Regions
Chica, Claudia; Diella, Francesca; Gibson, Toby J.
2009-01-01
Background Linear motifs are short modules of protein sequences that play a crucial role in mediating and regulating many protein–protein interactions. The function of linear motifs strongly depends on the context, e.g. functional instances mainly occur inside flexible regions that are accessible for interaction. Sometimes linear motifs appear as isolated islands of conservation in multiple sequence alignments. However, they also occur in larger blocks of sequence conservation, suggesting an active role for the neighbouring amino acids. Results The evolution of regions flanking 116 functional linear motif instances was studied. The conservation of the amino acid sequence and order/disorder tendency of those regions was related to presence/absence of the instance. For the majority of the analysed instances, the pairs of sequences conserving the linear motif were also observed to maintain a similar local structural tendency and/or to have higher local sequence conservation when compared to pairs of sequences where one is missing the linear motif. Furthermore, those instances have a higher chance to co–evolve with the neighbouring residues in comparison to the distant ones. Those findings are supported by examples where the regulation of the linear motif–mediated interaction has been shown to depend on the modifications (e.g. phosphorylation) at neighbouring positions or is thought to benefit from the binding versatility of disordered regions. Conclusion The results suggest that flanking regions are relevant for linear motif–mediated interactions, both at the structural and sequence level. More interestingly, they indicate that the prediction of linear motif instances can be enriched with contextual information by performing a sequence analysis similar to the one presented here. This can facilitate the understanding of the role of these predicted instances in determining the protein function inside the broader context of the cellular network where they arise. PMID:19584925
Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C. Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B.; Nauck, Markus; Kaminski, Wolfgang E.
2017-01-01
The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its “a” determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the “a” determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of “a” determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated. PMID:28472040
Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-Suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B; Nauck, Markus; Kaminski, Wolfgang E
2017-01-01
The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its "a" determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the "a" determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of "a" determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated.
NASA Technical Reports Server (NTRS)
Chen, Sheng-Hsien; Kivelson, Margaret G.; Gosling, Jack T.; Walker, Raymond T.; Lazarus, Allan J.
1992-01-01
On 15 Feb. 1978, the orientation of the interplanetary magnetic field (IMF) remained steadily northward for more than 12 hours. The ISEE 1 and 2 spacecraft were located near apogee on the dawn side flank of the magnetotail. IMP 8 was almost symmetrically located in the magnetosheath on the dusk flank and IMP 7 was upstream in the solar wind. Using plasma and magnetic field data, we show the following: (1) the magnetosheath flow speed on the flanks of the magnetotail steadily exceeded the solar wind speed by 20 percent; (2) surface waves with approximately a 5-min period and very non-sinusoidal waveform were persistently present on the dawn magnetopause and waves of similar period were present in the dusk magnetosheath; and (3) the magnetotail ceased to flare at an antisunward distance of 15 R(sub E). We propose that the acceleration of the magnetosheath flow is achieved by magnetic tension in the draped field configuration for northward IMF and that the reduction of tail flaring is consistent with a decreased amount of open magnetic flux and a larger standoff distance of the subsolar magnetopause. Results of a three-dimensional magnetohydrodynamic simulation support this phenomenological model.
Hussing, C; Bytyci, R; Huber, C; Morling, N; Børsting, C
2018-05-24
Some STR loci have internal sequence variations, which are not revealed by the standard STR typing methods used in forensic genetics (PCR and fragment length analysis by capillary electrophoresis (CE)). Typing of STRs with next-generation sequencing (NGS) uncovers the sequence variation in the repeat region and in the flanking regions. In this study, 363 Danish individuals were typed for 56 STRs (26 autosomal STRs, 24 Y-STRs, and 6 X-STRs) using the ForenSeq™ DNA Signature Prep Kit to establish a Danish STR sequence database. Increased allelic diversity was observed in 34 STRs by the PCR-NGS assay. The largest increases were found in DYS389II and D12S391, where the numbers of sequenced alleles were around four times larger than the numbers of alleles determined by repeat length alone. Thirteen SNPs and one InDel were identified in the flanking regions of 12 STRs. Furthermore, 36 single positions and five longer stretches in the STR flanking regions were found to have dubious genotyping quality. The combined match probability of the 26 autosomal STRs was 10,000 times larger using the PCR-NGS assay than by using PCR-CE. The typical paternity indices for trios and duos were 500 and 100 times larger, respectively, than those obtained with PCR-CE. The assay also amplified 94 SNPs selected for human identification. Eleven of these loci were not in Hardy-Weinberg equilibrium in the Danish population, most likely because the minimum threshold for allele calling (30 reads) in the ForenSeq™ Universal Analysis Software was too low and frequent allele dropouts were not detected.
Functional Architecture of T7 RNA Polymerase Transcription Complexes
Nayak, Dhananjaya; Guo, Qing; Sousa, Rui
2007-01-01
Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.
CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.
Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine
2007-07-01
Clustered regularly interspaced short palindromic repeats (CRISPRs) constitute a particular family of tandem repeats found in a wide range of prokaryotic genomes (half of eubacteria and almost all archaea). They consist of a succession of highly conserved regions (DR) varying in size from 23 to 47 bp, separated by similarly sized unique sequences (spacer) of usually viral origin. A CRISPR cluster is flanked on one side by an AT-rich sequence called the leader and assumed to be a transcriptional promoter. Recent studies suggest that this structure represents a putative RNA-interference-based immune system. Here we describe CRISPRFinder, a web service offering tools to (i) detect CRISPRs including the shortest ones (one or two motifs); (ii) define DRs and extract spacers; (iii) get the flanking sequences to determine the leader; (iv) blast spacers against Genbank database and (v) check if the DR is found elsewhere in prokaryotic sequenced genomes. CRISPRFinder is freely accessible at http://crispr.u-psud.fr/Server/CRISPRfinder.php.
Kang, J J; Yokoi, T J; Holland, M J
1995-12-01
The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.
A genetic switch controls the production of flagella and toxins in Clostridium difficile
2017-01-01
In the human intestinal pathogen Clostridium difficile, flagella promote adherence to intestinal epithelial cells. Flagellar gene expression also indirectly impacts production of the glucosylating toxins, which are essential to diarrheal disease development. Thus, factors that regulate the expression of the flgB operon will likely impact toxin production in addition to flagellar motility. Here, we report the identification a “flagellar switch” that controls the phase variable production of flagella and glucosylating toxins. The flagellar switch, located upstream of the flgB operon containing the early stage flagellar genes, is a 154 bp invertible sequence flanked by 21 bp inverted repeats. Bacteria with the sequence in one orientation expressed flagellum and toxin genes, produced flagella, and secreted the toxins (“flg phase ON”). Bacteria with the sequence in the inverse orientation were attenuated for flagellar and toxin gene expression, were aflagellate, and showed decreased toxin secretion (“flg phase OFF”). The orientation of the flagellar switch is reversible during growth in vitro. We provide evidence that gene regulation via the flagellar switch occurs post-transcription initiation and requires a C. difficile-specific regulatory factor to destabilize or degrade the early flagellar gene mRNA when the flagellar switch is in the OFF orientation. Lastly, through mutagenesis and characterization of flagellar phase locked isolates, we determined that the tyrosine recombinase RecV, which catalyzes inversion at the cwpV switch, is also responsible for inversion at the flagellar switch in both directions. Phase variable flagellar motility and toxin production suggests that these important virulence factors have both advantageous and detrimental effects during the course of infection. PMID:28346491
DOE Office of Scientific and Technical Information (OSTI.GOV)
Umans, L.; Serneels, L.; Hilliker, C.
1994-08-01
The authors have cloned the mouse gene coding for {alpha}{sub 2}-macroglobulin in overlapping {lambda} clones and have analyzed its structure. The gene contains 36 exons, coding for the 4.8-kb cDNA that we cloned previously. Including putative control elements in the 5{prime} flanking region, the gene covers about 45 kb. A region of 3.8 kb, stretching from 835 bases upstream of the cDNA start site to exon 4, including all intervening sequences, was sequenced completely. The analysis demonstrated that the putative promoter region of the mouse A2M gene differed considerably from the known promoter sequences of the human A2M gene andmore » of the rat acute-phas A2M gene. Comparison of the exon-intron structure of all known genes of the A2M family confirmed that the rat acute phase A2M gene is more closely related to the human gene than to the mouse A2M gene. To generate mice with the A2M gene inactivated, an insertion type of construct containing 7.5 kb of genomic DNA of the mouse strain 129/J, encompassing exons 16 to 19, was synthesized. A hygromycin marker gene was embedded in intron 17. After electroporation, 198 hygromycin-resistant ES cell lines were isolated and analyzed by Southern blotting. Five ES cell lines were obtained with one allele of the mouse A2M gene targeted by this insertion construct, demonstrating that the position and the characteristics of the vector served the intended goal.« less
Nishinaka, Toru; Ichijo, Yusuke; Ito, Maki; Kimura, Masayoshi; Katsuyama, Masato; Iwata, Kazumi; Miura, Takeshi; Terada, Tomoyuki; Yabe-Nishimura, Chihiro
2007-05-15
Curcumin is a plant-derived diferuloylmethane compound extracted from Curcuma longa, possessing antioxidative and anticarcinogenic properties. Antioxidants and oxidative stress are known to induce the expression of certain classes of detoxification enzymes. Since the upregulation of detoxifying enzymes affects the drug metabolism and cell defense system, it is important to understand the gene regulation by such agents. In this study, we demonstrated that curcumin could induce the expression of human glutathione S-transferase P1 (GSTP1). In HepG2 cells treated with 20muM curcumin, the level of GSTP1 mRNA was significantly increased. In luciferase reporter assays, curcumin augmented the promoter activity of a reporter construct carrying 336bp upstream of the 5'-flanking region of the GSTP1 gene. Mutation analyses revealed that the region including antioxidant response element (ARE), which overlaps AP1 in sequence, was essential to the response to curcumin. While the introduction of a wild-type Nrf2 expression construct augmented the promoter activity of the GSTP1 gene, co-expression of a dominant-negative Nrf2 abolished the responsiveness to curcumin. In addition, curcumin activated the expression of the luciferase gene from a reporter construct carrying multiple ARE consensus sequences but not one with multiple AP1 sites. In a gel mobility shift assay with an oligonucleotide with GSTP1 ARE, an increase in the amount of the binding complex was observed in the nuclear extracts of curcumin-treated HepG2 cells. These results suggested that ARE is the primary sequence for the curcumin-induced transactivation of the GSTP1 gene. The induction of GSTP1 may be one of the mechanisms underlying the multiple actions of curcumin.
A tetO Toolkit To Alter Expression of Genes in Saccharomyces cerevisiae.
Cuperus, Josh T; Lo, Russell S; Shumaker, Lucia; Proctor, Julia; Fields, Stanley
2015-07-17
Strategies to optimize a metabolic pathway often involve building a large collection of strains, each containing different versions of sequences that regulate the expression of pathway genes. Here, we develop reagents and methods to carry out this process at high efficiency in the yeast Saccharomyces cerevisiae. We identify variants of the Escherichia coli tet operator (tetO) sequence that bind a TetR-VP16 activator with differential affinity and therefore result in different TetR-VP16 activator-driven expression. By recombining these variants upstream of the genes of a pathway, we generate unique combinations of expression levels. Here, we built a tetO toolkit, which includes the I-OnuI homing endonuclease to create double-strand breaks, which increases homologous recombination by 10(5); a plasmid carrying six variant tetO sequences flanked by I-OnuI sites, uncoupling transformation and recombination steps; an S. cerevisiae-optimized TetR-VP16 activator; and a vector to integrate constructs into the yeast genome. We introduce into the S. cerevisiae genome the three crt genes from Erwinia herbicola required for yeast to synthesize lycopene and carry out the recombination process to produce a population of cells with permutations of tetO variants regulating the three genes. We identify 0.7% of this population as making detectable lycopene, of which the vast majority have undergone recombination at all three crt genes. We estimate a rate of ∼20% recombination per targeted site, much higher than that obtained in other studies. Application of this toolkit to medically or industrially important end products could reduce the time and labor required to optimize the expression of a set of metabolic genes.
Yang, Zujun; Zhang, Tao; Bolshoy, Alexander; Beharav, Alexander; Nevo, Eviatar
2009-05-01
'Evolution Canyon' (ECI) at Lower Nahal Oren, Mount Carmel, Israel, is an optimal natural microscale model for unravelling evolution in action highlighting the twin evolutionary processes of adaptation and speciation. A major model organism in ECI is wild barley, Hordeum spontaneum, the progenitor of cultivated barley, which displays dramatic interslope adaptive and speciational divergence on the 'African' dry slope (AS) and the 'European' humid slope (ES), separated on average by 200 m. Here we examined interslope single nucleotide polymorphism (SNP) sequences and the expression diversity of the drought resistant dehydrin 1 gene (Dhn1) between the opposite slopes. We analysed 47 plants (genotypes), 4-10 individuals in each of seven stations (populations) in an area of 7000 m(2), for Dhn1 sequence diversity located in the 5' upstream flanking region of the gene. We found significant levels of Dhn1 genic diversity represented by 29 haplotypes, derived from 45 SNPs in a total of 708 bp sites. Most of the haplotypes, 25 out of 29 (= 86.2%), were represented by one genotype; hence, unique to one population. Only a single haplotype was common to both slopes. Genetic divergence of sequence and haplotype diversity was generally and significantly different among the populations and slopes. Nucleotide diversity was higher on the AS, whereas haplotype diversity was higher on the ES. Interslope divergence was significantly higher than intraslope divergence. The applied Tajima D rejected neutrality of the SNP diversity. The Dhn1 expression under dehydration indicated interslope divergent expression between AS and ES genotypes, reinforcing Dhn1 associated with drought resistance of wild barley at 'Evolution Canyon'. These results are inexplicable by mutation, gene flow, or chance effects, and support adaptive natural microclimatic selection as the major evolutionary divergent driving force.
Characterization of (CA)n microsatellite repeats from large-insert clones.
Litt, M; Browne, D
2001-05-01
The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.
Regulation of zebrafish CYP3A65 transcription by AHR2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting
2013-07-15
CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenicmore » lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in mammalian CYP3 genes.« less
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
Chery, Joyce G; Sass, Chodon; Specht, Chelsea D
2017-09-01
We developed a bioinformatic pipeline that leverages a publicly available genome and published transcriptomes to design primers in conserved coding sequences flanking targeted introns of single-copy nuclear loci. Paullinieae (Sapindaceae) is used to demonstrate the pipeline. Transcriptome reads phylogenetically closer to the lineage of interest are aligned to the closest genome. Single-nucleotide polymorphisms are called, generating a "pseudoreference" closer to the lineage of interest. Several filters are applied to meet the criteria of single-copy nuclear loci with introns of a desired size. Primers are designed in conserved coding sequences flanking introns. Using this pipeline, we developed nine single-copy nuclear intron markers for Paullinieae. This pipeline is highly flexible and can be used for any group with available genomic and transcriptomic resources. This pipeline led to the development of nine variable markers for phylogenetic study without generating sequence data de novo.
Williams, Kevin R; Doak, Thomas G; Herrick, Glenn
2002-01-01
Background Ciliates employ massive chromatid breakage and de novo telomere formation during generation of the somatic macronucleus. Positions flanking the 81-MAC locus are reproducibly cut. But those flanking the Common Region are proposed to often escape cutting, generating three nested macronuclear chromosomes, two retaining "arms" still appended to the Common Region. Arm-distal positions must differ (in cis) from the Common Region flanks. Results The Common-Region-flanking positions also differ from the arm-distal positions in that they are "multi-TAS" regions: anchored PCR shows heterogeneous patterns of telomere addition sites, but arm-distal sites do not. The multi-TAS patterns are reproducible, but are sensitive to the sequence of the allele being processed. Thus, random degradation following chromatid cutting does not create this heterogeneity; these telomere addition sites also must be dictated by cis-acting sequences. Conclusions Most ciliates show such micro-heterogeneity in the precise positions of telomere addition sites. Telomerase is believed to be tightly associated with, and act in concert with, the chromatid-cutting nuclease: heterogeneity must be the result of intervening erosion activity. Our "weak-sites" hypothesis explains the correlation between alternative chromatid cutting at the Common Region boundaries and their multi-TAS character: when the chromatid-breakage machine encounters either a weak binding site or a weak cut site at these regions, then telomerase dissociates prematurely, leaving the new end subject to erosion by an exonuclease, which pauses at cis-acting sequences; telomerase eventually heals these resected termini. Finally, we observe TAS positioning influenced by trans-allelic interactions, reminiscent of transvection. PMID:12199911
Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun
2016-11-01
As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Knox, P.R.
1989-09-01
Donkey Creek and Coyote Creek fields contain combined reserves of approximately 35 million bbl of oil and are within a trend of fields on the eastern flank of the Powder River basin that totals over 100 million bbl of reserves. The principal producing formation is the Lower Cretaceous Fall River Sandstone. A study of 45 cores and 248 logs from the three pools in the Donkey Creek and Coyote fields has shown that the Fall River is composed of three progradational deltaic units deposited during a period of rising relative sea level. These are locally eroded and are filled bymore » a fluvial point-bar complex deposited following a lowering of relative sea level. Four important depositional facies have been recognized: the delta-front and distributary-channel sandstone of the highstand deltaic sequence and the point-bar sandstone and channel-abandonment of the lowstand fluvial sequence. Stratigraphic traps in Coyote Creek and south Donkey Creek pools are the result of permeable (250 md) point-bar sandstone (250 bbl oil/day ip) bounded updip by impermeable (0.1 md) channel abandonment mudstone. Most of the oil in the central Donkey Creek pool is produced from permeable (76 md) distributary-channel sandstone (150 bbl oil/day ip), which is restricted to the western flank of a structural nose. Lesser production, on the crest and upper western flank of the structure, is obtained from the less permeable (2.8 md) delta-front sandstone (50 bbl oil/day ip). Production is possibly limited to the crest and western flank by hydrodynamic processes.« less
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Structural evolution of Arsia Mons, Pavonis Mons, and Ascreus Mons Tharsis region of Mars
NASA Technical Reports Server (NTRS)
Crumpler, L. S.; Aubele, J. C.
1978-01-01
Analysis of Viking Orbiter data suggests that Arsia Mons, Pavonis Mons, and Ascreus Mons, three large shield volcanoes of the Tharsis volcanoes of Mars, have had similar evolutionary trends. Arsia Mons appears to have developed in the following sequence: (1) construction of a main shield volcano, (2) outbreak of parasitic eruption centers on the northeast and southwest flanks, (3) volcano-tectonic subsidence of the summit and formation of concentric fractures and grabens, possibly by evacuation of an underlying magma chamber during eruption of copious lavas from parasitic eruption centers on the northeast and southwest flanks, and (4) continued volcanism along a fissure or rift bisecting the main shield, resulting in flooding of the floor of the volcano-tectonic depression and inundation of the northeast and southwest flanks by voluminous lavas locally forming parasitic shields. In terms of this sequence Pavonis Mons has developed to stage (3) and Ascreus Mons has evolved to stage (2). This interpretation is supported by crater frequency-diameter distributions in the 0.1- to 3.0-km diameter range.
PH dependent adhesive peptides
Tomich, John; Iwamoto, Takeo; Shen, Xinchun; Sun, Xiuzhi Susan
2010-06-29
A novel peptide adhesive motif is described that requires no receptor or cross-links to achieve maximal adhesive strength. Several peptides with different degrees of adhesive strength have been designed and synthesized using solid phase chemistries. All peptides contain a common hydrophobic core sequence flanked by positively or negatively charged amino acids sequences.
NASA Astrophysics Data System (ADS)
Weathers, T. S.; Fisher, A. T.; Winslow, D. M.; Stauffer, P. H.; Gable, C. W.
2017-12-01
The flanks of mid-ocean ridges experience coupled flows of fluid, heat, and solutes that are critical for a wide range of global processes, including the cycling of carbon and nutrients, which supports a vast crustal biosphere. Only a few ridge-flank sites have been studied in detail; hydrogeologic conditions and processes in the volcanic crust are best understood on the eastern flank of the Juan de Fuca Ridge. This area has been extensively explored with decades of drilling, submersible, observatory, and survey expeditions and experiments, including the first hole-to-hole tracer injection experiment in the ocean crust. This study describes the development of reactive transport simulations for this ridge-flank setting using three-dimensional coupled (thermal-hydrological) models of crustal-scale circulation, beginning with the exploration of tracer transport. The prevailing flow direction is roughly south to north as a result of outcrop-to-outcrop flow, with a bulk flow rate in the range of meters/year. However, tracer was detected 500 m south ("upstream") from the injection borehole during the first year following injection. This may be explained by local mixing and/or formation fluid discharge from the southern borehole during and after injection. The constraints and parameters required to fit the observed tracer behavior can be used as a basis for modeling reactive transport processes such as nutrient delivery or microbial community evolution as a function of fluid flow. For example, the sulfate concentration in fluid samples from Baby Bare outcrop ( 8 km south of the tracer transport experiment) was 17.8 mmol/kg, whereas at Mama Bare outcrop ( 8 km to north of the tracer transport experiment) the sulfate concentration was 16.3 mmol/mg. By integrating laboratory-derived sulfate reduction rates from microbial samples originating from Juan de Fuca borehole observatories into reactive transport models, we can explore the range of microbial activity that supports the observed concentration gradients of sulfate and other solutes in the volcanic ocean crust.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fracasso, M.A.
The Travis Peak Formation (Lower Cretaceous) in the eastern East Texas basin represents a sand-rich, fluvial-deltaic depositional system. This lobate, high-constructive deltaic system prograded radially to the southeast from an Upshur County locus. Regional studies of the Travis Peak established a threefold internal stratigraphic framework: a middle sand-rich fluvial and delta-plain sequence is gradationally overlain and underlain by a marine-influenced delta-fringe zone with a higher mud content. The entire Travis Peak succession thins over the Bethany dome on the western flank of the Sabine uplift. However, the delta-fringe sequences are relatively thicker over the structure because of a disproportionately greatermore » thinning of the middle sandy fluvial-deltaic sequence. Lesser sand deposition over the Bethany dome reflects an active structural control over facies distribution. Gas production in the Bethany field and surrounding area is concentrated in thin zones (5-15 ft) of the upper delta-fringe sequence. This distribution probably reflects the increased abundance of mudstone beds in the upper delta-fringe interval, which may have served as source rocks or barriers to upward gas migration, or as both. The predominant trapping mechanism in this region is stratigraphic sand pinch-out in a structurally updip direction on the flanks of major structures. Studies of core and closely spaced electric logs west of the Bethany dome help define the depositional systems in the upper delta-fringe producing interval. This sequence comprises a complex mosaic of continental and marine facies, and exhibits an overall upward trend of increasing marine influence that spans a gradual transition into transgressive carbonates of the Sligo Formation.« less
Sequence-dependent DNA deformability studied using molecular dynamics simulations.
Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori
2007-01-01
Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.
