Sample records for upstream foreshock region

  1. Waves and Instabilities in Collisionless Shocks

    DTIC Science & Technology

    1984-04-01

    occur in the electron foreshock and are driven by suprathermal electrons escaping into the region upstream of the shock. Both the ion-acoustic and...ULF waves occur in the ion foreshock and are associated with ions streaming into the region upstream of 11 the shock. The region downstream of the...the discussion of these waves it is useful to distinguish two regions, called the electron foreshock and the ion foreshock . Because the particles

  2. Lunar Surface Electric Potential Changes Associated with Traversals through the Earth's Foreshock

    NASA Technical Reports Server (NTRS)

    Collier, Michael R.; Hills, H. Kent; Stubbs, Timothy J.; Halekas, Jasper S.; Delory, Gregory T.; Espley, Jared; Farrell, William M.; Freeman, John W.; Vondrak, Richard

    2011-01-01

    We report an analysis of one year of Suprathermal Ion Detector Experiment (SIDE) Total Ion Detector (TID) resonance events observed between January 1972 and January 1973. The study includes only those events during which upstream solar wind conditions were readily available. The analysis shows that these events are associated with lunar traversals through the dawn flank of the terrestrial magnetospheric bow shock. We propose that the events result from an increase in lunar surface electric potential effected by secondary electron emission due to primary electrons in the Earth's foreshock region (although primary ions may play a role as well). This work establishes (1) the lunar surface potential changes as the Moon moves through the terrestrial bow shock, (2) the lunar surface achieves potentials in the upstream foreshock region that differ from those in the downstream magnetosheath region, (3) these differences can be explained by the presence of energetic electron beams in the upstream foreshock region and (4) if this explanation is correct, the location of the Moon with respect to the terrestrial bow shock influences lunar surface potential.

  3. MESSENGER Observations of ULF Waves in Mercury's Foreshock Region

    NASA Technical Reports Server (NTRS)

    Le, Guan; Chi, Peter J.; Bardsen, Scott; Blanco-Cano, Xochitl; Slavin, James A.; Korth, Haje

    2012-01-01

    The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth s is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury s bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury s foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury s foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the 1-Hz waves in the Earth s foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth s foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.

  4. A study of the solar wind deceleration in the Earth's foreshock region

    NASA Technical Reports Server (NTRS)

    Zhang, T.-L.; Schwingenschuh, K.; Russell, C. T.

    1995-01-01

    Previous observations have shown that the solar wind is decelerated and deflected in the earth's upstream region populated by long-period waves. This deceleration is corelated with the 'diffuse' but not with the 'reflected' ion population. The speed of the solar wind may decrease tens of km/s in the foreshock region. The solar wind dynamic pressure exerted on the magnetopause may vary due to the fluctuation of the solar wind speed and density in the foreshock region. In this study, we examine this solar wind deceleration and determine how the solar wind deceleration varies in the foreshock region.

  5. Plasma Waves Associated with Energetic Particles Streaming into the Solar Wind from the Earth’s Bow Shock.

    DTIC Science & Technology

    1980-12-08

    when the magnetic field changed in such a way that the ISEE spacecraft were brought into the ion foreshock region. The lower panels of Figures 1 and 2...electrons in the absence of ions usually occurs when the spacecraft is downstream from the electron foreshock boundary but upstream of the ion... foreshock boundary. Two well-defined upstream ion events occur in the following hour as shown in Figure 5. The top panel shows that a moderately intense ion

  6. Effects of Nonconvective Electric Fields on Magnetospheric Plasma Dynamics.

    DTIC Science & Technology

    1983-01-31

    I.S.E.E. data (June, 1981 issue J. Geophys. Res.) has made a large contribution toward describing the structure of the foreshock region just upstream from...narrow layer on the most sunward region of the foreshock [Bonifazi and Moreno, 1981a,b] and form the distribution which is classified as "reflected...the foreshock region toughes the quasi perpendicular bow shock [Eastman et. al., 1981]. Therefore, ions reflected at this point may run along the

  7. VLF imaging of the Venus foreshock

    NASA Technical Reports Server (NTRS)

    Crawford, G. K.; Strangeway, R. J.; Russell, C. T.

    1993-01-01

    VLF plasma wave measurements obtained from the Pioneer Venus Orbiter Electric Field Detector (OEFD) have been used to construct statistical images of the Venus foreshock. Our data set contains all upstream measurements from an entire Venus year (approximately 200 orbits). Since the foreshock VLF characteristics vary with Interplanetary Magnetic Field (IMF) orientation we restrict the study to IMF orientations near the nominal Parker spiral angle (25 to 45). Our results show a strong decrease in 30 kHz wave intensity with both foreshock depth and distance. There is also an asymmetry in the 30 kHz emissions from the upstream and downstream foreshocks. The ion foreshock is characterized by strong emissions in the 5.4 kHz OEFD channel which are positioned much deeper in the foreshock than expected from terrestrial observations. No activity is observed in the region where field aligned ion distributions are expected. ULF wave activity, while weaker than at Earth, shows similar behavior and may indicate the presence of similar ion distributions.

  8. MESSENGER Magnetic Field Observations of Upstream Ultra-Low Frequency Waves at Mercury

    NASA Technical Reports Server (NTRS)

    Le, G.; Chi, P. J.; Boardsen, S.; Blanco-Cano, X.; Anderosn, B. J.; Korth, H.

    2012-01-01

    The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth's is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury's bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury's foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury's foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the I-Hz waves in the Earth's foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth's foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at near 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at near 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.

  9. A statistical study of atypical wave modes in the Earth's foreshock region

    NASA Astrophysics Data System (ADS)

    Hsieh, W.; Shue, J.; Lee, B.

    2010-12-01

    The Earth's foreshock, the region upstream the Earth’s bow shock, is filled with back-streaming particles and ultra-low frequency waves. Three different wave modes have been identified in the region, including 30-sec waves, 3-sec waves, and shocklets. Time History of Events and Macroscale Interactions during Substorms (THEMIS), a satellite mission that consists of five probes, provides multiple measuements of the Earth’s foreshock region. The method of Hilbert-Huang transform (HHT) includes the procedures of empirical mode decomposition and instantaneous frequency calculation. In this study, we use HHT to decompose intrinsic wave modes and perform a wave analysis of chaotic magnetic fields in the Earth's foreshock region. We find that some individual atypical wave modes other than 30-sec and 3-sec appear in the region. In this presentation, we will show the statistical characteristics, such as wave frequency, wave amplitude, and wave polarization of the atypical intrinsic wave modes, with respect to different locations in the foreshock region and to different solar wind conditions.

  10. On the upstream boundary of electron foreshocks in the solar wind

    NASA Technical Reports Server (NTRS)

    Zimbardo, G.; Veltri, P.

    1995-01-01

    The upstream boundary of electron foreshocks is defined as the path of the fastest electrons reflected by collisionless shocks and moving along the magnetic field in the solar wind. Considerable levels of magnetic fluctuations are found in these regions of the solar wind, and their effect is to create both a broadening and a fine structure of the electron foreshock boundary. The magnetic structure is studied by means of a 3-D numerical simulation of a turbulent magnetic field. Enhanced, anomalous diffusion is found, (Delta x(exp 2)) varies as s(sup alpha), where alpha is greater than 1 for typical values of the parameters (here, Delta x(exp 2) is the mean square width of the tangent magnetic surface and s is the field line length). This corresponds to a Levy flight regime for the magnetic field line random walk, and allows very efficient electron propagation perpendicular to the magnetic field. Implications on the observations of planetary foreshocks and of the termination shock foreshock are considered.

  11. Multipoint study of interplanetary shocks

    NASA Astrophysics Data System (ADS)

    Blanco-Cano, Xochitl; Kajdic, Primoz; Russell, Christopher T.; Aguilar-Rodriguez, Ernesto; Jian, Lan K.; Luhmann, Janet G.

    2016-04-01

    Interplanetary (IP) shocks are driven in the heliosphere by Interplanetary Coronal Mass Ejections (ICMEs) and Stream Interaction Regions (SIRs). These shocks perturb the solar wind plasma, and play an active role in the acceleration of ions to suprathermal energies. Shock fronts evolve as they move from the Sun. Their surfaces can be far from uniform and be modulated by changes in the ambient solar wind (magnetic field orientation, flow velocity), shocks rippling, and perturbations upstream and downstream from the shocks, i.e., electromagnetic waves. In this work we use multipoint observations from STEREO, WIND, and MESSENGER missions to study shock characteristics at different helio-longitudes and determine the properties of the waves near them. We also determine shock longitudinal extensions and foreshock sizes. The variations of geometry along the shock surface can result in different extensions of the wave and ion foreshocks ahead of the shocks, and in different wave modes upstream and downtream of the shocks. We find that the ion foreshock can extend up to 0.2 AU ahead of the shock, and that the upstream region with modified solar wind/waves can be very asymmetric.

  12. Observations of the magnetic fluctuation enhancement in the earth's foreshock region

    NASA Technical Reports Server (NTRS)

    Le, G.; Russell, C. T.

    1990-01-01

    Upstream waves have been postulated to be a major source of energy for the dayside magnetic pulsations within the magnetosphere. Thus, it is of interest to determine over what frequency range in the ion foreshock the power of fluctuations in the solar wind is enhanced. The magnetic field data from pairs of spacecraft, when they stay on either side of the ion foreshock boundary, were examined. It was found that the power of magnetic fluctuations is enhanced only at periods less than about two minutes, not at longer periods. Thus the upstream waves may contribute to Pc 3 and Pc 4 pulsations in the dayside magnetosphere, but they cannot be directly responsible for the longer-period waves.

  13. Remote radio observations of solar wind parameters upstream of planetary bow shocks

    NASA Technical Reports Server (NTRS)

    Macdowall, R. J.; Stone, R. G.; Gaffey, J. D., Jr.

    1992-01-01

    Radio emission is frequently produced at twice the electron plasma frequency 2fp in the foreshock region upstream of the terrestrial bow shock. Observations of this emission provide a remote diagnostic of solar wind parameters in the foreshock. Using ISEE-3 radio data, we present the first evidence that the radio intensity is proportional to the kinetic energy flux and to other parameters correlated with solar wind density. We provide a qualitative explanation of this intensity behavior and predict the detection of similar emission at Jupiter by the Ulysses spacecraft.

  14. New Observation of Wave Excitation and Inverse Cascade in the Foreshock Region

    NASA Astrophysics Data System (ADS)

    He, Jiansen; Duan, Die; Yan, Limei; Huang, Shiyong; Tu, Chuanyi; Marsch, Eckart; Wang, Linghua; Tian, Hui

    2016-04-01

    Foreshock with nascent plasma turbulence is regarded as a fascinating region to understand the basic plasma physical processes, e.g., wave-particle interactions as well as wave-wave couplings. Although there have been a bunch of intensive studies on this topic, some key clues about the chain of the physical processes still lacks from observations, e.g., the co-existence of upstream energetic particles as the free energy source, excited pump waves as the wave seed, inverse cascaded daughter waves, and scattered energetic particles as the end of nonlinear processes. A relatively comprehensive case study with some new observations is presented in this work. In our case, upstream energetic protons drifting at tens of Alfvén speed with respect to the background plasma protons is observed from 3DP/PESA-High onboard the WIND spacecraft. When looking at the wave magnetic activities, we are surprised to find the co-existence of high-frequency (0.1-0.5 Hz) large-amplitude right-hand polarized (RHP) waves and low-frequency (0.02-0.1 Hz) small-amplitude left-hand polarized (LHP) waves in the spacecraft (SC) frame. The anti-correlation between magnetic and velocity fluctuations along with the sunward magnetic field direction indicates the low-frequency LHP waves in the SC frame is in fact the sunward upstream RHP waves in the solar wind frame. This new observation lays solid foundation for the applicability of plasma non-resonance instability theory and inverse cascade theory to the foreshock region, in which the downstream high-frequency RHP pump waves are excited by the upstream reflected energetic protons through non-resonance instability and low-frequency RHP daughter waves are generated by the pump waves due to nonlinear parametric decay. The weak signal of alpha particle flux in the foreshock region concerned is also favorable to the occurrence of nonlinear decay process. Furthermore, enhanced downstream energetic proton fluxes are found and inferred to be scattered by the nascent turbulent fluctuations. Therefore, some key clues about the newborn turbulence in the foreshock are supplemented in this work. Nevertheless, the more complete scenario about the fundamental plasma physical processes in the foreshock is left for the newly launched MMS project and the proposed THOR mission.

  15. Short Wavelength Electrostatic Waves in the Earth’s Magnetosheath.

    DTIC Science & Technology

    1982-07-01

    to an antenna effect. Emissions likely to be ion-acoustic mode waves have been found up- stream of the bow shock ( foreshock ) in the solar wind...particles apparently reflected at the bow shock and associated with ion- acoustic mode waves in the Earth’s foreshock are also observed [Eastman et al...Res., 86, A 4493-4510, 1981. Eastman, T.E., 1.R. Anderson, L.A. Frank, and G.K. Parks, Upstream particles observed in the Earth’s foreshock region

  16. Spectral properties of Langmuir and beam-mode waves observed inside terrestrial foreshock by Cluster spacecraf

    NASA Astrophysics Data System (ADS)

    Pisa, D.; Soucek, J.; Santolik, O.

    2016-12-01

    Electrostatic plasma waves are commonly observed in the upstream regions of planetary shocks. Solar wind electrons accelerated at the shock front are reflected back into the solar wind and form electron beams. The electron distribution becomes unstable and electrostatic waves are generated inside the foreshock region. The processes of generation and evolution of electrostatic waves significantly depend on the solar wind plasma conditions and generally exhibit complex behavior. Langmuir waves can be identified as intense narrowband emission at the local plasma frequency and weaker broadband beam-mode waves below and above the plasma frequency deeper in the downstream region. We present a long-term survey of Langmuir and beam-mode waves in the vicinity of the plasma frequency observed upstream of the terrestrial bow shock by the Cluster spacecraft. Using solar wind data and bow shock positions from OMNI, as well as in-situ measurements of interplanetary magnetic field, we have mapped all available spacecraft positions into foreshock coordinates. For a study of plasma waves, we have used spectra and local plasma frequencies obtained from a passive and active mode of the WHISPER instrument. We show a spatial distribution of wave frequencies and spectral widths as a function of foreshock positions and solar wind conditions.

  17. Four Point Measurements of the Foreshock

    NASA Technical Reports Server (NTRS)

    Sibeck, D. G.; Omidi, N.; Angelopoulos, V.

    2008-01-01

    Hybrid code numerical simulations accurately predict the properties of the Earth's foreshock, a region populated by solar wind particles heated and reflected by their interaction with the bow shock. The thermal pressures associated with the reflected population suffice to substantially modify the oncoming solar wind, substantially reducing densities, velocities, and magnetic field strengths, but enhance temperatures. Enhanced thermal pressures cause the foreshock to expand at the expense of the ambient solar wind, creating a boundary that extends approx.10 RE upstream which is marked by enhanced densities and magnetic field strengths, and flows deflected away from the foreshock. We present a case study of Cluster plasma and magnetic field observations of this boundary.

  18. First Observations of a Foreshock Bubble at Earth: Implications for Magnetospheric Activity and Energetic Particle Acceleration

    NASA Technical Reports Server (NTRS)

    Turner, D. L.; Omidi, N.; Sibeck, D. G.; Angelopoulos, V.

    2011-01-01

    Earth?s foreshock, which is the quasi-parallel region upstream of the bow shock, is a unique plasma region capable of generating several kinds of large-scale phenomena, each of which can impact the magnetosphere resulting in global effects. Interestingly, such phenomena have also been observed at planetary foreshocks throughout our solar system. Recently, a new type of foreshock phenomena has been predicted: foreshock bubbles, which are large-scale disruptions of both the foreshock and incident solar wind plasmas that can result in global magnetospheric disturbances. Here we present unprecedented, multi-point observations of foreshock bubbles at Earth using a combination of spacecraft and ground observations primarily from the Time History of Events and Macroscale Interactions during Substorms (THEMIS) mission, and we include detailed analysis of the events? global effects on the magnetosphere and the energetic ions and electrons accelerated by them, potentially by a combination of first and second order Fermi and shock drift acceleration processes. This new phenomena should play a role in energetic particle acceleration at collisionless, quasi-parallel shocks throughout the Universe.

  19. Wave-number spectra and intermittency in the terrestrial foreshock region.

    PubMed

    Narita, Y; Glassmeier, K-H; Treumann, R A

    2006-11-10

    Wave-number spectra of magnetic field fluctuations are directly determined in the terrestrial foreshock region (upstream of a quasiparallel collisionless shock wave) using four-point Cluster spacecraft measurements. The spectral curve is characterized by three ranges reminiscent of turbulence: energy injection, inertial, and dissipation range. The spectral index for the inertial range spectrum is close to Kolmogorov's slope, -5/3. On the other hand, the fluctuations are highly anisotropic and intermittent perpendicular to the mean magnetic field direction. These results suggest that the foreshock is in a weakly turbulent and intermittent state in which parallel propagating Alfvén waves interact with one another, resulting in the phase coherence or the intermittency.

  20. Ion distributions in the Earth's foreshock upstream from the bow shock

    NASA Technical Reports Server (NTRS)

    Fuselier, S. A.

    1995-01-01

    A variety of suprathermal and energetic ion distributions are found upstream from shocks. Some distributions, such as field-aligned beams, are generated directly at the shock either through reflection processes or through leakage from the hotter downstream region. Other distributions, such as intermediate distributions, evolve from these parent distributions through wave-particle interactions. This paper reviews our current understanding of the creation and evolution of suprathermal distributions at shocks. Examples of suprathermal ion distributions are taken from observations at the Earth's bow shock. Particular emphasis is placed on the creation of field-aligned beams and specularly reflected ion distributions and on the evolution of these distributions in the Earth's ion foreshock. However, the results from this heavily studied region are applicable to interplanetary shocks, bow shocks at other planets, and comets.

  1. Electron plasma oscillations in the Venus foreshock

    NASA Technical Reports Server (NTRS)

    Crawford, G. K.; Strangeway, R. J.; Russell, C. T.

    1990-01-01

    Plasma waves are observed in the solar wind upstream of the Venus bow shock by the Pioneer Venus Orbiter. These wave signatures occur during periods when the interplanetary magnetic field through the spacecraft position intersects the bow shock, thereby placing the spacecraft in the foreshock region. The electron foreshock boundary is clearly evident in the data as a sharp onset in wave activity and a peak in intensity. Wave intensity is seen to drop rapidly with increasing penetration into the foreshock. The peak wave electric field strength at the electron foreshock boundary is found to be similar to terrestrial observations. A normalized wave spectrum was constructed using measurements of the electron plasma frequency and the spectrum was found to be centered about this value. These results, along with polarization studies showing the wave electric field to be field aligned, are consistent with the interpretation of the waves as electron plasma oscillations.

  2. Variations in plasma wave intensity with distance along the electron foreshock boundary at Venus

    NASA Technical Reports Server (NTRS)

    Crawford, G. K.; Strangeway, R. J.; Russell, C. T.

    1991-01-01

    Plasma waves are observed in the solar wind upstream of the Venus bow shock by the Pioneer Venus Orbiter. These wave signatures occur during periods when the interplanetary magnetic field through the spacecraft position intersects the bow shock, thereby placing the spacecraft in the foreshock region. Wave intensity is analyzed as a function of distance along the electron foreshock boundary. It is found that the peak wave intensity may increase along the foreshock boundary from the tangent point to a maximum value at several Venus radii, then decrease in intensity with subsequent increase in distance. These observations could be associated with the instability process: the instability of the distribution function increasing with distance from the tangent point to saturation at the peak. Thermalization of the beam for distances beyond this point could reduce the distribution function instability resulting in weaker wave signatures.