Innate Immune Complexity in the Purple Sea Urchin: Diversity of the Sp185/333 System
Smith, L. Courtney
2012-01-01
The California purple sea urchin, Strongylocentrotus purpuratus, is a long-lived echinoderm with a complex and sophisticated innate immune system. There are several large gene families that function in immunity in this species including the Sp185/333 gene family that has ∼50 (±10) members. The family shows intriguing sequence diversity and encodes a broad array of diverse yet similar proteins. The genes have two exons of which the second encodes the mature protein and has repeats and blocks of sequence called elements. Mosaics of element patterns plus single nucleotide polymorphisms-based variants of the elements result in significant sequence diversity among the genes yet maintains similar structure among the members of the family. Sequence of a bacterial artificial chromosome insert shows a cluster of six, tightly linked Sp185/333 genes that are flanked by GA microsatellites. The sequences between the GA microsatellites in which the Sp185/333 genes and flanking regions are located, are much more similar to each other than are the sequences outside the microsatellites suggesting processes such as gene conversion, recombination, or duplication. However, close linkage does not correspond with greater sequence similarity compared to randomly cloned and sequenced genes that are unlikely to be linked. There are three segmental duplications that are bounded by GAT microsatellites and include three almost identical genes plus flanking regions. RNA editing is detectible throughout the mRNAs based on comparisons to the genes, which, in combination with putative post-translational modifications to the proteins, results in broad arrays of Sp185/333 proteins that differ among individuals. The mature proteins have an N-terminal glycine-rich region, a central RGD motif, and a C-terminal histidine-rich region. The Sp185/333 proteins are localized to the cell surface and are found within vesicles in subsets of polygonal and small phagocytes. The coelomocyte proteome shows full-length and truncated proteins, including some with missense sequence. Current results suggest that both native Sp185/333 proteins and a recombinant protein bind bacteria and are likely important in sea urchin innate immunity. PMID:22566951
Metagenomic Analysis of Ammonia-Oxidizing Archaea Affiliated with the Soil Group
Bartossek, Rita; Spang, Anja; Weidler, Gerhard; Lanzen, Anders; Schleper, Christa
2012-01-01
Ammonia-oxidizing archaea (AOA) have recently been recognized as a significant component of many microbial communities and represent one of the most abundant prokaryotic groups in the biosphere. However, only few AOA have been successfully cultivated so far and information on the physiology and genomic content remains scarce. We have performed a metagenomic analysis to extend the knowledge of the AOA affiliated with group I.1b that is widespread in terrestrial habitats and of which no genome sequences has been described yet. A fosmid library was generated from samples of a radioactive thermal cave (46°C) in the Austrian Central Alps in which AOA had been found as a major part of the microbial community. Out of 16 fosmids that possessed either an amoA or 16S rRNA gene affiliating with AOA, 5 were fully sequenced, 4 of which grouped with the soil/I.1b (Nitrososphaera-) lineage, and 1 with marine/I.1a (Nitrosopumilus-) lineage. Phylogenetic analyses of amoBC and an associated conserved gene were congruent with earlier analyses based on amoA and 16S rRNA genes and supported the separation of the soil and marine group. Several putative genes that did not have homologs in currently available marine Thaumarchaeota genomes indicated that AOA of the soil group contain specific genes that are distinct from their marine relatives. Potential cis-regulatory elements around conserved promoter motifs found upstream of the amo genes in sequenced (meta-) genomes differed in marine and soil group AOA. On one fosmid, a group of genes including amoA and amoB were flanked by identical transposable insertion sequences, indicating that amoAB could potentially be co-mobilized in the form of a composite transposon. This might be one of the mechanisms that caused the greater variation in gene order compared to genomes in the marine counterparts. Our findings highlight the genetic diversity within the two major and widespread lineages of Thaumarchaeota. PMID:22723795
Mataseje, L F; Boyd, D A; Lefebvre, B; Bryce, E; Embree, J; Gravel, D; Katz, K; Kibsey, P; Kuhn, M; Langley, J; Mitchell, R; Roscoe, D; Simor, A; Taylor, G; Thomas, E; Turgeon, N; Mulvey, M R
2014-03-01
Emergence of plasmids harbouring bla(NDM-1) is a major public health concern due to their association with multidrug resistance and their potential mobility. PCR was used to detect bla(NDM-1) from clinical isolates of Providencia rettgeri (PR) and Klebsiella pneumoniae (KP). Antimicrobial susceptibilities were determined using Vitek 2. The complete DNA sequence of two bla(NDM-1) plasmids (pPrY2001 and pKp11-42) was obtained using a 454-Genome Sequencer FLX. Contig assembly and gap closures were confirmed by PCR-based sequencing. Comparative analysis was done using BLASTn and BLASTp algorithms. Both clinical isolates were resistant to all β-lactams, carbapenems, aminoglycosides, ciprofloxacin and trimethoprim/sulfamethoxazole, and susceptible to tigecycline. Plasmid pPrY2001 (113 295 bp) was isolated from PR. It did not show significant homology to any known plasmid backbone and contained a truncated repA and novel repB. Two bla(NDM-1)-harbouring plasmids from Acinetobacter lwoffii (JQ001791 and JQ060896) shared 100% similarity to a 15 kb region that contained bla(NDM-1). pPrY2001 also contained a type II toxin/antitoxin system. pKp11-42 (146 695 bp) was isolated from KP. It contained multiple repA genes. The plasmid backbone had the highest homology to the IncFIIk plasmid type (51% coverage, 100% nucleotide identity). The bla(NDM-1) region was unique in that it was flanked upstream by IS3000 and downstream by a novel transposon designated Tn6229. pKp11-42 also contained a number of mutagenesis and plasmid stability proteins. pPrY2001 differed from all known plasmids due to its novel backbone and repB. pKp11-42 was similar to IncFIIk plasmids and contained a number of genes that aid in plasmid persistence.
Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.
Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E
2001-06-01
Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.
DNA Barcode Sequence Identification Incorporating Taxonomic Hierarchy and within Taxon Variability
Little, Damon P.
2011-01-01
For DNA barcoding to succeed as a scientific endeavor an accurate and expeditious query sequence identification method is needed. Although a global multiple–sequence alignment can be generated for some barcoding markers (e.g. COI, rbcL), not all barcoding markers are as structurally conserved (e.g. matK). Thus, algorithms that depend on global multiple–sequence alignments are not universally applicable. Some sequence identification methods that use local pairwise alignments (e.g. BLAST) are unable to accurately differentiate between highly similar sequences and are not designed to cope with hierarchic phylogenetic relationships or within taxon variability. Here, I present a novel alignment–free sequence identification algorithm–BRONX–that accounts for observed within taxon variability and hierarchic relationships among taxa. BRONX identifies short variable segments and corresponding invariant flanking regions in reference sequences. These flanking regions are used to score variable regions in the query sequence without the production of a global multiple–sequence alignment. By incorporating observed within taxon variability into the scoring procedure, misidentifications arising from shared alleles/haplotypes are minimized. An explicit treatment of more inclusive terminals allows for separate identifications to be made for each taxonomic level and/or for user–defined terminals. BRONX performs better than all other methods when there is imperfect overlap between query and reference sequences (e.g. mini–barcode queries against a full–length barcode database). BRONX consistently produced better identifications at the genus–level for all query types. PMID:21857897
Van Kreijl, C F; Bos, J L
1977-01-01
The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740
Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses
Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa
2018-01-01
Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196
USDA-ARS?s Scientific Manuscript database
Several studies had reported homologous recombination between porcine circovirus type 2 (PCV2)-group 1 (Gp1) and -group 2 (Gp2) viruses. Interestingly, the recombination events described thus far mapped either within the Rep gene sequences or the sequences flanking the Rep gene region. Previously, ...
USDA-ARS?s Scientific Manuscript database
Previous research identified that the 5S ribosomal (rrn) gene and associated flanking sequences that are closely linked to the dkgB gene of Salmonella enterica were highly variable between serotypes, but not between subpopulations within the same serotype (PMID: 17005008). The degree of variability ...
USDA-ARS?s Scientific Manuscript database
BACKGROUND: The dkgB-linked ribosomal region of Salmonella enterica flanking a 5S gene shows genetic heterogeneity that distinguishes closely related serovars such as Enteritidis, Dublin, Gallinarum and Pullorum (Morales et al, 2006). We wanted to know how sequence-based ISR compared to the traditio...
Sorenson, Laurie; Santini, Francesco
2013-01-01
Ray-finned fishes constitute the dominant radiation of vertebrates with over 32,000 species. Although molecular phylogenetics has begun to disentangle major evolutionary relationships within this vast section of the Tree of Life, there is no widely available approach for efficiently collecting phylogenomic data within fishes, leaving much of the enormous potential of massively parallel sequencing technologies for resolving major radiations in ray-finned fishes unrealized. Here, we provide a genomic perspective on longstanding questions regarding the diversification of major groups of ray-finned fishes through targeted enrichment of ultraconserved nuclear DNA elements (UCEs) and their flanking sequence. Our workflow efficiently and economically generates data sets that are orders of magnitude larger than those produced by traditional approaches and is well-suited to working with museum specimens. Analysis of the UCE data set recovers a well-supported phylogeny at both shallow and deep time-scales that supports a monophyletic relationship between Amia and Lepisosteus (Holostei) and reveals elopomorphs and then osteoglossomorphs to be the earliest diverging teleost lineages. Our approach additionally reveals that sequence capture of UCE regions and their flanking sequence offers enormous potential for resolving phylogenetic relationships within ray-finned fishes. PMID:23824177
NASA Technical Reports Server (NTRS)
Breault, D. T.; Lichtler, A. C.; Rowe, D. W.
1997-01-01
Collagen reporter gene constructs have be used to identify cell-specific sequences needed for transcriptional activation. The elements required for endogenous levels of COL1A1 expression, however, have not been elucidated. The human COL1A1 minigene is expressed at high levels and likely harbors sequence elements required for endogenous levels of activity. Using stably transfected osteoblastic Py1a cells, we studied a series of constructs (pOBColCAT) designed to characterize further the elements required for high level of expression. pOBColCAT, which contains the COL1A1 first intron, was expressed at 50-100-fold higher levels than ColCAT 3.6, which lacks the first intron. This difference is best explained by improved mRNA processing rather than a transcriptional effect. Furthermore, variation in activity observed with the intron deletion constructs is best explained by altered mRNA splicing. Two major regions of the human COL1A1 minigene, the 3'-flanking sequences and the minigene body, were introduced into pOBColCAT to assess both transcriptional enhancing activity and the effect on mRNA stability. Analysis of the minigene body, which includes the first five exons and introns fused with the terminal six introns and exons, revealed an orientation-independent 5-fold increase in CAT activity. In contrast the 3'-flanking sequences gave rise to a modest 61% increase in CAT activity. Neither region increased the mRNA half-life of the parent construct, suggesting that CAT-specific mRNA instability elements may serve as dominant negative regulators of stability. This study suggests that other sites within the body of the COL1A1 minigene are important for high expression, e.g. during periods of rapid extracellular matrix production.
Huszar, Tunde I; Jobling, Mark A; Wetton, Jon H
2018-04-12
Short tandem repeats on the male-specific region of the Y chromosome (Y-STRs) are permanently linked as haplotypes, and therefore Y-STR sequence diversity can be considered within the robust framework of a phylogeny of haplogroups defined by single nucleotide polymorphisms (SNPs). Here we use massively parallel sequencing (MPS) to analyse the 23 Y-STRs in Promega's prototype PowerSeq™ Auto/Mito/Y System kit (containing the markers of the PowerPlex® Y23 [PPY23] System) in a set of 100 diverse Y chromosomes whose phylogenetic relationships are known from previous megabase-scale resequencing. Including allele duplications and alleles resulting from likely somatic mutation, we characterised 2311 alleles, demonstrating 99.83% concordance with capillary electrophoresis (CE) data on the same sample set. The set contains 267 distinct sequence-based alleles (an increase of 58% compared to the 169 detectable by CE), including 60 novel Y-STR variants phased with their flanking sequences which have not been reported previously to our knowledge. Variation includes 46 distinct alleles containing non-reference variants of SNPs/indels in both repeat and flanking regions, and 145 distinct alleles containing repeat pattern variants (RPV). For DYS385a,b, DYS481 and DYS390 we observed repeat count variation in short flanking segments previously considered invariable, and suggest new MPS-based structural designations based on these. We considered the observed variation in the context of the Y phylogeny: several specific haplogroup associations were observed for SNPs and indels, reflecting the low mutation rates of such variant types; however, RPVs showed less phylogenetic coherence and more recurrence, reflecting their relatively high mutation rates. In conclusion, our study reveals considerable additional diversity at the Y-STRs of the PPY23 set via MPS analysis, demonstrates high concordance with CE data, facilitates nomenclature standardisation, and places Y-STR sequence variants in their phylogenetic context. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Guaraldo, Michela; Santambrogio, Paolo; Rovelli, Elisabetta; di Savino, Augusta; Saglio, Giuseppe; Cittaro, Davide; Roetto, Antonella; Levi, Sonia
2016-09-01
Mitochondrial ferritin (FtMt) is an iron storage protein belonging to the ferritin family but, unlike the cytosolic ferritin, it has an iron-unrelated restricted tissue expression. FtMt appears to be preferentially expressed in cell types characterized by high metabolic activity and oxygen consumption, suggesting a role in protecting mitochondria from iron-dependent oxidative damage. The human gene (FTMT) is intronless and its promoter region has not been described yet. To analyze the regulatory mechanisms controlling FTMT expression, we characterized the 5‧ flanking region upstream the transcriptional starting site of FTMT by in silico enquiry of sequences conservation, DNA deletion analysis, and ChIP assay. The data revealed a minimal promoter region and identified the presence of SP1, CREB and YY1 as positive regulators, and GATA2, FoxA1 and C/EBPβ as inhibitors of the transcriptional regulation. Furthermore, the FTMT transcription is increased by acetylating and de-methylating agent treatments in K562 and HeLa cells. These treatments up-regulate FtMt expression even in fibroblasts derived from a Friedreich ataxia patient, where it might exert a beneficial effect against mitochondrial oxidative damage. The expression of FTMT appears regulated by a complex mechanism involving epigenetic events and interplay between transcription factors.
Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen
2016-09-01
Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.
Wang, Fei; Coe, Robert A; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul
2016-01-01
This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes.
Wang, Fei; Coe, Robert A.; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul
2016-01-01
This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes. PMID:27303811
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nagao, Yoshiro; Sly, W.S.; Batanian, J.R.
1995-08-10
Carbonic anhydrase V (CA V) is expressed in mitochondrial matrix in liver and several other tissues. It is of interest for its putative roles in providing bicarbonate to carbamoyl phosphate synthetase for ureagenesis and to pyruvate carboxylase for gluconeogenesis and its possible importance in explaining certain inherited metabolic disorders with hyperammonemia and hypoglycemia. Following the recent characterization of the cDNA for human CA V, we report the isolation of the human gene from two {lambda} genomic libraries and its characterization. The CA V gene (CA5) is approximately 50 kb long and contains 7 exons and 6 introns. The exon-intron boundariesmore » are found in positions identical to those determined for the previously described CA II, CA III, and CA VII genes. Like the CA VII gene, CA5 does not contain typical TATA and CAAT promoter elements in the 5{prime} flanking region but does contain a TTTAA sequence 147 nucleotides upstream of the initiation codon. CA5 also contains a 12-bp GT-rich segment beginning 13 bp downstream of the polyadenylation signal in the 3{prime} untranslated region of exon 7. FISH analysis allowed CA5 to be assigned to chromosome 16q24.3. An unprocessed pseudogene containing sequence homologous to exons 3-7 and introns 3-6 was also isolated and was assigned by FISH analysis to chromosome 16p11.2-p12. 22 refs., 4 figs., 1 tab.« less
Papa, Guido; Eichwald, Catherine; Burrone, Oscar R.
2016-01-01
Rotavirus genome consists of eleven segments of dsRNA, each encoding one single protein. Viral mRNAs contain an open reading frame (ORF) flanked by relatively short untranslated regions (UTRs), whose role in the viral cycle remains elusive. Here we investigated the role of 5’UTRs in T7 polymerase-driven cDNAs expression in uninfected cells. The 5’UTRs of eight genome segments (gs3, gs5-6, gs7-11) of the simian SA11 strain showed a strong inhibitory effect on the expression of viral proteins. Decreased protein expression was due to both compromised transcription and translation and was independent of the ORF and the 3’UTR sequences. Analysis of several mutants of the 21-nucleotide long 5’UTR of gs 11 defined an inhibitory motif (IM) represented by its primary sequence rather than its secondary structure. IM was mapped to the 5’ terminal 6-nucleotide long pyrimidine-rich tract 5’-GGY(U/A)UY-3’. The 5’ terminal position within the mRNA was shown to be essentially required, as inhibitory activity was lost when IM was moved to an internal position. We identified two mutations (insertion of a G upstream the 5’UTR and the U to A mutation of the fifth nucleotide of IM) that render IM non-functional and increase the transcription and translation rate to levels that could considerably improve the efficiency of virus helper-free reverse genetics strategies. PMID:27846320
Man, Michal; Epel, Bernard L
2004-06-01
A replicon based on Tobacco mosaic virus that was engineered to express the open reading frame (ORF) of the green fluorescent protein (GFP) gene in place of the native coat protein (CP) gene from a minimal CP subgenomic (sg) RNA promoter was found to accumulate very low levels of GFP. Regulatory regions within the CP ORF were identified that, when presented as untranslated regions flanking the GFP ORF, enhanced or inhibited sg transcription and GFP expression. Full GFP expression from the CP sgRNA promoter required more than the first 20 nt of the CP ORF but not beyond the first 56 nt. Further analysis indicated the presence of an enhancer element between nt +25 and +55 with respect to the CP translation start site. The inclusion of this enhancer sequence upstream of the GFP ORF led to elevated sg transcription and to a 50-fold increase in GFP accumulation in comparison with a minimal CP promoter in which the entire CP ORF was displaced by the GFP ORF. Inclusion of the 3'-terminal 22 nt had a minor positive effect on GFP accumulation, but the addition of extended untranslated sequences from the 3' terminus of the CP ORF downstream of the GFP ORF was basically found to inhibit sg transcription. Secondary structure analysis programs predicted the CP sgRNA promoter to reside within two stable stem-loop structures, which are followed by an enhancer region.
Chromosomal arrangement of leghemoglobin genes in soybean.
Lee, J S; Brown, G G; Verma, D P
1983-01-01
A cluster of four different leghemoglobin (Lb) genes was isolated from AluI-HaeIII and EcoRI genomic libraries of soybean in a set of overlapping clones which together include 45 kilobases (kb) of contiguous DNA. These four genes, including a pseudogene, are present in the same orientation and are arranged in the order: 5'-Lba-Lbc1-Lb psi-Lbc3-3'. The intergenic regions average 2.5 kb. In addition to this main Lb locus, there are other Lb genes which do not appear to be contiguous to this locus. A sequence probably common to the 3' region of Lb loci was found flanking the Lbc3 gene. The 3' flanking region of the main Lb locus also contains a sequence that appears to be expressed more abundantly in root tissue. Another sequence which is primarily expressed in root and leaf is found 5' to two Lb loci. Overall, the main leghemoglobin locus is similar in structure to the mammalian globin gene loci. Images PMID:6310504
Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M; Kashi, Yechezkel
2004-04-01
Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria.
Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M.; Kashi, Yechezkel
2004-01-01
Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria. PMID:15066845
Crescenzo-Chaigne, Bernadette; Barbezange, Cyril; van der Werf, Sylvie
2008-01-01
Background The transcription/replication of the influenza viruses implicate the terminal nucleotide sequences of viral RNA, which comprise sequences at the extremities conserved among the genomic segments as well as variable 3' and 5' non-coding (NC) regions. The plasmid-based system for the in vivo reconstitution of functional ribonucleoproteins, upon expression of viral-like RNAs together with the nucleoprotein and polymerase proteins has been widely used to analyze transcription/replication of influenza viruses. It was thus shown that the type A polymerase could transcribe and replicate type A, B, or C vRNA templates whereas neither type B nor type C polymerases were able to transcribe and replicate type A templates efficiently. Here we studied the importance of the NC regions from the seven segments of type C influenza virus for efficient transcription/replication by the type A and C polymerases. Results The NC sequences of the seven genomic segments of the type C influenza virus C/Johannesburg/1/66 strain were found to be more variable in length than those of the type A and B viruses. The levels of transcription/replication of viral-like vRNAs harboring the NC sequences of the respective type C virus segments flanking the CAT reporter gene were comparable in the presence of either type C or type A polymerase complexes except for the NS and PB2-like vRNAs. For the NS-like vRNA, the transcription/replication level was higher after introduction of a U residue at position 6 in the 5' NC region as for all other segments. For the PB2-like vRNA the CAT expression level was particularly reduced with the type C polymerase. Analysis of mutants of the 5' NC sequence in the PB2-like vRNA, the shortest 5' NC sequence among the seven segments, showed that additional sequences within the PB2 ORF were essential for the efficiency of transcription but not replication by the type C polymerase complex. Conclusion In the context of a PB2-like reporter vRNA template, the sequence upstream the polyU stretch plays a role in the transcription/replication process by the type C polymerase complex. PMID:18973655
Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.
The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).
Walker, M D; Park, C W; Rosen, A; Aronheim, A
1990-01-01
Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401
NASA Astrophysics Data System (ADS)
Haskell, Brian J.; Johnson, Thomas C.
1993-01-01
Two transects of box core, hydrographic and photographic stations were made along the Blake Outer Ridge on the southeastern U.S. continental rise to study how circulation patterns affect surface sediment properties. Circulation is strongest at 4200 m on the flanks of the ridge and is reflected in the suspended particulate distribution. A second turbidity maximum at 3600 m suggests that there may be a second axis of circulation at this depth. The intense circulation on the flanks of the ridge has resulted in winnowing of the sediment revealed by coarsening and flattening of the grain size distribution in the detrital silt fraction, and concentration of carbonate by the formation of a foraminiferal lag deposit. The mean grain size of the detrital silt fraction on the crest of the ridge decreases southeastwards with increasing distance from upstream sediment sources. Shifts in the position and strength of the Western Boundary Undercurrent affect the distance that relatively coarse silt is transported. Downcore changes in grain size can therefore be used as paleoceanographic proxy for changes in deepwater circulation.
Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U
2000-09-22
Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.
Wang, Xiao-rong; Chen, Ji-chao; Kang, Yu; Jiang, Ning; An, Shu-chang; Gao, Zhan-cheng
2012-03-01
The extended spectrum β-lactamase (ESBL)-producing Escherichia coli (E. coli) and Klebsiella pneumoniae (K. pneumoniae) are the major pathogens causing pneumonia and have a significant impact on the clinical course. Limited data exist on molecular characterization of ESBL-producing E. coli and K. pneumoniae that cause pneumonia. The aim of this study was to investigate the comprehensive multilevel characteristics of E. coli and K. pneumoniae causing pneumonia in China for the first time. E. coli (17) and K. pneumoniae (21) isolates responsible for pneumonia were isolated from 1270 specimens collected in a prospective multi-center study in eight teaching hospitals in China from June to December in 2007. The susceptibilities, ESBL confirmation, sequence typing, blaCTX-M and blaSHV genes, their genetic environment and plasmid Inc/rep types were determined. Sixteen E. coli (94.1%) and eleven K. pneumoniae (52.4%) isolates were ESBL producers. About 77.8% and 66.7% of them were resistance to ciprofloxacin and levofloxacin, and 100% were susceptible to imipenem. The most prevalent ESBL gene was CTX-M-14, followed by SHV-2, CTX-M-15, CTX-M-3, CTX-M-65, SHV-12, SHV-26 and SHV-28. SHV-1 and SHV-11 were also detected and coexisted with blaCTX-Ms in five strains, and three strains contained only SHV-1. All CTX-M-14 were detected ISEcp1 upstream and nine were found IS903 downstream and the majority of them (64.3%) were carried by IncF plasmids. All blaSHV were flanked by recF and deoR, located on IncF, IncN, IncX and IncH plasmids. Two SHV-2, one SHV-1 and the only SHV-28 were further preceded by IS26. Genes lacY and lacZ were detected at further upstream of two blaSHV-1. The K. pneumoniae carrying SHV-28 was susceptible to β-lactams, and no mutations or deletions in gene or promoter sequences were identified to account for susceptibility. Multilocus sequence typing experiments showed the ESBL-producing strains were genetically diverse. The rate of occurrence of blaESBL in E. coli and K. pneumoniae causing pneumonia was high, and blaCTX-M-14 was dominant and probably mobilized by ISEcp1 mainly on IncF plasmids. Importantly, unexpressed blaESBL genes may occur in susceptible isolates and hence may have clinical implications.
Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L
1980-01-01
The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547
Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas
2015-01-01
Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569
Flank vents and graben as indicators of Late Amazonian volcanotectonic activity on Olympus Mons
NASA Astrophysics Data System (ADS)
Peters, S. I.; Christensen, P. R.
2017-03-01
Previous studies have focused on large-scale features on Olympus Mons, such as its flank terraces, the summit caldera complex, and the basal escarpment and aureole deposits. Here we identify and characterize previously unrecognized and unmapped small scale features to help further understand the volcanotectonic evolution of this enormous volcano. Using Context Camera, High Resolution Imaging Science Experiment, Thermal Emission Imaging System, High Resolution Stereo Camera Digital Terrain Model, and Mars Orbiter Laser Altimeter data, we identified and characterized the morphology and distribution of 60 flank vents and 84 grabens on Olympus Mons. We find that effusive eruptions have dominated volcanic activity on Olympus Mons in the Late Amazonian. Explosive eruptions were rare, implying volatile-poor magmas and/or a lack of magma-water interactions during the Late Amazonian. The distribution of flank vents suggests dike propagation of hundreds of kilometers and shallow magma storage. Small grabens, not previously observed in lower-resolution data, occur primarily on the lower flanks of Olympus Mons and indicate late-stage extensional tectonism. Based on superposition relationships, we have concluded two stages of development for Olympus Mons during the Late Amazonian: (1) primarily effusive resurfacing and formation of flank vents followed by (2) waning effusive volcanism and graben formation and/or reactivation. This developmental sequence resembles that proposed for Ascraeus Mons and other large Martian shields, suggesting a similar geologic evolution for these volcanoes.
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.
Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B
1990-01-01
Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563
NASA Astrophysics Data System (ADS)
McPhei, J.
1987-07-01
Late Carboniferous continental conglomerates interbedded with silicic ignimbrite sheets outcrop along more than 400 km of the western margin of the southern portion of the New England Orogen. Farther east, the coeval sedimentary facies are volcanogenic shallow marine and turbidite deposits. The volcanic source terrain, no longer exposed, was located to the west of the existing conglomerate-ignimbrite sequences and was underlain by continental crust which is, in part, represented by the northern Lachlan Fold Belt. The regional Late Carboniferous palaeogeography was similar to that of the present-day western continental margin of South America. The geology of the oceanward-flank of the Andean arc in northern Chile and a section of the Late Carboniferous continental sequence near Currabubula are comparable in detail. The Andean stratovolcanoes and ignimbrite centres thus provide the means of reconstruction of the Late Carboniferous volcanic source terrain. The geological record of both of these continental margin volcanic arcs, preserved in deposits of the arc flanks, is shaped by volcanism, especially the eruption of voluminous ignimbrites, and by uplift, deformation and glaciation centered on the arc. For the arc sections considered, diversity in the flank sequences arises because these controls vary in importance spatially and during the life of the arc (20-30 Ma). For the entire Andean arc, arc-parallel variations in the sites of active volcanism and its character appear to be related to differences in the continental crust thickness and the circumstances of subduction of oceanic crust, particularly the dip of the Benioff Zone. By analogy, variation in the age, duration and style of volcanic activity along the late Palaeozoic magmatic arc of the western New England Orogen perhaps reflects the former existence of significant differences in crust thickness and in the angle of subduction.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Increased complexity of circRNA expression during species evolution.
Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li
2017-08-03
Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.
cis-Acting elements important for retroviral RNA packaging specificity.
Beasley, Benjamin E; Hu, Wei-Shau
2002-05-01
Spleen necrosis virus (SNV) proteins can package RNA from distantly related murine leukemia virus (MLV), whereas MLV proteins cannot package SNV RNA efficiently. We used this nonreciprocal recognition to investigate regions of packaging signals that influence viral RNA encapsidation specificity. Although the MLV and SNV packaging signals (Psi and E, respectively) do not contain significant sequence homology, they both contain a pair of hairpins. This hairpin pair was previously proposed to be the core element in MLV Psi. In the present study, MLV-based vectors were generated to contain chimeric SNV/MLV packaging signals in which the hairpins were replaced with the heterologous counterpart. The interactions between these chimeras and MLV or SNV proteins were examined by virus replication and RNA analyses. SNV proteins recognized all of the chimeras, indicating that these chimeras were functional. We found that replacing the hairpin pair did not drastically alter the ability of MLV proteins to package these chimeras. These results indicate that, despite the important role of the hairpin pair in RNA packaging, it is not the major motif responsible for the ability of MLV proteins to discriminate between the MLV and SNV packaging signals. To determine the role of sequences flanking the hairpins in RNA packaging specificity, vectors with swapped flanking regions were generated and evaluated. SNV proteins packaged all of these chimeras efficiently. In contrast, MLV proteins strongly favored chimeras with the MLV 5'-flanking regions. These data indicated that MLV Gag recognizes multiple elements in the viral packaging signal, including the hairpin structure and flanking regions.
Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.
Joshee, N; Kisaka, H; Kitagawa, Y
1998-01-01
One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.
Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong
2017-03-01
To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.
Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH
1990-01-01
We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968
Geologic Mapping Investigations of Alba Mons, Mars
NASA Astrophysics Data System (ADS)
Crown, D. A.; Berman, D. C.; Scheidt, S. P.; Hauber, E.
2018-06-01
Geologic mapping of the summit region and western flank of Alba Mons at 1:1M-scale is revealing sequences of volcanic, tectonic, impact, and degradation processes that have formed and modified the northernmost of the Tharsis volcanoes.
Polycythemia in transgenic mice expressing the human erythropoietin gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.
1989-04-01
Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5{prime} flanking sequence and 0.7 kilobase of 3{prime} flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver,more » adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels.« less
Cunha, Mariana Sequetin; Esposito, Danillo Lucas Alves; Rocco, Iray Maria; Maeda, Adriana Yurika; Vasami, Fernanda Gisele Silva; Nogueira, Juliana Silva; de Souza, Renato Pereira; Suzuki, Akemi; Addas-Carvalho, Marcelo; Barjas-Castro, Maria de Lourdes; Resende, Mariângela Ribeiro; Stucchi, Raquel Silveira Bello; Boin, Ilka de Fátima Santana Ferreira; Katz, Gizelda; Angerami, Rodrigo Nogueira
2016-01-01
We report here the genome sequence of Zika virus, strain ZikaSPH2015, containing all structural and nonstructural proteins flanked by the 5′ and 3′ untranslated region. It was isolated in São Paulo state, Brazil, in 2015, from a patient who received a blood transfusion from an asymptomatic donor at the time of donation. PMID:26941134
Janecek, S.
1996-01-01
The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins. PMID:8762144
Janecek, S
1996-06-01
The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins.
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
Kühne, Annett; Kaiser, Rolf; Schirmer, Markus; Heider, Ulrike; Muhlke, Sabine; Niere, Wiebke; Overbeck, Tobias; Hohloch, Karin; Trümper, Lorenz; Sezer, Orhan; Brockmöller, Jürgen
2007-07-01
Melphalan is widely used in the treatment of multiple myeloma. Pharmacokinetics of this alkylating drug shows high inter-individual variability. As melphalan is a phenylalanine derivative, the pharmacokinetic variability may be determined by genetic polymorphisms in the L-type amino acid transporters LAT1 (SLC7A5) and LAT2 (SLC7A8). Pharmacokinetics were analysed in 64 patients after first administration of intravenous melphalan. Severity of side effects was documented according to WHO criteria. Genomic DNA was analysed for polymorphisms in LAT1 and LAT2 by sequencing of the entire coding region, intron-exon boundaries and 2 kb upstream promoter region. Selected polymorphisms in the common heavy chain of both transporters, the protein 4F2hc (SLC3A2), were analysed by single nucleotide primer extension. Melphalan pharmacokinetics was highly variable with up to 6.2-fold differences in total clearance. A total of 44 polymorphisms were identified in LAT1 and 21 polymorphisms in LAT2. From all variants, only five were in the coding region and only one heterozygous non-synonymous polymorphism (Ala94Thr) was found in LAT2. Numerous polymorphisms were found in the LAT1 and LAT2 5'-flanking regions but did not correlate with expression of the respective genes. No significant correlations could be observed between the polymorphisms in 4F2hc, LAT1, and LAT2 with melphalan pharmacokinetics or with melphalan side effects. The study confirmed that these transporter genes are highly conserved, particularly in the coding sequences. Genetic variation in 4F2hc, LAT1, and LAT2 does not appear to be a major cause of inter-individual variability in pharmacokinetics and of adverse reactions to melphalan.
The human phospholamban gene: structure and expression.
McTiernan, C F; Frye, C S; Lemster, B H; Kinder, E A; Ogletree-Hughes, M L; Moravec, C S; Feldman, A M
1999-03-01
Phospholamban, through modulation of sarcoplasmic reticulum calcium-ATPase activity, is a key regulator of cardiac diastolic function. Alterations in phospholamban expression may define parameters of muscle relaxation. In experimental animals, phospholamban is differentially expressed in various striated and smooth muscles, and within the four chambers of the heart. Decreased phospholamban expression within the heart during heart failure has also been observed. Furthermore, regulatory elements of mammalian phospholamban genes remain poorly defined. To extend these studies to humans, we (1) characterized phospholamban expression in various human organs, (2) isolated genomic clones encoding the human phospholamban gene, and (3) prepared human phospholamban promoter/luciferase reporter constructs and performed transient transfection assays to begin identification of regulatory elements. We observed that human ventricle and quadriceps displayed high levels of phospholamban transcripts and proteins, with markedly lower expression observed in smooth muscles, while the right atria also expressed low levels of phospholamban. The human phospholamban gene structure closely resembles that reported for chicken, rabbit, rat, and mouse. Comparison of the human to other mammalian phospholamban genes indicates a marked conservation of sequence for at least 217 bp upstream of the transcription start site, which contains conserved motifs for GATA, CP1/NFY, M-CAT-like, and E-box elements. Transient transfection assays with a series of plasmids containing deleted 5' flanking regions (between -2530 and -66 through +85) showed that sequences between -169 and the CP1-box at -93 were required for maximal promoter activity in neonatal rat cardiomyocytes. Activity of these reporters in HeLa cells was markedly lower than that observed in rat cardiomyocytes, suggesting at least a partial tissue selectivity of these reporter constructs.
Flanking signal and mature peptide residues influence signal peptide cleavage
Choo, Khar Heng; Ranganathan, Shoba
2008-01-01
Background Signal peptides (SPs) mediate the targeting of secretory precursor proteins to the correct subcellular compartments in prokaryotes and eukaryotes. Identifying these transient peptides is crucial to the medical, food and beverage and biotechnology industries yet our understanding of these peptides remains limited. This paper examines the most common type of signal peptides cleavable by the endoprotease signal peptidase I (SPase I), and the residues flanking the cleavage sites of three groups of signal peptide sequences, namely (i) eukaryotes (Euk) (ii) Gram-positive (Gram+) bacteria, and (iii) Gram-negative (Gram-) bacteria. Results In this study, 2352 secretory peptide sequences from a variety of organisms with amino-terminal SPs are extracted from the manually curated SPdb database for analysis based on physicochemical properties such as pI, aliphatic index, GRAVY score, hydrophobicity, net charge and position-specific residue preferences. Our findings show that the three groups share several similarities in general, but they display distinctive features upon examination in terms of their amino acid compositions and frequencies, and various physico-chemical properties. Thus, analysis or prediction of their sequences should be separated and treated as distinct groups. Conclusion We conclude that the peptide segment recognized by SPase I extends to the start of the mature protein to a limited extent, upon our survey of the amino acid residues surrounding the cleavage processing site. These flanking residues possibly influence the cleavage processing and contribute to non-canonical cleavage sites. Our findings are applicable in defining more accurate prediction tools for recognition and identification of cleavage site of SPs. PMID:19091014
Williams, N P; Mueller, P P; Hinnebusch, A G
1988-01-01
Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626
Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.
2011-01-01
Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290
Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve
2003-01-01
The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766
Evaluation of the arrestin gene in patients with retinitis pigmentosa or an allied disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeStefano, D.J.; Berson, E.L.; Dryja, T.P.
1994-09-01
Arrestin, also called 48K protein or S-antigen, plays a role in deactivating rhodopsin, the photosensitive, seven-helix, G-protein receptor found in rod photoreceptors. In Drosophila, null mutations in arrestin genes cause a light-dependent photoreceptor degeneration. It is possible that a comparable photoreceptor degeneration in humans is caused by defects in the rod arrestin gene. In order to evaluate this possibility, we are characterizing the human arrestin locus on chromosome 2q. We screened a genomic library (5 million plaques) using an arrestin cDNA clone. Sixty-eight hybridizing clones were identified; portions of 7 clones were sequenced to determine the intron sequence flanking themore » exons. We are using SSCP analysis and direct genomic sequencing to screen the entire coding region, splice donor and acceptor sites, and the promoter region of the arrestin gene in 188 patients with autosomal dominant and 104 patients with autosomal recessive retinitis pigmentosa. We have already obtained flanking intron sequences necessary for SSCP analysis for 13 of 16 exons. So far, we have identified 4 silent base changes at codons 67 (TGC-to-TGT), 107 (CTG-to-CTC), 163 (GCC-to-GCT), and 288 (CTG-to-TGT), all with allele frequencies at 1% or less. Several other variant bands detected by SSCP analysis are currently being sequenced.« less
Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon
2013-01-01
The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860
“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta
Hansen, Geneviève; Chilton, Mary-Dell
1996-01-01
We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167
Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays
Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel
2006-01-01
Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921
Lee, Sooncheol; Kang, Changwon
2011-05-06
The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.
Sastre-Garau, X; Favre, M; Couturier, J; Orth, G
2000-08-01
We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.
Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R
2005-09-01
We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.
Characterization of circulating transfer RNA-derived RNA fragments in cattle
Casas, Eduardo; Cai, Guohong; Neill, John D.
2015-01-01
The objective was to characterize naturally occurring circulating transfer RNA-derived RNA fragments (tRFs) in cattle1. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences aligned to transfer RNA (tRNA) genes or their flanking sequences were characterized. Sequences aligned to the beginning of 5′ end of the mature tRNA were classified as tRF5; those aligned to the 3′ end of mature tRNA were classified as tRF3; and those aligned to the beginning of the 3′ end flanking sequences were classified as tRF1. There were 3,190,962 sequences that mapped to transfer RNA and small non-coding RNAs in the bovine genome. Of these, 2,323,520 were identified as tRF5s, 562 were tRF3s, and 81 were tRF1s. There were 866,799 sequences identified as other small non-coding RNAs (microRNA, rRNA, snoRNA, etc.) and were excluded from the study. The tRF5s ranged from 28 to 40 nucleotides; and 98.7% ranged from 30 to 34 nucleotides in length. The tRFs with the greatest number of sequences were derived from tRNA of histidine, glutamic acid, lysine, glycine, and valine. There was no association between number of codons for each amino acid and number of tRFs in the samples. The reason for tRF5s being the most abundant can only be explained if these sequences are associated with function within the animal. PMID:26379699
Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.
2014-01-01
The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924
Cunha, Mariana Sequetin; Esposito, Danillo Lucas Alves; Rocco, Iray Maria; Maeda, Adriana Yurika; Vasami, Fernanda Gisele Silva; Nogueira, Juliana Silva; de Souza, Renato Pereira; Suzuki, Akemi; Addas-Carvalho, Marcelo; Barjas-Castro, Maria de Lourdes; Resende, Mariângela Ribeiro; Stucchi, Raquel Silveira Bello; Boin, Ilka de Fátima Santana Ferreira; Katz, Gizelda; Angerami, Rodrigo Nogueira; da Fonseca, Benedito Antonio Lopes
2016-03-03
We report here the genome sequence of Zika virus, strain ZikaSPH2015, containing all structural and nonstructural proteins flanked by the 5' and 3' untranslated region. It was isolated in São Paulo state, Brazil, in 2015, from a patient who received a blood transfusion from an asymptomatic donor at the time of donation. Copyright © 2016 Cunha et al.
Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...
Agouti sequence polymorphisms in coyotes, wolves and dogs suggest hybridization.
Schmutz, Sheila M; Berryere, Thomas G; Barta, Jodi L; Reddick, Kimberley D; Schmutz, Josef K
2007-01-01
Domestic dogs have been shown to have multiple alleles of the Agouti Signal Peptide (ASIP) in exon 4 and we wished to determine the level of polymorphism in the common wild canids of Canada, wolves and coyotes, in comparison. All Canadian coyotes and most wolves have banded hairs. The ASIP coding sequence of the wolf did not vary from the domestic dog but one variant was detected in exon 4 of coyotes that did not alter the arginine at this position. Two other differences were found in the sequence flanking exon 4 of coyotes compared with the 45 dogs and 1 wolf. The coyotes also demonstrated a relatively common polymorphism in the 3' UTR sequence that could be used for population studies. One of the ASIP alleles (R96C) in domestic dogs causes a solid black coat color in homozygotes. Although some wolves are melanistic, this phenotype does not appear to be caused by this same mutation. However, one wolf, potentially a dog-wolf hybrid or descendant thereof, was heterozygous for this allele. Likewise 2 coyotes, potentially dog-coyote or wolf-coyote hybrid descendants, were heterozygous for the several polymorphisms in and flanking exon 4. We could conclude that these were coyote-dog hybrids because both were heterozygous for 2 mutations causing fawn coat color in dogs.
The Specificity of Trimming of MHC Class I-Presented Peptides in the Endoplasmic Reticulum1
Hearn, Arron; York, Ian A.; Rock, Kenneth L.
2010-01-01
Aminopeptidases in the endoplasmic reticulum (ER) can cleave antigenic peptides and in so doing either create or destroy MHC class I-presented epitopes. However the specificity of this trimming process overall and of the major ER aminopeptidase ERAP1 in particular is not well understood. This issue is important because peptide trimming influences the magnitude and specificity of CD8 T cell responses. By systematically varying the N-terminal flanking sequences of peptides in a cell free biochemical system and in intact cells, we elucidated the specificity of ERAP1 and of ER trimming overall. ERAP1 can cleave after many amino acids on the N-terminus of epitope precursors but does so at markedly different rates. The specificity seen with purified ERAP1 is similar to that observed for trimming and presentation of epitopes in the ER of intact cells. We define N-terminal sequences that are favorable or unfavorable for antigen presentation in ways that are independent from the epitopes core sequence. When databases of known presented peptides were analyzed, the residues that were preferred for the trimming of model peptide precursors were found to be overrepresented in N-terminal flanking sequences of epitopes generally. These data define key determinants in the specificity of antigen processing. PMID:19828632
bpRNA: large-scale automated annotation and analysis of RNA secondary structure.
Danaee, Padideh; Rouches, Mason; Wiley, Michelle; Deng, Dezhong; Huang, Liang; Hendrix, David
2018-05-09
While RNA secondary structure prediction from sequence data has made remarkable progress, there is a need for improved strategies for annotating the features of RNA secondary structures. Here, we present bpRNA, a novel annotation tool capable of parsing RNA structures, including complex pseudoknot-containing RNAs, to yield an objective, precise, compact, unambiguous, easily-interpretable description of all loops, stems, and pseudoknots, along with the positions, sequence, and flanking base pairs of each such structural feature. We also introduce several new informative representations of RNA structure types to improve structure visualization and interpretation. We have further used bpRNA to generate a web-accessible meta-database, 'bpRNA-1m', of over 100 000 single-molecule, known secondary structures; this is both more fully and accurately annotated and over 20-times larger than existing databases. We use a subset of the database with highly similar (≥90% identical) sequences filtered out to report on statistical trends in sequence, flanking base pairs, and length. Both the bpRNA method and the bpRNA-1m database will be valuable resources both for specific analysis of individual RNA molecules and large-scale analyses such as are useful for updating RNA energy parameters for computational thermodynamic predictions, improving machine learning models for structure prediction, and for benchmarking structure-prediction algorithms.
Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E
2015-03-20
Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.
Panfil, M.S.; Gardner, T.W.; Hirth, K.G.
1999-01-01
Late Holocene (240 km2 on the east side of the volcano with >25 cm of tephra. Lavas from eruptive sequence I dammed drainage in the lowland area near the town of San Nicolas and caused local upstream deposition of as much as 30 m of lacustrine silts, clays, and sands. These lacustrine deposits record an eruptive hiatus for the Tetimpa area of about 750 14C yr: between ca. 2100 and ca. 1350 yr B.P., no major tephras were deposited in the Tetimpa area. In upland areas, this time period is represented by an unconformity and by Entisols formed in the top of pumice deposits and lavas from eruptive sequence I. Artifacts, agricultural furrows, and dwellings record human reoccupation of this surface. At the end of this hiatus, several lahars were deposited above the lacustrine sequence and locally above the Entisol in upland positions adjacent to streams. Between ca. 1350 and ca. 1200 yr B.P., tephras from eruptive sequence II buried these paleosols, occupation sites, lacustrine sediments, and lahars. Andesitic (~62% SiO2) pumice lapilli deposits in the Tetimpa area record three pumice-fall eruptions directed northeast and east of the crater. The first and smallest of these (maximum Tetimpa area thickness = 12 cm; >52 km2 covered by >25 cm) took place at ca. 1350 yr B.P. and was accompanied by pyroclastic surge events preserved in the Tetimpa area by charcoal, sand waves, and cross-stratified sand-sized tephra. At ca. 1200 yr B.P., the products of two Plinian-style events and additional pyroclastic surges reached the Tetimpa area. The largest of these tephra-fall events covered the Tetimpa area with 0.5-1 m of tephra and blanketed an area of >230 km2 with a thickness of >25 cm. The Tetimpa record confirms two of the four periods of explosive volcanism recognized by studies conducted around Popocatepetl in the past 30 yr. Eruptive sequence I corresponds to the explosive period between 2100 and 2500 yr B.P., and eruptive sequence II corresponds to the period between 900 and 1400 yr B.P. The archaeology and lacustrine stratigraphy of the Tetimpa area help constrain the timing of the Plinian phase of eruptive sequence I to ca. 2100 yr B.P. and suggest that the pumice-fall eruptions of eruptive sequence II took place in at least two intervals between ca. 1350 and ca. 1200 yr B.P.
Itzhaki, H; Maxson, J M; Woodson, W R
1994-09-13
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.
Characterization of ROP18 alleles in human toxoplasmosis.
Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique
2014-04-01
The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.
The volcanotectonic structures of Ascraeus Mons
NASA Astrophysics Data System (ADS)
Byrne, Paul; van Wyk de Vries, Benjamin; Murray, John; Troll, Valentin
2010-05-01
Ascraeus Mons is the tallest of three large volcanoes situated to the NE of the Tharsis Rise and aligned parallel to a NE-SW regional structural trend. With a vertical relief of 14.9 km and an E-W diameter of 400 km, the main shield has a convex-upward morphology and a summit plateau, whilst significantly younger lava rift aprons issue from expansive embayments on its lower flanks onto the surrounding plains. The volcano hosts several types of well-preserved surface structures, and so has served as a basis for understanding Martian volcano geodynamics. Previous studies have not incorporated the full set of structures on Ascraeus Mons, however, and have been limited by photogeological data of lower resolution than that available today. We have used a GIS of MOLA, HRSC, and CTX data to map the spatial and temporal distributions of the most pronounced structures on Ascraeus Mons — its summit calderas, flank terraces, arcuate graben, and pit craters — to develop as comprehensive an evolutionary sequence for this volcano as possible. We summarise our mapping results here. · The 55-km wide caldera complex consists of at least three NE-SW-aligned depressions, with a possible fourth caldera on the periphery. Depths range from 818 m for the shallowest caldera to 3,110 m for the deepest. Whilst most lavas on the volcano are summit-derived, even the latest flows are cut by post-caldera formation subsidence and fracturing. · Flank terraces, topographically subtle outward-verging, convex-upward structures, encircle Ascraeus Mons in an imbricate, fish-scale pattern. 142 terraces in total extend from immediately below the summit to the basal plains, but do not occur on the rift aprons. The mean circumferential length for terraces is 31.9 km, though terraces over 60 km long lie on the NW and SE flanks. · Arcuate graben crosscut the NW flanks and surrounding plains, and extend for ca. 90° concentric to the volcano. These structures vary in width from 400 m to 1,200 m, and are between 10 and 100 m deep. They are shallower and more laterally continuous than the pit troughs observed elsewhere on the flanks (described below), although pits do occur nearby, and in places are laterally contiguous with graben. · Pit craters are circular or ovoid rimless depressions, between 190 and 3,000 m in diameter and several 100s m deep, that are superposed upon the latest lavas on the volcano. Rows of pits form crater chains, whilst chains can merge to form troughs. We mapped 4,166 pits across the volcano, trending circumferential near the summit to radial low on the NE and SW flanks; here, chains and troughs coalesce to form the embayments. Caldera formation is likely the result of evacuation of an underlying magma chamber. Recent work indicates that flank terraces are compressive structures, formed by upper flank shortening of a volcano as it flexes the supporting lithosphere; flexure could also account for the arcuate graben concentric to the shield. In contrast, pit craters are probably extensional structures, formed by collapse into subsurface voids. A developmental sequence for Ascraeus Mons, therefore, needs to account for the disparate formation mechanisms proposed for these spatially coincident structures. Incorporating our findings with earlier studies of this volcano, we conclude that Ascraeus has experienced a history of rapid shield building, coeval with magma chamber evacuation, which initiated sustained lithospheric flexure and led to the formation of flank terraces and concentric graben. Main shield construction was followed by a period of repose before rift apron volcanism initiated on the lower flanks along the NE-SW regional lineament. Ultimately, the dominant tectonic regime upon the volcano's flanks changed from compressional to extensional, resulting in the development of pit craters. This model may help establish a framework for understanding the volcanotectonic histories of large shields across Mars.
Tchoudakova, A; Kishida, M; Wood, E; Callard, G V
2001-11-01
Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most prominently in retinal ganglion cells (RGC) and axon-like projections to the optic tectum. Expression of a cyp19a/GFP reporter was not detectable up to 72 hpf. Tandem analysis of cyp19a and cyp19b promoters in living zebrafish embryos can be a useful approach for identifying cis-elements and cellular factors involved in the correct tissue-specific, spatial, temporal and estrogen regulated expression of aromatase genes during CNS and gonadal development.
Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou
2018-04-01
While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.
Maia, A L; Berry, M J; Sabbag, R; Harney, J W; Larsen, P R
1995-08-01
The type 1 deiodinase (D1) provides the major portion of the circulating T3 in vertebrates. In C3H and certain other inbred mice, liver and kidney D1 activity is 5- to 10-fold lower than in the common phenotype, C57. The lower D1 levels are paralleled by a decreased normal-sized dio1 mRNA and hyperthyroxinemia. Low activity cosegregates with a restriction fragment length variant (RFLV) in both inbred and recombinant strains, indicating it is due to differences in the dio1 gene. The exonic structure and the deduced amino acid sequences are identical for both strains and highly homologous to that of the rat. The RFLV is due to an approximately 150-base pair expansion of repetitive sequences in the second intron of the C3H gene, but this segment does not differentially affect the transient expression of a human GH gene. The promoter and 5'-flanking regions of the C3H and C57 dio1 genes are very similar and are GC rich without TATA or CCAAT boxes. However, functional assays of 1.5-kilobase 5'-flanking dio1-CAT constructs showed 2- to 3-fold higher activity of the C57-CAT constructs. Deletion mutants showed that sequences between -705 and -162 were the cause of this. In this region, the only major difference between the two genes is a 21-base pair insert containing five CTG repeats in the C3H promoter. This difference also cosegregates with low D1 activity and the intron RFLV in four other mouse strains. The correlation of the CTG repeat insert with both in vitro and in vivo expression and the absence of other significant sequence differences in the 5'-flanking region argue that this is the major explanation for the impaired expression of the dio1 gene and the resulting hyperthyroxinemia of the C3H mouse.
Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A
2016-01-01
The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.
Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.
2000-01-01
The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202
Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J
2000-11-01
Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.
Dias, Miguel de Sousa; Hernan, Imma; Pascual, Beatriz; Borràs, Emma; Mañé, Begoña; Gamundi, Maria José
2013-01-01
Purpose To devise an effective method for detecting mutations in 12 genes (CA4, CRX, IMPDH1, NR2E3, RP9, PRPF3, PRPF8, PRPF31, PRPH2, RHO, RP1, and TOPORS) commonly associated with autosomal dominant retinitis pigmentosa (adRP) that account for more than 95% of known mutations. Methods We used long-range PCR (LR-PCR) amplification and next-generation sequencing (NGS) performed in a GS Junior 454 benchtop sequencing platform. Twenty LR-PCR fragments, between 3,000 and 10,000 bp, containing all coding exons and flanking regions of the 12 genes, were obtained from DNA samples of patients with adRP. Sequencing libraries were prepared with an enzymatic (Fragmentase technology) method. Results Complete coverage of the coding and flanking sequences of the 12 genes assayed was obtained with NGS, with an average sequence depth of 380× (ranging from 128× to 1,077×). Five previous known mutations in the adRP genes were detected with a sequence variation percentage between 35% and 65%. We also performed a parallel sequence analysis of four samples, three of them new patients with index adRP, in which two novel mutations were detected in RHO (p.Asn73del) and PRPF31 (p.Ile109del). Conclusions The results demonstrate that genomic LR-PCR amplification together with NGS is an effective method for analyzing individual patient samples for mutations in a monogenic heterogeneous disease such as adRP. This approach proved effective for the parallel analysis of adRP and has been introduced as routine. Additionally, this approach could be extended to other heterogeneous genetic diseases. PMID:23559859
Chen, Zhuo; Xu, Shixia; Zhou, Kaiya; Yang, Guang
2011-10-27
A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future.
Burke, Kathleen A; Kauffman, Karlina J; Umbaugh, C Samuel; Frey, Shelli L; Legleiter, Justin
2013-05-24
Huntington disease (HD) is caused by an expanded polyglutamine (poly(Q)) repeat near the N terminus of the huntingtin (htt) protein. Expanded poly(Q) facilitates formation of htt aggregates, eventually leading to deposition of cytoplasmic and intranuclear inclusion bodies containing htt. Flanking sequences directly adjacent to the poly(Q) domain, such as the first 17 amino acids on the N terminus (Nt17) and the polyproline (poly(P)) domain on the C-terminal side of the poly(Q) domain, heavily influence aggregation. Additionally, htt interacts with a variety of membraneous structures within the cell, and Nt17 is implicated in lipid binding. To investigate the interaction between htt exon1 and lipid membranes, a combination of in situ atomic force microscopy, Langmuir trough techniques, and vesicle permeability assays were used to directly monitor the interaction of a variety of synthetic poly(Q) peptides with different combinations of flanking sequences (KK-Q35-KK, KK-Q35-P10-KK, Nt17-Q35-KK, and Nt17-Q35-P10-KK) on model membranes and surfaces. Each peptide aggregated on mica, predominately forming extended, fibrillar aggregates. In contrast, poly(Q) peptides that lacked the Nt17 domain did not appreciably aggregate on or insert into lipid membranes. Nt17 facilitated the interaction of peptides with lipid surfaces, whereas the poly(P) region enhanced this interaction. The aggregation of Nt17-Q35-P10-KK on the lipid bilayer closely resembled that of a htt exon1 construct containing 35 repeat glutamines. Collectively, this data suggests that the Nt17 domain plays a critical role in htt binding and aggregation on lipid membranes, and this lipid/htt interaction can be further modulated by the presence of the poly(P) domain.
Relevance of sodium/glucose cotransporter-1 (SGLT1) to diabetes mellitus and obesity in dogs.
Batchelor, D J; German, A J; Shirazi-Beechey, S P
2013-04-01
Glucose transport across the enterocyte brush border membrane by sodium/glucose cotransporter-1 (SGLT1, coded by Slc5a1) is the rate-limiting step for intestinal glucose transport. The relevance of SGLT1 expression in predisposition to diabetes mellitus and to obesity was investigated in dogs. Cultured Caco-2/TC7 cells were shown to express SGLT1 in vitro. A 2-kbp fragment of the Slc5a1 5' flanking region was cloned from canine genomic DNA, ligated into reporter gene plasmids, and shown to drive reporter gene expression in these cells above control (P < 0.001). To determine the effect of the 3 known SNPs in this region on promoter function, new promoter/reporter constructs (all permutations of these 3 SNPs) were created by site-directed mutagenesis. No significant differences in promoter function were seen, suggesting that these SNPs do not have a significant effect on the constitutive transcription of SGLT1 mRNA in dogs. A search for novel SNPs in this region in dogs was made in 2 breeds predisposed to diabetes mellitus (Samoyed and cairn terrier), 2 breeds that rarely develop diabetes (boxer and German shepherd), and 2 breeds predisposed to obesity (Labrador retriever and cocker spaniel). The Slc5a1 5' flanking region was amplified from 10 healthy individuals of each of these breeds by high-fidelity PCR with the use of breed-labeled primers and sequenced by pyrosequencing. The sequence of the Slc5a1 5' flanking region in all individuals of all breeds tested was identical. On this evidence, variations in Slc5a1 promoter sequence between dogs do not influence the pathogenesis of diabetes mellitus or obesity in these breeds. Copyright © 2013 Elsevier Inc. All rights reserved.
2011-01-01
Background A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. Results An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Conclusions Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future. PMID:22029548
A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle
NASA Astrophysics Data System (ADS)
Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo
2003-04-01
From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.
USDA-ARS?s Scientific Manuscript database
Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...
Rim, Jong S; Kozak, Leslie P
2002-09-13
Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.
Allnutt, T R; Roper, K; Henry, C
2008-01-23
A genetic marker system based on the S1 Short Interspersed Elements (SINEs) in the important commercial crop, oilseed rape ( Brassica napus L.) has been developed. SINEs provided a successful multilocus, dominant marker system that was capable of clearly delineating winter- and spring-type crop varieties. Sixteen of 20 varieties tested showed unique profiles from the 17 polymorphic SINE markers generated. The 3' or 5' flank region of nine SINE markers were cloned, and DNA was sequenced. In addition, one putative pre-transposition SINE allele was cloned and sequenced. Two SINE flanking sequences were used to design real-time PCR assays. These quantitative SINE assays were applied to study the genetic structure of eight fields of oilseed rape crops. Studied fields were more genetically diverse than expected for the chosen loci (mean H T = 0.23). The spatial distribution of SINE marker frequencies was highly structured in some fields, suggesting locations of volunteer impurities within the crop. In one case, the assay identified a mislabeling of the crop variety. SINE markers were a useful tool for crop genetics, phylogenetics, variety identification, and purity analysis. The use and further application of quantitative, real-time PCR markers are discussed.
Shao, Chengchen; Zhang, Yaqi; Zhou, Yueqin; Zhu, Wei; Xu, Hongmei; Liu, Zhiping; Tang, Qiqun; Shen, Yiwen; Xie, Jianhui
2015-01-01
Aim To systemically select and evaluate short tandem repeats (STRs) on the chromosome 14 and obtain new STR loci as expanded genotyping markers for forensic application. Methods STRs on the chromosome 14 were filtered from Tandem Repeats Database and further selected based on their positions on the chromosome, repeat patterns of the core sequences, sequence homology of the flanking regions, and suitability of flanking regions in primer design. The STR locus with the highest heterozygosity and polymorphism information content (PIC) was selected for further analysis of genetic polymorphism, forensic parameters, and the core sequence. Results Among 26 STR loci selected as candidates, D14S739 had the highest heterozygosity (0.8691) and PIC (0.8432), and showed no deviation from the Hardy-Weinberg equilibrium. 14 alleles were observed, ranging in size from 21 to 34 tetranucleotide units in the core region of (GATA)9-18 (GACA)7-12 GACG (GACA)2 GATA. Paternity testing showed no mutations. Conclusion D14S739 is a highly informative STR locus and could be a suitable genetic marker for forensic applications in the Han Chinese population. PMID:26526885
2012-01-01
Background The mycobacteriophage large serine recombinase Bxb1 catalyzes site-specific recombination between its corresponding attP and attB recognition sites. Previously, we and others have shown that Bxb1 has catalytic activity in various eukaryotic species including Nicotiana tabacum, Schizosaccharomyces pombe, insects and mammalian cells. Results In this work, the Bxb1 recombinase gene was transformed and constitutively expressed in Arabidopsis thaliana plants harboring a chromosomally integrated attP and attB-flanked target sequence. The Bxb1 recombinase successfully excised the target sequence in a conservative manner and the resulting recombination event was heritably transmitted to subsequent generations in the absence of the recombinase transgene. In addition, we also show that Bxb1 recombinase expressing plants can be manually crossed with att-flanked target transgenic plants to generate excised progeny. Conclusion The Bxb1 large serine recombinase performs site-specific recombination in Arabidopsis thaliana germinal tissue, producing stable lines free of unwanted DNA. The precise site-specific deletion produced by Bxb1 in planta demonstrates that this enzyme can be a useful tool for the genetic engineering of plants without selectable marker transgenes or other undesirable exogenous sequences. PMID:22436504
NASA Astrophysics Data System (ADS)
Szymanski, E.; Stockli, D.; Johnson, P.; Kattan, F. H.; Al Shamari, A.
2006-12-01
Numerous models exploring the rupturing modes and mechanisms of continental lithosphere are based on geological evidence from the Red Sea/Gulf of Suez rift system. Individually, the Red Sea basin is the prototype for many models of orthogonal continental rifting. Despite being a classic example of continental extension, many temporal and spatial strain distribution aspects, as well as the dynamic evolution of the rift architecture of the Red Sea, remain poorly constrained. Critical data come mostly from the Gulf of Suez and the Egyptian and Yemeni margins of the Red Sea; the rift flanks in Sudan and Saudi Arabia have remained largely unstudied, leaving a large information gap along the central portions of the rift system. Improving continental lithosphere rupture models requires an absolute understanding of the timing and magnitude of strain partitioning along the full rift flank. This study focuses on the development of extensional structures, syn- extensional sedimentary deposits, and rift-related Tertiary basaltic volcanism along the central flank of the rift system in Saudi Arabia. Geo- and thermochronometric techniques are used to elucidate the evolution of inboard and outboard strain markers manifested by structurally-controlled extensional basins that parallel the trend of the main Red Sea rift. Constraints on the dynamics of rift flank deformation are achieved through the collection of thermochronometric transects that traverse both the entire Arabian shield and individual normal faults that bound inland basins. Preliminary results show inland basins as asymmetric half-grabens filled by tilted Cenozoic sedimentary strata and separated by exhumed basement fault blocks. The most prominent extensional basin is the NW-trending Hamd-Jizil basin, located north of Madinah, measuring ~200 km along strike and up to 20 km in width. The Hamd-Jizil basin is structurally characterized by two half-grabens exposing a series of syn-rift siliciclastic sedimentary sections below Tertiary basalts. In certain areas, thick basalt sequences provide basin infill and appear faulted by a younger series of normal faults. Work continues on the production of further geo- and thermochronologic data for the Tertiary basalt sequences as well as the entire rift flank region.
Selinger, David A.; Chandler, Vicki L.
2001-01-01
The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116
Two alternative ways of start site selection in human norovirus reinitiation of translation.
Luttermann, Christine; Meyers, Gregor
2014-04-25
The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.
A tag-based approach for high-throughput analysis of CCWGG methylation.
Denisova, Oksana V; Chernov, Andrei V; Koledachkina, Tatyana Y; Matvienko, Nicholas I
2007-10-15
Non-CpG methylation occurring in the context of CNG sequences is found in plants at a large number of genomic loci. However, there is still little information available about non-CpG methylation in mammals. Efficient methods that would allow detection of scarcely localized methylated sites in small quantities of DNA are required to elucidate the biological role of non-CpG methylation in both plants and animals. In this study, we tested a new whole genome approach to identify sites of CCWGG methylation (W is A or T), a particular case of CNG methylation, in genomic DNA. This technique is based on digestion of DNAs with methylation-sensitive restriction endonucleases EcoRII-C and AjnI. Short DNAs flanking methylated CCWGG sites (tags) are selectively purified and assembled in tandem arrays of up to nine tags. This allows high-throughput sequencing of tags, identification of flanking regions, and their exact positions in the genome. In this study, we tested specificity and efficiency of the approach.
Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M
2015-07-01
The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boccaccio, C.; Deshatrette, J.; Meunier-Rotival, M.
1994-05-01
The genomic fragment carrying the human activator of liver function, previously described as an episome capable of inducing differentiation upon transfection into a dedifferentiated rat hepatoma cell line, was mapped on human chromosome 12q24.2-12q24.3. This chromosomal location was indistinguishable by in situ hybridization from that of the gene coding for the hepatic transcription factor HNF1. The sequence of the integrated form of the episome as well as its flanking sequences show that it is rich in retroposons. It contains a human ribosomal protein L21 processed pseudogene, one truncated L1Hs sequence, and 10 Alu repeats, which belong to different subfamilies.
Watanabe, Yoshiyuki; Yamamoto, Hiroyuki; Oikawa, Ritsuko; Toyota, Minoru; Yamamoto, Masakazu; Kokudo, Norihiro; Tanaka, Shinji; Arii, Shigeki; Yotsuyanagi, Hiroshi; Koike, Kazuhiko; Itoh, Fumio
2015-01-01
Integration of DNA viruses into the human genome plays an important role in various types of tumors, including hepatitis B virus (HBV)–related hepatocellular carcinoma. However, the molecular details and clinical impact of HBV integration on either human or HBV epigenomes are unknown. Here, we show that methylation of the integrated HBV DNA is related to the methylation status of the flanking human genome. We developed a next-generation sequencing-based method for structural methylation analysis of integrated viral genomes (denoted G-NaVI). This method is a novel approach that enables enrichment of viral fragments for sequencing using unique baits based on the sequence of the HBV genome. We detected integrated HBV sequences in the genome of the PLC/PRF/5 cell line and found variable levels of methylation within the integrated HBV genomes. Allele-specific methylation analysis revealed that the HBV genome often became significantly methylated when integrated into highly methylated host sites. After integration into unmethylated human genome regions such as promoters, however, the HBV DNA remains unmethylated and may eventually play an important role in tumorigenesis. The observed dynamic changes in DNA methylation of the host and viral genomes may functionally affect the biological behavior of HBV. These findings may impact public health given that millions of people worldwide are carriers of HBV. We also believe our assay will be a powerful tool to increase our understanding of the various types of DNA virus-associated tumorigenesis. PMID:25653310
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Stability of Tandem Repeats in the Drosophila Melanogaster HSR-Omega Nuclear RNA
Hogan, N. C.; Slot, F.; Traverse, K. L.; Garbe, J. C.; Bendena, W. G.; Pardue, M. L.
1995-01-01
The Drosophila melanogaster Hsr-omega locus produces a nuclear RNA containing >5 kb of tandem repeat sequences. These repeats are unique to Hsr-omega and show concerted evolution similar to that seen with classical satellite DNAs. In D. melanogaster the monomer is ~280 bp. Sequences of 191/2 monomers differ by 8 +/- 5% (mean +/- SD), when all pairwise comparisons are considered. Differences are single nucleotide substitutions and 1-3 nucleotide deletions/insertions. Changes appear to be randomly distributed over the repeat unit. Outer repeats do not show the decrease in monomer homogeneity that might be expected if homogeneity is maintained by recombination. However, just outside the last complete repeat at each end, there are a few fragments of sequence similar to the monomer. The sequences in these flanking regions are not those predicted for sequences decaying in the absence of recombination. Instead, the fragmentation of the sequence homology suggests that flanking regions have undergone more severe disruptions, possibly during an insertion or amplification event. Hsr-omega alleles differing in the number of repeats are detected and appear to be stable over a few thousand generations; however, both increases and decreases in repeat numbers have been observed. The new alleles appear to be as stable as their predecessors. No alleles of less than ~5 kb nor more than ~16 kb of repeats were seen in any stocks examined. The evidence that there is a limit on the minimum number of repeats is consistent with the suggestion that these repeats are important in the function of the unusual Hsr-omega nuclear RNA. PMID:7540581
2008-01-01
Background The arginine vasopressin V1a receptor (V1aR) modulates social cognition and behavior in a wide variety of species. Variation in a repetitive microsatellite element in the 5' flanking region of the V1aR gene (AVPR1A) in rodents has been associated with variation in brain V1aR expression and in social behavior. In humans, the 5' flanking region of AVPR1A contains a tandem duplication of two ~350 bp, microsatellite-containing elements located approximately 3.5 kb upstream of the transcription start site. The first block, referred to as DupA, contains a polymorphic (GT)25 microsatellite; the second block, DupB, has a complex (CT)4-(TT)-(CT)8-(GT)24 polymorphic motif, known as RS3. Polymorphisms in RS3 have been associated with variation in sociobehavioral traits in humans, including autism spectrum disorders. Thus, evolution of these regions may have contributed to variation in social behavior in primates. We examined the structure of these regions in six ape, six monkey, and one prosimian species. Results Both tandem repeat blocks are present upstream of the AVPR1A coding region in five of the ape species we investigated, while monkeys have only one copy of this region. As in humans, the microsatellites within DupA and DupB are polymorphic in many primate species. Furthermore, both single (lacking DupB) and duplicated alleles (containing both DupA and DupB) are present in chimpanzee (Pan troglodytes) populations with allele frequencies of 0.795 and 0.205 for the single and duplicated alleles, respectively, based on the analysis of 47 wild-caught individuals. Finally, a phylogenetic reconstruction suggests two alternate evolutionary histories for this locus. Conclusion There is no obvious relationship between the presence of the RS3 duplication and social organization in primates. However, polymorphisms identified in some species may be useful in future genetic association studies. In particular, the presence of both single and duplicated alleles in chimpanzees provides a unique opportunity to assess the functional role of this duplication in contributing to variation in social behavior in primates. While our initial studies show no signs of directional selection on this locus in chimps, pharmacological and genetic association studies support a potential role for this region in influencing V1aR expression and social behavior. PMID:18573213
Donaldson, Zoe R; Kondrashov, Fyodor A; Putnam, Andrea; Bai, Yaohui; Stoinski, Tara L; Hammock, Elizabeth A D; Young, Larry J
2008-06-23
The arginine vasopressin V1a receptor (V1aR) modulates social cognition and behavior in a wide variety of species. Variation in a repetitive microsatellite element in the 5' flanking region of the V1aR gene (AVPR1A) in rodents has been associated with variation in brain V1aR expression and in social behavior. In humans, the 5' flanking region of AVPR1A contains a tandem duplication of two approximately 350 bp, microsatellite-containing elements located approximately 3.5 kb upstream of the transcription start site. The first block, referred to as DupA, contains a polymorphic (GT)25 microsatellite; the second block, DupB, has a complex (CT)4-(TT)-(CT)8-(GT)24 polymorphic motif, known as RS3. Polymorphisms in RS3 have been associated with variation in sociobehavioral traits in humans, including autism spectrum disorders. Thus, evolution of these regions may have contributed to variation in social behavior in primates. We examined the structure of these regions in six ape, six monkey, and one prosimian species. Both tandem repeat blocks are present upstream of the AVPR1A coding region in five of the ape species we investigated, while monkeys have only one copy of this region. As in humans, the microsatellites within DupA and DupB are polymorphic in many primate species. Furthermore, both single (lacking DupB) and duplicated alleles (containing both DupA and DupB) are present in chimpanzee (Pan troglodytes) populations with allele frequencies of 0.795 and 0.205 for the single and duplicated alleles, respectively, based on the analysis of 47 wild-caught individuals. Finally, a phylogenetic reconstruction suggests two alternate evolutionary histories for this locus. There is no obvious relationship between the presence of the RS3 duplication and social organization in primates. However, polymorphisms identified in some species may be useful in future genetic association studies. In particular, the presence of both single and duplicated alleles in chimpanzees provides a unique opportunity to assess the functional role of this duplication in contributing to variation in social behavior in primates. While our initial studies show no signs of directional selection on this locus in chimps, pharmacological and genetic association studies support a potential role for this region in influencing V1aR expression and social behavior.
Relative ages of lava flows at Alba Patera, Mars
NASA Technical Reports Server (NTRS)
Schneeberger, Dale M.; Pieri, David C.
1987-01-01
Many large lava flows on the flanks of Alba Patera are astonishing in their volume and length. As a suite, these flows suggest tremendously voluminous and sustained eruptions, and provide dimensional boundary conditions typically a factor of 100 larger than terrestrial flows. One of the most striking features associated with Alba Patera is the large, radially oriented lava flows that exhibit a variety of flow morphologies. These include sheet flows, tube fed and tube channel flows, and undifferentiated flows. Three groups of flows were studied; flows on the northwest flank, southeast flank, and the intracaldera region. The lava flows discussed probably were erupted as a group during the same major volcanic episode as suggested by the data presented. Absolute ages are poorly constrained for both the individual flows and shield, due in part to disagreement as to which absolute age curve is representative for Mars. A relative age sequence is implied but lacks precision due to the closeness of the size frequency curves.
Cyclic flank-vent and central-vent eruption patterns
NASA Astrophysics Data System (ADS)
Takada, Akira
Many basaltic and andesitic polygenetic volcanoes have cyclic eruptive activity that alternates between a phase dominated by flank eruptions and a phase dominated by eruptions from a central vent. This paper proposes the use of time-series diagrams of eruption sites on each polygenetic volcano and intrusion distances of dikes to evaluate volcano growth, to qualitatively reconstruct the stress history within the volcano, and to predict the next eruption site. In these diagrams the position of an eruption site is represented by the distance from the center of the volcano and the clockwise azimuth from north. Time-series diagrams of Mauna Loa, Kilauea, Kliuchevskoi, Etna, Sakurajima, Fuji, Izu-Oshima, and Hekla volcanoes indicate that fissure eruption sites of these volcanoes migrated toward the center of the volcano linearly, radially, or spirally with damped oscillation, occasionally forming a hierarchy in convergence-related features. At Krafla, terminations of dikes also migrated toward the center of the volcano with time. Eruption sites of Piton de la Fournaise did not converge but oscillated around the center. After the convergence of eruption sites with time, the central eruption phase is started. The intrusion sequence of dikes is modeled, applying crack interaction theory. Variation in convergence patterns is governed by the regional stress and the magma supply. Under the condition that a balance between regional extension and magma supply is maintained, the central vent convergence time during the flank eruption phase is 1-10 years, whereas the flank vent recurrence time during the central eruption phase is greater than 100 years owing to an inferred decrease in magma supply. Under the condition that magma supply prevails over regional extension, the central vent convergence time increases, whereas the flank vent recurrence time decreases owing to inferred stress relaxation. Earthquakes of M>=6 near a volcano during the flank eruption phase extend the central vent convergence time. Earthquakes during the central eruption phase promote recurrence of flank eruptions. Asymmetric distribution of eruption sites around the flanks of a volcano can be caused by local stress sources such as an adjacent volcano.
Transcriptional activation of Mina by Sp1/3 factors.
Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark
2013-01-01
Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.
Transcriptional Activation of Mina by Sp1/3 Factors
Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark
2013-01-01
Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617
Upadhyay, Sanjay K
2014-05-01
To determine the bioactive conformation required to bind with receptor aIIbb3, the peptide sequence RIPRGDMP from Kistrin was inserted into CDR 1 loop region of REI protein, resulting in REI-RGD34. The activity of REI-RGD34 was observed to increase at higher temperature towards the receptor aIIbb3. It could be justified in either way: the modified complex forces the restricted peptide to adapt bioactive conformation or it unfolds the peptide in a way that opens its binding surface with high affinity for receptor. Here, we model the conformational preference of RGD sequence in RIPRGDMP at 25 and 42 °C using multiple MD simulations. Further, we model the peptide sequence RGD, PRGD and PRGDMP from kistrin to observe the effect of flanking residues on conformational sampling of RGD. The presence of flanking residues around RGD peptide greatly influenced the conformational sampling. A transition from bend to turn conformation was observed for RGD sequence at 42 °C. The turn conformation shows pharmacophoric parameters required to recognize the receptor aIIbb3. Thus, the temperaturedependent activity of RIPRGDMP when inserted into the loop region of REI can be explained by the presence of the turn conformation. This study will help in designing potential antagonist for the receptor aIIbb3.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.
Lo, W Y; Ting, L P
1994-01-01
Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237
Scar-less multi-part DNA assembly design automation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hillson, Nathan J.
The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less
Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi
2018-05-17
Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.
Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R
2004-07-01
The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Molecular epidemiology of infectious laryngotracheitis: a review
USDA-ARS?s Scientific Manuscript database
Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...