  3. Prediction of Solar-Terrestrial Disturbances: Decay Phase of Energetic Proton Events.

    DTIC Science & Technology

    1982-10-01

    Dependence of 50 keV upstream ion events at IMP 7/8 upon magnetic field-bow shock geometry in the earth’s foreshock : A statistical study, J. Geophys_.Rers...ion events in the F. C. Roelof Earth’s foreshock R. Reinhard ISEE-3/IKtP-8 observations of simultaneous upstream proton T. R. Sanderson events K.-P

  4. Foreshock and magnetosheath transients, origin and connection to the magnetopause.

    NASA Astrophysics Data System (ADS)

    Blanco-Cano, X.

    2014-12-01

    The solar wind interaction with earths's magnetosphere begins well ahead of the magnetopause when the solar wind encounters the foreshock, bow shock and magnetosheath. In these regions a variety of waves and magnetic structures exist and modify the solar wind. The foreshock is permeated by a variety of ultra low frequency (ULF) waves and magnetic transient structures such as shocklets, SLAMs, and cavitons. These structures are very compressive and are generated by the solar wind interaction with backstreaming particles plus non linear processes. Other structures such as hot flow anomalies (HFA), and spontaneous hot flow anomalies (SHFA) can also exist in the foreshock. HFAs are generated by discontinuities that arrive to the bow shock. Recent studies show that SHFA have the same profiles as HFA, but form by the interaction of foreshock cavitons with the bowshock. Foreshock bubbles can form when energetic ions upstream of the quasi-parallel bow shock interact with rotational discontinuities in the solar wind. All these structures can merge with the bow shock and be convected into the magnetosheath. The magnetosheath is both a place for rich plasma physical processes and a filter between solar wind and the magnetospheric plasma and magnetic field environments. It is permeated by the superposition of upstream convected structures plus locally generated waves (ion cyclotron and mirror mode). Recent studies have shown that jets and magnetosheath filamentary structures (MFS) can be observed downstream from the bow shock. Jets are associated to shock rippling efects and MFS to acceleration of particles at and near the shock. Due to the presence of the foreshock, bow shock and magnetosheath transients, the solar wind arriving to the magnetopause is very different to the pristine solar wind. In this talk we will address the main characteristics of these transients, discuss their origin, and how they can modify the solar wind, the bow shock, the magnetosheath and the magnetopause.

  5. Magnetosphere on May 11, 1999, the day the solar wind almost disappeared: II. Magnetic pulsations in space and on the ground

    NASA Astrophysics Data System (ADS)

    Le, G.; Chi, P. J.; Goedecke, W.; Russell, C. T.; Szabo, A.; Petrinec, S. M.; Angelopoulos, V.; Reeves, G. D.; Chun, F. K.

    2000-08-01

    Simultaneous observations by Wind and IMP-8 in the upstream region on May 11, 1999, when the solar wind density was well below its usual values and the IMF was generally weakly northward, indicate there were upstream waves present in the foreshock, but wave power was an order of magnitude weaker than usual due to an extremely weak bow shock and tenuous solar wind plasma. Magnetic pulsations in the magnetosphere have been observed in the magnetic field data from Polar and at mid-latitude ground stations. By comparing May 11 with a control day under normal solar wind conditions and with a similar foreshock geometry, we find that the magnetosphere was much quieter than usual. The Pc 3-4 waves were nearly absent in the dayside magnetosphere both at Polar and as seen at mid-latitude ground stations even through the foreshock geometry was favorable for the generation of these waves. Since the solar wind speed was not unusual on this day, these observations suggest that it is the Mach number of the solar wind flow relative to the magnetosphere that controls the amplitude of Pc 3-4 waves in the magnetosphere.

  6. A Single Deformed Bow Shock for Titan-Saturn System

    NASA Astrophysics Data System (ADS)

    Sulaiman, A. H.; Omidi, N.; Kurth, W. S.; Madanian, H.; Cravens, T.; Sergis, N.; Dougherty, M. K.; Edberg, N. J. T.

    2017-12-01

    During periods of high solar wind pressure, Saturn's bow shock is pushed inside Titan's orbit exposing the moon and its ionosphere to the supersonic solar wind. The Cassini spacecraft's T96 encounter with Titan occurred during such a period and is the subject of this presentation. The observations during this encounter show evidence for the presence of outbound and inbound shock crossings associated with Saturn and Titan. They also reveal the presence of two foreshocks: one between the outbound Kronian and inbound Titan bow shocks (foreshock-1) and the other between the outbound Titan and inbound Kronian bow shocks (foreshock-2). Using electromagnetic hybrid (kinetic ions, fluid electrons) simulations and Cassini observations we show that the origin of foreshock-1 is tied to the formation of a single deformed bow shock for the Titan-Saturn system. We also report for the first time, the observations of spontaneous hot flow anomalies (SHFAs) in foreshock-1 making Saturn the fourth planet this phenomenon has been observed and indicating its universal nature. The results of hybrid simulations also show the generation of oblique fast magnetosonic waves upstream of the outbound Titan bow shock in agreement with the observations of large amplitude magnetosonic pulsations in foreshock-2. The formation of a single deformed bow shock results in unique foreshock-bow shock or foreshock-foreshock geometries. For example, the presence of Saturn's foreshock upstream of Titan's quasi-perpendicular bow shock result in ion acceleration through a combination of shock drift and Fermi processes. We also discuss the implications of a single deformed bow shock for Saturn's magnetopause and magnetosphere.

  7. Energies of backstreaming protons in the foreshock

    NASA Technical Reports Server (NTRS)

    Greenstadt, E. W.

    1976-01-01

    A predicted pattern of energy vs detector location in the cislunar region is displayed for protons of zero pitch angle traveling upstream away from the quasi-parallel bow shock. The pattern is implied by upstream wave boundary properties. In the solar ecliptic, protons are estimated to have a minimum of 1.1 times the solar wind bulk energy E sub SW when the wave boundary is in the early morning sector and a maximum of 8.2 E sub SW when the boundary is near the predawn flank.

  8. Relativistic Electrons Produced by Foreshock Disturbances Observed Upstream of Earth's Bow Shock

    NASA Technical Reports Server (NTRS)

    Wilson, L. B., III; Sibeck, D. G.; Turner, D. L.; Osmane, A.; Caprioli, D.; Angelopoulos, V.

    2016-01-01

    Charged particles can be reflected and accelerated by strong (i.e., high Mach number) astrophysical collisionless shock waves, streaming away to form a foreshock region in communication with the shock. Foreshocks are primarily populated by suprathermal ions that can generate foreshock disturbances-largescale (i.e., tens to thousands of thermal ion Larmor radii), transient (approximately 5-10 per day) structures. They have recently been found to accelerate ions to energies of several keV. Although electrons in Saturn's high Mach number (M > 40) bow shock can be accelerated to relativistic energies (nearly 1000 keV), it has hitherto been thought impossible to accelerate electrons beyond a few tens of keV at Earth's low Mach number (1 =M <20) bow shock. Here we report observations of electrons energized by foreshock disturbances to energies up to at least approximately 300 keV. Although such energetic electrons have been previously observed, their presence has been attributed to escaping magnetospheric particles or solar events. These relativistic electrons are not associated with any solar or magnetospheric activity. Further, due to their relatively small Larmor radii (compared to magnetic gradient scale lengths) and large thermal speeds (compared to shock speeds), no known shock acceleration mechanism can energize thermal electrons up to relativistic energies. The discovery of relativistic electrons associated with foreshock structures commonly generated in astrophysical shocks could provide a new paradigm for electron injections and acceleration in collisionless plasmas.

  9. Foreshock Langmuir waves for unusually constant solar wind conditions: Data and implications for foreshock structure

    NASA Astrophysics Data System (ADS)

    Cairns, Iver H.; Robinson, P. A.; Anderson, Roger R.; Strangeway, R. J.

    1997-10-01

    Plasma wave data are compared with ISEE 1's position in the electron foreshock for an interval with unusually constant (but otherwise typical) solar wind magnetic field and plasma characteristics. For this period, temporal variations in the wave characteristics can be confidently separated from sweeping of the spatially varying foreshock back and forth across the spacecraft. The spacecraft's location, particularly the coordinate Df downstream from the foreshock boundary (often termed DIFF), is calculated by using three shock models and the observed solar wind magnetometer and plasma data. Scatterplots of the wave field versus Df are used to constrain viable shock models, to investigate the observed scatter in the wave fields at constant Df, and to test the theoretical predictions of linear instability theory. The scatterplots confirm the abrupt onset of the foreshock waves near the upstream boundary, the narrow width in Df of the region with high fields, and the relatively slow falloff of the fields at large Df, as seen in earlier studies, but with much smaller statistical scatter. The plots also show an offset of the high-field region from the foreshock boundary. It is shown that an adaptive, time-varying shock model with no free parameters, determined by the observed solar wind data and published shock crossings, is viable but that two alternative models are not. Foreshock wave studies can therefore remotely constrain the bow shock's location. The observed scatter in wave field at constant Df is shown to be real and to correspond to real temporal variations, not to unresolved changes in Df. By comparing the wave data with a linear instability theory based on a published model for the electron beam it is found that the theory can account qualitatively and semiquantitatively for the abrupt onset of the waves near Df=0, for the narrow width and offset of the high-field region, and for the decrease in wave intensity with increasing Df. Quantitative differences between observations and theory remain, including large overprediction of the wave fields and the slower than predicted falloff at large Df of the wave fields. These differences, as well as the unresolved issue of the electron beam speed in the high-field region of the foreshock, are discussed. The intrinsic temporal variability of the wave fields, as well as their overprediction based on homogeneous plasma theory, are indicative of stochastic growth physics, which causes wave growth to be random and varying in sign, rather than secular.

  10. Relativistic Electrons Produced by Foreshock Disturbances Observed Upstream of Earth's Bow Shock.

    PubMed

    Wilson, L B; Sibeck, D G; Turner, D L; Osmane, A; Caprioli, D; Angelopoulos, V

    2016-11-18

    Charged particles can be reflected and accelerated by strong (i.e., high Mach number) astrophysical collisionless shock waves, streaming away to form a foreshock region in communication with the shock. Foreshocks are primarily populated by suprathermal ions that can generate foreshock disturbances-large-scale (i.e., tens to thousands of thermal ion Larmor radii), transient (∼5-10  per day) structures. They have recently been found to accelerate ions to energies of several keV. Although electrons in Saturn's high Mach number (M>40) bow shock can be accelerated to relativistic energies (nearly 1000 keV), it has hitherto been thought impossible to accelerate electrons beyond a few tens of keV at Earth's low Mach number (1≤M<20) bow shock. Here we report observations of electrons energized by foreshock disturbances to energies up to at least ∼300  keV. Although such energetic electrons have been previously observed, their presence has been attributed to escaping magnetospheric particles or solar events. These relativistic electrons are not associated with any solar or magnetospheric activity. Further, due to their relatively small Larmor radii (compared to magnetic gradient scale lengths) and large thermal speeds (compared to shock speeds), no known shock acceleration mechanism can energize thermal electrons up to relativistic energies. The discovery of relativistic electrons associated with foreshock structures commonly generated in astrophysical shocks could provide a new paradigm for electron injections and acceleration in collisionless plasmas.

  11. VLF waves in the foreshock

    NASA Technical Reports Server (NTRS)

    Strangeway, R. J.; Crawford, G. K.

    1995-01-01

    Plasma waves observed in the VLF range upstream of planetary bow shocks not only modify the particle distributions, but also provide important information about the acceleration processes that occur at the bow shock. Electron plasma oscillations observed near the tangent field line in the electron foreshock are generated by electrons reflected at the bow shock through a process that has been referred to as Fast Fermi acceleration. Fast Fermi acceleration is the same as shock-drift acceleration, which is one of the mechanisms by which ions are energized at the shock. We have generated maps of the VLF emissions upstream of the Venus bow shock, using these maps to infer properties of the shock energization processes. We find that the plasma oscillations extend along the field line up to a distance that appears to be controlled by the shock scale size, implying that shock curvature restricsts the flux and energy of reflected electrons. We also find that the ion acoustic waves are observed in the ion foreshock, but at Venus these emissions are not detected near the ULF forshock boundary. Through analogy with terrestrial ion observations, this implies that the ion acoustic waves are not generated by ion beams, but are instead generated by diffuse ion distributions found deep within the ion foreshock. However, since the shock is much smaller at Venus, and there is no magnetosphere, we might expect ion distributions within the ion foreshock to be different than at the Earth. Mapping studies of the terrestrial foreshock similar to those carried out at Venus appear to be necessary to determine if the inferences drawn from Venus data are applicable to other foreshocks.

  12. VLF emissions in the Venus foreshock - Comparison with terrestrial observations

    NASA Technical Reports Server (NTRS)

    Crawford, G. K.; Strangeway, R. J.; Russell, C. T.

    1993-01-01

    An examination is conducted of ELF/VLF emissions observed in the solar wind upstream of the Venus shock, for the 100 Hz-30 kHz range, using data from the Pioneer Venus Orbiter's electric field detector and magnetometer instruments. Detailed comparisons are made with terrestrial measurements for both the electron and ion foreshocks. The results obtained support the Crawford et al. (1990) identification of the Venus electron foreshock emissions as electron plasma oscillations, whose waves are generated in situ and act to isotropize the electron distributions.

  13. Foreshock Langmuir Waves for Unusually Constant Solar Wind Conditions: Data and Implications for Foreshock Structure

    NASA Technical Reports Server (NTRS)

    Cairns, Iver H.; Robinson, P. A.; Anderson, Roger R.; Strangeway, R. J.

    1997-01-01

    Plasma wave data are compared with ISEE 1's position in the electron foreshock for an interval with unusually constant (but otherwise typical) solar wind magnetic field and plasma characteristics. For this period, temporal variations in the wave characteristics can be confidently separated from sweeping of the spatially varying foreshock back and forth across the spacecraft. The spacecraft's location, particularly the coordinate D(sub f) downstream from the foreshock boundary (often termed DIFF), is calculated by using three shock models and the observed solar wind magnetometer and plasma data. Scatterplots of the wave field versus D(sub f) are used to constrain viable shock models, to investigate the observed scatter in the wave fields at constant D(sub f), and to test the theoretical predictions of linear instability theory. The scatterplots confirm the abrupt onset of the foreshock waves near the upstream boundary, the narrow width in D(sub f) of the region with high fields, and the relatively slow falloff of the fields at large D(sub f), as seen in earlier studies, but with much smaller statistical scatter. The plots also show an offset of the high-field region from the foreshock boundary. It is shown that an adaptive, time-varying shock model with no free parameters, determined by the observed solar wind data and published shock crossings, is viable but that two alternative models are not. Foreshock wave studies can therefore remotely constrain the bow shock's location. The observed scatter in wave field at constant D(sub f) is shown to be real and to correspond to real temporal variations, not to unresolved changes in D(sub f). By comparing the wave data with a linear instability theory based on a published model for the electron beam it is found that the theory can account qualitatively and semiquantitatively for the abrupt onset of the waves near D(sub f) = 0, for the narrow width and offset of the high-field region, and for the decrease in wave intensity with increasing D(sub f). Quantitative differences between observations and theory remain, including large overprediction of the wave fields and the slower than predicted falloff at large D(sub f) of the wave fields. These differences, as well as the unresolved issue of the electron beam speed in the high-field region of the foreshock, are discussed. The intrinsic temporal variability of the wave fields, as well as their overprediction based on homogeneous plasma theory, are indicative of stochastic growth physics, which causes wave growth to be random and varying in sign, rather than secular.

  14. A study of the coherence length of ULF waves in the earth's foreshock

    NASA Technical Reports Server (NTRS)

    Le, G.; Russell, C. T.

    1990-01-01

    High-time-resolution magnetic-field data for different separations of ISEE 1 and 2 in the earth's ion foreshock region are examined to study the coherence length of upstream ULF waves. Examining the correlation coefficients of the low-frequency waves as a function of separation distance shows that the correlation coefficient depends mainly on the separation distance of ISEE 1 and 2 transverse to the solar-wind flow. It drops to about 0.5 when the transverse separation is about 1 earth radius, a distance much larger than the proton thermal gyroradius in the solar wind. Thus the coherence length of the low-frequency waves is about one earth radius, which is of the order of the wavelength, and is consistent with that estimated from the bandwidth of the waves.

  15. Observations of large-amplitude MHD waves in Jupiter's foreshock in connection with a quasi-perpendicular shock structure

    NASA Technical Reports Server (NTRS)

    Bavassano-Cattaneo, M. B.; Moreno, G.; Scotto, M. T.; Acuna, M.

    1987-01-01

    Plasma and magnetic field observations performed onboard the Voyager 2 spacecraft have been used to investigate Jupiter's foreshock. Large-amplitude waves have been detected in association with the quasi-perpendicular structure of the Jovian bow shock, thus proving that the upstream turbulence is not a characteristic signature of the quasi-parallel shock.

  16. Energetic ion leakage from foreshock transient cores

    NASA Astrophysics Data System (ADS)

    Liu, Terry Z.; Angelopoulos, Vassilis; Hietala, Heli

    2017-07-01

    Earth's foreshock is filled with backstreaming particles that can interact with the ambient solar wind and its discontinuities to form foreshock transients. Many foreshock transients have a core with low dynamic pressure that can significantly perturb the bow shock and the magnetosphere-ionosphere system. Foreshock transients have also been recently recognized as sites of particle acceleration, which may be important for seeding the parent shock with energetic particles. A relevant step of this seeding would be energetic ion leakage into the surrounding foreshock environment. On the other hand, such leakage would also suppress the energetic particle flux contrast across foreshock transients' boundaries masking their perceived contribution to ion energization. To further examine this hypothesis of ion leakage, we report on multipoint case studies of three foreshock transient events selected from a large database. The cases were selected to exemplify, in increasing complexity, the nature and consequences of energetic ion leakage. Ion energy dispersion, observed upstream and/or downstream of the foreshock transients, is explained with a simple, ballistic model of ions leaking from the foreshock transients. Larger energies are required for leaked ions to reach the spacecraft as the distance between the transient and spacecraft increases. Our model, which explains well the observed ion energy dispersion and velocity distributions, can also be used to reveal the shape of the foreshock transients in three dimensions. Our results suggest that ion leakage from foreshock transient cores needs to be accounted for both in statistical studies and in global models of ion acceleration under quasi-parallel foreshock conditions.

  17. Origin of energetic ions observed in the terrestrial ion foreshock : 2D full-particle simulations

    NASA Astrophysics Data System (ADS)

    Savoini, Philippe; Lembege, bertrand

    2016-04-01

    Collisionless shocks are well-known structures in astrophysical environments which dissipate bulk flow kinetic energy and accelerate large fraction of particle. Spacecrafts have firmly established the existence of the so-called terrestrial foreshock region magnetically connected to the shock and filled by two distinct populations in the quasi-perpendicular shock region (i.e. for 45r{ } ≤ quad θ Bn quad ≤ 90r{ }, where θ Bn is the angle between the shock normal and the upstream magnetic field) : (i) the field-aligned ion beams or `` FAB '' characterized by a gyrotropic distributionsout{,} and (ii) the gyro-phase bunched ions or `` GPB '' characterized by a NON gyrotropic distribution. The present work is based on the use of two dimensional PIC simulation of a curved shock and associated foreshock region where full curvature effects, time of flight effects and both electrons and ions dynamics are fully described by a self consistent approach. Our previous analysis (Savoini et Lembège, 2015) has evidenced that these two types of backstreaming populations can originate from the shock front itself without invoking any local diffusion by ion beam instabilities. Present results are focussed on individual ion trajectories and evidence that "FAB" population is injected into the foreshock mainly along the shock front whereas the "GPB" population penetrates more deeply the shock front. Such differences explain why the "FAB" population loses their gyro-phase coherency and become gyrotropic which is not the case for the "GPB". The impact of these different injection features on the energy gain for each ion population will be presented in détails. Savoini, P. and B. Lembège (2015), `` Production of nongyrotropic and gyrotropic backstreaming ion distributions in the quasi-perpendicular ion foreshock région '', J. Geophys. Res., 120, pp 7154-7171, doi = 10.1002/2015JA021018.