PRIMARY STRUCTURE OF THE P450 LANOSTEROL DEMETHYLASE GENE FROM SACCHAROMYCES CEREVISIAE
We have sequenced the structural gene and flanking regions for lanosterol 14 alpha-demethylase (14DM) from Saccharomyces cerevisiae. An open reading frame of 530 codons encodes a 60.7-kDa protein. When this gene is disrupted by integrative transformation, the resulting strain req...
Wang, Li Kai; Zhu, Hui; Shuman, Stewart
2009-03-27
NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria, where they are essential for growth and present attractive targets for antimicrobial drug discovery. LigA has a distinctive modular structure in which a nucleotidyltransferase catalytic domain is flanked by an upstream NMN-binding module and by downstream OB-fold, zinc finger, helix-hairpin-helix, and BRCT domains. Here we conducted a structure-function analysis of the nucleotidyltransferase domain of Escherichia coli LigA, guided by the crystal structure of the LigA-DNA-adenylate intermediate. We tested the effects of 29 alanine and conservative mutations at 15 amino acids on ligase activity in vitro and in vivo. We thereby identified essential functional groups that coordinate the reactive phosphates (Arg(136)), contact the AMP adenine (Lys(290)), engage the phosphodiester backbone flanking the nick (Arg(218), Arg(308), Arg(97) plus Arg(101)), or stabilize the active domain fold (Arg(171)). Finer analysis of the mutational effects revealed step-specific functions for Arg(136), which is essential for the reaction of LigA with NAD(+) to form the covalent ligase-AMP intermediate (step 1) and for the transfer of AMP to the nick 5'-PO(4) to form the DNA-adenylate intermediate (step 2) but is dispensable for phosphodiester formation at a preadenylylated nick (step 3).
Hao, Chenyang; Tang, Saijun; Zhang, Xueyong; Li, Tian
2014-01-01
To better understand the transcriptional regulation of high molecular weight glutenin subunit (HMW-GS) expression, we isolated four Glu-1Bx promoters from six wheat cultivars exhibiting diverse protein expression levels. The activities of the diverse Glu-1Bx promoters were tested and compared with β-glucuronidase (GUS) reporter fusions. Although all the full-length Glu-1Bx promoters showed endosperm-specific activities, the strongest GUS activity was observed with the 1Bx7OE promoter in both transient expression assays and stable transgenic rice lines. A 43 bp insertion in the 1Bx7OE promoter, which is absent in the 1Bx7 promoter, led to enhanced expression. Analysis of promoter deletion constructs confirmed that a 185 bp MITE (miniature inverted-repeat transposable element) in the 1Bx14 promoter had a weak positive effect on Glu-1Bx expression, and a 54 bp deletion in the 1Bx13 promoter reduced endosperm-specific activity. To investigate the effect of the 43 bp insertion in the 1Bx7OE promoter, a functional marker was developed to screen 505 Chinese varieties and 160 European varieties, and only 1Bx7-type varieties harboring the 43 bp insertion in their promoters showed similar overexpression patterns. Hence, the 1Bx7OE promoter should be important tool in crop genetic engineering as well as in molecular assisted breeding. PMID:25133580
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schmidhauser, C. Bissell, M.J.; Myers, C.A.; Casperson, G.F.
1990-12-01
Milk protein regulation involves synergistic action of lactogenic hormones and extracellular matrix (ECM). It is well established that substratum has a dramatic effect on morphology and function of mammary cells. The molecular mechanisms that regulate the ECM- and hormone-dependent gene expression, however, have not been resolved. To address this question, a subpopulation (designated CID 9) of the mouse mammary epithelial cell strain COMMA-2D has been developed in which more than 35% of the cells express {beta}-casein, form alveoli-like structures when plated onto a reconstituted basement membrane, and secrete {beta}-casein undirectionally into a lumen. These cells were stably transfected with amore » series of chloramphenicol acetyltransferase (CAT) fusion genes to study transcriptional regulation of the bovine {beta}-casein gene. The expression of CAT in these lines demonstrated a striking matrix and hormone dependency. This regulation occurered primarily at the transcriptional level and was dependent on the length of the 5{prime} flanking region of the {beta}-casein promotor. Both matrix and hormonal control of transcription occurred within at least the first 1790 base pairs upstream and/or 42 base pairs downstream of the transcriptional initiation site. The ECM effect was independent of glucocorticoid stimulation. However, prolactin was essential and hydrocortisone further increased CAT expression. Endogenous {beta}-casein expression in these lines was similar to that of the parent CID 9 cells. Our data indicate the existence of matrix-dependent elements that regulate transcription.« less
Finding functional features in Saccharomyces genomes by phylogenetic footprinting.
Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark
2003-07-04
The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.
Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.
2015-03-22
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less
Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B
2015-06-01
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.
Rosa, Rafael Diego; Stoco, Patricia Hermes; Barracco, Margherita Anna
2008-11-01
Anti-lipopolysaccharide factors (ALFs) are antimicrobial peptides found in limulids and crustaceans that have a potent and broad range of antimicrobial activity. We report here the identification and molecular characterisation of new sequences encoding for ALFs in the haemocytes of the freshwater prawn Macrobrachium olfersi and also in two Brazilian penaeid species, Farfantepenaeus paulensis and Litopenaeus schmitti. All obtained sequences encoded for highly cationic peptides containing two conserved cysteine residues flanking a putative LPS-binding domain. They exhibited a significant amino acid similarity with crustacean and limulid ALF sequences, especially with those of penaeid shrimps. This is the first identification of ALF in a freshwater prawn.
Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J
1997-04-01
The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.
Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.
Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S
2015-12-01
Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.
Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching
2015-01-01
Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517
Macrolide resistance in Legionella pneumophila: the role of LpeAB efflux pump.
Massip, Clémence; Descours, Ghislaine; Ginevra, Christophe; Doublet, Patricia; Jarraud, Sophie; Gilbert, Christophe
2017-05-01
A previous study on 12 in vitro -selected azithromycin-resistant Legionella pneumophila lineages showed that ribosomal mutations were major macrolide resistance determinants. In addition to these mechanisms that have been well described in many species, mutations upstream of lpeAB operon, homologous to acrAB in Escherichia coli , were identified in two lineages. In this study, we investigated the role of LpeAB and of these mutations in macrolide resistance of L. pneumophila . The role of LpeAB was studied by testing the antibiotic susceptibility of WT, deleted and complemented L. pneumophila Paris strains. Translational fusion experiments using GFP as a reporter were conducted to investigate the consequences of the mutations observed in the upstream sequence of lpeAB operon. We demonstrated the involvement of LpeAB in an efflux pump responsible for a macrolide-specific reduced susceptibility of L. pneumophila Paris strain. Mutations in the upstream sequence of lpeAB operon were associated with an increased protein expression. Increased expression was also observed under sub-inhibitory macrolide concentrations in strains with both mutated and WT promoting regions. LpeAB are components of an efflux pump, which is a macrolide resistance determinant in L. pneumophila Paris strain. Mutations observed in the upstream sequence of lpeAB operon in resistant lineages led to an overexpression of this efflux pump. Sub-inhibitory concentrations of macrolides themselves participated in upregulating this efflux and could constitute a first step in the acquisition of a high macrolide resistance level. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Islam, Md Ekramul; Kikuta, Hiroshi; Inoue, Fumitaka; Kanai, Maiko; Kawakami, Atsushi; Parvin, Mst Shahnaj; Takeda, Hiroyuki; Yamasu, Kyo
2006-12-01
In vertebrate embryos, positioning of the boundary between the midbrain and hindbrain (MHB) and subsequent isthmus formation are dependent upon the interaction between the Otx2 and Gbx genes. In zebrafish, sequential expression of gbx1 and gbx2 in the anterior hindbrain contributes to this process, whereas in mouse embryos, a single Gbx gene (Gbx2) is responsible for MHB development. In the present study, to investigate the regulatory mechanism of gbx2 in the MHB/isthmic region of zebrafish embryos, we cloned the gene and showed that its organization is conserved among different vertebrates. Promoter analyses revealed three enhancers that direct reporter gene expression after the end of epiboly in the anterior-most hindbrain, which is a feature of the zebrafish gbx2 gene. One of the enhancers is located upstream of gbx2 (AMH1), while the other two enhancers are located downstream of gbx2 (AMH2 and AMH3). Detailed analysis of the AMH1 enhancer showed that it directs expression in the rhombomere 1 (r1) region and the dorsal thalamus, as has been shown for gbx2, whereas no expression was induced by the AMH1 enhancer in other embryonic regions in which gbx2 is expressed. The AMH1 enhancer is composed of multiple regulatory subregions that share the same spatial specificity. The most active of the regulatory subregions is a 291-bp region that contains at least two Pax2-binding sites, both of which are necessary for the function of the main component (PB1-A region) of the AMH1 enhancer. In accordance with these results, enhancer activity in the PB1-A region, as well as gbx2 expression in r1, was missing in no isthmus mutant embryos that lacked functional pax2a. In addition, we identified an upstream conserved sequence of 227bp that suppresses the enhancer activity of AMH1. Taken together, these findings suggest that gbx2 expression during the somitogenesis stage in zebrafish is regulated by a complex mechanism involving Pax2 as well as activators and suppressors in the regions flanking the gene.
Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto
2008-04-08
The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.
LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).
Hobson, Neil; Deyholos, Michael K
2013-04-01
Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.
Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8
DOE Office of Scientific and Technical Information (OSTI.GOV)
Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong
2010-02-19
Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less
Molecular characterization of the complete genome of falconid herpesvirus strain S-18
USDA-ARS?s Scientific Manuscript database
Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...
USDA-ARS?s Scientific Manuscript database
Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5' and 3' flanking regions of IRS2 (approx. 14.5 kb), were bidirectionally sequenced for single nucleotide...
USDA-ARS?s Scientific Manuscript database
The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1alpha subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated...
Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.
Ponce, M R; Quesada, V; Micol, J L
1998-05-01
An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.
E74-like factor 2 regulates valosin-containing protein expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Binglin; Tomita, Yasuhiko; Qiu, Ying
2007-05-11
Enhanced expression of valosin-containing protein (VCP) correlates with invasion and metastasis of cancers. To clarify the transcription mechanism of VCP, human and mouse genomic sequence was compared, revealing a 260 bp DNA sequence in the 5'-flanking region of VCP gene to be highly conserved between the two, in which binding motif of E74-like factor 2/new Ets-related factor (ELF2/NERF) was identified. Chromatin immunoprecipitation assay showed binding of ELF2/NERF to the 5'-flanking region of VCP gene. Knock-down of ELF2/NERF by siRNA decreased expression level of VCP. Viability of cells under tumor necrosis factor-alpha treatment significantly reduced in ELF2/NERF-knock-down breast cancer cell line.more » Immunohistochemical analysis on clinical breast cancer specimens showed a correlation of nuclear ELF2/NERF expression with VCP expression and proliferative activity of cells shown by Ki-67 immunohistochemistry. These findings indicate that ELF2/NERF promotes VCP transcription and that ELF2/NERF-VCP pathway might be important for cell survival and proliferation under cytokine stress.« less
Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin
2015-10-01
Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.
Nikaido, Masato; Matsuno, Fumio; Hamilton, Healy; Brownell, Robert L.; Cao, Ying; Ding, Wang; Zuoyan, Zhu; Shedlock, Andrew M.; Fordyce, R. Ewan; Hasegawa, Masami; Okada, Norihiro
2001-01-01
SINE (short interspersed element) insertion analysis elucidates contentious aspects in the phylogeny of toothed whales and dolphins (Odontoceti), especially river dolphins. Here, we characterize 25 informative SINEs inserted into unique genomic loci during evolution of odontocetes to construct a cladogram, and determine a total of 2.8 kb per taxon of the flanking sequences of these SINE loci to estimate divergence times among lineages. We demonstrate that: (i) Odontocetes are monophyletic; (ii) Ganges River dolphins, beaked whales, and ocean dolphins diverged (in this order) after sperm whales; (iii) three other river dolphin taxa, namely the Amazon, La Plata, and Yangtze river dolphins, form a monophyletic group with Yangtze River dolphins being the most basal; and (iv) the rapid radiation of extant cetacean lineages occurred some 28–33 million years B.P., in strong accord with the fossil record. The combination of SINE and flanking sequence analysis suggests a topology and set of divergence times for odontocete relationships, offering alternative explanations for several long-standing problems in cetacean evolution. PMID:11416211
Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine
2007-01-01
Background In Archeae and Bacteria, the repeated elements called CRISPRs for "clustered regularly interspaced short palindromic repeats" are believed to participate in the defence against viruses. Short sequences called spacers are stored in-between repeated elements. In the current model, motifs comprising spacers and repeats may target an invading DNA and lead to its degradation through a proposed mechanism similar to RNA interference. Analysis of intra-species polymorphism shows that new motifs (one spacer and one repeated element) are added in a polarised fashion. Although their principal characteristics have been described, a lot remains to be discovered on the way CRISPRs are created and evolve. As new genome sequences become available it appears necessary to develop automated scanning tools to make available CRISPRs related information and to facilitate additional investigations. Description We have produced a program, CRISPRFinder, which identifies CRISPRs and extracts the repeated and unique sequences. Using this software, a database is constructed which is automatically updated monthly from newly released genome sequences. Additional tools were created to allow the alignment of flanking sequences in search for similarities between different loci and to build dictionaries of unique sequences. To date, almost six hundred CRISPRs have been identified in 475 published genomes. Two Archeae out of thirty-seven and about half of Bacteria do not possess a CRISPR. Fine analysis of repeated sequences strongly supports the current view that new motifs are added at one end of the CRISPR adjacent to the putative promoter. Conclusion It is hoped that availability of a public database, regularly updated and which can be queried on the web will help in further dissecting and understanding CRISPR structure and flanking sequences evolution. Subsequent analyses of the intra-species CRISPR polymorphism will be facilitated by CRISPRFinder and the dictionary creator. CRISPRdb is accessible at PMID:17521438
Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R
2005-08-01
Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.
Pesicek, Jeremy; Thurber, Clifford H.; DeShon, Heather R.; Prejean, Stephanie G.; Zhang, Haijiang
2008-01-01
Waveform cross-correlation with bispectrum verification is combined with double-difference tomography to increase the precision of earthquake locations and constrain regional 3D P-wave velocity heterogeneity at Great Sitkin volcano, Alaska. From 1999 through 2005, the Alaska Volcano Observatory (AVO) recorded ∼1700 earthquakes in the vicinity of Great Sitkin, including two ML 4.3 earthquakes that are among the largest events in the AVO catalog. The majority of earthquakes occurred during 2002 and formed two temporally and spatially separate event sequences. The first sequence began on 17 March 2002 and was centered ∼20 km west of the volcano. The second sequence occurred on the southeast flank of Great Sitkin and began 28 May 2002. It was preceded by two episodes of volcanic tremor. Earthquake relocations of this activity on the southeast flank define a vertical planar feature oriented radially from the summit and in the direction of the assumed regional maximum compressive stress due to convergence along the Alaska subduction zone. This swarm may have been caused or accompanied by the emplacement of a dike. Relocations of the mainshock–aftershock sequence occurring west of Great Sitkin are consistent with rupture on a strike-slip fault. Tomographic images support the presence of a vertically dipping fault striking parallel to the direction of convergence in this region. The remaining catalog hypocenters relocate along discrete features beneath the volcano summit; here, low P-wave velocities possibly indicate the presence of magma beneath the volcano.
Nakamura, Masayuki; Kuwahara, Hideto; Onoyama, Keisuke; Iwai, Hisashi
2012-08-01
Agrobacterium tumefaciens-mediated transformation (AtMT) has become a common technique for DNA transformation of yeast and filamentous fungi. In this study, we first established a protocol of AtMT for the phytopathogenic fungus Colletotrichum sansevieriae. Binary T-DNA vector containing the hygromycin B phosphotransferase gene controlled by the Aspergillus nidulans gpdA promoter and the trpC terminator was constructed with pCAMBIA0380 and used with three different strains LBA4404, GV3101, and GV2260 of A. tumefaciens. Transformants were most effectively obtained when GV2260 and C. sansevieriae Sa-1-2 were co-cultivated; there were about 320 transformants per 10(6) spores. When 1,048 transformants were inoculated on Sansevieria trifasciata, three transformants were found to have completely lost their pathogenicity and two transformants displayed reduced pathogenicity. All of the five transformants had a single copy of T-DNA in their genomes. The three pathogenicity-deficient transformants were subjected to thermal asymmetric interlaced polymerase chain reaction and the reaction allowed us to amplify the sequences flanking the left and/or right borders. The flanking sequences of the two transformants, M154 and M875, showed no homology to any sequences in databases, but the sequences of M678 contained motifs of alpha-1,3-glucan synthase, suggesting that the gene might contribute to the pathogenicity of C. sansevieriae. This study describes a useful method for investigating pathogenicity genes in C. sansevieriae.
Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection
NASA Technical Reports Server (NTRS)
Harada, Kazuo; Orgel, Leslie E.
1993-01-01
We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.
A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon
Carlo, Troy; Sierra, Rebecca; Berget, Susan M.
2000-01-01
Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741
Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz
2013-01-01
Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.
Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N
1991-11-20
A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.
Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon
2014-11-01
The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.
Coexistence of Two blaNDM-5 Genes on an IncF Plasmid as Revealed by Nanopore Sequencing.
Feng, Yu; Liu, Lu; McNally, Alan; Zong, Zhiyong
2018-05-01
In a carbapenem-resistant Escherichia coli clinical isolate of sequence type 167, two copies of bla NDM-5 were found on a 144,225-bp IncF self-transmissible plasmid of the F36:A4:B - type. Both bla NDM-5 genes were located in 11,065-bp regions flanked by two copies of IS 26 The two regions were identical in sequence but were present at different locations on the plasmid, suggesting a duplication of the same region. This study highlights the complex genetic contexts of bla NDM-5 . Copyright © 2018 American Society for Microbiology.
Isolation and characterization of major histocompatibility complex class II B genes in cranes.
Kohyama, Tetsuo I; Akiyama, Takuya; Nishida, Chizuko; Takami, Kazutoshi; Onuma, Manabu; Momose, Kunikazu; Masuda, Ryuichi
2015-11-01
In this study, we isolated and characterized the major histocompatibility complex (MHC) class II B genes in cranes. Genomic sequences spanning exons 1 to 4 were amplified and determined in 13 crane species and three other species closely related to cranes. In all, 55 unique sequences were identified, and at least two polymorphic MHC class II B loci were found in most species. An analysis of sequence polymorphisms showed the signature of positive selection and recombination. A phylogenetic reconstruction based on exon 2 sequences indicated that trans-species polymorphism has persisted for at least 10 million years, whereas phylogenetic analyses of the sequences flanking exon 2 revealed a pattern of concerted evolution. These results suggest that both balancing selection and recombination play important roles in the crane MHC evolution.
Length and sequence variability in mitochondrial control region of the milkfish, Chanos chanos.
Ravago, Rachel G; Monje, Virginia D; Juinio-Meñez, Marie Antonette
2002-01-01
Extensive length variability was observed in the mitochondrial control region of the milkfish, Chanos chanos. The nucleotide sequence of the control region and flanking regions was determined. Length variability and heteroplasmy was due to the presence of varying numbers of a 41-bp tandemly repeated sequence and a 48-bp insertion/deletion (indel). The structure and organization of the milkfish control region is similar to that of other teleost fish and vertebrates. However, extensive variation in the copy number of tandem repeats (4-20 copies) and the presence of a relatively large (48-bp) indel, are apparently uncommon in teleost fish control region sequences reported to date. High sequence variability of control region peripheral domains indicates the potential utility of selected regions as markers for population-level studies.
Molecular basis of length polymorphism in the human zeta-globin gene complex.
Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J
1983-01-01
The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667
Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao
2011-12-28
For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.
AmpliVar: mutation detection in high-throughput sequence from amplicon-based libraries.
Hsu, Arthur L; Kondrashova, Olga; Lunke, Sebastian; Love, Clare J; Meldrum, Cliff; Marquis-Nicholson, Renate; Corboy, Greg; Pham, Kym; Wakefield, Matthew; Waring, Paul M; Taylor, Graham R
2015-04-01
Conventional means of identifying variants in high-throughput sequencing align each read against a reference sequence, and then call variants at each position. Here, we demonstrate an orthogonal means of identifying sequence variation by grouping the reads as amplicons prior to any alignment. We used AmpliVar to make key-value hashes of sequence reads and group reads as individual amplicons using a table of flanking sequences. Low-abundance reads were removed according to a selectable threshold, and reads above this threshold were aligned as groups, rather than as individual reads, permitting the use of sensitive alignment tools. We show that this approach is more sensitive, more specific, and more computationally efficient than comparable methods for the analysis of amplicon-based high-throughput sequencing data. The method can be extended to enable alignment-free confirmation of variants seen in hybridization capture target-enrichment data. © 2015 WILEY PERIODICALS, INC.
2014-01-01
Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199
hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0
Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej
2015-01-01
Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581
Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce
2004-07-01
The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be restricted to a subpopulation of OT neurons.
Redkiewicz, Patrycja; Stachyra, Anna; Sawicka, Róz∙a; Bocian, Katarzyna; Góra-Sochacka, Anna; Kosson, Piotr; Sirko, Agnieszka
2017-01-01
Influenza is one of the most important illnesses in the modern world, causing great public health losses each year due to the lack of medication and broadly protective, long-lasting vaccines. The development of highly immunogenic and safe vaccines is currently one of the major problems encountered in efficient influenza prevention. DNA vaccines represent a novel and powerful alternative to the conventional vaccine approaches. To improve the efficacy of the DNA vaccine against influenza H5N1, we inserted three repeated kappa B (κB) motifs, separated by a 5-bp nucleotide spacer, upstream of the cytomegalovirus promoter and downstream of the SV40 late polyadenylation signal. The κB motif is a specific DNA element (10pb-long) recognized by one of the most important transcription factors NFκB. NFκB is present in almost all animal cell types and upon cell stimulation under a variety of pathogenic conditions. NFκB is released from IκB and translocates to the nucleus and binds to κB sites, thereby leading to enhanced transcription and expression of downstream genes. We tested the variants of DNA vaccine with κB sites flanking the antigen expression cassette and without such sites in two animal models: chickens (broilers and layers) and mice (BALB/c). In chickens, the variant with κB sites stimulated stronger humoral response against the target antigen. In mice, the differences in humoral response were less apparent. Instead, it was possible to spot several gene expression differences in the spleens isolated from mice immunized with both variants. The results of our study indicate that modification of the sequence outside of the sequence encoding the antigen might enhance the immune response to the target but understanding the mechanisms responsible for this process requires further analysis. PMID:28883819
Tarazona-Santos, Eduardo; Fabbri, Cristina; Yeager, Meredith; Magalhaes, Wagner C; Burdett, Laurie; Crenshaw, Andrew; Pettener, Davide; Chanock, Stephen J
2010-03-23
Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs). Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13) is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American), all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp), while the C-terminal region downstream of intron 6 ( approximately 2600 bp) harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1) episodes of natural selection (likely a selective sweep) predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2) the target of natural selection may not be in the SLC2A4 coding sequence. We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.
Sense transcription through the S region is essential for immunoglobulin class switch recombination
Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine
2011-01-01
Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751
Graveley, Brenton R.
2008-01-01
Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213
Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David
2001-01-01
Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681
León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.
2013-01-01
Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665
Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A
1994-12-01
We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.
Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M
1993-01-01
Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916
Reducing DNA context dependence in bacterial promoters
Carr, Swati B.; Densmore, Douglas M.
2017-01-01
Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998
Chi, Po-Shen; Wong, Hin-Chung
2017-10-16
Vibrio parahaemolyticus is a halophilic foodborne pathogenic bacterium that causes gastroenteritis; it has become an issue of global concern since the emergence and spread of pandemic O3:K6 strains. This study evaluated the role of Vibrio pathogenicity island (VPaI)-associated fragments in the genetic variation and grouping of this pathogen. Distribution of some VPaI fragments and flanking fragments (VPaI-1, VPaI-4, VPaI-5, VPaI-6 and VPaI-7) was determined in a total of 53 V. parahaemolyticus isolates from environmental and clinical sources in Taiwan, and supported by the sequences of seven fragments of VPaI-4 and its flanking fragment VP2145. As determined from the distribution of these VPaI-associated fragments, the clinical pandemic isolates were closely related in a single cluster; the clinical nonpandemic isolates were grouped into several clusters, while the environmental isolates were comparatively highly diversified. The profiles of virulence-associated genes of environmental pathogenic isolates varied, and were closer to those of clinical nonpandemic isolates than those of pandemic isolates. Isolates with atypical profiles of the VPaI-associated fragments and virulence-associated genes were identified. Sequences of VP2145 exhibited a close phylogenetic relationship among these local isolates, which were distinct from most V. parahaemolyticus strains from other geographic regions. This investigation demonstrated the application of VPaI-associated fragments in studying the genetic variation and clustering of V. parahaemolyticus isolates from different sources. Copyright © 2017. Published by Elsevier B.V.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Dhanda, Sandeep Kumar; Grifoni, Alba; Pham, John; Vaughan, Kerrie; Sidney, John; Peters, Bjoern; Sette, Alessandro
2018-01-01
Unwanted immune responses against protein therapeutics can reduce efficacy or lead to adverse reactions. T-cell responses are key in the development of such responses, and are directed against immunodominant regions within the protein sequence, often associated with binding to several allelic variants of HLA class II molecules (promiscuous binders). Herein, we report a novel computational strategy to predict 'de-immunized' peptides, based on previous studies of erythropoietin protein immunogenicity. This algorithm (or method) first predicts promiscuous binding regions within the target protein sequence and then identifies residue substitutions predicted to reduce HLA binding. Further, this method anticipates the effect of any given substitution on flanking peptides, thereby circumventing the creation of nascent HLA-binding regions. As a proof-of-principle, the algorithm was applied to Vatreptacog α, an engineered Factor VII molecule associated with unintended immunogenicity. The algorithm correctly predicted the two immunogenic peptides containing the engineered residues. As a further validation, we selected and evaluated the immunogenicity of seven substitutions predicted to simultaneously reduce HLA binding for both peptides, five control substitutions with no predicted reduction in HLA-binding capacity, and additional flanking region controls. In vitro immunogenicity was detected in 21·4% of the cultures of peptides predicted to have reduced HLA binding and 11·4% of the flanking regions, compared with 46% for the cultures of the peptides predicted to be immunogenic. This method has been implemented as an interactive application, freely available online at http://tools.iedb.org/deimmunization/. © 2017 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fracasso, M.A.; Dutton, S.P.; Finley, R.J.