  18. Electron velocity distributions near the earth's bow shock

    NASA Technical Reports Server (NTRS)

    Feldman, W. C.; Anderson, R. C.; Bame, S. J.; Gary, S. P.; Gosling, J. T.; Mccomas, D. J.; Thomsen, M. F.; Paschmann, G.; Hoppe, M. M.

    1983-01-01

    New information is presented on the general characteristics of electron distribution functions upstream, within, and downstream of the earth's bow shock, thereby providing new insights into the instabilities in collisionless shocks. The results presented are from a survey of electron velocity distributions measured near the earth's bow shock between October 1977 and December 1978 using the Los Alamos/Garching plasma instrumentation aboard ISEE 2. A wide variety of distribution shapes is found within the different plasma regions in close proximity to the bow shock. It is found that these shapes can be classified into general types that are characteristic of three different plasma regions, namely the upstream region or electron foreshock, the shock proper where most of the heating occurs, and the downstream region or the magnetosheath. Evidence is provided that field-aligned, rather than cross-field, instabilities are the major source of electron dissipation in the earth's bow shock.

  19. Nonlinear Wave-Particle Interaction: Implications for Newborn Planetary and Backstreaming Proton Velocity Distribution Functions

    NASA Astrophysics Data System (ADS)

    Romanelli, N.; Mazelle, C.; Meziane, K.

    2018-02-01

    Seen from the solar wind (SW) reference frame, the presence of newborn planetary protons upstream from the Martian and Venusian bow shocks and SW protons reflected from each of them constitutes two sources of nonthermal proton populations. In both cases, the resulting proton velocity distribution function is highly unstable and capable of giving rise to ultralow frequency quasi-monochromatic electromagnetic plasma waves. When these instabilities take place, the resulting nonlinear waves are convected by the SW and interact with nonthermal protons located downstream from the wave generation region (upstream from the bow shock), playing a predominant role in their dynamics. To improve our understanding of these phenomena, we study the interaction between a charged particle and a large-amplitude monochromatic circularly polarized electromagnetic wave propagating parallel to a background magnetic field, from first principles. We determine the number of fix points in velocity space, their stability, and their dependence on different wave-particle parameters. Particularly, we determine the temporal evolution of a charged particle in the pitch angle-gyrophase velocity plane under nominal conditions expected for backstreaming protons in planetary foreshocks and for newborn planetary protons in the upstream regions of Venus and Mars. In addition, the inclusion of wave ellipticity effects provides an explanation for pitch angle distributions of suprathermal protons observed at the Earth's foreshock, reported in previous studies. These analyses constitute a mean to evaluate if nonthermal proton velocity distribution functions observed at these plasma environments present signatures that can be understood in terms of nonlinear wave-particle processes.

  20. Formation of gyrotropic and non gyrotropic field-aligned beams in the Earth's quasi-perpendicular Ion Foreshock: Full-particle 2D simulation results

    NASA Astrophysics Data System (ADS)

    Savoini, P.; Lembege, B.

    2013-12-01

    The ion foreshock located upstream of the Earth's bow shock is populated with ions reflected back by the shock front with an high energy gain. In-situ spacecraft measurements have clearly established the existence of two distinct populations in the foreshock upstream of quasi-perpendicular shock region (i.e. for 45° ≤ ΘBn≤ 90°, where ΘBn is the angle between the shock normal and the upstream magnetostatic field): (i) field-aligned (';FAB') ion beams characterized by a gyrotropic distribution, and (ii) gyro-phase bunched (';GPB') ions characterized by a NON gyrotropic distribution, which exhibits a non-vanishing perpendicular bulk velocity. The purpose of the present work is to identify the possible sources of the different backstreaming ions and is based on the use of 2D PIC simulations of a curved shock, where full curvature effects, time of flight effects and both electrons and ions dynamics are fully described by a self consistent approach. Our analysis evidences that the two populations mentionned above may have different origins identified both in terms of interaction time and distance of penetration within the shock front. In particular, ours simulations evidence that "GPB" and ';FAB' populations are characterized by a short (Δinter= 1 to 2 tci) and much larger (Δinter= 1 to 10 tci) interaction time respectively, where τci is the ion upstream gyroperiod. In addition, a deeper statistical analysis of ion trajectories evidences that: (i) both populations can be discriminated in terms of injection angle into the shock front (i.e. defined between the local normal to the shock front and the gyration velocity vector at the time ions reach the front). Such a behavior explains how reflected ions can be splitted in the observed two populations "FAB" and "GPB". (ii) ion trajectories strongly differ between the "FAB" and "GPB" populations at the shock front. In particular, ';FAB' ions suffer multi-bounces whereas ';GPB '; ions make only one bounce. Such differences can explain why the ';FAB' population loses their gyro-phase coherency and become gyrotropic which is not the case for the "GPB". As evidenced by these simulations the origin of both populations can be associated directly to their interaction with the shock front itself and do not require any upstream instability which can be another source for such backstreaming ions.

  1. Oblique Alfvén instabilities driven by compensated currents

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Malovichko, P.; Voitenko, Y.; De Keyser, J., E-mail: voitenko@oma.be

    2014-01-10

    Compensated-current systems created by energetic ion beams are widespread in space and astrophysical plasmas. The well-known examples are foreshock regions in the solar wind and around supernova remnants. We found a new oblique Alfvénic instability driven by compensated currents flowing along the background magnetic field. Because of the vastly different electron and ion gyroradii, oblique Alfvénic perturbations react differently on the currents carried by the hot ion beams and the return electron currents. Ultimately, this difference leads to a non-resonant aperiodic instability at perpendicular wavelengths close to the beam ion gyroradius. The instability growth rate increases with increasing beam currentmore » and temperature. In the solar wind upstream of Earth's bow shock, the instability growth time can drop below 10 proton cyclotron periods. Our results suggest that this instability can contribute to the turbulence and ion acceleration in space and astrophysical foreshocks.« less

  2. Whistler mode waves observed by MGF search coil magnetometer -Polarization and wave normal features of upstream waves near the bow-shock

    NASA Astrophysics Data System (ADS)

    Hayashi, K.; Matsui, H.; Kawano, H.; Yamamoto, T.; Kokubun, S.

    1994-12-01

    Whistler mode waves observed in the upstream region very close to the bow-shock is focused from the initial survey for magnetic fed data in a frequency range between 1Hz and 50Hz observed by the search coil magnetometer on board the Geotail satellite. Based on the three component wave form data polarization and wave-normal characteristics of foreshock waves is first shown as dynamic spectra for the whole Fourier components of the 50 Hz band width. Intense whistler mode waves generated in the foot region of the bow-shock are found strongly controlled in the observed polarization dependent on the angle between directions of the wave propagation and the solar wind flow but not very dependent on frequency. Our simple scheme to derive the ware characteristics which is effective to survey large amount of data continuously growing is also introduced.

  3. Foreshock ULF wave boundary at Venus

    NASA Astrophysics Data System (ADS)

    Shan, L.; Mazelle, C. X.; Meziane, K.; Romanelli, N. J.; Ge, Y.; Du, A.; Zhang, T.

    2017-12-01

    Foreshock ULF waves are a significant physical phenomenon on the plasma environment for terrestrial planets. The occurrence of ULF waves, associated with backstreaming ions and accelerated at shocks, implies the conditions and properties of the shock and its foreshock. The location of ultra-low frequency (ULF) quasi-monochromatic wave onset upstream of Venus bow shock is explored using Venus Express magnetic field data. We report the existence of a spatial foreshock boundary behind which ULF waves are present. We have found that the ULF wave boundary is sensitive to the interplanetary magnetic field (IMF) direction and appears well defined for a cone angle larger than 30o. In the Venusian foreshock, the slope of the wave boundary with respect to the Sun-Venus direction increase with IMF cone angle. We also found that for the IMF nominal direction at Venus' orbit, the boundary makes an inclination of 70o. Moreover, we have found that the inferred velocity of an ion traveling along the ULF boundary is in a qualitative agreement with a quasi-adiabatic reflection of a portion of the solar wind at the bow shock.

  4. Acceleration of Particles Near Earth's Bow Shock

    NASA Astrophysics Data System (ADS)

    Sandroos, A.

    2012-12-01

    Collisionless shock waves, for example, near planetary bodies or driven by coronal mass ejections, are a key source of energetic particles in the heliosphere. When the solar wind hits Earth's bow shock, some of the incident particles get reflected back towards the Sun and are accelerated in the process. Reflected ions are responsible for the creation of a turbulent foreshock in quasi-parallel regions of Earth's bow shock. We present first results of foreshock macroscopic structure and of particle distributions upstream of Earth's bow shock, obtained with a new 2.5-dimensional self-consistent diffusive shock acceleration model. In the model particles' pitch angle scattering rates are calculated from Alfvén wave power spectra using quasilinear theory. Wave power spectra in turn are modified by particles' energy changes due to the scatterings. The new model has been implemented on massively parallel simulation platform Corsair. We have used an earlier version of the model to study ion acceleration in a shock-shock interaction event (Hietala, Sandroos, and Vainio, 2012).

  5. Spontaneous Hot Flow Anomalies at Quasi-Parallel Shocks: 2. Hybrid Simulations

    NASA Technical Reports Server (NTRS)

    Omidi, N.; Zhang, H.; Sibeck, D.; Turner, D.

    2013-01-01

    Motivated by recent THEMIS observations, this paper uses 2.5-D electromagnetic hybrid simulations to investigate the formation of Spontaneous Hot Flow Anomalies (SHFA) upstream of quasi-parallel bow shocks during steady solar wind conditions and in the absence of discontinuities. The results show the formation of a large number of structures along and upstream of the quasi-parallel bow shock. Their outer edges exhibit density and magnetic field enhancements, while their cores exhibit drops in density, magnetic field, solar wind velocity and enhancements in ion temperature. Using virtual spacecraft in the simulation, we show that the signatures of these structures in the time series data are very similar to those of SHFAs seen in THEMIS data and conclude that they correspond to SHFAs. Examination of the simulation data shows that SHFAs form as the result of foreshock cavitons interacting with the bow shock. Foreshock cavitons in turn form due to the nonlinear evolution of ULF waves generated by the interaction of the solar wind with the backstreaming ions. Because foreshock cavitons are an inherent part of the shock dissipation process, the formation of SHFAs is also an inherent part of the dissipation process leading to a highly non-uniform plasma in the quasi-parallel magnetosheath including large scale density and magnetic field cavities.

  6. The Quasi-monochromatic ULF Wave Boundary in the Venusian Foreshock: Venus Express Observations

    NASA Astrophysics Data System (ADS)

    Shan, Lican; Mazelle, Christian; Meziane, Karim; Romanelli, Norberto; Ge, Yasong S.; Du, Aimin; Lu, Quanming; Zhang, Tielong

    2018-01-01

    The location of ultralow-frequency (ULF) quasi-monochromatic wave onset upstream of Venus bow shock is explored using Venus Express magnetic field data. We report the existence of a spatial foreshock boundary behind which ULF waves are present. We have found that the ULF wave boundary at Venus is sensitive to the interplanetary magnetic field (IMF) direction like the terrestrial one and appears well defined for a cone angle larger than 30°. In the Venusian foreshock, the inclination angle of the wave boundary with respect to the Sun-Venus direction increases with the IMF cone angle. We also found that for the IMF nominal direction (θBX = 36°) at Venus' orbit, the value of this inclination angle is 70°. Moreover, we have found that the inferred velocity of an ion traveling along the ULF boundary is in a qualitative agreement with a quasi-adiabatic reflection of a portion of the solar wind at the bow shock. For an IMF nominal direction at Venus, the inferred bulk speed of ions traveling along this boundary is 1.07 VSW, sufficiently enough to overcome the solar wind convection. This strongly suggests that the backstreaming ions upstream of the Venusian bow shock provide the main energy source for the ULF waves.

  7. ULF waves in the foreshock

    NASA Technical Reports Server (NTRS)

    Greenstadt, E. W.; Le, G.; Strangeway, R. J.

    1995-01-01

    We review our current knowledge of ULF waves in planetary foreshocks. Most of this knowledge comes from observations taken within a few Earth radii of the terrestrial bow shock. Terrestrial foreshock ULF waves can be divided into three types, large amplitude low frequency waves (approximately 30-s period), upstream propagating whistlers (1-Hz waves), and 3-s waves. The 30-s waves are apparently generated by back-streaming ion beams, while the 1-Hz waves are generated at the bow shock. The source of the 3-s waves has yet to be determined. In addition to issues concerning the source of ULF waves in the foreshock, the waves present a number of challenges, both in terms of data acquisition, and comparison with theory. The various waves have different coherence scales, from approximately 100 km to approximately 1 Earth radius. Thus multi-spacecraft separation strategies must be tailored to the phenomenon of interest. From a theoretical point of view, the ULF waves are observed in a plasma in which the thermal pressure is comparable to the magnetic pressure, and the rest-frame wave frequency can be moderate fraction of the proton gyro-frequency. This requires the use of kinetic plasma wave dispersion relations, rather than multi-fluid MHD. Lastly, and perhaps most significantly, ULF waves are used to probe the ambient plasma, with inferences being drawn concerning the types of energetic ion distributions within the foreshock. However, since most of the data were acquired close to the bow shock, the properties of the more distant foreshock have to be deduced mainly through extrapolation of the near-shock results. A general understanding of the wave and plasma populations within the foreshock, their interrelation, and evolution, requires additional data from the more distant foreshock.

  8. Nonlinear low frequency (LF) waves - Comets and foreshock phenomena

    NASA Technical Reports Server (NTRS)

    Tsurutani, Bruce T.

    1991-01-01

    A review is conducted of LF wave nonlinear properties at comets and in the earth's foreshock, engaging such compelling questions as why there are no cometary cyclotron waves, the physical mechanism responsible for 'dispersive whiskers', and the character of a general description of linear waves. Attention is given to the nonlinear properties of LF waves, whose development is illustrated by examples of waves and their features at different distances from the comet, as well as by computer simulation results. Also discussed is a curious wave mode detected from Comet Giacobini-Zinner, both at and upstream of the bow shock/wave.

  9. Multispacecraft study of shock-flux rope interaction

    NASA Astrophysics Data System (ADS)

    Blanco-Cano, X.; Burgess, D.; Sundberg, T.; Kajdic, P.

    2016-12-01

    Interplanetary (IP) shocks can be driven in the solar wind by fast coronal mass ejections. These shocks play an active role in particle acceleration near the Sun and through the heliosphere, being associated to solar energetic particle (SEP) and energetic storm particle (ESP) events. IP shocks can interact with structures in the solar wind, and with planetary magnetospheres. In this work we study how the properties of an IP shock change when it interacts with a medium scale flux rope (FR). We use measurements from CLUSTER, WIND and ACE. These three spacecraft observed the shock-FR interaction at different stages of its evolution. We find that the shock-FR interaction locally changes the shock geometry, affecting ion injection processes, and the upstream and downstream regions. While WIND and ACE observed a quasi-perpendicular shock, CLUSTER crossed a quasi-parallel shock and a foreshock with a variety of ion distributions. The complexity of the ion foreshock can be explained by the dynamics of the shock transitioning from quasi-perpendicular to quasi-parallel, and the geometry of the magnetic field around the flux rope.

  10. The quasiperpendicular environment of large magnetic pulses in Earth's quasiparallel foreshock - ISEE 1 and 2 observations

    NASA Technical Reports Server (NTRS)

    Greenstadt, E. W.; Moses, S. L.; Coroniti, F. V.; Farris, M. H.; Russell, C. T.

    1993-01-01

    ULF waves in Earth's foreshock cause the instantaneous angle theta-B(n) between the upstream magnetic field and the shock normal to deviate from its average value. Close to the quasi-parallel (Q-parallel) shock, the transverse components of the waves become so large that the orientation of the field to the normal becomes quasi-perpendicular (Q-perpendicular) during applicable phases of each wave cycle. Large upstream pulses of B were observed completely enclosed in excursions of Theta-B(n) into the Q-perpendicular range. A recent numerical simulation included Theta-B(n) among the parameters examined in Q-parallel runs, and described a similar coincidence as intrinsic to a stage in development of the reformation process of such shocks. Thus, the natural environment of the Q-perpendicular section of Earth's bow shock seems to include an identifiable class of enlarged magnetic pulses for which local Q-perpendicular geometry is a necessary association.

  11. Foreshock occurrence before large earthquakes

    USGS Publications Warehouse

    Reasenberg, P.A.

    1999-01-01

    Rates of foreshock occurrence involving shallow M ??? 6 and M ??? 7 mainshocks and M ??? 5 foreshocks were measured in two worldwide catalogs over ???20-year intervals. The overall rates observed are similar to ones measured in previous worldwide and regional studies when they are normalized for the ranges of magnitude difference they each span. The observed worldwide rates were compared to a generic model of earthquake clustering based on patterns of small and moderate aftershocks in California. The aftershock model was extended to the case of moderate foreshocks preceding large mainshocks. Overall, the observed worldwide foreshock rates exceed the extended California generic model by a factor of ???2. Significant differences in foreshock rate were found among subsets of earthquakes defined by their focal mechanism and tectonic region, with the rate before thrust events higher and the rate before strike-slip events lower than the worldwide average. Among the thrust events, a large majority, composed of events located in shallow subduction zones, had a high foreshock rate, while a minority, located in continental thrust belts, had a low rate. These differences may explain why previous surveys have found low foreshock rates among thrust events in California (especially southern California), while the worldwide observations suggests the opposite: California, lacking an active subduction zone in most of its territory, and including a region of mountain-building thrusts in the south, reflects the low rate apparently typical for continental thrusts, while the worldwide observations, dominated by shallow subduction zone events, are foreshock-rich. If this is so, then the California generic model may significantly underestimate the conditional probability for a very large (M ??? 8) earthquake following a potential (M ??? 7) foreshock in Cascadia. The magnitude differences among the identified foreshock-mainshock pairs in the Harvard catalog are consistent with a uniform distribution over the range of observation.

  12. Proton beam generation of whistler waves in the earth's foreshock

    NASA Technical Reports Server (NTRS)

    Wong, H. K.; Goldstein, M. L.

    1987-01-01

    It is shown that proton beams, often observed upstream of the earth's bow shock and associated with the generation of low-frequency hydromagnetic fluctuations, are also capable of generating whistler waves. The waves can be excited by an instability driven by two-temperature streaming Maxwellian proton distributions which have T (perpendicular)/T(parallel) much greater than 1. It can also be excited by gyrating proton beam distributions. These distributions generate whistler waves with frequencies ranging from 10 to 100 times the proton cyclotron frequency (in the solar wind reference frame) and provide another mechanism for generating the '1-Hz' waves often seen in the earth's foreshock.

  13. FORESHOCK AND ATERSHOCK SEQUENCES OF SOME LARGE EARTHQUAKES IN THE REGION OF GREECE,

    DTIC Science & Technology

    or more foreshocks of magnitude larger than 3.8 occurred in forty per cent of the cases. The probability for an earthquake to be preceded by a large... foreshock not much smaller than the main shock is 10%. It is shown that some properties of the earth’s material in the aftershock region can be

  14. Plasma Waves in the Magnetosheath of Venus

    NASA Technical Reports Server (NTRS)

    Strangeway, Robert J.

    1996-01-01

    Research supported by this grant is divided into three basic topics of investigation. These are: (1) Plasma waves in the Venus magnetosheath, (2) Plasma waves in the Venus foreshock and solar wind, (3) plasma waves in the Venus nightside ionosphere and ionotail. The main issues addressed in the first area - Plasma waves in the Venus magnetosheath - dealt with the wave modes observed in the magnetosheath and upper ionosphere, and whether these waves are a significant source of heating for the topside ionosphere. The source of the waves was also investigated. In the second area - Plasma waves in the Venus foreshock and solar wind, we carried out some research on waves observed upstream of the planetary bow shock known as the foreshock. The foreshock and bow shock modify the ambient magnetic field and plasma, and need to be understood if we are to understand the magnetosheath. Although most of the research was directed to wave observations on the dayside of the planet, in the last of the three basic areas studied, we also analyzed data from the nightside. The plasma waves observed by the Pioneer Venus Orbiter on the nightside continue to be of considerable interest since they have been cited as evidence for lightning on Venus.

  15. On nonstationarity and rippling of the quasiperpendicular zone of the Earth bow shock: Cluster observations

    NASA Astrophysics Data System (ADS)

    Lobzin, V. V.; Krasnoselskikh, V. V.; Musatenko, K.; Dudok de Wit, T.

    2008-09-01

    A new method for remote sensing of the quasiperpendicular part of the bow shock surface is presented. The method is based on analysis of high frequency electric field fluctuations corresponding to Langmuir, upshifted, and downshifted oscillations in the electron foreshock. Langmuir waves usually have maximum intensity at the upstream boundary of this region. All these waves are generated by energetic electrons accelerated by quasiperpendicular zone of the shock front. Nonstationary behavior of the shock, in particular due to rippling, should result in modulation of energetic electron fluxes, thereby giving rise to variations of Langmuir waves intensity. For upshifted and downshifted oscillations, the variations of both intensity and central frequency can be observed. For the present study, WHISPER measurements of electric field spectra obtained aboard Cluster spacecraft are used to choose 48 crossings of the electron foreshock boundary with dominating Langmuir waves and to perform for the first time a statistical analysis of nonstationary behavior of quasiperpendicular zone of the Earth's bow shock. Analysis of hidden periodicities in plasma wave energy reveals shock front nonstationarity in the frequency range 0.33 fBi

  16. Effect of upstream ULF waves on the energetic ion diffusion at the earth's foreshock: Theory, Simulation, and Observations

    NASA Astrophysics Data System (ADS)

    Otsuka, F.; Matsukiyo, S.; Kis, A.; Hada, T.

    2017-12-01

    Spatial diffusion of energetic particles is an important problem not only from a fundamental physics point of view but also for its application to particle acceleration processes at astrophysical shocks. Quasi-linear theory can provide the spatial diffusion coefficient as a function of the wave turbulence spectrum. By assuming a simple power-law spectrum for the turbulence, the theory has been successfully applied to diffusion and acceleration of cosmic rays in the interplanetary and interstellar medium. Near the earth's foreshock, however, the wave spectrum often has an intense peak, presumably corresponding to the upstream ULF waves generated by the field-aligned beam (FAB). In this presentation, we numerically and theoretically discuss how the intense ULF peak in the wave spectrum modifies the spatial parallel diffusion of energetic ions. The turbulence is given as a superposition of non-propagating transverse MHD waves in the solar wind rest frame, and its spectrum is composed of a piecewise power-law spectrum with different power-law indices. The diffusion coefficients are then estimated by using the quasi-linear theory and test particle simulations. We find that the presence of the ULF peak produces a concave shape of the diffusion coefficient when it is plotted versus the ion energy. The results above are used to discuss the Cluster observations of the diffuse ions at the Earth's foreshock. Using the density gradients of the energetic ions detected by the Cluster spacecraft, we determine the e-folding distances, equivalently, the spatial diffusion coefficients, of ions with their energies from 10 to 32 keV. The observed e-folding distances are significantly smaller than those estimated in the past statistical studies. This suggests that the particle acceleration at the foreshock can be more efficient than considered before. Our test particle simulation explains well the small estimate of the e-folding distances, by using the observed wave turbulence spectrum near the shock.

  17. Foreshock occurrence rates before large earthquakes worldwide

    USGS Publications Warehouse

    Reasenberg, P.A.

    1999-01-01

    Global rates of foreshock occurrence involving shallow M ??? 6 and M ??? 7 mainshocks and M ??? 5 foreshocks were measured, using earthquakes listed in the Harvard CMT catalog for the period 1978-1996. These rates are similar to rates ones measured in previous worldwide and regional studies when they are normalized for the ranges of magnitude difference they each span. The observed worldwide rates were compared to a generic model of earthquake clustering, which is based on patterns of small and moderate aftershocks in California, and were found to exceed the California model by a factor of approximately 2. Significant differences in foreshock rate were found among subsets of earthquakes defined by their focal mechanism and tectonic region, with the rate before thrust events higher and the rate before strike-slip events lower than the worldwide average. Among the thrust events a large majority, composed of events located in shallow subduction zones, registered a high foreshock rate, while a minority, located in continental thrust belts, measured a low rate. These differences may explain why previous surveys have revealed low foreshock rates among thrust events in California (especially southern California), while the worldwide observations suggest the opposite: California, lacking an active subduction zone in most of its territory, and including a region of mountain-building thrusts in the south, reflects the low rate apparently typical for continental thrusts, while the worldwide observations, dominated by shallow subduction zone events, are foreshock-rich.

  18. Multispacecraft study of shock-flux rope interaction

    NASA Astrophysics Data System (ADS)

    Blanco-Cano, Xochitl; Burgess, David; Sundberg, Torbjorn; Kajdic, Primoz

    2017-04-01

    Interplanetary (IP) shocks can be driven in the solar wind by fast coronal mass ejections. These shocks can accelerate particles near the Sun and through the heliosphere, being associated to solar energetic particle (SEP) and energetic storm particle (ESP) events. IP shocks can interact with structures in the solar wind, and with planetary magnetospheres. In this study we show how the properties of an IP shock change when it interacts with a medium scale flux rope (FR) like structure. We use data measurements from CLUSTER, WIND and ACE. These three spacecraft observed the shock-FR interaction at different stages of its evolution. We find that the shock-FR interaction locally changes the shock geometry, affecting ion injection processes, and the upstream and downstream regions. While WIND and ACE observed a quasi-perpendicular shock, CLUSTER crossed a quasi-parallel shock and a foreshock with a variety of ion distributions. The complexity of the ion foreshock can be explained by the dynamics of the shock transitioning from quasi-perpendicular to quasi-parallel, and the geometry of the magnetic field around the flux rope. Interactions such as the one we discuss can occur often along the extended IP shock fronts, and hence their importance towards a better understanding of shock acceleration.

  19. Effect of field-aligned-beam in parallel diffusion of energetic particles in the Earth's foreshock

    NASA Astrophysics Data System (ADS)

    Matsukiyo, S.; Nakanishi, K.; Otsuka, F.; Kis, A.; Lemperger, I.; Hada, T.

    2016-12-01

    Diffusive shock acceleration (DSA) is one of the plausible acceleration mechanisms of cosmic rays. In the standard DSA model the partial density of the accelerated particles, diffused into upstream, exponentially decreases as the distance to the shock increases. Kis et al. (GRL, 31, L20801, 2004) examined the density gradients of energetic ions upstream of the bow shock with high accuracy by using Cluster data. They estimated the diffusion coefficients of energetic ions for the event in February 18, 2003 and showed that the obtained diffusion coefficients are significantly smaller than those estimated in the past statistical study. This implies that particle acceleration at the bow shock can be more efficient than considered before. Here, we focus on the effect of the field-aligned-beam (FAB) which is often observed in the foreshock, and examine how the FAB affects the efficiency of diffusion of the energetic ions by performing test particle simulations. The upstream turbulence is given by the superposition of parallel Alfven waves with power-law energy spectrum with random phase approximation. In the spectrum we further add a peak corresponding to the waves resonantly generated by the FAB. The dependence of the diffusion coefficient on the presence of the FAB as well as total energy of the turbulence, power-law index of the turbulence, and intensity of FAB oriented waves are discussed.

  20. Operational foreshock forecasting: Fifteen years after

    NASA Astrophysics Data System (ADS)

    Ogata, Y.

    2010-12-01

    We are concerned with operational forecasting of the probability that events are foreshocks of a forthcoming earthquake that is significantly larger (mainshock). Specifically, we define foreshocks as the preshocks substantially smaller than the mainshock by a magnitude gap of 0.5 or larger. The probability gain of foreshock forecast is extremely high compare to long-term forecast by renewal processes or various alarm-based intermediate-term forecasts because of a large event’s low occurrence rate in a short period and a narrow target region. Thus, it is desired to establish operational foreshock probability forecasting as seismologists have done for aftershocks. When a series of earthquakes occurs in a region, we attempt to discriminate foreshocks from a swarm or mainshock-aftershock sequence. Namely, after real time identification of an earthquake cluster using methods such as the single-link algorithm, the probability is calculated by applying statistical features that discriminate foreshocks from other types of clusters, by considering the events' stronger proximity in time and space and tendency towards chronologically increasing magnitudes. These features were modeled for probability forecasting and the coefficients of the model were estimated in Ogata et al. (1996) for the JMA hypocenter data (M≧4, 1926-1993). Currently, fifteen years has passed since the publication of the above-stated work so that we are able to present the performance and validation of the forecasts (1994-2009) by using the same model. Taking isolated events into consideration, the probability of the first events in a potential cluster being a foreshock vary in a range between 0+% and 10+% depending on their locations. This conditional forecasting performs significantly better than the unconditional (average) foreshock probability of 3.7% throughout Japan region. Furthermore, when we have the additional events in a cluster, the forecast probabilities range more widely from nearly 0% to about 40% depending on the discrimination features among the events in the cluster. This conditional forecasting further performs significantly better than the unconditional foreshock probability of 7.3%, which is the average probability of the plural events in the earthquake clusters. Indeed, the frequency ratios of the actual foreshocks are consistent with the forecasted probabilities. Reference: Ogata, Y., Utsu, T. and Katsura, K. (1996). Statistical discrimination of foreshocks from other earthquake clusters, Geophys. J. Int. 127, 17-30.

  1. Formation of Accelerated Backstreaming Particles within the Quasi-perpendicular Ion Terrestrial Foreshock: 2D Full-Particle and Test-particles simulations

    NASA Astrophysics Data System (ADS)

    Savoini, P.; Lembege, B.

    2016-12-01

    Backstreaming ion populations are observed upstream of the Terrestrial bow shock and form the ion foreshock. Two distinct populations have been firmly identified by spacecrafts within the quasi-perpendicular shock region (i.e. for 45° ≤ ΘBn ≤ 90°, where ΘBn is the angle between the shock normal and the upstream magnetostatic field): so called (i) field-aligned ion beams (« FAB ») characterized by a gyrotropic distribution, and (ii) gyro-phase bunched ions («GPB »), characterized by a NON gyrotropic distribution.The origin of these backstreaming ions is still an important unresolved question which can be partially analyzed with the help of 2D PIC simulation of a curved shock, where full curvature effects, time of flight effects and both electrons and ions dynamics are fully included by a self consistent approach. Our previous analysis (Savoini et Lembege, 2015) has evidenced that these two populations can be generated directly by the macroscopic fields at the shock front itself. Present results based on ion trajectories analysis confirm: (i) the importance of the interaction time ΔTinter spent by ions within the shock front. "GPB" population is characterized by a very short interaction time (ΔTinter = 1 to 2 tci) in comparison to the "FAB" population (ΔTinter = 2 tci to 10 tci), where tci is the upstream ion gyroperiod. (ii) the key role of the injection angle (i.e. defined between the normal of the shock front and the gyration velocity at the time incoming ions hit the shock front) which strongly differs between FAB and GPB ions. (iii) that "FAB" ions drift along the shock front and « scan » a large ΘBn range (up to 20°) which explains the loss of their initial gyro-phase, before being re-injected into the upstream region. Moreover, our test-particule simulations evidence the importance of the shock wave profile for both the « FAB » and « GPB » populations. Such results show that the reflection process is not continuous in time and in space, but strongly depends of the local shock front profile met by incoming ions at their hitting time. The same simulations also emphasize the slight decrease of backstreaming ions density when the electric field space charge effect present within the shock front is artificially canceled. A comparison between self-consistent and test-particles results will be presented in more details.

  2. Upstream waves in Saturn's foreshock

    NASA Technical Reports Server (NTRS)

    Bavassano Cattaneo, M. B.; Cattaneo, P.; Moreno, G.; Lepping, R. P.

    1991-01-01

    An analysis based on plasma and magnetic-field data obtained from Voyager 1 during its Saturn encounter is reported. The plasma data provided every 96 sec and magnetic-field data averaged over 48 sec are utilized. The evidence of upstream waves at Saturn are detected. The waves have a period, in the spacecraft frame, of about 550 sec and a relative amplitude larger than 0.3, are left- and right-hand elliptically polarized, and propagate at about 30 deg with respect to the average magnetic field. The appearance of the waves is correlated with the spacecraft being magnetically connected to the bow shock.

  3. DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pitňa, A.; Šafránková, J.; Němeček, Z.

    2016-03-01

    Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those inmore » the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.« less

  4. Foreshocks and Swarms of Induced Seismicity in Southern Kansas

    NASA Astrophysics Data System (ADS)

    Rubinstein, J. L.; Skoumal, R.; Dougherty, S. L.; Cochran, E. S.

    2017-12-01

    Protracted foreshock sequences and swarm-like behavior have been observed for a number of induced earthquakes, including Guy-Greenbrier, Raton Basin, Youngstown, and the Fairview sequences. Many other induced earthquake sequences have seen intermittent seismicity before the largest earthquake in the sequence. The prevalence of foreshocks and swarms as part of induced earthquake sequences likely reflects the ongoing increase in and expansion of fluid pressure in a region, such that higher magnitude events will occur once a large region has been sufficiently influenced by fluid injection. Diffusion of fluid pressure has been observed in some induced seismicity sequences whereby seismicity moves away from an injector, making the earlier events foreshocks. Natural seismicity in other parts of the central and eastern United States experience far fewer foreshock sequences. This is additional evidence that injection-caused increase in fluid pressure is the reason that these foreshocks and swarms are occurring. To better understand foreshocks and swarm-like behavior of induced seismicity, we examine the seismicity in southern Kansas from 2014-2017. The seismic network in southern Kansas represents the densest, longest-running (>3.5 years) network with publicly available data in near-real-time in an area of induced seismicity. This has yielded a magnitude of completeness of 2.0, which is lower than in most other areas of induced seismicity. We further enhance this catalog by using template matching. With this expanded catalog, we identify and examine foreshock and swarm behavior for all M3.5 and larger mainshocks in Kansas.

  5. Self-organizing Large-scale Structures in Earth's Foreshock Waves

    NASA Astrophysics Data System (ADS)

    Ganse, U.; Pfau-Kempf, Y.; Turc, L.; Hoilijoki, S.; von Alfthan, S.; Vainio, R. O.; Palmroth, M.

    2017-12-01

    Earth's foreshock is populated by plasma waves in the ULF regime, assumed to be caused by wave instabilities of shock-reflected particle beams. While in-situ observation of these waves has provided plentiful data of their amplitudes, frequencies, obliquities and relation to local plasma conditions, global-scale structures are hard to grasp from observation data alone. The hybrid-Vlasov simulation system Vlasiator, designed for kinetic modeling of the Earth's magnetosphere, has been employed to study foreshock formation under radial and near-radial IMF conditions on global scales. Structures arising in the foreshock can be comprehensively studied and directly compared to observation results. Our modeling results show that foreshock waves present emergent large-scale structures, in which regions of waves with similar phase exist. At the interfaces of these regions ("spines") we observe high wave obliquity, higher beam densities and lower beam velocities than inside them. We characterize these apparently self-organizing structures through the interplay between wave- and beam properties and present the microphysical mechanisms involved in their creation.

  6. Theory of Type 3 and Type 2 Solar Radio Emissions

    NASA Technical Reports Server (NTRS)

    Robinson, P. A.; Cairns, I. H.

    2000-01-01

    The main features of some current theories of type III and type II bursts are outlined. Among the most common solar radio bursts, type III bursts are produced at frequencies of 10 kHz to a few GHz when electron beams are ejected from solar active regions, entering the corona and solar wind at typical speeds of 0.1c. These beams provide energy to generate Langmuir waves via a streaming instability. In the current stochastic-growth theory, Langmuir waves grow in clumps associated with random low-frequency density fluctuations, leading to the observed spiky waves. Nonlinear wave-wave interactions then lead to secondary emission of observable radio waves near the fundamental and harmonic of the plasma frequency. Subsequent scattering processes modify the dynamic radio spectra, while back-reaction of Langmuir waves on the beam causes it to fluctuate about a state of marginal stability. Theories based on these ideas can account for the observed properties of type III bursts, including the in situ waves and the dynamic spectra of the radiation. Type 11 bursts are associated with shock waves propagating through the corona and interplanetary space and radiating from roughly 30 kHz to 1 GHz. Their basic emission mechanisms are believed to be similar to those of type III events and radiation from Earth's foreshock. However, several sub-classes of type II bursts may exist with different source regions and detailed characteristics. Theoretical models for type II bursts are briefly reviewed, focusing on a model with emission from a foreshock region upstream of the shock for which observational evidence has just been reported.

  7. AFTERSHOCK SEQUENCES AND CRUSTAL STRUCTURE IN THE REGION OF GREECE.

    DTIC Science & Technology

    the strain release characteristics and other properties of the aftershock and foreshock sequences (1) of all shocks of M 5.9 which have occurred in...relation between the water loading of two artificial lakes in the region of Greece and the earthquake activity in foreshocks or swarm of shocks triggered

  8. On the persistence of unstable bump-on-tail electron velocity distributions in the earth's foreshock

    NASA Technical Reports Server (NTRS)

    Klimas, Alexander J.; Fitzenreiter, Richard J.

    1988-01-01

    This paper presents further evidence for the persistence of bump-on-tail unstable reduced velocity distributions in the earth's electron foreshock, which contradicts the understanding of quasi-linear saturation of the bump-on-tail instability. A modified theory for the saturation of the bump-on-tail instability in the earth's foreshock is proposed to explain the mechanism of this persistence, and the predictions are compared to the results of a numerical simulation of the electron plasma in the foreshock. The results support the thesis that quasi-linear saturation of the bump-on-tail instability is modified in the foreshock, due to the driven nature of the region, so that at saturation the stabilized velocity distribution still appears bump-on-tail unstable to linear plasma analysis.

  9. Effect of Upstream ULF Waves on the Energetic Ion Diffusion at the Earth's Foreshock. I. Theory and Simulation

    NASA Astrophysics Data System (ADS)

    Otsuka, Fumiko; Matsukiyo, Shuichi; Kis, Arpad; Nakanishi, Kento; Hada, Tohru

    2018-02-01

    Field-aligned diffusion of energetic ions in the Earth’s foreshock is investigated by using the quasi-linear theory (QLT) and test particle simulation. Non-propagating MHD turbulence in the solar wind rest frame is assumed to be purely transverse with respect to the background field. We use a turbulence model based on a multi-power-law spectrum including an intense peak that corresponds to upstream ULF waves resonantly generated by the field-aligned beam (FAB). The presence of the ULF peak produces a concave shape of the diffusion coefficient when it is plotted versus the ion energy. The QLT including the effect of the ULF wave explains the simulation result well, when the energy density of the turbulent magnetic field is 1% of that of the background magnetic field and the power-law index of the wave spectrum is less than 2. The numerically obtained e-folding distances from 10 to 32 keV ions match with the observational values in the event discussed in the companion paper, which contains an intense ULF peak in the spectra generated by the FAB. Evolution of the power spectrum of the ULF waves when approaching the shock significantly affects the energy dependence of the e-folding distance.

  10. Gradual unlocking of a plate boundary controlled the April 2014 M8.1 Iquique, Northern Chile megathrust earthquake

    NASA Astrophysics Data System (ADS)

    Schurr, B.; Hainzl, S.; Bedford, J. R.; Hoechner, A.; Wang, R.; Zhang, Y.; Oncken, O.; Palo, M.; Bartsch, M.; Moreno, M.; Tilmann, F. J.; Dahm, T.; Victor, P.; Barrientos, S. E.; Vilotte, J. P.