The Travis Peak formation (lower Cretaceous) in the eastern East Texas basin is a fluvio-deltaic depositional system divided into large-scale facies packages: a middle sandstone-rich fluvial and delta-plain sequence that is gradationally overlain and underlain by a marine-influenced delta-fringe zone with a higher mudstone content. Domes and structural terraces on the west flank of the Sabine Uplift influenced deposition of Travis Peak sediments, and most Travis Peak gas production in this area is from thin sandstones (<25 ft(<7.6 m) thick) in the upper delta-fringe facies. The trapping mechanism is stratigraphic pinch-out of sandstones or porosity zones within sandstone, or both,more » on the flanks of structures. Detailed mapping of producing sandstone sequences in the uppermost upper delta-fringe on the western flank of the Bethany structure has delineated fluvial channelways, distributary or tidal channels, and barrier of distributary-mouth bars. Most Travis Peak gas production in the Bethany West area is from the bases of channel sandstones in a marine-influenced facies belt. Travis Peak sandstones in the eastern East Texas basin have undergone a complex series of diagenetic modifications. Precipitation of authigenic quartz, ankerite, dolomite, illite, and chlorite and the introduction of reservoir bitumen were the most important causes of occlusion of primary porosity and reduction of permeability. Permeability decreases with depth in the Travis Peak, which suggests that the diagenetic processes that caused extensive cementation and resultant low permeability throughout most of the formation operated less completely on sediments deposited near the top of the succession.« less
NASA Astrophysics Data System (ADS)
Rud'ko, S. V.; Petrov, P. Yu.; Kuznetsov, A. B.; Shatsillo, A. V.; Petrov, O. L.
2017-12-01
New data were obtained on δ13Ccarb and δ18O variations in the sequence of deposits of the Dal'nyaya Taiga series at the western and eastern flanks of the Ura anticline. The summary δ13C curve was plotted in view of the correlation of sequence-stratigraphic data of the basin analysis. A series of positive anomalies was found within the succession. Alternatives for global chemostratigraphic correlation of the Dal'nyaya Taiga series of the Ura uplift were considered.
Compositional correlations in the chicken genome.
Musto, H; Romero, H; Zavala, A; Bernardi, G
1999-09-01
This paper analyses the compositional correlations that hold in the chicken genome. Significant linear correlations were found among the regions studied-coding sequences (and their first, second, and third codon positions), flanking regions (5' and 3'), and introns-as is the case in the human genome. We found that these compositional correlations are not limited to global GC levels but even extend to individual bases. Furthermore, an analysis of 1037 coding sequences has confirmed a correlation among GC(3), GC(2), and GC(1). The implications of these results are discussed.
John F. Walker; Orson K. Miller; Jonathan L. Horton
2005-01-01
Diversity of ectotrophic mycobionts on outplanted seedlings of two oak species (Quercus rubra and Quercus prinus) was estimated at two sites in mature mixed forests in the southern Appalachian Mountains by sequencing nuclear 5.8S rRNA genes and the flanking internal transcribed spacer regions I and II (ITS). The...
Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research
Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in
PRIMARY STRUCTURE OF THE CYTOCHROME P450 LANOSTEROL 14A-DEMETHYLASE GENE FROM CANDIDA TROPICALIS
We report the nucleotide sequence of the gene and flanking DNA for the cytochrome P450 lanosterol 14 alpha-demethylase (14DM) from the yeast Candida tropicalis ATCC750. An open reading frame (ORF) of 528 codons encoding a 60.9-kD protein is identified. This ORF includes a charact...
Orthologs in Arabidopsis thaliana of the Hsp70 interacting protein Hip
Webb, Mary Alice; Cavaletto, John M.; Klanrit, Preekamol; Thompson, Gary A.
2001-01-01
The Hsp70-interacting protein Hip binds to the adenosine triphosphatase domain of Hsp70, stabilizing it in the adenosine 5′-diphosphate–ligated conformation and promoting binding of target polypeptides. In mammalian cells, Hip is a component of the cytoplasmic chaperone heterocomplex that regulates signal transduction via interaction with hormone receptors and protein kinases. Analysis of the complete genome sequence of the model flowering plant Arabidopsis thaliana revealed 2 genes encoding Hip orthologs. The deduced sequence of AtHip-1 consists of 441 amino acid residues and is 42% identical to human Hip. AtHip-1 contains the same functional domains characterized in mammalian Hip, including an N-terminal dimerization domain, an acidic domain, 3 tetratricopeptide repeats flanked by a highly charged region, a series of degenerate GGMP repeats, and a C-terminal region similar to the Sti1/Hop/p60 protein. The deduced amino acid sequence of AtHip-2 consists of 380 amino acid residues. AtHip-2 consists of a truncated Hip-like domain that is 46% identical to human Hip, followed by a C-terminal domain related to thioredoxin. AtHip-2 is 63% identical to another Hip-thioredoxin protein recently identified in Vitis labrusca (grape). The truncated Hip domain in AtHip-2 includes the amino terminus, the acidic domain, and tetratricopeptide repeats with flanking charged region. Analyses of expressed sequence tag databases indicate that both AtHip-1 and AtHip-2 are expressed in A thaliana and that orthologs of Hip are also expressed widely in other plants. The similarity between AtHip-1 and its mammalian orthologs is consistent with a similar role in plant cells. The sequence of AtHip-2 suggests the possibility of additional unique chaperone functions. PMID:11599566
Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine
2014-12-12
Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.
Breakpoint structure of the Anopheles gambiae 2Rb chromosomal inversion.
Lobo, Neil F; Sangaré, Djibril M; Regier, Allison A; Reidenbach, Kyanne R; Bretz, David A; Sharakhova, Maria V; Emrich, Scott J; Traore, Sekou F; Costantini, Carlo; Besansky, Nora J; Collins, Frank H
2010-10-25
Alternative arrangements of chromosome 2 inversions in Anopheles gambiae are important sources of population structure, and are associated with adaptation to environmental heterogeneity. The forces responsible for their origin and maintenance are incompletely understood. Molecular characterization of inversion breakpoints provides insight into how they arose, and provides the basis for development of molecular karyotyping methods useful in future studies. Sequence comparison of regions near the cytological breakpoints of 2Rb allowed the molecular delineation of breakpoint boundaries. Comparisons were made between the standard 2R+b arrangement in the An. gambiae PEST reference genome and the inverted 2Rb arrangements in the An. gambiae M and S genome assemblies. Sequence differences between alternative 2Rb arrangements were exploited in the design of a PCR diagnostic assay, which was evaluated against the known chromosomal banding pattern of laboratory colonies and field-collected samples from Mali and Cameroon. The breakpoints of the 7.55 Mb 2Rb inversion are flanked by extensive runs of the same short (72 bp) tandemly organized sequence, which was likely responsible for chromosomal breakage and rearrangement. Application of the molecular diagnostic assay suggested that 2Rb has a single common origin in An. gambiae and its sibling species, Anopheles arabiensis, and also that the standard arrangement (2R+b) may have arisen twice through breakpoint reuse. The molecular diagnostic was reliable when applied to laboratory colonies, but its accuracy was lower in natural populations. The complex repetitive sequence flanking the 2Rb breakpoint region may be prone to structural and sequence-level instability. The 2Rb molecular diagnostic has immediate application in studies based on laboratory colonies, but its usefulness in natural populations awaits development of complementary molecular tools.
Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio
2017-03-01
Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.
Sorting Out the Ocean Crust Deep Biosphere with Single Cell Omics Approaches
NASA Astrophysics Data System (ADS)
Orcutt, B.; D'Angelo, T.; Goordial, J.; Jones, R. M.; Carr, S. A.
2017-12-01
Although oceanic crust comprises a large habitat for subsurface life, the structure, function, and dynamics of microbial communities living on rocks in the subsurface are poorly understood. Single cell level approaches can overcome limitations of low biomass in subsurface systems. Coupled with incubation experiments with amino acid orthologs, single cell level sorting can reveal high resolution information about identity, functional potential, and growth. Leveraging collaboration with the Single Cell Genomics Center and the Facility for Aquatic Cytometry at Bigelow Laboratory, we present recent results from single cell level sorting and -omics sequencing from several crustal environments, including the Atlantis Massif and the Juan de Fuca Ridge flank. We will also highlight new experiments conducted with samples recovered from the flank of the Mid-Atlantic Ridge.
Shukunami, Chisa; Takimoto, Aki; Nishizaki, Yuriko; Yoshimoto, Yuki; Tanaka, Seima; Miura, Shigenori; Watanabe, Hitomi; Sakuma, Tetsushi; Yamamoto, Takashi; Kondoh, Gen; Hiraki, Yuji
2018-02-16
Tenomodulin (Tnmd) is a type II transmembrane glycoprotein predominantly expressed in tendons and ligaments. We found that scleraxis (Scx), a member of the Twist-family of basic helix-loop-helix transcription factors, is a transcriptional activator of Tnmd expression in tenocytes. During embryonic development, Scx expression preceded that of Tnmd. Tnmd expression was nearly absent in tendons and ligaments of Scx-deficient mice generated by transcription activator-like effector nucleases-mediated gene disruption. Tnmd mRNA levels were dramatically decreased during serial passages of rat tenocytes. Scx silencing by small interfering RNA significantly suppressed endogenous Tnmd mRNA levels in tenocytes. Mouse Tnmd contains five E-box sites in the ~1-kb 5'-flanking region. A 174-base pair genomic fragment containing a TATA box drives transcription in tenocytes. Enhancer activity was increased in the upstream region (-1030 to -295) of Tnmd in tenocytes, but not in NIH3T3 and C3H10T1/2 cells. Preferential binding of both Scx and Twist1 as a heterodimer with E12 or E47 to CAGATG or CATCTG and transactivation of the 5'-flanking region were confirmed by electrophoresis mobility shift and dual luciferase assays, respectively. Scx directly transactivates Tnmd via these E-boxes to positively regulate tenocyte differentiation and maturation.
Insertion and deletion mutagenesis of the human cytomegalovirus genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spaete, R.R.; Mocarski, E.S.
1987-10-01
Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less
SSR allelic variation in almond (Prunus dulcis Mill.).
Xie, Hua; Sui, Yi; Chang, Feng-Qi; Xu, Yong; Ma, Rong-Cai
2006-01-01
Sixteen SSR markers including eight EST-SSR and eight genomic SSRs were used for genetic diversity analysis of 23 Chinese and 15 international almond cultivars. EST- and genomic SSR markers previously reported in species of Prunus, mainly peach, proved to be useful for almond genetic analysis. DNA sequences of 117 alleles of six of the 16 SSR loci were analysed to reveal sequence variation among the 38 almond accessions. For the four SSR loci with AG/CT repeats, no insertions or deletions were observed in the flanking regions of the 98 alleles sequenced. Allelic size variation of these loci resulted exclusively from differences in the structures of repeat motifs, which involved interruptions or occurrences of new motif repeats in addition to varying number of AG/CT repeats. Some alleles had a high number of uninterrupted repeat motifs, indicating that SSR mutational patterns differ among alleles at a given SSR locus within the almond species. Allelic homoplasy was observed in the SSR loci because of base substitutions, interruptions or compound repeat motifs. Substitutions in the repeat regions were found at two SSR loci, suggesting that point mutations operate on SSRs and hinder the further SSR expansion by introducing repeat interruptions to stabilize SSR loci. Furthermore, it was shown that some potential point mutations in the flanking regions are linked with new SSR repeat motif variation in almond and peach.
Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert
2009-07-01
Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.
Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion.
Abrão, M G; Leite, M V; Carvalho, L R; Billerbeck, A E C; Nishi, M Y; Barbosa, A S; Martin, R M; Arnhold, I J P; Mendonca, B B
2006-09-01
PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. Pituitary function and imaging assessment and molecular analysis of PROP1. Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.
Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T
2014-10-01
A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.
Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto
2008-01-01
The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377
Nafissi, Maryam; Chau, Jeannette; Xu, Jimin
2012-01-01
Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479
Ba Abdullah, Mohammed M; Palermo, Richard D; Palser, Anne L; Grayson, Nicholas E; Kellam, Paul; Correia, Samantha; Szymula, Agnieszka; White, Robert E
2017-12-01
Epstein-Barr virus (EBV) is a ubiquitous pathogen of humans that can cause several types of lymphoma and carcinoma. Like other herpesviruses, EBV has diversified through both coevolution with its host and genetic exchange between virus strains. Sequence analysis of the EBV genome is unusually challenging because of the large number and lengths of repeat regions within the virus. Here we describe the sequence assembly and analysis of the large internal repeat 1 of EBV (IR1; also known as the BamW repeats) for more than 70 strains. The diversity of the latency protein EBV nuclear antigen leader protein (EBNA-LP) resides predominantly within the exons downstream of IR1. The integrity of the putative BWRF1 open reading frame (ORF) is retained in over 80% of strains, and deletions truncating IR1 always spare BWRF1. Conserved regions include the IR1 latency promoter (Wp) and one zone upstream of and two within BWRF1. IR1 is heterogeneous in 70% of strains, and this heterogeneity arises from sequence exchange between strains as well as from spontaneous mutation, with interstrain recombination being more common in tumor-derived viruses. This genetic exchange often incorporates regions of <1 kb, and allelic gene conversion changes the frequency of small regions within the repeat but not close to the flanks. These observations suggest that IR1-and, by extension, EBV-diversifies through both recombination and breakpoint repair, while concerted evolution of IR1 is driven by gene conversion of small regions. Finally, the prototype EBV strain B95-8 contains four nonconsensus variants within a single IR1 repeat unit, including a stop codon in the EBNA-LP gene. Repairing IR1 improves EBNA-LP levels and the quality of transformation by the B95-8 bacterial artificial chromosome (BAC). IMPORTANCE Epstein-Barr virus (EBV) infects the majority of the world population but causes illness in only a small minority of people. Nevertheless, over 1% of cancers worldwide are attributable to EBV. Recent sequencing projects investigating virus diversity to see if different strains have different disease impacts have excluded regions of repeating sequence, as they are more technically challenging. Here we analyze the sequence of the largest repeat in EBV (IR1). We first characterized the variations in protein sequences encoded across IR1. In studying variations within the repeat of each strain, we identified a mutation in the main laboratory strain of EBV that impairs virus function, and we suggest that tumor-associated viruses may be more likely to contain DNA mixed from two strains. The patterns of this mixing suggest that sequences can spread between strains (and also within the repeat) by copying sequence from another strain (or repeat unit) to repair DNA damage. Copyright © 2017 Ba abdullah et al.
Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron
2013-06-21
Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.
Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.
Gilmartin, G M; Fleming, E S; Oetjen, J
1992-01-01
The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica
Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.
2006-01-01
The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.
Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul
2012-11-20
Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies.
Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pennacchio, L.A.
1994-05-06
We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina
2018-01-01
Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs from environmental hotspots such as discharge sites of pharmaceutical effluents. PMID:29387045
Zhang, Tiejun; Yu, Long-Xi; Zheng, Ping; Li, Yajun; Rivera, Martha; Main, Dorrie; Greene, Stephanie L
2015-01-01
Drought resistance is an important breeding target for enhancing alfalfa productivity in arid and semi-arid regions. Identification of genes involved in drought tolerance will facilitate breeding for improving drought resistance and water use efficiency in alfalfa. Our objective was to use a diversity panel of alfalfa accessions comprised of 198 cultivars and landraces to identify genes involved in drought tolerance. The panel was selected from the USDA-ARS National Plant Germplasm System alfalfa collection and genotyped using genotyping by sequencing. A greenhouse procedure was used for phenotyping two important traits associated with drought tolerance: drought resistance index (DRI) and relative leaf water content (RWC). Marker-trait association identified nineteen and fifteen loci associated with DRI and RWC, respectively. Alignments of target sequences flanking to the resistance loci against the reference genome of M. truncatula revealed multiple chromosomal locations. Markers associated with DRI are located on all chromosomes while markers associated with RWC are located on chromosomes 1, 2, 3, 4, 5, 6 and 7. Co-localizations of significant markers between DRI and RWC were found on chromosomes 3, 5 and 7. Most loci associated with DRI in this work overlap with the reported QTLs associated with biomass under drought in alfalfa. Additional significant markers were targeted to several contigs with unknown chromosomal locations. BLAST search using their flanking sequences revealed homology to several annotated genes with functions in stress tolerance. With further validation, these markers may be used for marker-assisted breeding new alfalfa varieties with drought resistance and enhanced water use efficiency.
Namouchi, Amine; Mardassi, Helmi
2006-11-01
Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.
Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V
2003-12-01
This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.
Borchert, S; Stachelhaus, T; Marahiel, M A
1994-01-01
The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553
VIZARD: analysis of Affymetrix Arabidopsis GeneChip data
NASA Technical Reports Server (NTRS)
Moseyko, Nick; Feldman, Lewis J.
2002-01-01
SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at http://www.anm.f2s.com/research/vizard/ CONTACT: moseyko@uclink4.berkeley.edu.
Analysis of C. elegans VIG-1 expression.
Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong
2008-12-31
Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.
Berends Sexton, T; Jones, J T; Mullet, J E
1990-05-01
A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.
Haut, Donald D.; Pintel, D. J.
1998-01-01
Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034
NASA Astrophysics Data System (ADS)
Gasmi, S.; Ferval, M.; Pelissier, C.; D'Amico, F.; Maris, T.; Tackx, M.; Legal, L.
2014-05-01
As an estuary being restored, the Scheldt (Belgium/The Netherlands) offers an interesting setting to study the response of organisms and ecosystems to changing conditions. This study specifically deals with this with regard to the spatio-temporal distribution and possible genetic differentiation among the species complex Eurytemora affinis (copepoda, calanoida). Until the 1990s, E. affinis typically occurred downstream the Scheldt estuary (Belgium/The Netherlands). In parallel to water quality improvement, E.affinis has recently also occurred upstream the estuary and in some of the tributaries. This paper aims to assess the origin of the copepod sibling species complex E. affinis occurring upstream the Scheldt estuary through genetic characterization. Using the Inter Simple Sequence Repeat (ISSR) technique, we explored genetic pools of the E. affinis complex in three Scheldt localities (downstream, middle-estuary and upstream) and two of its tributaries. Four ISSR primers produced 75 polymorphic loci. Bayesian and hierarchical analysis revealed different but close genetic entities in both down and upstream localities. The middle-estuary individuals were genetically a composite mix of downstream and upstream populations (84% from downstream and 16% from upstream). A distinctive separation of the tributaries and the main Scheldt stream populations suggests that two fully independent genetic pools are present. It is of note that the tributaries showed a lack of genetic subdivision, that upstream and downstream E. affinis populations are closely related, and that the downstream population is most likely at the origin of the upstream one, which implies the necessity to guarantee sufficient oxygen concentration levels throughout the estuarine continuum to guarantee the presence of this species upstream. The results of the ISSR technique are discussed in comparison with genetic studies on E. affinis using COI barcoding.
Mechanism of estrogen activation of c-myc oncogene expression.
Dubik, D; Shiu, R P
1992-08-01
The estrogen receptor complex is a known trans-acting factor that regulates transcription of specific genes through an interaction with a specific estrogen-responsive cis-acting element (ERE). In previous studies we have shown that in estrogen-responsive human breast cancer cells estrogen rapidly activates c-myc expression. This activated expression occurs through enhanced transcription and does not require the synthesis of new protein intermediates; therefore, an ERE is present in the human c-myc gene regulatory region. To localize the ERE, constructs containing varying lengths of the c-myc 5'-flanking region ranging from -2327 to +25 (relative to the P1 promoter) placed adjacent to the chloramphenicol acetyl transferase reporter gene (CAT) were prepared. They were used in transient transfection studies in MCF-7 and HeLa cells co-transfected with an estrogen receptor expression vector. These studies reveal that all constructs containing the P2 promoter region exhibited estrogen-regulated CAT expression and that a 116-bp region upstream and encompassing the P2 TATA box is necessary for this activity. Analysis of this 116-bp region failed to identify a cis-acting element with sequences resembling the consensus ERE; however, co-transfection studies with mutant estrogen receptor expression vectors showed that the DNA-binding domain of the receptor is essential for estrogen-regulated CAT gene expression. We have also observed that anti-estrogen receptor complexes can weakly trans-activate from this 116-bp region but fail to do so from the ERE-containing ApoVLDLII-CAT construct. To explain these results we propose a new mechanism of estrogen trans-activation in the c-myc gene promoter.
The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster
Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.
1993-01-01
A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264
Odom, Obed W; Baek, Kwang-Hyun; Dani, Radhika N; Herrin, David L
2008-03-01
Certain group I introns insert into intronless DNA via an endonuclease that creates a double-strand break (DSB). There are two models for intron homing in phage: synthesis-dependent strand annealing (SDSA) and double-strand break repair (DSBR). The Cr.psbA4 intron homes efficiently from a plasmid into the chloroplast psbA gene in Chlamydomonas, but little is known about the mechanism. Analysis of co-transformants selected using a spectinomycin-resistant 16S gene (16S(spec)) provided evidence for both pathways. We also examined the consequences of the donor DNA having only one-sided or no homology with the psbA gene. When there was no homology with the donor DNA, deletions of up to 5 kb involving direct repeats that flank the psbA gene were obtained. Remarkably, repeats as short as 15 bp were used for this repair, which is consistent with the single-strand annealing (SSA) pathway. When the donor had one-sided homology, the DSB in most co-transformants was repaired using two DNAs, the donor and the 16S(spec) plasmid, which, coincidentally, contained a region that is repeated upstream of psbA. DSB repair using two separate DNAs provides further evidence for the SDSA pathway. These data show that the chloroplast can repair a DSB using short dispersed repeats located proximally, distally, or even on separate molecules relative to the DSB. They also provide a rationale for the extensive repertoire of repeated sequences in this genome.
Billaut-Laden, Ingrid; Allorge, Delphine; Crunelle-Thibaut, Aurélie; Rat, Emmanuel; Cauffiez, Christelle; Chevalier, Dany; Houdret, Nicole; Lo-Guidice, Jean-Marc; Broly, Franck
2006-08-01
Rhodanese or thiosulfate sulfurtransferase (TST) is a mitochondrial matrix enzyme that plays roles in cyanide detoxification, the formation of iron-sulfur proteins and the modification of sulfur-containing enzymes. Transsulfuration reaction catalyzed by TST is also involved in H(2)S detoxification. To date, no polymorphism of the human TST gene had been reported. We developed a screening strategy based on a PCR-SSCP method to search for mutations in the 3 exons of TST and their proximal flanking regions. This strategy has been applied to DNA samples from 50 unrelated French individuals of Caucasian origin. Eleven polymorphisms consisting in seven nucleotide substitutions in non-coding regions, two silent mutations and two missense mutations were characterized. The functional consequences of the identified mutations were assessed in vivo by measurement of erythrocyte TST activity and/or in vitro using heterologous expression in Saccharomyces cerevisiae or transient transfection assay in HT29 and Caco-2 cell lines. The P(285)A variant appears to encode a protein with a 50% decrease of in vitro intrinsic clearance compared to the wild-type enzyme. Additionally, the six polymorphisms located upstream the ATG initiation codon are responsible for a significant decrease (ranging from 40% to 73%) in promoter activity of a reporter gene compared to the corresponding wild-type sequence. This work constitutes the first report of the existence of a functional genetic polymorphism affecting TST activity and should be of great help to investigate certain disorders for which impairment of CN(-) or H(2)S detoxification have been suggested to be involved.
Human homolog of the mouse sperm receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chamberlin, M.E.; Dean, J.
1990-08-01
The human zona pellucida, composed of three glycoproteins (ZP1, ZP2, and ZP3), forms an extracellular matrix that surrounds ovulated eggs and mediates species-specific fertilization. The genes that code for at least two of the zona proteins (ZP2 and ZP3) cross-hybridize with other mammalian DNA. The recently characterized mouse sperm receptor gene (Zp-3) was used to isolate its human homolog. The human homolog spans {approx}18.3 kilobase pairs (kbp) (compared to 8.6 kbp for the mouse gene) and contains eight exons, the sizes of which are strictly conserved between the two species. Four short (8-15 bp) sequences within the first 250 bpmore » of the 5{prime} flanking region in the human Zp-3 homolog are also present upstream of mouse Zp-3. These elements may modulate oocyte-specific gene expression. By using the polymerase chain reaction, a full-length cDNA of human ZP3 was isolated from human ovarian poly(A){sup +} RNA and used to deduce the structure of human ZP3 mRNA. Certain features of the human and mouse ZP3 transcripts are conserved. Both have unusually short 5{prime} and 3{prime} untranslated regions, both contain a single open reading frame that is 74% identical, and both code for 424 amino acid polypeptides that are 67% the same. The similarity between the two proteins may define domains that are important in maintaining the structural integrity of the zona pellucida, while the differences may play a role in mediating the species-specific events of mammalian fertilization.« less
Simultaneous Differentiation and Typing of Entamoeba histolytica and Entamoeba dispar
Zaki, Mehreen; Meelu, Parool; Sun, Wei; Clark, C. Graham
2002-01-01
Sequences corresponding to some of the polymorphic loci previously reported from Entamoeba histolytica have been detected in Entamoeba dispar. Comparison of nucleotide sequences of two loci between E. dispar strain SAW760 and E. histolytica strain HM-1:IMSS revealed significant differences in both repeat and flanking regions. The tandem repeat units varied not only in sequence but also in number and arrangement between the two species at both the loci. Using the sequences obtained, primer pairs aimed at amplifying species-specific products were designed and tested on a variety of E. histolytica and E. dispar samples. Amplification results were in complete agreement with the original species classification in all cases, and the PCR products displayed discernible size and pattern variations among the isolates. PMID:11923344
Composition and Structure of Mauna Loa's Submarine West Flank, Hawaii
NASA Astrophysics Data System (ADS)
Borchers, D.; Morgan, J. K.; Clague, D. A.; Moore, G. F.
2003-12-01
James Moore's pioneering work on submarine landslides in the Hawaiian Islands contributed significantly to early models for the structure and evolution of Mauna Loa's submarine western flank. The west flank experienced catastrophic failure in the past, generating massive blocks and debris fields offshore. Moore recognized that the midslope bench near the base of the submarine flank must have postdated the debris avalanche, but little data existed to determine if it formed in response to further landsliding or to deeper volcanic processes. As the processes that shaped Mauna Loa are thought to be analogous to those currently active at Kilauea, an improved understanding of Mauna Loa's history can provide valuable insight into the future of the younger Hawaiian volcanoes. Several recent marine surveys in the area, including submersible surveys conducted by MBARI and JAMSTEC, and a multi-channel seismic (MCS) survey carried out by the University of Hawaii, provide important new data about the composition and structure of Mauna Loa's submarine west flank. We carried out detailed geochemical, petrographic and structural analyses of rock samples and dive videos collected from the exposed northern wall of the midslope bench, documenting a repeated sequences of volcaniclastic sandstones and breccias. This stratigraphy contrasts with the predominantly subaerially erupted basalts composing the upper flank. Several thick ponded flows or sill-like diabase units are also interspersed in the section. The volcaniclastic units are highly cemented, and many contain hydrothermal alteration products, including chlorite, zeolites, and actinolite. The most altered rocks occur near the base of the bench and the degree of alteration decreases upward in the section. Samples collected from the outer scarp of the bench show evidence for intense shearing and cataclasis at all scales. The new MCS line crosses Mauna Loa's southern submarine flank and central bench. More than 500 m of finely layered slope strata overlie the upper flank to the south, and are truncated above the Ka Lae avalanche scar. The central bench to the north, sampled by the MBARI dives, shows only thin sediment cover above a poorly reflective interior. Strong deep reflections in both locations begin to resolve the underlying oceanic crust, as well as probable fault planes that may be responsible for flank deformation in this area. The abundance of volcaniclastic rocks with Mauna Loa affinities within the bench supports the idea that giant landslides from Mauna Loa were the source of much of the offshore debris. The stratal repetition, deformation fabrics, and cementation of the volcaniclastics also suggest that the rocks composing the bench were once deeply buried and have been subsequently exhumed by thrusting, most likely driven by deep volcanic spreading.
Parson, Walther; Ballard, David; Budowle, Bruce; Butler, John M; Gettings, Katherine B; Gill, Peter; Gusmão, Leonor; Hares, Douglas R; Irwin, Jodi A; King, Jonathan L; Knijff, Peter de; Morling, Niels; Prinz, Mechthild; Schneider, Peter M; Neste, Christophe Van; Willuweit, Sascha; Phillips, Christopher
2016-05-01
The DNA Commission of the International Society for Forensic Genetics (ISFG) is reviewing factors that need to be considered ahead of the adoption by the forensic community of short tandem repeat (STR) genotyping by massively parallel sequencing (MPS) technologies. MPS produces sequence data that provide a precise description of the repeat allele structure of a STR marker and variants that may reside in the flanking areas of the repeat region. When a STR contains a complex arrangement of repeat motifs, the level of genetic polymorphism revealed by the sequence data can increase substantially. As repeat structures can be complex and include substitutions, insertions, deletions, variable tandem repeat arrangements of multiple nucleotide motifs, and flanking region SNPs, established capillary electrophoresis (CE) allele descriptions must be supplemented by a new system of STR allele nomenclature, which retains backward compatibility with the CE data that currently populate national DNA databases and that will continue to be produced for the coming years. Thus, there is a pressing need to produce a standardized framework for describing complex sequences that enable comparison with currently used repeat allele nomenclature derived from conventional CE systems. It is important to discern three levels of information in hierarchical order (i) the sequence, (ii) the alignment, and (iii) the nomenclature of STR sequence data. We propose a sequence (text) string format the minimal requirement of data storage that laboratories should follow when adopting MPS of STRs. We further discuss the variant annotation and sequence comparison framework necessary to maintain compatibility among established and future data. This system must be easy to use and interpret by the DNA specialist, based on a universally accessible genome assembly, and in place before the uptake of MPS by the general forensic community starts to generate sequence data on a large scale. While the established nomenclature for CE-based STR analysis will remain unchanged in the future, the nomenclature of sequence-based STR genotypes will need to follow updated rules and be generated by expert systems that translate MPS sequences to match CE conventions in order to guarantee compatibility between the different generations of STR data. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.
1988-01-01
To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981
Biogeochemical and Microbial Survey of Gravity Cores from the Guaymas Basin and Sonora Margin
NASA Astrophysics Data System (ADS)
Buckley, A.; Mckay, L. J.; Chanton, J.; Hensen, C.; Turner, T.; Aiello, I. W.; Ravelo, A. C.; Mortera, C.; Teske, A.
2015-12-01
During the cruise "Guaymas14" with RV El Puma (Oct. 14-25, 2014), 15 sediment cores were obtained from the Guaymas Basin Ridge flanks and the Sonora Margin, to contrast the shallow subsurface sediments of the seafloor set at this spreading center and its adjacent continental margin. Here we present biogeochemical profiles of porewater dissolved gases and stable ions, along with high-throughout 16S rRNA gene sequencing of selected samples. Cores from the NW and SE ends of the Guaymas Basin ridge flanks were not sulfidic, and showed neither sulfate depletion nor methane accumulation. In contrast, samples of compression-impacted Sonora Margin on the NE edge of Guaymas Basin and from the upper Sonora Margin beneath the oxygen minimum zone showed an abundance of sulfide, DIC with sulfate depletion, and accumulation of biogenic methane (δ13C-CH4 ca. -85 to -88 ‰) at supersaturated concentrations below sulfate-replete sediment. Samples from an attenuated off-axis seep site on the NW flank of Guaymas Basin differed from both Sonora Margin and Guaymas Basin. The off-axis seep sediments contained 1 to 1.5 mM methane, with distinct δ13C -isotopic content (δ13C-CH4 near -60 ‰); intermediate to the biogenic methane of the Sonora Margin and the hydrothermally produced methane at Guaymas Basin. Unaltered sulfate and low sulfide concentrations indicate insufficiently reduced conditions, suggesting the methane was not produced in situ. Porewater DIC concentrations in the old seep site and the control site were similar to each other (3-5 mM), and lower than in the Sonora Margin sites (ca. 20-40 mM), indicating low bioremineralization in the old seep site and control sediments. Diverse seafloor habitats are expected to result in distinct microbiota that range from strictly anaerobic seep specialists and methane-cycling archaea in the Sonora Margin to diversified heterotrophic communities in the off-axis ridge flank sediments of Guaymas Basin; high-throughput sequencing should also address potential hydrothermal microbial signature in the attenuated off-axis seep site.
Ngezahayo, Frédéric; Xu, Chunming; Wang, Hongyan; Jiang, Lily; Pang, Jinsong; Liu, Bao
2009-01-01
Background mPing is an endogenous MITE in the rice genome, which is quiescent under normal conditions but can be induced towards mobilization under various stresses. The cellular mechanism responsible for modulating the activity of mPing remains unknown. Cytosine methylation is a major epigenetic modification in most eukaryotes, and the primary function of which is to serve as a genome defense system including taming activity of transposable elements (TEs). Given that tissue-culture is capable of inducing both methylation alteration and mPing transposition in certain rice genotypes, it provides a tractable system to investigate the possible relationship between the two phenomena. Results mPing transposition and cytosine methylation alteration were measured in callus and regenerated plants in three rice (ssp. indica) genotypes, V14, V27 and R09. All three genotypes showed transposition of mPing, though at various frequencies. Cytosine methylation alteration occurred both at the mPing-flanks and at random loci sampled globally in callus and regenerated plants of all three genotypes. However, a sharp difference in the changing patterns was noted between the mPing-flanks and random genomic loci, with a particular type of methylation modification, i.e., CNG hypermethylation, occurred predominantly at the mPing-flanks. Pearson's test on pairwise correlations indicated that mPing activity is positively correlated with specific patterns of methylation alteration at random genomic loci, while the element's immobility is positively correlated with methylation levels of the mPing's 5'-flanks. Bisulfite sequencing of two mPing-containing loci showed that whereas for the immobile locus loss of CG methylation in the 5'-flank was accompanied by an increase in CHG methylation, together with an overall increase in methylation of all three types (CG, CHG and CHH) in the mPing-body region, for the active locus erasure of CG methylation in the 5'-flank was not followed by such a change. Conclusion Our results documented that tissue culture-induced mPing activity in rice ssp. indica is correlated with alteration in cytosine methylation patterns at both random genomic loci and the elements' flanks, while the stability of mPing positively correlates with enhanced methylation levels of both the flanks and probably the elements per se. Thus, our results implicate a possible role of cytosine methylation in maintaining mPing stability under normal conditions, and in releasing the element's activity as a consequence of epigenetic perturbation in a locus-specific manner under certain stress conditions. PMID:19604382
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Xun; Guanga, Gerald P; Wan, Cheng
2012-11-13
MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
USDA-ARS?s Scientific Manuscript database
The highly effective Hessian fly-resistance gene, H33, was introgressed from durum wheat into common wheat and genetically mapped to chromosome 3AS, in previous research. However, H33 located to a region that is well-known to be devoid of molecular markers, with the closest flanking simple sequence ...
USDA-ARS?s Scientific Manuscript database
Transposable elements (TEs) are mobile DNA regions that alter host genome structure and gene expression. A novel 588 bp non-autonomous high copy number TE in the Ostrinia nubilalis genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A+T content (62.3%),...
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Leonard, D A; Rajaram, N; Kerppola, T K
1997-05-13
Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.
Regulation of gene expression mediating indeterminate muscle growth in teleosts.
Ahammad, A K Shakur; Asaduzzaman, Md; Asakawa, Shuichi; Watabe, Shugo; Kinoshita, Shigeharu
2015-08-01
Teleosts are unique among vertebrates due to their indeterminate muscle growth, i.e., continued production of neonatal muscle fibers until death. However, the molecular mechanism(s) underlying this property is unknown. Here, we focused on the torafugu (Takifugu rubripes) myosin heavy chain gene, MYHM2528-1, which is specifically expressed in neonatal muscle fibers produced by indeterminate muscle growth. We examined the flanking region of MYHM2528-1 through an in vivo reporter assay using zebrafish (Danio rerio) and identified a 2100 bp 5'-flanking sequence that contained sufficient promoter activity to allow specific gene expression. The effects of enhanced promoter activity were observed at the outer region of the fast muscle and the dorsal edge of slow muscle in zebrafish larvae. At the juvenile stage, the promoter was specifically activated in small diameter muscle fibers scattered throughout fast muscle and in slow muscle near the septum separating slow and fast muscles. This spatio-temporal promoter activity overlapped with known myogenic zones involved in teleost indeterminate muscle growth. A deletion mutant analysis revealed that the -2100 to -600 bp 5'flanking sequence of MYHM2528-1 is essential for promoter activity. This region contains putative binding sites for several representative myogenesis-related transcription factors and nuclear factor of activated T-cell (NFAT), a transcription activator involved in regeneration of mammalian adult skeletal muscle. A significant reduction in the promoter activity of the MYHM2528-1 deletion constructs was observed in accordance with a reduction in the number of these binding sites, suggesting the involvement of specific transcription factors in indeterminate muscle growth. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.
2009-01-01
Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269
Wide distribution of O157-antigen biosynthesis gene clusters in Escherichia coli.
Iguchi, Atsushi; Shirai, Hiroki; Seto, Kazuko; Ooka, Tadasuke; Ogura, Yoshitoshi; Hayashi, Tetsuya; Osawa, Kayo; Osawa, Ro
2011-01-01
Most Escherichia coli O157-serogroup strains are classified as enterohemorrhagic E. coli (EHEC), which is known as an important food-borne pathogen for humans. They usually produce Shiga toxin (Stx) 1 and/or Stx2, and express H7-flagella antigen (or nonmotile). However, O157 strains that do not produce Stxs and express H antigens different from H7 are sometimes isolated from clinical and other sources. Multilocus sequence analysis revealed that these 21 O157:non-H7 strains tested in this study belong to multiple evolutionary lineages different from that of EHEC O157:H7 strains, suggesting a wide distribution of the gene set encoding the O157-antigen biosynthesis in multiple lineages. To gain insight into the gene organization and the sequence similarity of the O157-antigen biosynthesis gene clusters, we conducted genomic comparisons of the chromosomal regions (about 59 kb in each strain) covering the O-antigen gene cluster and its flanking regions between six O157:H7/non-H7 strains. Gene organization of the O157-antigen gene cluster was identical among O157:H7/non-H7 strains, but was divided into two distinct types at the nucleotide sequence level. Interestingly, distribution of the two types did not clearly follow the evolutionary lineages of the strains, suggesting that horizontal gene transfer of both types of O157-antigen gene clusters has occurred independently among E. coli strains. Additionally, detailed sequence comparison revealed that some positions of the repetitive extragenic palindromic (REP) sequences in the regions flanking the O-antigen gene clusters were coincident with possible recombination points. From these results, we conclude that the horizontal transfer of the O157-antigen gene clusters induced the emergence of multiple O157 lineages within E. coli and speculate that REP sequences may involve one of the driving forces for exchange and evolution of O-antigen loci.
Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R
1997-09-05
To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.
Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.
2011-01-01
We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875
Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda
2012-09-01
Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.
Kim, K H; Hemenway, C
1997-05-26
The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.
Molecular design of sequence specific DNA alkylating agents.
Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi
2009-01-01
Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.
Transposition-mediated DNA re-replication in maize
Zhang, Jianbo; Zuo, Tao; Wang, Dafang; Peterson, Thomas
2014-01-01
Every DNA segment in a eukaryotic genome normally replicates once and only once per cell cycle to maintain genome stability. We show here that this restriction can be bypassed through alternative transposition, a transposition reaction that utilizes the termini of two separate, nearby transposable elements (TEs). Our results suggest that alternative transposition during S phase can induce re-replication of the TEs and their flanking sequences. The DNA re-replication can spontaneously abort to generate double-strand breaks, which can be repaired to generate Composite Insertions composed of transposon termini flanking segmental duplications of various lengths. These results show how alternative transposition coupled with DNA replication and repair can significantly alter genome structure and may have contributed to rapid genome evolution in maize and possibly other eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.03724.001 PMID:25406063
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buchman, A.R.; Kimmerly, W.J.; Rine, J.
1988-01-01
Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less
Modulation of tissue repair by regeneration enhancer elements.
Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D
2016-04-14
How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.
Lohmer, S; Maddaloni, M; Motto, M; Salamini, F; Thompson, R D
1993-01-01
The protein encoded by the Opaque-2 (O2) gene is a transcription factor, translated from an mRNA that possesses an unusually long 5' leader sequence containing three upstream open reading frames (uORFs). The efficiency of translation of O2 mRNA has been tested in vivo by a transient assay in which the level of activation of the b32 promoter, a natural target of O2 protein, is measured. We show that uORF-less O2 alleles possess a higher transactivation value than the wild-type allele and that the reduction in transactivation due to the uORFs is a cis-dominant effect. The data presented indicate that both uORF1 and uORF2 are involved in the reducing effect and suggest that both are likely to be translated. PMID:8439744
Human Promoters Are Intrinsically Directional
Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe
2015-01-01
Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469
Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh
2017-11-01
Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.
Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan
2014-01-01
The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084
Sun, Xiaoyong; Wang, Lin; Ding, Jiechao; Wang, Yanru; Wang, Jiansheng; Zhang, Xiaoyang; Che, Yulei; Liu, Ziwei; Zhang, Xinran; Ye, Jiazhen; Wang, Jie; Sablok, Gaurav; Deng, Zhiping; Zhao, Hongwei
2016-10-01
A new regulatory class of small endogenous RNAs called circular RNAs (circRNAs) has been described as miRNA sponges in animals. Using 16 Arabidopsis thaliana RNA-Seq data sets, we identified 803 circRNAs in RNase R-/non-RNase R-treated samples. The results revealed the following features: Canonical and noncanonical splicing can generate circRNAs; chloroplasts are a hotspot for circRNA generation; furthermore, limited complementary sequences exist not only in introns, but also in the sequences flanking splice sites. The latter finding suggests that multiple combinations between complementary sequences may facilitate the formation of the circular structure. Our results contribute to a better understanding of this novel class of plant circRNAs. © 2016 Federation of European Biochemical Societies.
Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur
2012-01-01
Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607
Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.
Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R
2017-11-01
DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.
Yun, Tao; Zhang, Dabing; Ma, Xuejun; Cao, Zhenzhen; Chen, Liu; Ni, Zheng; Ye, Weicheng; Yu, Bin; Hua, Jionggang; Zhang, Yan; Zhang, Cun
2012-03-01
Duck tembusu virus (DTMUV) is an emerging agent that causes a severe disease in ducks. We report herein the first complete genome sequences of duck tembusu virus strains YY5, ZJ-407, and GH-2, isolated from Shaoxing ducks, breeder ducks, and geese, respectively, in China. The genomes of YY5, ZJ-407, and GH-2 are all 10,990 nucleotides (nt) in length and encode a putative polyprotein of 3,426 amino acids. It is flanked by a 5' and a 3' noncoding region (NCR) of 94 and 618 nt, respectively. Knowledge of the whole sequence of DTMUV will be useful for further studies of the mechanisms of virus replication and pathogenesis.
Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization
Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue
2010-01-01
Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873
Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi
2013-10-01
Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.
Analysis of Morphogenic Effect of hDAB2IP on Prostate Cancer and its Disease Correlation
2007-02-01
variety of or- gans and cell lines. By determining the promoter sequence from the 5’- flanking region of the mDab2ip gene in mouse prosta - tic epithelial...patient with de novo acute myeloid leukemia. Genes Chromo- somes Cancer 39, 324 –334. WANG, Z., TSENG, C.P., PONG, R.C., CHEN, H., MCCONNELL, J.D
Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.
1988-08-01
The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less
Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R
1988-01-01
We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343
Vian, A; Carrascosa, A V; García, J L; Cortés, E
1998-06-01
The nucleotide sequence of both the bgaA gene, coding for a thermostable beta-galactosidase of Thermus sp. strain T2, and its flanking regions was determined. The deduced amino acid sequence of the enzyme predicts a polypeptide of 645 amino acids (Mr, 73,595). Comparative analysis of the open reading frames located in the flanking regions of the bgaA gene revealed that they might encode proteins involved in the transport and hydrolysis of sugars. The observed homology between the deduced amino acid sequences of BgaA and the beta-galactosidase of Bacillus stearothermophilus allows us to classify the new enzyme within family 42 of glycosyl hydrolases. BgaA was overexpressed in its active form in Escherichia coli, but more interestingly, an active chimeric beta-galactosidase was constructed by fusing the BgaA protein to the choline-binding domain of the major pneumococcal autolysin. This chimera illustrates a novel approach for producing an active and thermostable hybrid enzyme that can be purified in a single step by affinity chromatography on DEAE-cellulose, retaining the catalytic properties of the native enzyme. The chimeric enzyme showed a specific activity of 191,000 U/mg at 70 degrees C and a Km value of 1.6 mM with o-nitrophenyl-beta-D-galactopyranoside as a substrate, and it retained 50% of its initial activity after 1 h of incubation at 70 degrees C.
Nguyen, Tuan; Ruan, Zheng; Oruganty, Krishnadev; Kannan, Natarajan
2015-01-01
Mitogen activated protein kinases (MAPKs) form a closely related family of kinases that control critical pathways associated with cell growth and survival. Although MAPKs have been extensively characterized at the biochemical, cellular, and structural level, an integrated evolutionary understanding of how MAPKs differ from other closely related protein kinases is currently lacking. Here, we perform statistical sequence comparisons of MAPKs and related protein kinases to identify sequence and structural features associated with MAPK functional divergence. We show, for the first time, that virtually all MAPK-distinguishing sequence features, including an unappreciated short insert segment in the β4-β5 loop, physically couple distal functional sites in the kinase domain to the D-domain peptide docking groove via the C-terminal flanking tail (C-tail). The coupling mediated by MAPK-specific residues confers an allosteric regulatory mechanism unique to MAPKs. In particular, the regulatory αC-helix conformation is controlled by a MAPK-conserved salt bridge interaction between an arginine in the αC-helix and an acidic residue in the C-tail. The salt-bridge interaction is modulated in unique ways in individual sub-families to achieve regulatory specificity. Our study is consistent with a model in which the C-tail co-evolved with the D-domain docking site to allosterically control MAPK activity. Our study provides testable mechanistic hypotheses for biochemical characterization of MAPK-conserved residues and new avenues for the design of allosteric MAPK inhibitors. PMID:25799139
CRISPR-based screening of genomic island excision events in bacteria.
Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe
2015-06-30
Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.
Kass, David H; Janoušek, Václav; Wang, Liuyang; Tucker, Priscilla K
2014-06-01
Reproductive barriers exist between the house mouse subspecies, Mus musculus musculus and M. m. domesticus, members of the Mus musculus species complex, primarily as a result of hybrid male infertility, and a hybrid zone exists where their ranges intersect in Europe. Using single nucleotide polymorphisms (SNPs) diagnostic for the two taxa, the extent of introgression across the genome was previously compared in these hybrid populations. Sixty-nine of 1316 autosomal SNPs exhibited reduced introgression in two hybrid zone transects suggesting maladaptive interactions among certain loci. One of these markers is within a region on chromosome 11 that, in other studies, has been associated with hybrid male sterility of these subspecies. We assessed sequence variation in a 20 Mb region on chromosome 11 flanking this marker, and observed its inclusion within a roughly 150 kb stretch of DNA showing elevated sequence differentiation between the two subspecies. Four genes are associated with this genomic subregion, with two entirely encompassed. One of the two genes, the uncharacterized 1700093K21Rik gene, displays distinguishing features consistent with a potential role in reproductive isolation between these subspecies. Along with its expression specifically within spermatogenic cells, we present various sequence analyses that demonstrate a high rate of molecular evolution of this gene, as well as identify a subspecies amino acid variant resulting in a structural difference. Taken together, the data suggest a role for this gene in reproductive isolation.
NASA Astrophysics Data System (ADS)
Acharyya, S. K.
2015-07-01
This study provides an insight into the lithotectonic evolution of the N-S trending Indo-Burma Range (IBR), constituting the southern flank of the Himalayan syntaxis. Paleogene flyschoid sediments (Disang-Barail) that represent a shallow marine to deltaic environment mainly comprise the west-central sector of IBR, possibly resting upon a continental base. On the east, these sequences are tectonically flanked by the Eocene olistostromal facies of the Disang, which developed through accretion of trench sediments during the subduction. The shelf and trench facies sequences of the Disang underwent overthrusting from the east, giving rise to two ophiolite suites ( Naga Hills Lower Ophiolite ( NHLO) and Victoria Hills Upper Ophiolite ( VHUO), but with different accretion history. The ophiolite and ophiolite cover rock package were subsequently overthrusted by the Proterozoic metamorphic sequence, originated from the Burmese continent. The NHLO suite of Late Jurassic to Early Eocene age is unconformably overlain by mid-Eocene shallow marine ophiolite-derived clastics. On the south, the VHUO of Mesozoic age is structurally underlain by continental metamorphic rocks. The entire package in Victoria Hills is unconformably overlain by shallow marine Late Albian sediments. Both the ophiolite suites and the sandwiched continental metamorphic rocks are thrust westward over the Paleogene shelf sediments. These dismembered ophiolites and continental metamorphic rocks suggest thin-skinned tectonic detachment processes in IBR, as reflected from the presence of klippe of continental metamorphic rocks over the NHLO and the flyschoid Disang floor sediments and half windows exposing the Disang beneath the NHLO.