    2014-12-01

    On April 1st, 2014, Northern Chile, was struck by a magnitude 8.1 earthquake near the city of Iquique following a protracted series of foreshocks. The earthquake occurred within a seismic gap left behind by two great earthquakes devastating the northern Chilean and southern Peruvian coast about 140 years ago in 1868 and 1877. This segment, about 500 km long, was the only one along the Chilean subduction zone that has not ruptured within the last century. The Integrated Plate boundary Observatory Chile (IPOC) monitored the entire sequence of events, providing unprecedented resolution of the build-up to the main event and its rupture evolution. We analyzed the entire seismicity in this section of the subduction zone since 2007. The offshore rupture region of the Iquique event has been more or less continuously seismically active within our observation period. This is in contrast to the segments to the north and south, which are still unruptured and seismically quiet. Starting in July 2013, three foreshock clusters with increasingly larger magnitudes occurred within the future rupture area. The largest Mw 6.7 foreshock, two weeks before the mainshock, had a source mechanism distinctively different from the mainshock and with a centroid depth of only 9 km probably occurred in the upper plate. The Iquique mainshock initiated then at the northern end of the foreshock zone, inside a region of intermediate interseismic locking. Comparing the foreshock distribution to the long term deformation history of the margin, we find that the area exhibits a high gradient of locking from weakly locked updip to fully locked downdip. Mapping the b-value of the foreshocks indicates significantly lower b-values in the source area compared to all other regions where the b-value can be resolved. Importantly, a gradual drop of the b-value from about 0.75 to below 0.6 is observed in the source region within the three years before the Iquique earthquake. This has only been reversed within the last days of the foreshock sequence. We conclude that gradual weakening of the central part of the seismic gap accentuated by the foreshock activity in a zone of intermediate seismic coupling was instrumental in causing final failure.

  11. Detailed observations of California foreshock sequences: Implications for the earthquake initiation process

    USGS Publications Warehouse

    Dodge, D.A.; Beroza, G.C.; Ellsworth, W.L.

    1996-01-01

    We find that foreshocks provide clear evidence for an extended nucleation process before some earthquakes. In this study, we examine in detail the evolution of six California foreshock sequences, the 1986 Mount Lewis (ML, = 5.5), the 1986 Chalfant (ML = 6.4), the. 1986 Stone Canyon (ML = 4.7), the 1990 Upland (ML = 5.2), the 1992 Joshua Tree (MW= 6.1), and the 1992 Landers (MW = 7.3) sequence. Typically, uncertainties in hypocentral parameters are too large to establish the geometry of foreshock sequences and hence to understand their evolution. However, the similarity of location and focal mechanisms for the events in these sequences leads to similar foreshock waveforms that we cross correlate to obtain extremely accurate relative locations. We use these results to identify small-scale fault zone structures that could influence nucleation and to determine the stress evolution leading up to the mainshock. In general, these foreshock sequences are not compatible with a cascading failure nucleation model in which the foreshocks all occur on a single fault plane and trigger the mainshock by static stress transfer. Instead, the foreshocks seem to concentrate near structural discontinuities in the fault and may themselves be a product of an aseismic nucleation process. Fault zone heterogeneity may also be important in controlling the number of foreshocks, i.e., the stronger the heterogeneity, the greater the number of foreshocks. The size of the nucleation region, as measured by the extent of the foreshock sequence, appears to scale with mainshock moment in the same manner as determined independently by measurements of the seismic nucleation phase. We also find evidence for slip localization as predicted by some models of earthquake nucleation. Copyright 1996 by the American Geophysical Union.

  12. Foreshock triggering of the 1 April 2014 Mw 8.2 Iquique, Chile, earthquake

    NASA Astrophysics Data System (ADS)

    Herman, Matthew W.; Furlong, Kevin P.; Hayes, Gavin P.; Benz, Harley M.

    2016-08-01

    On April 1st, 2014, a Mw 8.2 (U.S. Geological Survey moment magnitude) earthquake occurred in the subduction zone offshore northern Chile. In the two weeks leading up to the earthquake, a sequence of foreshocks, starting with a Mw 6.7 earthquake on March 16th and including three more Mw 6.0+ events, occurred predominantly south of the April 1st mainshock epicenter and up-dip of the area of significant slip during the mainshock. Using earthquake locations and source parameters derived in a previous study (Hayes et al., 2014) and a Coulomb failure stress change analysis of these events, we assess in detail the hypothesis that the earthquakes occurred as a cascading sequence, each event successively triggering the next, ultimately triggering the rupture of the mainshock. Following the initial Mw 6.7 event, each of the three largest foreshocks (Mw 6.4, 6.2 and 6.3), as well as the hypocenter of the mainshock, occurred in a region of positive Coulomb stress change produced by the preceding events, indicating these events were brought closer to failure by the prior seismicity. In addition, we reexamine the possibility that aseismic slip occurred and what role it may have played in loading the plate boundary. Using horizontal GPS displacements from along the northern Chile coast prior to the mainshock, we find that the foreshock seismicity alone likely does not account for the observed signals. We perform a grid search for the location and magnitude of an aseismic slip patch that can account for the difference between observed signals and foreshock-related displacement, and find that a slow slip region with slip corresponding to a Mw ∼ 6.8 earthquake located coincident with or up-dip of the foreshock seismicity can best explain this discrepancy. Additionally, such a slow slip region positively loads the mainshock hypocentral area, enhancing the positive loading produced by the foreshock seismicity.

  13. The Effects of Travel Path and Source Structure on the Character of Regional Distance Seismograms from Nuclear Explosions

    DTIC Science & Technology

    1991-12-27

    and had a ML of 6.4. The earthquake sequence was very energetic, having a foreshock with a ML of 5.9 and three large aftershocks measuring 5.8, 5.6...regional data-A review, Bull. Seism. Soc. Am. 72, S89-S129. Smith, K. D., and K. F. Priestley (1988). The foreshock sequence of the 1986 Chalfant

  14. 3-D Dynamic Rupture Simulations of the 2016 Kumamoto, Japan, Earthquake

    NASA Astrophysics Data System (ADS)

    Fukuyama, E.; Urata, Y.; Yoshida, K.

    2016-12-01

    On April 16, 2016 at 01:25 (JST), an M7.3 main shock of the 2016 Kumamoto, Japan, earthquake sequence occurred along the Futagawa and Hinagu faults. A few days before, three M6-class foreshocks occurred: M6.5 on April 14 at 21:26, M5.8 on April 14 at 22:27, and M6.4 on April 15 at 00:03 (JST). The focal mechanisms of the first and third foreshocks were similar to those of the main shock; therefore, the extensive stress shadow should have been generated on the fault plane of the main shock. The purpose of this study is to illuminate why the rupture of the main shock propagated successfully under such stress conditions by 3-D dynamic rupture simulations, assuming the fault planes estimated by the distributions of aftershocks.First, we investigated time evolution of aftershock hypocenters relocated by the Double Difference method (Waldhauser & Ellsworth, 2000). The result showed that planar distribution of the hypocenters was formed after each M6 event. It allows us to estimate fault planes of the three foreshocks and the main shock.Then, we evaluated stress changes on the fault planes of the main shock due to the three foreshocks. We obtained the slip distributions of the foreshocks by using Eshelby (1957)'s solution, assuming elliptical cracks with constant stress drops on the estimated fault planes. The stress changes on the fault planes of the main shock were calculated by using Okada (1992)'s solution. The obtained stress change distribution showed that the hypocenter of the main shock existed on the region with positive ΔCFF while ΔCFF in the shallower regions than the hypocenter was negative. Therefore, the foreshocks could encourage the initiation of the main shock rupture and could hinder the rupture propagating toward the shallow region.Finally, we conducted 3-D dynamic rupture simulations (Hok and Fukuyama, 2011) of the main shock under the initial stresses, which were the sum of the stress changes by these foreshocks and the regional stress field estimated by Yoshida et al. (2016, submitted). We used slip-weakening law with uniform friction parameters. We conducted many simulations varying unknown parameters (the friction parameters and the values of the principal stresses), and we will discuss the conditions for the rupture propagation of the main shock and the effects of the foreshocks on the main shock.

  15. Seismic amplitude measurements suggest foreshocks have different focal mechanisms than aftershocks

    USGS Publications Warehouse

    Lindh, A.; Fuis, G.; Mantis, C.

    1978-01-01

    The ratio of the amplitudes of P and S waves from the foreshocks and aftershocks to three recent California earthquakes show a characteristic change at the time of the main events. As this ratio is extremely sensitive to small changes in the orientation of the fault plane, a small systematic change in stress or fault configuration in the source region may be inferred. These results suggest an approach to the recognition of foreshocks based on simple measurements of the amplitudes of seismic waves. Copyright ?? 1978 AAAS.

  16. Ongoing data reduction, theoretical studies and supporting research in magnetospheric physics

    NASA Technical Reports Server (NTRS)

    Scarf, F. L.; Greenstadt, E. W.

    1984-01-01

    Data from ISEE-3, Pioneer Venus Orbiter, and Voyager 1 and 2 were analyzed. The predictability of local shock macrostructure at ISEE-1, at the Earth's bow shock, from solar wind measurements made up-stream by ISEE-3, was conducted using computer graphic format. Morphology of quasi-parallel shock was reviewed. The review attempted to interrelate various measurements and computations involving the q-parallel structure and foreshock elements connected to it. A new classification for q-parallel morphology was suggested.

  17. A mechanism for plasma waves at the harmonics of the plasma frequency foreshock boundary

    NASA Technical Reports Server (NTRS)

    Klimas, A. J.

    1982-01-01

    A bump-on-tail unstable reduced velocity distribution, constructed from data obtained at the upstream boundary of the electron foreshock by the GSFC electron spectrometer experiment on the ISEE-1 satellite, is used as the initial plasma state for a numerical integration of the 1D-Vlasov-Maxwell system of equations. The integration is carried through the growth of the instability, beyond its saturation, and well into the stabilized plasma regime. A power spectrum computed for the electric field of the stabilized plasma is dominated by a narrow peak at the Bohm-Gross frequency of the unstable field mode but also contains significant power at the harmonics of the Bohm-Gross frequency. The harmonic power is in sharp peaks which are split into closely spaced doublets. The fundamental peak at the Bohm-Gross frequency is split into a closely spaced triplet. The mechanism for excitation of the second harmonic is shown to be second order wave-wave coupling.

  18. Distribution and solar wind control of compressional solar wind-magnetic anomaly interactions observed at the Moon by ARTEMIS

    NASA Astrophysics Data System (ADS)

    Halekas, J. S.; Poppe, A. R.; Lue, C.; Farrell, W. M.; McFadden, J. P.

    2017-06-01

    A statistical investigation of 5 years of observations from the two-probe Acceleration, Reconnection, Turbulence, and Electrodynamics of Moon's Interaction with the Sun (ARTEMIS) mission reveals that strong compressional interactions occur infrequently at high altitudes near the ecliptic but can form in a wide range of solar wind conditions and can occur up to two lunar radii downstream from the lunar limb. The compressional events, some of which may represent small-scale collisionless shocks ("limb shocks"), occur in both steady and variable interplanetary magnetic field (IMF) conditions, with those forming in steady IMF well organized by the location of lunar remanent crustal magnetization. The events observed by ARTEMIS have similarities to ion foreshock phenomena, and those observed in variable IMF conditions may result from either local lunar interactions or distant terrestrial foreshock interactions. Observed velocity deflections associated with compressional events are always outward from the lunar wake, regardless of location and solar wind conditions. However, events for which the observed velocity deflection is parallel to the upstream motional electric field form in distinctly different solar wind conditions and locations than events with antiparallel deflections. Consideration of the momentum transfer between incoming and reflected solar wind populations helps explain the observed characteristics of the different groups of events.Plain Language SummaryWe survey the environment around the Moon to determine when and where strong amplifications in the charged particle density and magnetic field strength occur. These structures may be some of the smallest shock waves in the solar system, and learning about their formation informs us about the interaction of charged particles with small-scale magnetic fields throughout the solar system and beyond. We find that these compressions occur in an extended region downstream from the lunar dawn and dusk regions and that they can form under a wide variety of solar wind conditions. However, we find that two distinctly different types of interactions occur for different magnetic field geometries and solar wind conditions. The two types of events appear to differ because of the different trajectories followed by solar wind protons that reflect from localized lunar magnetic fields and the resulting differences in how the incoming solar wind from upstream interacts with these reflected particles.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016JApA...37...14B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016JApA...37...14B"><span>Large Scale Earth's Bow Shock with Northern IMF as Simulated by PIC Code in Parallel with MHD Model</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Baraka, Suleiman</p> <p>2016-06-01</p> <p>In this paper, we propose a 3D kinetic model (particle-in-cell, PIC) for the description of the large scale Earth's bow shock. The proposed version is stable and does not require huge or extensive computer resources. Because PIC simulations work with scaled plasma and field parameters, we also propose to validate our code by comparing its results with the available MHD simulations under same scaled solar wind (SW) and (IMF) conditions. We report new results from the two models. In both codes the Earth's bow shock position is found to be ≈14.8 R E along the Sun-Earth line, and ≈29 R E on the dusk side. Those findings are consistent with past in situ observations. Both simulations reproduce the theoretical jump conditions at the shock. However, the PIC code density and temperature distributions are inflated and slightly shifted sunward when compared to the MHD results. Kinetic electron motions and reflected ions upstream may cause this sunward shift. Species distributions in the foreshock region are depicted within the transition of the shock (measured ≈2 c/ ω pi for Θ Bn = 90° and M MS = 4.7) and in the downstream. The size of the foot jump in the magnetic field at the shock is measured to be (1.7 c/ ω pi ). In the foreshocked region, the thermal velocity is found equal to 213 km s-1 at 15 R E and is equal to 63 km s -1 at 12 R E (magnetosheath region). Despite the large cell size of the current version of the PIC code, it is powerful to retain macrostructure of planets magnetospheres in very short time, thus it can be used for pedagogical test purposes. It is also likely complementary with MHD to deepen our understanding of the large scale magnetosphere.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018ApJ...857...36Y','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018ApJ...857...36Y"><span>Impact of Shock Front Rippling and Self-reformation on the Electron Dynamics at Low-Mach-number Shocks</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Yang, Zhongwei; Lu, Quanming; Liu, Ying D.; Wang, Rui</p> <p>2018-04-01</p> <p>Electron dynamics at low-Mach-number collisionless shocks are investigated by using two-dimensional electromagnetic particle-in-cell simulations with various shock normal angles. We found: (1) The reflected ions and incident electrons at the shock front provide an effective mechanism for the quasi-electrostatic wave generation due to the charge-separation. A fraction of incident electrons can be effectively trapped and accelerated at the leading edge of the shock foot. (2) At quasi-perpendicular shocks, the electron trapping and reflection is nonuniform due to the shock rippling along the shock surface and is more likely to take place at some locations accompanied by intense reflected ion-beams. The electron trapping process has a periodical evolution over time due to the shock front self-reformation, which is controlled by ion dynamics. Thus, this is a cross-scale coupling phenomenon. (3) At quasi-parallel shocks, reflected ions can travel far back upstream. Consequently, quasi-electrostatic waves can be excited in the shock transition and the foreshock region. The electron trajectory analysis shows these waves can trap electrons at the foot region and reflect a fraction of them far back upstream. Simulation runs in this paper indicate that the micro-turbulence at the shock foot can provide a possible scenario for producing the reflected electron beam, which is a basic condition for the type II radio burst emission at low-Mach-number interplanetary shocks driven by Coronal Mass Ejections (CMEs).</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_2");'>2</a></li> <li><a href="#" onclick='return showDiv("page_3");'>3</a></li> <li class="active"><span>4</span></li> <li><a href="#" onclick='return showDiv("page_5");'>5</a></li> <li><a href="#" onclick='return showDiv("page_6");'>6</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_4 --> <div id="page_5" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_3");'>3</a></li> <li><a href="#" onclick='return showDiv("page_4");'>4</a></li> <li class="active"><span>5</span></li> <li><a href="#" onclick='return showDiv("page_6");'>6</a></li> <li><a href="#" onclick='return showDiv("page_7");'>7</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="81"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2012AGUFM.S53A2481D','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2012AGUFM.S53A2481D"><span>A non-accelerating foreshock sequence followed by a short period of quiescence for a large inland earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Doi, I.; Kawakata, H.</p> <p>2012-12-01</p> <p>Laboratory experiments [e.g. Scholz, 1968; Lockner et al., 1992] and field observations [e.g. Dodge et al., 1996; Helmstetter and Sornette, 2003; Bouchon et al., 2011] have elucidated part of foreshock behavior and mechanism, but we cannot identify foreshocks while they are occurring. Recently, in Japan, a dense seismic network, Hi-net (High Sensitivity Seismograph Network), provides continuous waveform records for regional seismic events. The data from this network enable us to analyze small foreshocks which occur on long period time scales prior to a major event. We have an opportunity to grasp the more detailed pattern of foreshock generation. Using continuous waveforms recorded at a seismic station located in close proximity to the epicenter of the 2008 Iwate-Miyagi inland earthquake, we conducted a detailed investigation of its foreshocks. In addition to the two officially recognized foreshocks, calculation of cross-correlation coefficients between the continuous waveform record and one of the previously recognized foreshocks revealed that 20 micro foreshocks occurred within the same general area. Our analysis also shows that all of these foreshocks occurred within the same general area relative to the main event. Over the two week period leading up to the Iwate-Miyagi earthquake, such foreshocks only occurred during the last 45 minutes, specifically over a 35 minute period followed by a 10 minute period of quiescence just before the mainshock. We found no evidence of acceleration of this foreshock sequence. Rock fracturing experiments using a constant loading rate or creep tests have consistently shown that the occurrence rate of small fracturing events (acoustic emissions; AEs) increases before the main rupture [Scholz, 1968]. This accelerative pattern of preceding events was recognized in case of the 1999 Izmit earthquake [Bouchon et al., 2011]. Large earthquakes however need not be accompanied by acceleration of foreshocks if a given fault's host rock system has a negative feedback response to local loading. For example, the spatial distribution of AEs may remain constant during the nucleation phase of rock fracture under conditions of loading control [Lockner et al., 1992]. The host rock systems for faults inland may be stiffer than those undergoing deformation at plate interfaces. We think these differences in load responses between inland and inter-plate fault systems as critical factors in the contrasting foreshock patterns from the 1999 Izmit earthquake and the events analyzed in this study. Acknowledgements: We used waveform data of Hi-net, operated by National Research Institute for Earth Science and Disaster Prevention (NIED) in Japan. Hypocenter information determined by Japan Metrological Agency (JMA) was referred. We would like to express sincere gratitude to them.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EGUGA..19.5740U','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EGUGA..19.5740U"><span>3-D Spontaneous Rupture Simulations of the 2016 Kumamoto, Japan, Earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Urata, Yumi; Yoshida, Keisuke; Fukuyama, Eiichi</p> <p>2017-04-01</p> <p>We investigated the M7.3 Kumamoto, Japan, earthquake to illuminate why and how the rupture of the main shock propagated successfully by 3-D dynamic rupture simulations, assuming a complicated fault geometry estimated based on the distributions of aftershocks. The M7.3 main shock occurred along the Futagawa and Hinagu faults. A few days before, three M6-class foreshocks occurred. Their hypocenters were located along by the Hinagu and Futagawa faults and their focal mechanisms were similar to those of the main shock; therefore, an extensive stress shadow can have been generated on the fault plane of the main shock. First, we estimated the geometry of the fault planes of the three foreshocks as well as that of the main shock based on the temporal evolution of relocated aftershock hypocenters. Then, we evaluated static stress changes on the main shock fault plane due to the occurrence of the three foreshocks assuming elliptical cracks with constant stress drops on the estimated fault planes. The obtained static stress change distribution indicated that the hypocenter of the main shock is located on the region with positive Coulomb failure stress change (ΔCFS) while ΔCFS in the shallow region above the hypocenter was negative. Therefore, these foreshocks could encourage the initiation of the main shock rupture and could hinder the rupture propagating toward the shallow region. Finally, we conducted 3-D dynamic rupture simulations of the main shock using the initial stress distribution, which was the sum of the static stress changes by these foreshocks and the regional stress field. Assuming a slip-weakening law with uniform friction parameters, we conducted 3-D dynamic rupture simulations by varying the friction parameters and the values of the principal stresses. We obtained feasible parameter ranges to reproduce the rupture propagation of the main shock consistent with those revealed by seismic waveform analyses. We also demonstrated that the free surface encouraged the slip evolution of the main shock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19940033825&hterms=earth+magnetic+field&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dearth%2Bmagnetic%2Bfield','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19940033825&hterms=earth+magnetic+field&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dearth%2Bmagnetic%2Bfield"><span>High-time resolution measurements of upstream magnetic field and plasma conditions during flux transfer events at the Earth's dayside magnetopause</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Jacob, Jamey D.; Carrell, Cynthia</p> <p>1993-01-01</p> <p>We present preliminary results of a study of upstream magnetic field and plasma conditions measured by IRM during flux transfer events observed at the Earth's magnetopause by CCE. This study was designed to determine the importance of various upstream factors in the formation of bipolar magnetic field signatures called flux transfer events (FTEs). Six FTE encounters were examined. In three cases, the two satellites were on similar magnetic field lines. Preliminary investigation showed that fluctuations occurred in the Bz component of the interplanetary magnetic field (IMF) resulting in a southward field preceding the FTE in all three of these cases. In two of these cases, the changes were characterized by a distinct rotation from a strong southward to a strong northward field. There were also accompanying changes in the dynamic and thermal pressure in the solar wind immediately before the FTE was encountered. Examination of the 3D plasma distributions showed that these pulses were due to the addition of energetic upstreaming foreshock particles. There were no consistent changes in either Bz or the plasma pressure at IRM for the three events when the satellites were not connected by the IMF.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2006AGUSMSH21A..06K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2006AGUSMSH21A..06K"><span>Similarities and Differences between the Termination Foreshock/ Bow Shock and Planetary Bow Shocks</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Krimigis, S. M.; Decker, R. B.; Roelof, E. C.; Hill, M. E.</p> <p>2006-05-01</p> <p>It is now evident that Voyager 1 (V1) entered the termination foreshock (TFS) at ~~85 AU in mid-2002, exited this region in early 2003 and re-entered in the late 2003-early 2004 time frame, before finally crossing the termination shock (TS) at ~~94 AU on December 16, 2004. The TFS region is characterized by large intensities of tangentially outward-moving beams of energetic ions E > 40 keV, and generally isotropic electron intensity increases E > 350 keV (Krimigis et al, 2003; Decker et al, 2005). Elevated magnetic field intensities were observed throughout these periods (Burlaga et al, 2003, 2005) and comparison with particle pressures showed this region to be a high-beta plasma (Krimigis et al, 2004, 2005). Proximity of the TS was also evident from occasional electron plasma oscillations seen as early as 91 AU (Gurnett and Kurth, 2005). In this paper we examine the extent to which the TFS and TS exhibit properties seen in planetary bow shocks using data from Voyager?s flyby of the outer planets and Cassini data in the vicinity of Saturn. Magnetic field distributions in these high-beta regions appear to be Gaussian. A possible source for the TSF particles is the supertherma1 population residing in the heliosheath, similar to upstream ions observed leaking from planetary magnetospheres. Krimigis, S.M. et al, Nature, 426, pg 45-48, 2003. Decker, R. B. et al, Science, 309, 2020- 2024, 2005. Burlaga et al, Geophys. Res. Lett., 30, NO. 20, 2072, doi:10.1029/2003GL018291, 2003. Burlaga, L. F, et al, Science, 309, 2027-2029, 2005 Krimigis S. M., et al, V. Florinski, N. V. Pogorelov, and G. P. Zank (eds) CP719, American Institute of Physics, 0-7354-0199-3/04, 133-138, 2004. Krimigis, S. M., et al, Proceedings of the Solar Wind 11 / SOHO 16 Conference,12-17 June 2005, Whistler, Canada, , B. Fleck & T.H. Zurbuchen (eds), (ESA SP-592, September 2005) Gurnett, D. A., and W. S. Kurth, Science, 309, 2025- 2027, 2005</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20020086296','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20020086296"><span>Investigation of Solar Wind Correlations and Solar Wind Modifications Near Earth by Multi-Spacecraft Observations: IMP 8, WIND and INTERBALL-1</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Paularena, Karolen I.; Richardson, John D.; Zastenker, Georgy N.</p> <p>2002-01-01</p> <p>The foundation of this Project is use of the opportunity available during the ISTP (International Solar-Terrestrial Physics) era to compare solar wind measurements obtained simultaneously by three spacecraft - IMP 8, WIND and INTERBALL-1 at wide-separated points. Using these data allows us to study three important topics: (1) the size and dynamics of near-Earth mid-scale (with dimension about 1-10 million km) and small-scale (with dimension about 10-100 thousand km) solar wind structures; (2) the reliability of the common assumption that solar wind conditions at the upstream Lagrangian (L1) point accurately predict the conditions affecting Earth's magnetosphere; (3) modification of the solar wind plasma and magnetic field in the regions near the Earth magnetosphere, the foreshock and the magnetosheath. Our Project was dedicated to these problems. Our research has made substantial contributions to the field and has lead others to undertake similar work.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19830042540&hterms=lazarus&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAuthor-Name%26N%3D0%26No%3D90%26Ntt%3Dlazarus','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19830042540&hterms=lazarus&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAuthor-Name%26N%3D0%26No%3D90%26Ntt%3Dlazarus"><span>Solar wind deceleration and MHD turbulence in the earth's foreshock region - ISEE 1 and 2 and IMP 8 observations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Bonifazi, C.; Moreno, G.; Russell, C. T.; Lazarus, A. J.; Sullivan, J. D.</p> <p>1983-01-01</p> <p>The interaction of the solar wind with ions backstreaming from the earth's bow shock is investigated using plasma and magnetic field measurements on ISEE 1 and 2 and IMP 8 at widely separated positions in the earth's foreshock. This technique separates temporal and spatial variations within the foreshock. It is found that the solar wind acceleration associated with backstreaming ions is correlated with the amplitude of the MHD turbulence, and that the largest decelerations are seen close to the bow shock. The density of the backstreaming ion beam is strongly correlated with distance from the shock, and decreases by about a factor of three in a distance of about 3R(e).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2008JGRA..113.5101G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2008JGRA..113.5101G"><span>Distribution of escaping ions produced by non-specular reflection at the stationary quasi-perpendicular shock front</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Gedalin, M.; Liverts, M.; Balikhin, M. A.</p> <p>2008-05-01</p> <p>Field-aligned and gyrophase bunched ion beams are observed in the foreshock of the Earth bow shock. One of the mechanisms proposed for their production is non-specular reflection at the shock front. We study the distributions which are formed at the stationary quasi-perpendicular shock front within the same process which is responsible for the generation of reflected ions and transmitted gyrating ions. The test particle motion analysis in a model shock allows one to identify the parameters which control the efficiency of the process and the features of the escaping ion distribution. These parameters are: the angle between the shock normal and the upstream magnetic field, the ratio of the ion thermal velocity to the flow velocity upstream, and the cross-shock potential. A typical distribution of escaping ions exhibits a bimodal pitch angle distribution (in the plasma rest frame).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S21B0700L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S21B0700L"><span>Comparison of aftershock sequences between 1975 Haicheng earthquake and 1976 Tangshan earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Liu, B.</p> <p>2017-12-01</p> <p>The 1975 ML 7.3 Haicheng earthquake and the 1976 ML 7.8 Tangshan earthquake occurred in the same tectonic unit. There are significant differences in spatial-temporal distribution, number of aftershocks and time duration for the aftershock sequence followed by these two main shocks. As we all know, aftershocks could be triggered by the regional seismicity change derived from the main shock, which was caused by the Coulomb stress perturbation. Based on the rate- and state- dependent friction law, we quantitative estimated the possible aftershock time duration with a combination of seismicity data, and compared the results from different approaches. The results indicate that, aftershock time durations from the Tangshan main shock is several times of that form the Haicheng main shock. This can be explained by the significant relationship between aftershock time duration and earthquake nucleation history, normal stressand shear stress loading rateon the fault. In fact the obvious difference of earthquake nucleation history from these two main shocks is the foreshocks. 1975 Haicheng earthquake has clear and long foreshocks, while 1976 Tangshan earthquake did not have clear foreshocks. In that case, abundant foreshocks may mean a long and active nucleation process that may have changed (weakened) the rocks in the source regions, so they should have a shorter aftershock sequences for the reason that stress in weak rocks decay faster.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2010AGUFM.S53E..07S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2010AGUFM.S53E..07S"><span>Correlation of Foreshock Occurrence with Mainshock Depth, Rake, and Magnitude from the High Precision Catalog for Northern California</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Schaff, D. P.; Waldhauser, F.; Lerner-Lam, A.</p> <p>2010-12-01</p> <p>Foreshocks are perhaps the best-documented and most undisputed precursors to some large earthquakes. The question remains, however, if foreshocks have any more predictive power for future mainshocks than any other earthquake. Several researchers argue for a single unifying triggering law for foreshocks, mainshocks, and aftershocks. An alternate model is that foreshocks are the byproduct of an aseismic pre-slip phase that scales with mainshock magnitude. In this case foreshocks are different than other earthquakes and have predictive value for the mainshock location, origin time, and magnitude. We examine 612 mainshocks with M ≥ 4 from the cross-correlation double-difference catalog for northern California. 235 (44%) of these had foreshock sequences, providing us with a data set more than an order of magnitude larger than those used in previous studies. We are able to confirm with improved accuracy correlations of foreshock occurrence and characteristics with depth. The proportion of mainshocks with associated foreshocks, the number of foreshocks in the sequence, the foreshock duration, and the foreshock radius in map view all decrease with increasing depth, all with statistical significance above 95%. This supports models where increasing normal stress due to lithostatic load inhibits foreshock occurrence. Other M ≥ 4 events that were classified as aftershocks of larger events did not show the depth dependence. However, our analysis does not confirm a previous observation that increased normal stress due to tectonic loading appears to inhibit foreshock occurrence. We observe a negative correlation of foreshock magnitude with foreshock duration which is consistent with a model of mainshocks triggered by increased pore pressure. We observe a statistically significant relationship between foreshock magnitude and mainshock magnitude, lending support to the pre-slip model.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19950016411','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19950016411"><span>Langmuir-like waves and radiation in planetary foreshocks</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cairns, Iver H.; Robinson, P. A.; Anderson, R. R.; Gurnett, D. A.; Kurth, W. S.</p> <p>1995-01-01</p> <p>The basic objectives of this NASA Grant are to develop theoretical understandings (tested with spacecraft data) of the generation and characteristics of electron plasma waves, commonly known as Langmuir-like waves, and associated radiation near f(sub p) and 2f(sub p) in planetary foreshocks. (Here f(sub p) is plasma frequency.) Related waves and radiation in the source regions of interplanetary type III solar radio bursts provide a simpler observational and theoretical context for developing and testing such understandings. Accordingly, applications to type III bursts constitute a significant fraction of the research effort. The testing of the new Stochastic Growth Theory (SGT) for type III bursts, and its extension and testing for foreshock waves and radiation, constitutes a major longterm strategic goal of the research effort.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70096613','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70096613"><span>Observations of static Coulomb stress triggering of the November 2011 M5.7 Oklahoma earthquake sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Sumy, Danielle F.; Cochran, Elizabeth S.; Keranen, Katie M.; Wei, Maya; Abers, Geoffrey A.</p> <p>2014-01-01</p> <p>In November 2011, a M5.0 earthquake occurred less than a day before a M5.7 earthquake near Prague, Oklahoma, which may have promoted failure of the mainshock and thousands of aftershocks along the Wilzetta fault, including a M5.0 aftershock. The M5.0 foreshock occurred in close proximity to active fluid injection wells; fluid injection can cause a buildup of pore fluid pressure, decrease the fault strength, and may induce earthquakes. Keranen et al. [2013] links the M5.0 foreshock with fluid injection, but the relationship between the foreshock and successive events has not been investigated. Here we examine the role of coseismic Coulomb stress transfer on earthquakes that follow the M5.0 foreshock, including the M5.7 mainshock. We resolve the static Coulomb stress change onto the focal mechanism nodal plane that is most consistent with the rupture geometry of the three M ≥ 5.0 earthquakes, as well as specified receiver fault planes that reflect the regional stress orientation. We find that Coulomb stress is increased, e.g., fault failure is promoted, on the nodal planes of ~60% of the events that have focal mechanism solutions, and more specifically, that the M5.0 foreshock promoted failure on the rupture plane of the M5.7 mainshock. We test our results over a range of effective coefficient of friction values. Hence, we argue that the M5.0 foreshock, induced by fluid injection, potentially triggered a cascading failure of earthquakes along the complex Wilzetta fault system.