Archaebacterial rhodopsin sequences: Implications for evolution
NASA Technical Reports Server (NTRS)
Lanyi, J. K.
1991-01-01
It was proposed over 10 years ago that the archaebacteria represent a separate kingdom which diverged very early from the eubacteria and eukaryotes. It follows that investigations of archaebacterial characteristics might reveal features of early evolution. So far, two genes, one for bacteriorhodopsin and another for halorhodopsin, both from Halobacterium halobium, have been sequenced. We cloned and sequenced the gene coding for the polypeptide of another one of these rhodopsins, a halorhodopsin in Natronobacterium pharaonis. Peptide sequencing of cyanogen bromide fragments, and immuno-reactions of the protein and synthetic peptides derived from the C-terminal gene sequence, confirmed that the open reading frame was the structural gene for the pharaonis halorhodopsin polypeptide. The flanking DNA sequences of this gene, as well as those of other bacterial rhodopsins, were compared to previously proposed archaebacterial consensus sequences. In pairwise comparisons of the open reading frame with DNA sequences for bacterio-opsin and halo-opsin from Halobacterium halobium, silent divergences were calculated. These indicate very considerable evolutionary distance between each pair of genes, even in the dame organism. In spite of this, three protein sequences show extensive similarities, indicating strong selective pressures.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-04-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.
Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z
1994-01-01
The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.
Tectonic controls on rift basin morphology: Evolution of the northern Malawi (Nyasa) rift
NASA Technical Reports Server (NTRS)
Ebinger, C. J.; Deino, A. L.; Tesha, A. L.; Becker, T.; Ring, U.
1993-01-01
Radiometric (K-Ar and Ar-40/Ar-39) age determinations of volcanic and volcaniclastic rocks, combined with structural, gravity, and seismic reflection data, are used to constrain the age of sedimentary strata contained within the seismically and volcanically active northern Malawi (Nyasa) rift and to characterize changes in basin and flank morphologies with time. Faulting and volcanism within the Tukuyu-Karonga basin began at approximately 8.6 Ma, when sediments were deposited in abroad, initially asymmetric lake basin bounded on its northeastern side by a border fault system with minor topographic relief. Extensions, primarily by a slip along the border fault, and subsequent regional isostatic compensation led to the development of a 5-km-deep basin bounded by broad uplifted flanks. Along the low-relief basin margin opposite border fault, younger stratigraphic sequences commonly onlap older wedge-shaped sequences, although their internal geometry is often progradational. Intrabasinal faulting, flankuplift, and basaltic and felsic volcanism from centers at the northern end of the basin became more important at about 2.5 Ma when cross-rift transfer faults developed to link the Tukuyu-Karonga basin to the Rukwa basin. Local uplift and volcanic construction at the northern end of the basin led to a southeastward shift in the basin's depocenter. Sequence boundaries are commonly erosional along this low-relief (hanging wall) margin and conformable in the deep lake basin. The geometry of stratigraphic sequences and the distribution of the erosion indicate that horizontal and vertical crustal movements both across and along the length of the rift basin led to changes in levels of the lake, irrespective of paleoclimatic fluctuations.
Huang, Jinqiang; Li, Yongjuan; Shao, Changwei; Wang, Na; Chen, Songlin
2017-06-20
The nanos gene encodes an RNA-binding zinc finger protein, which is required in the development and maintenance of germ cells. However, there is very limited information about nanos in flatfish, which impedes its application in fish breeding. In this study, we report the molecular cloning, characterization and functional analysis of the 3'-untranslated region of the nanos gene (Csnanos) from half-smooth tongue sole (Cynoglossus semilaevis), which is an economically important flatfish in China. The 1233-bp cDNA sequence, 1709-bp genomic sequence and flanking sequences (2.8-kb 5'- and 1.6-kb 3'-flanking regions) of Csnanos were cloned and characterized. Sequence analysis revealed that CsNanos shares low homology with Nanos in other species, but the zinc finger domain of CsNanos is highly similar. Phylogenetic analysis indicated that CsNanos belongs to the Nanos2 subfamily. Csnanos expression was widely detected in various tissues, but the expression level was higher in testis and ovary. During early development and sex differentiation, Csnanos expression exhibited a clear sexually dimorphic pattern, suggesting its different roles in the migration and differentiation of primordial germ cells (PGCs). Higher expression levels of Csnanos mRNA in normal females and males than in neomales indicated that the nanos gene may play key roles in maintaining the differentiation of gonad. Moreover, medaka PGCs were successfully labeled by the microinjection of synthesized mRNA consisting of green fluorescence protein and the 3'-untranslated region of Csnanos. These findings provide new insights into nanos gene expression and function, and lay the foundation for further study of PGC development and applications in tongue sole breeding. Copyright © 2017 Elsevier B.V. All rights reserved.
Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael
2017-02-01
We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.
Sharma, Ronesh; Bayarjargal, Maitsetseg; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok
2018-01-21
Intrinsically Disordered Proteins (IDPs) lack stable tertiary structure and they actively participate in performing various biological functions. These IDPs expose short binding regions called Molecular Recognition Features (MoRFs) that permit interaction with structured protein regions. Upon interaction they undergo a disorder-to-order transition as a result of which their functionality arises. Predicting these MoRFs in disordered protein sequences is a challenging task. In this study, we present MoRFpred-plus, an improved predictor over our previous proposed predictor to identify MoRFs in disordered protein sequences. Two separate independent propensity scores are computed via incorporating physicochemical properties and HMM profiles, these scores are combined to predict final MoRF propensity score for a given residue. The first score reflects the characteristics of a query residue to be part of MoRF region based on the composition and similarity of assumed MoRF and flank regions. The second score reflects the characteristics of a query residue to be part of MoRF region based on the properties of flanks associated around the given residue in the query protein sequence. The propensity scores are processed and common averaging is applied to generate the final prediction score of MoRFpred-plus. Performance of the proposed predictor is compared with available MoRF predictors, MoRFchibi, MoRFpred, and ANCHOR. Using previously collected training and test sets used to evaluate the mentioned predictors, the proposed predictor outperforms these predictors and generates lower false positive rate. In addition, MoRFpred-plus is a downloadable predictor, which makes it useful as it can be used as input to other computational tools. https://github.com/roneshsharma/MoRFpred-plus/wiki/MoRFpred-plus:-Download. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji
1999-01-01
Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208
Characterization of Cer-1 cis-regulatory region during early Xenopus development.
Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António
2011-05-01
Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.
Danilowicz, Claudia; Hermans, Laura; Coljee, Vincent; Prévost, Chantal
2017-01-01
Abstract During DNA recombination and repair, RecA family proteins must promote rapid joining of homologous DNA. Repeated sequences with >100 base pair lengths occupy more than 1% of bacterial genomes; however, commitment to strand exchange was believed to occur after testing ∼20–30 bp. If that were true, pairings between different copies of long repeated sequences would usually become irreversible. Our experiments reveal that in the presence of ATP hydrolysis even 75 bp sequence-matched strand exchange products remain quite reversible. Experiments also indicate that when ATP hydrolysis is present, flanking heterologous dsDNA regions increase the reversibility of sequence matched strand exchange products with lengths up to ∼75 bp. Results of molecular dynamics simulations provide insight into how ATP hydrolysis destabilizes strand exchange products. These results inspired a model that shows how pairings between long repeated sequences could be efficiently rejected even though most homologous pairings form irreversible products. PMID:28854739
Vandenbol, M; Jauniaux, J C; Grenson, M
1989-11-15
The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.
Venieraki, Anastasia; Dimou, Maria; Vezyri, Eleni; Vamvakas, Alexandros; Katinaki, Pagona-Artemis; Chatzipavlidis, Iordanis; Tampakaki, Anastasia; Katinakis, Panagiotis
2014-01-01
The presence of nitrogen fixers within the genus Pseudomonas has been established and so far most isolated strains are phylogenetically affiliated to Pseudomonas stutzeri. A gene ortholog neighborhood analysis of the nitrogen fixation island (NFI) in four diazotrophic P. stutzeri strains and Pseudomonas azotifigens revealed that all are flanked by genes coding for cobalamin synthase (cobS) and glutathione peroxidise (gshP). The putative NFIs lack all the features characterizing a mobilizable genomic island. Nevertheless, bioinformatic analysis P. stutzeri DSM 4166 NFI demonstrated the presence of short inverted and/or direct repeats within both flanking regions. The other P. stutzeri strains carry only one set of repeats. The genetic diversity of eleven diazotrophic Pseudomonas isolates was also investigated. Multilocus sequence typing grouped nine isolates along with P. stutzeri and two isolates are grouped in a separate clade. A Rep-PCR fingerprinting analysis grouped the eleven isolates into four distinct genotypes. We also provided evidence that the putative NFI in our diazotrophic Pseudomonas isolates is flanked by cobS and gshP genes. Furthermore, we demonstrated that the putative NFI of Pseudomonas sp. Gr65 is flanked by inverted repeats identical to those found in P. stutzeri DSM 4166 and while the other P. stutzeri isolates harbor the repeats located in the intergenic region between cobS and glutaredoxin genes as in the case of P. stutzeri A1501. Taken together these data suggest that all putative NFIs of diazotrophic Pseudomonas isolates are anchored in an intergenic region between cobS and gshP genes and their flanking regions are designated by distinct repeats patterns. Moreover, the presence of almost identical NFIs in diazotrophic Pseudomonas strains isolated from distal geographical locations around the world suggested that this horizontal gene transfer event may have taken place early in the evolution. PMID:25251496
Venieraki, Anastasia; Dimou, Maria; Vezyri, Eleni; Vamvakas, Alexandros; Katinaki, Pagona-Artemis; Chatzipavlidis, Iordanis; Tampakaki, Anastasia; Katinakis, Panagiotis
2014-01-01
The presence of nitrogen fixers within the genus Pseudomonas has been established and so far most isolated strains are phylogenetically affiliated to Pseudomonas stutzeri. A gene ortholog neighborhood analysis of the nitrogen fixation island (NFI) in four diazotrophic P. stutzeri strains and Pseudomonas azotifigens revealed that all are flanked by genes coding for cobalamin synthase (cobS) and glutathione peroxidise (gshP). The putative NFIs lack all the features characterizing a mobilizable genomic island. Nevertheless, bioinformatic analysis P. stutzeri DSM 4166 NFI demonstrated the presence of short inverted and/or direct repeats within both flanking regions. The other P. stutzeri strains carry only one set of repeats. The genetic diversity of eleven diazotrophic Pseudomonas isolates was also investigated. Multilocus sequence typing grouped nine isolates along with P. stutzeri and two isolates are grouped in a separate clade. A Rep-PCR fingerprinting analysis grouped the eleven isolates into four distinct genotypes. We also provided evidence that the putative NFI in our diazotrophic Pseudomonas isolates is flanked by cobS and gshP genes. Furthermore, we demonstrated that the putative NFI of Pseudomonas sp. Gr65 is flanked by inverted repeats identical to those found in P. stutzeri DSM 4166 and while the other P. stutzeri isolates harbor the repeats located in the intergenic region between cobS and glutaredoxin genes as in the case of P. stutzeri A1501. Taken together these data suggest that all putative NFIs of diazotrophic Pseudomonas isolates are anchored in an intergenic region between cobS and gshP genes and their flanking regions are designated by distinct repeats patterns. Moreover, the presence of almost identical NFIs in diazotrophic Pseudomonas strains isolated from distal geographical locations around the world suggested that this horizontal gene transfer event may have taken place early in the evolution.
Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V
2016-05-19
Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.
Gálvez, José Héctor; Tai, Helen H.; Lagüe, Martin; Zebarth, Bernie J.; Strömvik, Martina V.
2016-01-01
Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha−1 was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency. PMID:27193058
Mozambique upper fan: origin of depositional units
DOE Office of Scientific and Technical Information (OSTI.GOV)
Droz, L.; Mougenot, D.
1987-11-01
The upper Mozambique Fan includes a stable down-stream region, with a north-south channel flanked by thick (1.5 sec two-way traveltime) asymmetric levees, and a migrating upstream region where at least two main feeding paths have been successively dominant. From the Oligocene to early Miocene, the north-south Serpa Pinto Valley acted as the main conduit for the north Mozambique terrigenous sediments. From the middle Miocene, the west-east Zambezi Valley became the dominant path and supplied the fan with sediments transported by the Zambezi River from the central part of Mozanbique. The transfer from one sediment-feeding system to the other is relatedmore » to the abandonment of the Serpa Pinto Valley because of graben formation along the Davie Ridge, which trapped the sediments, and the increase of the Zambezi River sediment supply because of the creation and erosion of the East African Rift. 13 figures.« less
A pause site for RNA polymerase II is associated with termination of transcription.
Enriquez-Harris, P; Levitt, N; Briggs, D; Proudfoot, N J
1991-01-01
Termination of transcription by RNA polymerase II has been postulated to involve a pausing process. We have identified such a pause signal, 350 bp into the 3' flanking region of the human alpha 2 globin gene at a position where termination is thought to occur. We show that this pause signal enhances the utilization of an upstream poly(A) site which is otherwise out-competed by a stronger downstream poly(A) site. We also demonstrate that the pause site rescues a poly(A) site that is inactive due to its location within an intron. Using nuclear run-on analysis we show that elongating RNA polymerase II molecules accumulate over this pause signal. Furthermore we show that when the pause site is positioned immediately downstream of a strong poly(A) signal, significant levels of transcription termination take place. Images PMID:2050120
Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito
2002-01-01
Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471
Shin, Jeong Hong; Jung, Soobin; Ramakrishna, Suresh; Kim, Hyongbum Henry; Lee, Junwon
2018-07-07
Genome editing technology using programmable nucleases has rapidly evolved in recent years. The primary mechanism to achieve precise integration of a transgene is mainly based on homology-directed repair (HDR). However, an HDR-based genome-editing approach is less efficient than non-homologous end-joining (NHEJ). Recently, a microhomology-mediated end-joining (MMEJ)-based transgene integration approach was developed, showing feasibility both in vitro and in vivo. We expanded this method to achieve targeted sequence substitution (TSS) of mutated sequences with normal sequences using double-guide RNAs (gRNAs), and a donor template flanking the microhomologies and target sequence of the gRNAs in vitro and in vivo. Our method could realize more efficient sequence substitution than the HDR-based method in vitro using a reporter cell line, and led to the survival of a hereditary tyrosinemia mouse model in vivo. The proposed MMEJ-based TSS approach could provide a novel therapeutic strategy, in addition to HDR, to achieve gene correction from a mutated sequence to a normal sequence. Copyright © 2018 Elsevier Inc. All rights reserved.
Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong
2013-12-01
The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Circular RNA biogenesis can proceed through an exon-containing lariat precursor.
Barrett, Steven P; Wang, Peter L; Salzman, Julia
2015-06-09
Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression programs, yet its function remains largely unknown. The presumed biogenesis of these RNAs involves a non-canonical 'backsplicing' event. Recent studies in mammalian cell culture posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s). Although such sequence elements are common in mammals, they are rare in lower eukaryotes, making current models insufficient to describe circularization. Through systematic splice site mutagenesis and the identification of splicing intermediates, we show that circular RNA in Schizosaccharomyces pombe is generated through an exon-containing lariat precursor. Furthermore, we have performed high-throughput and comprehensive mutagenesis of a circle-forming exon, which enabled us to discover a systematic effect of exon length on RNA circularization. Our results uncover a mechanism for circular RNA biogenesis that may account for circularization in genes that lack noticeable flanking intronic secondary structure.
Malur, Achut G.; Gupta, Neera K.; De, Bishnu P.; Banerjee, Amiya K.
2002-01-01
The large protein (L) of the human parainfluenza virus type 3 (HPIV3) is the functional RNA-dependent RNA polymerase, which possesses highly conserved residues QGDNQ located within motif C of domain III comprising the putative polymerase active site. We have characterized the role of the QGDNQ residues as well as the residues flanking this region in the polymerase activity of the L protein by site-directed mutagenesis and examining the polymerase activity of the wild-type and mutant L proteins by an in vivo minigenome replication assay and an in vitro mRNA transcription assay. All mutations in the QGDNQ residues abolished transcription while mutations in the flanking residues gave rise to variable polymerase activities. These observations support the contention that the QGDNQ sequence is absolutely required for the polymerase activity of the HPIV3 RNA-dependent RNA polymerase. PMID:12064576
Chronology of volcanism and rift basin propagation - Rungwe volcanic province, East Africa
NASA Technical Reports Server (NTRS)
Ebinger, C. J.; Deino, A. L.; Drake, R. E.; Tesha, A. L.
1989-01-01
The spatial and temporal development of along-axis segmentation in youthful continental rifts was investigated using the results of field, remote sensing, and K-Ar geochronology studies conducted in four (Rukwa, Songwe, Usangu, and Karonga) rift basins within the Rungwe volcanic province in East Africa. Results indicated that the Rukwa and Karonga border fault segments formed between 7.25 and 5 m.y. ago, the Usangu border fault segment developed between 3 and 2 m.y. ago, and subsidence along the Songwe border fault segment had occurred by 0.5 Ma. It is shown that individual basins developed diachronously, each following a similar sequence: (1) initial border fault development; (2) asymmetric basin subsidence/flank uplift and the development of monoclines opposite the border faults; and (3) continued subsidence and tilting along intrabasinal faults with flexural upwarping of the rift flanks, enhancing basinal asymmetries.
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa
2012-01-01
Background Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies. PMID:23167289
Characterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.
Zhang, Wenbo; Lin, Xiaofei; Peddigari, Suresh; Takechi, Katsuaki; Takano, Hiroyoshi; Takio, Susumu
2007-02-01
Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3' and 5' RACE suggested that PySN1 was expressed as a chimera transcript with flanking SINE-unrelated sequences and possessed the poly-A tail at the same position near the 3' end of PySN1.
spa typing for epidemiological surveillance of Staphylococcus aureus.
Hallin, Marie; Friedrich, Alexander W; Struelens, Marc J
2009-01-01
The spa typing method is based on sequencing of the polymorphic X region of the protein A gene (spa), present in all strains of Staphylococcus aureus. The X region is constituted of a variable number of 24-bp repeats flanked by well-conserved regions. This single-locus sequence-based typing method combines a number of technical advantages, such as rapidity, reproducibility, and portability. Moreover, due to its repeat structure, the spa locus simultaneously indexes micro- and macrovariations, enabling the use of spa typing in both local and global epidemiological studies. These studies are facilitated by the establishment of standardized spa type nomenclature and Internet shared databases.
Processing of Archaebacterial Intron-Containing tRNA Gene Transcripts.
1987-07-31
1{ 1. Project Goals: A. To determine the mechanism of tRNA intron processing in the halophilic archaebacteria. B. Characterize and compare the...enzyme(s) responsible for the removal of 5’-flanking sequences from halophilic and sulfur-dependent tRNA gene transcripts. C. Examine the structure and...distribution of tRNA introns in the halophilic archaebacteria. 2. Accomplishments: A. Intron processing mechanism We have succeeded in our primary
Simplex and duplex event-specific analytical methods for functional biotech maize.
Lee, Seong-Hun; Kim, Su-Jeong; Yi, Bu-Young
2009-08-26
Analytical methods are very important in the control of genetically modified organism (GMO) labeling systems or living modified organism (LMO) management for biotech crops. Event-specific primers and probes were developed for qualitative and quantitative analysis for biotech maize event 3272 and LY 038 on the basis of the 3' flanking regions, respectively. The qualitative primers confirmed the specificity by a single PCR product and sensitivity to 0.05% as a limit of detection (LOD). Simplex and duplex quantitative methods were also developed using TaqMan real-time PCR. One synthetic plasmid was constructed from two taxon-specific DNA sequences of maize and two event-specific 3' flanking DNA sequences of event 3272 and LY 038 as reference molecules. In-house validation of the quantitative methods was performed using six levels of mixing samples, from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-30%. Limits of quantitation (LOQs) of the quantitative methods were all 0.1% for simplex real-time PCRs of event 3272 and LY 038 and 0.5% for duplex real-time PCR of LY 038. This study reports that event-specific analytical methods were applicable for qualitative and quantitative analysis for biotech maize event 3272 and LY 038.
Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E
2005-08-01
The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.
Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.
2005-01-01
The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237
Wang, Meng; Rada, Cristina; Neuberger, Michael S
2010-01-18
High-affinity antibodies are generated by somatic hypermutation with nucleotide substitutions introduced into the IgV in a semirandom fashion, but with intrinsic mutational hotspots strategically located to optimize antibody affinity maturation. The process is dependent on activation-induced deaminase (AID), an enzyme that can deaminate deoxycytidine in DNA in vitro, where its activity is sensitive to the identity of the 5'-flanking nucleotide. As a critical test of whether such DNA deamination activity underpins antibody diversification and to gain insight into the extent to which the antibody mutation spectrum is dependent on the intrinsic substrate specificity of AID, we investigated whether it is possible to change the IgV mutation spectrum by altering AID's active site such that it prefers a pyrimidine (rather than a purine) flanking the targeted deoxycytidine. Consistent with the DNA deamination mechanism, B cells expressing the modified AID proteins yield altered IgV mutation spectra (exhibiting a purine-->pyrimidine shift in flanking nucleotide preference) and altered hotspots. However, AID-catalyzed deamination of IgV targets in vitro does not yield the same degree of hotspot dominance to that observed in vivo, indicating the importance of features beyond AID's active site and DNA local sequence environment in determining in vivo hotspot dominance.
Kim, S-J; Young, L J; Gonen, D; Veenstra-VanderWeele, J; Courchesne, R; Courchesne, E; Lord, C; Leventhal, B L; Cook, E H; Insel, T R
2002-01-01
Impairment in social reciprocity is a central component of autism. In preclinical studies, arginine vasopressin (AVP) has been shown to increase a range of social behaviors, including affiliation and attachment, via the V(1a) receptor (AVPR1A) in the brain. Both the behavioral effects of AVP and the neural distribution of the V1a receptor vary greatly across mammalian species. This difference in regional receptor expression as well as differences in social behavior may result from a highly variable repetitive sequence in the 5' flanking region of the V1a gene (AVPR1A). Given this comparative evidence for a role in inter-species variation in social behavior, we explored whether within our own species, variation in the human AVPR1A may contribute to individual variations in social behavior, with autism representing an extreme form of social impairment. We genotyped two microsatellite polymorphisms from the 5' flanking region of AVPR1A for 115 autism trios and found nominally significant transmission disequilibrium between autism and one of the microsatellite markers by Multiallelic Transmission/Disequilibrium test (MTDT) that was not significant after Bonferroni correction. We also screened approximately 2 kb of the 5' flanking region and the coding region and identified 10 single nucleotide polymorphisms.
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doug Blankenship
Archive of ArcGIS data from the West Flank FORGE site located in Coso, California. Archive contains the following eight shapefiles: Polygon of the 3D geologic model (WestFlank3DGeologicModelExtent) Polylines of the traces 3D modeled faults (WestFlank3DModeledFaultTraces) Polylines of the fault traces from Duffield and Bacon, 1980 (WestFlankFaultsfromDuffieldandBacon) Polygon of the West Flank FORGE site (WestFlankFORGEsite) Polylines of the traces of the geologic cross-sections (cross-sections in a separate archive in the GDR) (WestFlankGeologicCrossSections) Polylines of the traces of the seismic reflection profiles through and adjacent to the West Flank site (seismic reflection profiles in a separate archive in the GDR) (WestFlankSiesmicReflectionProfiles) Pointsmore » of the well collars in and around the West Flank site (WestFlankWellCollars) Polylines of the surface expression of the West Flank well paths (WestFlankWellPaths)« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu
2010-10-15
Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less
User Guidelines for the Brassica Database: BRAD.
Wang, Xiaobo; Cheng, Feng; Wang, Xiaowu
2016-01-01
The genome sequence of Brassica rapa was first released in 2011. Since then, further Brassica genomes have been sequenced or are undergoing sequencing. It is therefore necessary to develop tools that help users to mine information from genomic data efficiently. This will greatly aid scientific exploration and breeding application, especially for those with low levels of bioinformatic training. Therefore, the Brassica database (BRAD) was built to collect, integrate, illustrate, and visualize Brassica genomic datasets. BRAD provides useful searching and data mining tools, and facilitates the search of gene annotation datasets, syntenic or non-syntenic orthologs, and flanking regions of functional genomic elements. It also includes genome-analysis tools such as BLAST and GBrowse. One of the important aims of BRAD is to build a bridge between Brassica crop genomes with the genome of the model species Arabidopsis thaliana, thus transferring the bulk of A. thaliana gene study information for use with newly sequenced Brassica crops.
Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN
Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger
2016-01-01
Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831