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017APS..DPPQI2004D','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017APS..DPPQI2004D"><span>First Satellite Measurement of the ULF Wave Growth Rate in the Ion Foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Dorfman, Seth</p> <p>2017-10-01</p> <p>Waves generated by accelerated particles are important throughout our heliosphere. These particles often gain their energy at shocks via Fermi acceleration. At the Earth's bow shock, this mechanism accelerates ion beams back into the solar wind; the beams can then generate ultra low frequency (ULF) waves via an ion-ion right hand resonant instability. These waves influence the shock structure and particle acceleration, lead to coherent structures in the magnetosheath, and are ideal for non-linear interaction studies relevant to turbulence. We report the first satellite measurement of the ultralow frequency (ULF) wave growth rate in the upstream region of the Earth's bow shock. This is made possible by employing the two ARTEMIS spacecraft orbiting the moon at 60 Earth radii from Earth to characterize crescent-shaped reflected ion beams and relatively monochromatic ULF waves. The event to be presented features spacecraft separation of 2.5 Earth radii (0.9 +/- 0.1 wavelengths) in the solar wind flow direction along a nearly radial interplanetary magnetic field. By contrast, most prior ULF wave observations use spacecraft with insufficient separation to see wave growth and are so close to Earth (within 30 Earth radii) that waves convected from different events interfere. Using ARTEMIS data, the ULF wave growth rate is estimated and found to fall within dispersion solver predictions during the initial growth time. Observed frequencies and wave numbers are within the predicted range. Other ULF wave properties such as the phase speed, obliquity, and polarization are consistent with expectations from resonant beam instability theory and prior satellite measurements. These results not only advance our understanding of the foreshock, but will also inform future nonlinear studies related to turbulence and dissipation in the heliosphere. Supported by NASA, NASA Eddy Postdoctoral Fellowship.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28694472','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28694472"><span>The Pawnee earthquake as a result of the interplay among injection, faults and foreshocks.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Chen, Xiaowei; Nakata, Nori; Pennington, Colin; Haffener, Jackson; Chang, Jefferson C; He, Xiaohui; Zhan, Zhongwen; Ni, Sidao; Walter, Jacob I</p> <p>2017-07-10</p> <p>The Pawnee M5.8 earthquake is the largest event in Oklahoma instrument recorded history. It occurred near the edge of active seismic zones, similar to other M5+ earthquakes since 2011. It ruptured a previously unmapped fault and triggered aftershocks along a complex conjugate fault system. With a high-resolution earthquake catalog, we observe propagating foreshocks leading to the mainshock within 0.5 km distance, suggesting existence of precursory aseismic slip. At approximately 100 days before the mainshock, two M ≥ 3.5 earthquakes occurred along a mapped fault that is conjugate to the mainshock fault. At about 40 days before, two earthquakes clusters started, with one M3 earthquake occurred two days before the mainshock. The three M ≥ 3 foreshocks all produced positive Coulomb stress at the mainshock hypocenter. These foreshock activities within the conjugate fault system are near-instantaneously responding to variations in injection rates at 95% confidence. The short time delay between injection and seismicity differs from both the hypothetical expected time scale of diffusion process and the long time delay observed in this region prior to 2016, suggesting a possible role of elastic stress transfer and critical stress state of the fault. Our results suggest that the Pawnee earthquake is a result of interplay among injection, tectonic faults, and foreshocks.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014AGUFM.S41C4496Y','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014AGUFM.S41C4496Y"><span>Imaging and Understanding Foreshock and Aftershock Behavior Around the 2014 Iquique, Northern Chile, Earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Yang, H.; Meng, X.; Peng, Z.; Newman, A. V.; Hu, S.; Williamson, A.</p> <p>2014-12-01</p> <p>On April 1st, 2014, a moment magnitude (MW) 8.2 earthquake occurred offshore Iquique, Northern Chile. There were numerous smaller earthquakes preceding and following the mainshock, making it an ideal case to study the spatio-temporal relation among these events and their association with the mainshock. We applied a matched-filter technique to detect previously missing foreshocks and aftershocks of the 2014 Iquique earthquake. Using more than 900 template events recorded by 19 broadband seismic stations (network code CX) operated by the GEOFON Program of GFZ Potsdam, we found 4392 earthquakes between March 1st and April 3rd, 2014, including more than 30 earthquakes with magnitude larger than 4 that were previously missed in the catalog from the Chile National Seismological Center. Additionally, we found numerous small earthquakes with magnitudes between 1 and 2 preceding the largest foreshock, an MW 6.7 event occurring on March 16th, approximately 2 weeks before the Iquique mainshock. We observed that the foreshocks migrated northward at a speed of approximately 6 km/day. Using a finite fault slip model of the mainshock determined from teleseismic waveform inversion (Hayes, 2014), we calculated the Coulomb stress changes in the nearby regions of the mainshock. We found that there was ~200% increase in seismicity in the areas with increased Coulomb stress. Our next step is to evaluate the Coulomb stress changes associated with earlier foreshocks and their roles in triggering later foreshocks, and possibly the mainshock. For this, we plan to create a fault model of the temporal evolution of the Coulomb behavior along the interface with time, assuming Wells and Coppersmith (1994) type fault parameters. These results will be compared with double-difference relocations (using HypoDD), presenting a more accurate understanding of the spatial-temporal evolution of foreshocks and aftershocks of the 2014 Iquique earthquake.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19900043505&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19900043505&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dforeshock"><span>Measurement of the electron beam mode in earth's foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Onsager, T. G.; Holzworth, R. H.</p> <p>1990-01-01</p> <p>High frequency electric field measurements from the AMPTE IRM plasma wave receiver are used to identify three simultaneously excited electrostatic wave modes in the earth's foreshock region: the electron beam mode, the Langmuir mode, and the ion acoustic mode. A technique is developed which allows the rest frame frequecy and wave number of the electron beam waves to be determined. It is shown that the experimentally determined rest frame frequency and wave number agree well with the most unstable frequency and wave number predicted by linear homogeneous Vlasov theory for a plasma with Maxwellian background electrons and a Lorentzian electron beam. From a comparison of the experimentally determined and theoretical values, approximate limits are put on the electron foreshock beam temperatures. A possible generation mechanism for ion acoustic waves involving mode coupling between the electron beam and Langmuir modes is also discussed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EP%26S...69..150U','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EP%26S...69..150U"><span>3-D dynamic rupture simulations of the 2016 Kumamoto, Japan, earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Urata, Yumi; Yoshida, Keisuke; Fukuyama, Eiichi; Kubo, Hisahiko</p> <p>2017-11-01</p> <p>Using 3-D dynamic rupture simulations, we investigated the 2016 Mw7.1 Kumamoto, Japan, earthquake to elucidate why and how the rupture of the main shock propagated successfully, assuming a complicated fault geometry estimated on the basis of the distributions of the aftershocks. The Mw7.1 main shock occurred along the Futagawa and Hinagu faults. Within 28 h before the main shock, three M6-class foreshocks occurred. Their hypocenters were located along the Hinagu and Futagawa faults, and their focal mechanisms were similar to that of the main shock. Therefore, an extensive stress shadow should have been generated on the fault plane of the main shock. First, we estimated the geometry of the fault planes of the three foreshocks as well as that of the main shock based on the temporal evolution of the relocated aftershock hypocenters. We then evaluated the static stress changes on the main shock fault plane that were due to the occurrence of the three foreshocks, assuming elliptical cracks with constant stress drops on the estimated fault planes. The obtained static stress change distribution indicated that Coulomb failure stress change (ΔCFS) was positive just below the hypocenter of the main shock, while the ΔCFS in the shallow region above the hypocenter was negative. Therefore, these foreshocks could encourage the initiation of the main shock rupture and could hinder the propagation of the rupture toward the shallow region. Finally, we conducted 3-D dynamic rupture simulations of the main shock using the initial stress distribution, which was the sum of the static stress changes caused by these foreshocks and the regional stress field. Assuming a slip-weakening law with uniform friction parameters, we computed 3-D dynamic rupture by varying the friction parameters and the values of the principal stresses. We obtained feasible parameter ranges that could reproduce the characteristic features of the main shock rupture revealed by seismic waveform analyses. We also observed that the free surface encouraged the slip evolution of the main shock.[Figure not available: see fulltext.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFMSM34A..01H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFMSM34A..01H"><span>Kinetic Interactions Between the Solar Wind and Lunar Magnetic Fields</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Halekas, J. S.; Poppe, A. R.; Fatemi, S.; Turner, D. L.; Holmstrom, M.</p> <p>2016-12-01</p> <p>Despite their relatively weak strength, small scale, and incoherence, lunar magnetic anomalies can affect the incoming solar wind flow. The plasma interaction with lunar magnetic fields drives significant compressions of the solar wind plasma and magnetic field, deflections of the incoming flow, and a host of plasma waves ranging from the ULF to the electrostatic range. Recent work suggests that the large-scale features of the solar wind-magnetic anomaly interactions may be driven by ion-ion instabilities excited by reflected ions, raising the possibility that they are analogous to ion foreshock phenomena. Indeed, despite their small scale, many of the phenomena observed near lunar magnetic anomalies appear to have analogues in the foreshock regions of terrestrial planets. We discuss the charged particle distributions, fields, and waves observed near lunar magnetic anomalies, and place them in a context with the foreshocks of the Earth, Mars, and other solar system objects.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JGRA..122.1531M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JGRA..122.1531M"><span>Martian electron foreshock from MAVEN observations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Meziane, K.; Mazelle, C. X.; Romanelli, N.; Mitchell, D. L.; Espley, J. R.; Connerney, J. E. P.; Hamza, A. M.; Halekas, J.; McFadden, J. P.; Jakosky, B. M.</p> <p>2017-02-01</p> <p>Flux enhancements of energetic electrons are always observed when the Mars Atmosphere and Volatile EvolutioN (MAVEN) spacecraft is magnetically connected to the shock. The observations indicate that the foreshock electrons consist of two populations. The most energetic (E≥237 eV) originate from a narrow region at the nearly perpendicular shock. They always appear as spikes, and their flux level reaches a maximum when the angle θBn approaches 90°. The other population emanates from the entire Martian bow shock surface, and the flux level decreases slightly from the quasi-parallel to quasi-perpendicular regions. A detailed examination of the pitch angle distribution shows that the enhanced fluxes are associated with electrons moving sunward. Annulus centered along the interplanetary magnetic field direction is the most stringent feature of the 3-D angular distribution. The gyrotropic character is observed over the whole range of shock geometry. Although such signatures in the electron pitch angle distribution function strongly suggest that the reflection off the shock of a fraction of the solar wind electrons is the main mechanism for the production of Martian foreshock electrons, the decay of the flux of the second population on the other hand has yet to be understood.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2010AGUFMSM11A1676P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2010AGUFMSM11A1676P"><span>Simultaneous Traveling Convection Vortex (TCV) Events and Pc 1-2 Wave Bursts at Cusp/Cleft Latitudes observed in Arctic Canada and Svalbard</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Posch, J. L.; Witte, A. J.; Engebretson, M. J.; Murr, D.; Lessard, M.; Raita, T.; Singer, H. J.</p> <p>2010-12-01</p> <p>Traveling convection vortices (TCVs), which appear in ground magnetometer records at near-cusp latitudes as solitary ~5 mHz pulses, are now known to originate in instabilities in the ion foreshock just upstream of Earth’s bow shock. They can also stimulate compressions or relaxations of the dayside magnetosphere (evident in geosynchronous satellite data). These transient compressions can in turn sharply increase the growth rate of electromagnetic ion cyclotron (EMIC) waves, which also appear in ground records at near-cusp latitudes as bursts of Pc 1-2 pulsations. In this study we have identified simultaneous TCV - Pc 1-2 burst events occurring from 2008 through the first 7 months of 2010 in Eastern Arctic Canada and Svalbard, using a combination of fluxgate magnetometers (MACCS and IMAGE) and search coil magnetometers in each region. Magnetometer observations at GOES 10 and 12, at longitudes near the MACCS sites, are also used to characterize the strength of the magnetic perturbations. There is no direct proportion between the amplitude of TCV and Pc 1-2 wave events in either region, consistent with the highly variable densities and pitch angle distributions of plasma of ring current / plasma sheet energies in the outer dayside magnetosphere.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFM.S21B2697T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFM.S21B2697T"><span>Spatio-temporal foreshock activity during stick-slip experiments of large rock samples</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tsujimura, Y.; Kawakata, H.; Fukuyama, E.; Yamashita, F.; Xu, S.; Mizoguchi, K.; Takizawa, S.; Hirano, S.</p> <p>2016-12-01</p> <p>Foreshock activity has sometimes been reported for large earthquakes, and has been roughly classified into the following two classes. For shallow intraplate earthquakes, foreshocks occurred in the vicinity of the mainshock hypocenter (e.g., Doi and Kawakata, 2012; 2013). And for intraplate subduction earthquakes, foreshock hypocenters migrated toward the mainshock hypocenter (Kato, et al., 2012; Yagi et al., 2014). To understand how foreshocks occur, it is useful to investigate the spatio-temporal activities of foreshocks in the laboratory experiments under controlled conditions. We have conducted stick-slip experiments by using a large-scale biaxial friction apparatus at NIED in Japan (e.g., Fukuyama et al., 2014). Our previous results showed that stick-slip events repeatedly occurred in a run, but only those later events were preceded by foreshocks. Kawakata et al. (2014) inferred that the gouge generated during the run was an important key for foreshock occurrence. In this study, we proceeded to carry out stick-slip experiments of large rock samples whose interface (fault plane) is 1.5 meter long and 0.5 meter wide. After some runs to generate fault gouge between the interface. In the current experiments, we investigated spatio-temporal activities of foreshocks. We detected foreshocks from waveform records of 3D array of piezo-electric sensors. Our new results showed that more than three foreshocks (typically about twenty) had occurred during each stick-slip event, in contrast to the few foreshocks observed during previous experiments without pre-existing gouge. Next, we estimated the hypocenter locations of the stick-slip events, and found that they were located near the opposite end to the loading point. In addition, we observed a migration of foreshock hypocenters toward the hypocenter of each stick-slip event. This suggests that the foreshock activity observed in our current experiments was similar to that for the interplate earthquakes in terms of the spatio-temporal pattern. This work was supported by NIED research project "Development of monitoring and forecasting technology for crustal activity", JSPS KAKENHI Grant Number 23340131, and MEXT of Japan, under its Earthquake and Volcano Hazards Observation and Research Program.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_3");'>3</a></li> <li><a href="#" onclick='return showDiv("page_4");'>4</a></li> <li class="active"><span>5</span></li> <li><a href="#" onclick='return showDiv("page_6");'>6</a></li> <li><a href="#" onclick='return showDiv("page_7");'>7</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_5 --> <div id="page_6" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_4");'>4</a></li> <li><a href="#" onclick='return showDiv("page_5");'>5</a></li> <li class="active"><span>6</span></li> <li><a href="#" onclick='return showDiv("page_7");'>7</a></li> <li><a href="#" onclick='return showDiv("page_8");'>8</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="101"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016PApGe.173.3247P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016PApGe.173.3247P"><span>Foreshock Patterns Preceding Great Earthquakes in the Subduction Zone of Chile</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Papadopoulos, G. A.; Minadakis, G.</p> <p>2016-10-01</p> <p>Foreshock activity is considered as one of the most promising precursory changes for the main shock prediction in the short term. Averaging over several foreshock sequences has shown that foreshocks are characterized by distinct 3D patterns: their epicenters move towards the main shock epicenter, event count accelerates, and b-value drops. However, these space-time-size patterns were verified so far only in a very few individual cases mainly due to inadequate seismicity catalogue data. We have investigated 3D foreshock patterns before the M w 8.8 Maule in 27 February 2010, M w 8.1 Iquique in 1 April 2014, and M w 8.4 Illapel in 16 September 2015 great earthquakes in the Chile subduction zone. To avoid biased results, no a priori spatiotemporal definitions of foreshocks were inserted. The procedure was based on pattern recognition from statistically significant seismicity changes in the three domains. The pattern recognition in one domain was independent of the pattern recognition in another domain. We found and verified with two independent catalogue data sets (CSN, IPOC) that within a critical area of ca. 65 km from the main shock epicenter, the 2014 event was preceded by distinct foreshock 3D patterns. A nearly weak foreshock stage (20 January-14 March 2014) was followed by a main-strong stage (15 March-1 April 2014) highly significant in all domains, although foreshock activity slightly decreased in about the last 5 days. Seismic moment release also accelerated in the last stage due to the occurrence of a cluster of very strong foreshock events. Foreshock activity very likely occurred in the hanging-wall fault domain on the South American Plate overriding Nazca Plate. The 2014 foreshock activity was quite similar to the one preceding the 6 Apr. 2009 L' Aquila (Italy) M w 6.3 earthquake associated with normal faulting. Using the 2014 earthquake as a reference event, we observed that similar foreshock 3D patterns preceded the 2010 and 2015 earthquakes within critical distances of about 170 and 50 km, respectively. However, the foreshock activities were only weak in both the cases likely because of poor catalogue completeness.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFMSM11A2276T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFMSM11A2276T"><span>Characteristics of Energetic Particle Acceleration in Hot Flow Anomalies Observed by MMS</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Turner, D. L.; Schwartz, S. J.; Wilson, L. B., III; Liu, T. Z.; Osmane, A.; Fennell, J. F.; Blake, J. B.; Jaynes, A. N.; Goodrich, K.; Mauk, B.; Gershman, D. J.; Avanov, L. A.; Strangeway, R. J.; Torbert, R. B.; Burch, J. L.; Leonard, T. W.</p> <p>2017-12-01</p> <p>During its orbital transits with apogees on Earth's dayside, NASA's Magnetospheric Multiscale (MMS) mission captured high resolution observations from several transient ion foreshock phenomena, including multiple hot flow anomalies (HFAs). With MMS' four identically instrumented spacecraft, those events offer unprecedented multipoint observations and resolution of plasma, energetic particles, and electric and magnetic fields and waves within and around HFAs. In this presentation, we compare and contrast the geometries and characteristics of fully-developed HFAs observed by MMS in the interest of determining which HFAs are most efficient at accelerating energetic particles (i.e. >1 to 100s of keV electrons, protons, and heavy ions) and how those HFAs may do so. In particular, we focus on: 1) the orientation of the fast magnetosonic shocks and wave activity that form at the upstream edge of HFAs and 2) how the unique structures and activity characteristic of HFAs may result in enhanced acceleration of energetic particles via shock acceleration processes and shock-shock interactions between the HFA shock and Earth's bow shock. The results of this study are of interest to previous studies of foreshock transients from missions such as THEMIS and Cluster, are relevant to the dayside science objectives of the MMS extended mission, and may have implications for energetic particle acceleration at other astrophysical shocks throughout the Universe.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015PhDT.......519S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015PhDT.......519S"><span>Laboratory studies of frictional sliding and the implications of precursory seismicity</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Selvadurai, Paul A.</p> <p></p> <p>The dynamic transition from slow to rapid sliding along a frictional interface is of interest to geophysicists, engineers and scientists alike. In our direct shear experiment, we simulated a pre-existing frictional fault similar to those occurring naturally in the Earth. The laboratory study reported here has incorporated appropriate sensors that can detect foreshock events on the fringe of a nucleation zone prior to a gross fault rupture (main shock). During loading we observed foreshocks sequences as slip transitioned from slow to rapid sliding. These laboratory-induced foreshocks showed similar acoustic characteristics and spatio-temporal evolution as those detected in nature. Through direct observation (video camera), foreshocks were found to be the rapid, localized (millimeter length scale) failure of highly stresses asperities formed along the interface. The interface was created by the meshing of two rough polymethyl methacrylate (PMMA) bodies in a direct shear configuration. A carefully calibrated pressure sensitive film was used to map the contact junctions (asperities) throughout the interface at a range of applied normal loads Fn. Foreshocks were found to coalesce in a region of the fault that exhibited a more dense distribution of asperities (referred to as the seismogenic region). Microscopy of the interface in the seismogenic region displayed a variety of surface roughness at various length scales. This may have been introduced from the surface preparation techniques use to create a mature interface. The mature interface consisted of 'flat-topped' asperity regions with separating sharp valleys. The 'flat-topped' sections spanned millimetric length scales and were considerably flatter (nanometric roughness) that the roughness exhibited at longer length scales (tens of millimeters). We believe that the smoother, 'flat-topped' sections were responsible for the individual asperity formation (determining their size and strength), whereas the longer length scale roughness influenced the asperity-asperity interaction during the nucleation phase. Asperities in the seismogenic region where shown to exist close enough to each other so that elastic communication (through the off-fault material) could not be neglected. Prior to gross fault rupture (i.e. mainshock), we measured the propagation of a slow nucleating rupture into the relatively 'locked', seimsogenic region of the fault. Slow slip dynamics were captured using slip sensors placed along the fault that measured a non-uniform slip profile leading up to failure. We found that the propagation of the slow rupture into the locked region was dependent on the normal force Fn. Higher Fn was found to slow the propagation of shear rupture into the locked region. Within the relatively 'locked' region, a noticeable increase in size and a more compact spatial-temporal distribution of foreshocks were measured when Fn was increased. In order to develop an understanding of the relationship between Fn and the resistance of the fault to slow rupture, a quasi-static finite element (FE) model was developed. The model used distributions of asperities measured directly from the pressure sensitive film in a small section of the interface where foreshocks coalesced; specifically, the region where the slowly propagating slip front encountered the more dense distribution of asperities. A single asperity was modeled and followed the Cattaneo partial slip asperity solution. As the shear force increased along the fault, the asperities in this model were able to accommodate tangential slip by entering a partial sliding regime; the central contact of the asperities remained adhered while sliding accumulated along its periphery. Partial slip on the asperity propagated inwards as the shear force was incrementally increased. A further increase in the shear force caused the asperity to enter a full sliding condition. Increasing confining loads caused increased stiffness and increased capacity to store potential shear strain energy -- a possible measure of the 'degree of coupling' between the fault surfaces. Physics from the numerical model followed the qualitative observations made using photometry of asperities along the interface, which visualized asperities in the 'locked' region -- larger asperities remained stuck throughout the loading cycle and the light transmitted through individual asperities decreased from the periphery as shear loads increased. The numerical partial slip, quantified by the potential energy stored by the asperity, increased relative to the normal pressure p. Asperity-asperity interactions were modeled along the interface using a quasi-static analysis. Progression of slip into the asperity field was increasingly inhibited as the normal confining force Fn was increased. The computational model provided an explanation as to why an increased confining force Fn could result in an increased resistance to slow rupture as well as an increased potential for larger foreshocks within the resistive, relatively 'locked' section of a fault. This study lays the foundation for more innovative laboratory work that could potentially improve the phenomenological models currently used to estimate earthquake hazard. (Abstract shortened by UMI.).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2011AGUFMSH53B2051G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2011AGUFMSH53B2051G"><span>Kinetic Simulations of Type II Radio Burst Emission Processes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ganse, U.; Spanier, F. A.; Vainio, R. O.</p> <p>2011-12-01</p> <p>The fundamental emission process of Type II Radio Bursts has been under discussion for many decades. While analytic deliberations point to three wave interaction as the source for fundamental and harmonic radio emissions, sparse in-situ observational data and high computational demands for kinetic simulations have not allowed for a definite conclusion to be reached. A popular model puts the radio emission into the foreshock region of a coronal mass ejection's shock front, where shock drift acceleration can create eletrcon beam populations in the otherwise quiescent foreshock plasma. Beam-driven instabilities are then assumed to create waves, forming the starting point of three wave interaction processes. Using our kinetic particle-in-cell code, we have studied a number of emission scenarios based on electron beam populations in a CME foreshock, with focus on wave-interaction microphysics on kinetic scales. The self-consistent, fully kinetic simulations with completely physical mass-ratio show fundamental and harmonic emission of transverse electromagnetic waves and allow for detailled statistical analysis of all contributing wavemodes and their couplings.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19890024139&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19890024139&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dforeshock"><span>Formation of the wave compressional boundary in the earth's foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Skadron, George; Holdaway, Robert D.; Lee, Martin A.</p> <p>1988-01-01</p> <p>Using an evolutionary model and allowing for nonuniform proton injection and wave growth rates, the compressional wave boundaries corresponding to IMF inclinations to the solar wind of theta(BV) equal to 45 and 25 deg were located. The compressional boundaries deduced from this model were found to support the results of Greenstadt and Baum (1986) who have concluded that the observed compressional boundaries are incompatible with wave growth at a fixed growth rate, due to the interaction of a uniform beam with the solar wind. The results indicate, however, that the compressional boundaries are quite compatible with nonuniform beams and growth rates which result from the coupled evolution of the energetic protons and the waves with which they interact. It was found that, in the solar wind frame, the dominant wave-particle interaction in the outer foreshock is the damping of inward propagating (toward the shock) left-polarized waves, producing a magnetically quiet region immediately downstream of the foreshock boundary.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013AGUFM.G31C..05O','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013AGUFM.G31C..05O"><span>Geodetic characteristic of the postseismic deformation following the interplate large earthquake along the Japan Trench (Invited)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ohta, Y.; Hino, R.; Ariyoshi, K.; Matsuzawa, T.; Mishina, M.; Sato, T.; Inazu, D.; Ito, Y.; Tachibana, K.; Demachi, T.; Miura, S.</p> <p>2013-12-01</p> <p>On March 9, 2011 at 2:45 (UTC), an M7.3 interplate earthquake (hereafter foreshock) occurred ~45 km northeast of the epicenter of the M9.0 2011 Tohoku earthquake. This foreshock preceded the 2011 Tohoku earthquake by 51 hours. Ohta et al., (2012, GRL) estimated co- and postseismic afterslip distribution based on a dense GPS network and ocean bottom pressure gauge sites. They found the afterslip distribution was mainly concentrated in the up-dip extension of the coseismic slip. The coseismic slip and afterslip distribution of the foreshock were also located in the slip deficit region (between 20-40m slip) of the coiseismic slip of the M9.0 mainshock. The slip amount for the afterslip is roughly consistent with that determined by repeating earthquake analysis carried out in a previous study (Kato et al., 2012, Science). The estimated moment release for the afterslip reached magnitude 6.8, even within a short time period of 51 hours. They also pointed out that a volumetric strainmeter time series suggests that this event advanced with a rapid decay time constant (4.8 h) compared with other typical large earthquakes. The decay time constant of the afterslip may reflect the frictional property of the plate interface, especially effective normal stress controlled by fluid. For verification of the short decay time constant of the foreshock, we investigated the postseismic deformation characteristic following the 1989 and 1992 Sanriku-Oki earthquakes (M7.1 and M6.9), 2003 and 2005 Miyagi-Oki earthquakes (M6.8 and M7.2), and 2008 Fukushima-Oki earthquake (M6.9). We used four components extensometer at Miyako (39.59N, 141.98E) on the Sanriku coast for 1989 and 1992 event. For 2003, 2005 and 2008 events, we used volumetric strainmeter at Kinka-zan (38.27N, 141.58E) and Enoshima (38.27N, 141.60E). To extract the characteristics of the postseismic deformation, we fitted the logarithmic function. The estimated decay time constants for each earthquake had almost similar range (1-15 h) with the foreshock of the 2011 Tohoku earthquake (4.8h), but relatively small compared with the typical interplate earthquakes. The comparison of decay time constant with other typical large interplate earthquakes is very difficult because of difference in the observation sensors such as GPS and strainmeter. In any case, decay time constant of postseismic deformation for the foreshock of the 2011 Tohoku earthquake is not anomalous compared with other events in this region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25119049','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25119049"><span>Gradual unlocking of plate boundary controlled initiation of the 2014 Iquique earthquake.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Schurr, Bernd; Asch, Günter; Hainzl, Sebastian; Bedford, Jonathan; Hoechner, Andreas; Palo, Mauro; Wang, Rongjiang; Moreno, Marcos; Bartsch, Mitja; Zhang, Yong; Oncken, Onno; Tilmann, Frederik; Dahm, Torsten; Victor, Pia; Barrientos, Sergio; Vilotte, Jean-Pierre</p> <p>2014-08-21</p> <p>On 1 April 2014, Northern Chile was struck by a magnitude 8.1 earthquake following a protracted series of foreshocks. The Integrated Plate Boundary Observatory Chile monitored the entire sequence of events, providing unprecedented resolution of the build-up to the main event and its rupture evolution. Here we show that the Iquique earthquake broke a central fraction of the so-called northern Chile seismic gap, the last major segment of the South American plate boundary that had not ruptured in the past century. Since July 2013 three seismic clusters, each lasting a few weeks, hit this part of the plate boundary with earthquakes of increasing peak magnitudes. Starting with the second cluster, geodetic observations show surface displacements that can be associated with slip on the plate interface. These seismic clusters and their slip transients occupied a part of the plate interface that was transitional between a fully locked and a creeping portion. Leading up to this earthquake, the b value of the foreshocks gradually decreased during the years before the earthquake, reversing its trend a few days before the Iquique earthquake. The mainshock finally nucleated at the northern end of the foreshock area, which skirted a locked patch, and ruptured mainly downdip towards higher locking. Peak slip was attained immediately downdip of the foreshock region and at the margin of the locked patch. We conclude that gradual weakening of the central part of the seismic gap accentuated by the foreshock activity in a zone of intermediate seismic coupling was instrumental in causing final failure, distinguishing the Iquique earthquake from most great earthquakes. Finally, only one-third of the gap was broken and the remaining locked segments now pose a significant, increased seismic hazard with the potential to host an earthquake with a magnitude of >8.5.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19910062345&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19910062345&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dforeshock"><span>The earth's foreshock, bow shock, and magnetosheath</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Onsager, T. G.; Thomsen, M. F.</p> <p>1991-01-01</p> <p>Studies directly pertaining to the earth's foreshock, bow shock, and magnetosheath are reviewed, and some comparisons are made with data on other planets. Topics considered in detail include the electron foreshock, the ion foreshock, the quasi-parallel shock, the quasi-perpendicular shock, and the magnetosheath. Information discussed spans a broad range of disciplines, from large-scale macroscopic plasma phenomena to small-scale microphysical interactions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA216256','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA216256"><span>Particle Simulations in Magnetospheric Plasmas</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1989-12-18</p> <p>Foreshock As an application of the simulation method used in the proposed research (Broadband electrostatic noise), the beam instability in the... foreshock has been investigated. Electrons backstreaming into the Earth’s foreshock generate waves near the plasma frequency by the beam instability. Two...results and numerical solutions of the dispersion equation indicate that the center frequency of the intense narrowband waves near the foreshock boundary</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24526224','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24526224"><span>The debate on the prognostic value of earthquake foreshocks: a meta-analysis.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Mignan, Arnaud</p> <p>2014-02-14</p> <p>The hypothesis that earthquake foreshocks have a prognostic value is challenged by simulations of the normal behaviour of seismicity, where no distinction between foreshocks, mainshocks and aftershocks can be made. In the former view, foreshocks are passive tracers of a tectonic preparatory process that yields the mainshock (i.e., loading by aseismic slip) while in the latter, a foreshock is any earthquake that triggers a larger one. Although both processes can coexist, earthquake prediction is plausible in the first case while virtually impossible in the second. Here I present a meta-analysis of 37 foreshock studies published between 1982 and 2013 to show that the justification of one hypothesis or the other depends on the selected magnitude interval between minimum foreshock magnitude m(min) and mainshock magnitude M. From this literature survey, anomalous foreshocks are found to emerge when m(min) < M - 3.0. These results suggest that a deviation from the normal behaviour of seismicity may be observed only when microseismicity is considered. These results are to be taken with caution since the 37 studies do not all show the same level of reliability. These observations should nonetheless encourage new research in earthquake predictability with focus on the potential role of microseismicity.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA206252','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA206252"><span>Particle Simulations of Magnetospheric Plasmas</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1989-03-14</p> <p>scale vortices. 2 2. Beam Instability in the Foreshock As an application of the simulation method used in the proposed research (Broadband...electrostatic noise), the beam instability in the foreshock has been investigated. Electrons backstreaming into the Earth’s foreshock generate waves near the...narrowband waves near the foreshock boundary may be between 0.9wp and 0.98wpe, rather than being above w., as previously believed. 3 3. Whistler Mode</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFM.S21A2685N','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFM.S21A2685N"><span>Real-time Mainshock Forecast by Statistical Discrimination of Foreshock Clusters</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Nomura, S.; Ogata, Y.</p> <p>2016-12-01</p> <p>Foreshock discremination is one of the most effective ways for short-time forecast of large main shocks. Though many large earthquakes accompany their foreshocks, discreminating them from enormous small earthquakes is difficult and only probabilistic evaluation from their spatio-temporal features and magnitude evolution may be available. Logistic regression is the statistical learning method best suited to such binary pattern recognition problems where estimates of a-posteriori probability of class membership are required. Statistical learning methods can keep learning discreminating features from updating catalog and give probabilistic recognition of forecast in real time. We estimated a non-linear function of foreshock proportion by smooth spline bases and evaluate the possibility of foreshocks by the logit function. In this study, we classified foreshocks from earthquake catalog by the Japan Meteorological Agency by single-link clustering methods and learned spatial and temporal features of foreshocks by the probability density ratio estimation. We use the epicentral locations, time spans and difference in magnitudes for learning and forecasting. Magnitudes of main shocks are also predicted our method by incorporating b-values into our method. We discuss the spatial pattern of foreshocks from the classifier composed by our model. We also implement a back test to validate predictive performance of the model by this catalog.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3924212','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3924212"><span>The debate on the prognostic value of earthquake foreshocks: A meta-analysis</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Mignan, Arnaud</p> <p>2014-01-01</p> <p>The hypothesis that earthquake foreshocks have a prognostic value is challenged by simulations of the normal behaviour of seismicity, where no distinction between foreshocks, mainshocks and aftershocks can be made. In the former view, foreshocks are passive tracers of a tectonic preparatory process that yields the mainshock (i.e., loading by aseismic slip) while in the latter, a foreshock is any earthquake that triggers a larger one. Although both processes can coexist, earthquake prediction is plausible in the first case while virtually impossible in the second. Here I present a meta-analysis of 37 foreshock studies published between 1982 and 2013 to show that the justification of one hypothesis or the other depends on the selected magnitude interval between minimum foreshock magnitude mmin and mainshock magnitude M. From this literature survey, anomalous foreshocks are found to emerge when mmin < M − 3.0. These results suggest that a deviation from the normal behaviour of seismicity may be observed only when microseismicity is considered. These results are to be taken with caution since the 37 studies do not all show the same level of reliability. These observations should nonetheless encourage new research in earthquake predictability with focus on the potential role of microseismicity. PMID:24526224</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018EP%26S...70...90T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018EP%26S...70...90T"><span>Characteristics of foreshock activity inferred from the JMA earthquake catalog</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tamaribuchi, Koji; Yagi, Yuji; Enescu, Bogdan; Hirano, Shiro</p> <p>2018-05-01</p> <p>We investigated the foreshock activity characteristics using the Japan Meteorological Agency Unified Earthquake Catalog for the last 20 years. Using the nearest-neighbor distance approach, we systematically and objectively classified the earthquakes into clustered and background seismicity. We further categorized the clustered events into foreshocks, mainshocks, and aftershocks and analyzed their statistical features such as the b-value of the frequency-magnitude distribution. We found that the b-values of the foreshocks are lower than those of the aftershocks. This b-value difference suggested that not only the stochastic cascade effect but also the stress changes/aseismic processes may contribute to the mainshock-triggering process. However, forecasting the mainshock based on b-value analysis may be difficult. In addition, the rate of foreshock occurrence in all clusters (with two or more events) was nearly constant (30-40%) over a wide magnitude range. The difference in the magnitude, time, and epicentral distance between the mainshock and largest foreshock followed a power law. We inferred that the distinctive characteristics of foreshocks can be better revealed using the improved catalog, which includes the micro-earthquake information.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016EGUGA..1813520M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016EGUGA..1813520M"><span>Foreshock patterns preceding large earthquakes in the subduction zone of Chile</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Minadakis, George; Papadopoulos, Gerassimos A.</p> <p>2016-04-01</p> <p>Some of the largest earthquakes in the globe occur in the subduction zone of Chile. Therefore, it is of particular interest to investigate foreshock patterns preceding such earthquakes. Foreshocks in Chile were recognized as early as 1960. In fact, the giant (Mw9.5) earthquake of 22 May 1960, which was the largest ever instrumentally recorded, was preceded by 45 foreshocks in a time period of 33h before the mainshock, while 250 aftershocks were recorded in a 33h time period after the mainshock. Four foreshocks were bigger than magnitude 7.0, including a magnitude 7.9 on May 21 that caused severe damage in the Concepcion area. More recently, Brodsky and Lay (2014) and Bedford et al. (2015) reported on foreshock activity before the 1 April 2014 large earthquake (Mw8.2). However, 3-D foreshock patterns in space, time and size were not studied in depth so far. Since such studies require for good seismic catalogues to be available, we have investigated 3-D foreshock patterns only before the recent, very large mainshocks occurring on 27 February 2010 (Mw 8.8), 1 April 2014 (Mw8.2) and 16 September 2015 (Mw8.4). Although our analysis does not depend on a priori definition of short-term foreshocks, our interest focuses in the short-term time frame, that is in the last 5-6 months before the mainshock. The analysis of the 2014 event showed an excellent foreshock sequence consisting by an early-weak foreshock stage lasting for about 1.8 months and by a main-strong precursory foreshock stage that was evolved in the last 18 days before the mainshock. During the strong foreshock period the seismicity concentrated around the mainshock epicenter in a critical area of about 65 km mainly along the trench domain to the south of the mainshock epicenter. At the same time, the activity rate increased dramatically, the b-value dropped and the mean magnitude increased significantly, while the level of seismic energy released also increased. In view of these highly significant seismicity changes we used the 1 April 2014 large earthquake as a reference event when examining the 2015 and 2010 large Chilean earthquakes. This consideration is also justified by that the 3-D patterns revealed before the 2014 earthquake are quite similar to the ones that preceded the M = 6.3 L'Aquila (Italy) mainshock of 6 April 2009. The 2015 large event was preceded only by a weak foreshock sequence while no statistically significant foreshock activity was detected before the 2010 large mainshock. It is not clear so far if these different results are due to geophysical factors or to the fact that the catalogue completeness is much better in the area of the 2014 event than in the areas of 2010 and 2015 events. This is a contribution of the research project EARTHWARN, funded by the Institute of Geodynamics, National Observatory of Athens, Greece.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA101743','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA101743"><span>Broadband Discrimination Studies</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1976-03-01</p> <p>Oroville. This low seismicity continued through initial loading of nearby Oroville Dam in 1967-68 and until the first foreshock on June 28, 1975...Twenty-one foreshocks (ML > 1.6), the largest of magnitude 4.7, preceded the magnitude 5.7 main shock of 01 August. All foreshocks and aftershocks of ML...preceded by foreshocks beginning on June 28, 1975, the largest of which had ML = 3.5 (Table 1); the sequence appeared to have died out (only five events</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19920059725&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19920059725&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dforeshock"><span>Outer heliospheric radio emissions. II - Foreshock source models</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cairns, Iver H.; Kurth, William S.; Gurnett, Donald A.</p> <p>1992-01-01</p> <p>Observations of LF radio emissions in the range 2-3 kHz by the Voyager spacecraft during the intervals 1983-1987 and 1989 to the present while at heliocentric distances greater than 11 AU are reported. New analyses of the wave data are presented, and the characteristics of the radiation are reviewed and discussed. Two classes of events are distinguished: transient events with varying starting frequencies that drift upward in frequency and a relatively continuous component that remains near 2 kHz. Evidence for multiple transient sources and for extension of the 2-kHz component above the 2.4-kHz interference signal is presented. The transient emissions are interpreted in terms of radiation generated at multiples of the plasma frequency when solar wind density enhancements enter one or more regions of a foreshock sunward of the inner heliospheric shock. Solar wind density enhancements by factors of 4-10 are observed. Propagation effects, the number of radiation sources, and the time variability, frequency drift, and varying starting frequencies of the transient events are discussed in terms of foreshock sources.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2010AGUFM.S43A2031R','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2010AGUFM.S43A2031R"><span>The seismic velocity structure of a foreshock zone on an oceanic transform fault: Imaging a rupture barrier to the 2008 Mw 6.0 earthquake on the Gofar fault, EPR</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Roland, E. C.; McGuire, J. J.; Lizarralde, D.; Collins, J. A.</p> <p>2010-12-01</p> <p>East Pacific Rise (EPR) oceanic transform faults are known to exhibit a number of unique seismicity characteristics, including abundant seismic swarms, a prevalence of aseismic slip, and high rates of foreshock activity. Until recently the details of how this behavior fits into the seismic cycle of large events that occur periodically on transforms have remained poorly understood. In 2008 the most recent seismic cycle of the western segment (G3) of the Gofar fault (4 degrees South on the EPR) ended with a Mw 6.0 earthquake. Seismicity associated with this event was recorded by a local array of ocean bottom seismometers, and earthquake locations reveal several distinct segments with unique slip behavior on the G3 fault. Preceding the Mw 6.0 event, a significant foreshock sequence was recorded just to the east of the mainshock rupture zone that included more than 20,000 detected earthquakes. This foreshock zone formed the eastern barrier to the mainshock rupture, and following the mainshock, seismicity rates within the foreshock zone remained unchanged. Based on aftershock locations of events following the 2007 Mw 6.0 event that completed the seismic cycle on the eastern end of the G3 fault, it appears that the same foreshock zone may have served as the western rupture barrier for that prior earthquake. Moreover, mainshock rupture associated with each of the last 8 large (~ Mw 6.0) events on the G3 fault seems to terminate at the same foreshock zone. In order to elucidate some of the structural controls on fault slip and earthquake rupture along transform faults, we present a seismic P-wave velocity profile crossing the center of the foreshock zone of the Gofar fault, as well as a profile for comparison across the neighboring Quebrada fault. Although tectonically similar, Quebrada does not sustain large earthquakes and is thought to accommodate slip primarily aseismically and with small magnitude earthquake swarms. Velocity profiles were obtained using data collected from ~100 km refraction profiles crossing the two faults, each using 8 short period ocean bottom seismometers from OBSIP and over 900 shots from the RV Marcus Langseth. These data are modeled using a 2-D tomographic code that allows joint inversion of the Pg, PmP, and Pn arrivals. We resolve a significant low velocity zone associated with the faults, which likely indicates rocks that have undergone intensive brittle deformation. Low velocities may also signify the presence of metamorphic alteration and/or elevated fluid pressures, both of which could have a significant affect on the friction laws that govern fault slip in these regions. A broad low velocity zone is apparent in the shallow crust (< 3km) at both faults, with velocities that are reduced by more than 1 km/s relative to the surrounding oceanic crust. A narrower zone of reduced seismic velocity appears to extend to mantle depths, and particularly on the Gofar fault, this corresponds with the seismogenic zone inferred from located foreshock seismicity, spanning depths of 3-9 km beneath the seafloor.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70012410','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70012410"><span>A change in fault-plane orientation between foreshocks and aftershocks of the Galway Lake earthquake, ML = 5.2, 1975, Mojave desert, California</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Fuis, G.S.; Lindh, A.G.</p> <p>1979-01-01</p> <p>A marked change is observed in P/SV amplitude ratios, measured at station TPC, from foreshocks to aftershocks of the Galway Lake earthquake. This change is interpreted to be the result of a change in fault-plane orientation occurring between foreshocks and aftershocks. The Galway Lake earthquake, ML= 5.2, occurred on June 1, 1975. The first-motion fault-plane solutions for the main shock and most foreshocks and aftershocks indicate chiefly right-lateral strike-slip on NNW-striking planes that dip steeply, 70-90??, to the WSW. The main event was preceded by nine located foreshocks, ranging in magnitude from 1.9 to 3.4, over a period of 12 weeks, starting on March 9, 1975. All of the foreshocks form a tight cluster approximately 1 km in diameter. This cluster includes the main shock. Aftershocks are distributed over a 6-km-long fault zone, but only those that occurred inside the foreshock cluster are used in this study. Seismograms recorded at TPC (?? = 61 km), PEC (?? = 93 km), and CSP (?? = 83 km) are the data used here. The seismograms recorded at TPC show very consistent P/SV amplitude ratios for foreshocks. For aftershocks the P/SV ratios are scattered, but generally quite different from foreshock ratios. Most of the scatter for the aftershocks is confined to the two days following the main shock. Thereafter, however, the P/SV ratios are consistently half as large as for foreshocks. More subtle (and questionable) changes in the P/SV ratios are observed at PEC and CSP. Using theoretical P/SV amplitude ratios, one can reproduce the observations at TPC, PEC and CSP by invoking a 5-12?? counterclockwise change in fault strike between foreshocks and aftershocks. This interpretation is not unique, but it fits the data better than invoking, for example, changes in dip or slip angle. First-motion data cannot resolve this small change, but they permit it. Attenuation changes would appear to be ruled out by the fact that changes in the amplitude ratios, PTPC/PPEC and ptpc/pcsp, are observed, and these changes accompany the changes in P/SV. Observations for the Galway Lake earthquake are similar to observations for the Oroville, California, earthquake (ML = 5.7) of August 1, 1975, and the Brianes Hills, California, earthquake (ML = 4.3) of January 8, 1977 (Lindh et al., Science Vol. 201, pp. 56-59). A change in fault-plane orientation between foreshocks and aftershocks may be understandable in terms of early en-echelon cracking (foreshocks) giving way to shear on the main fault plane (main shock plus aftershocks). Recent laboratory data (Byerlee et al., Tectonophysics, Vol. 44, pp. 161-171) tend to support this view. ?? 1979.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014AGUFM.S31D4454M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014AGUFM.S31D4454M"><span>Dual Megathrust Slip Behaviors of the 2014 Iquique Earthquake Sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Meng, L.; Huang, H.; Burgmann, R.; Ampuero, J. P.; Strader, A. E.</p> <p>2014-12-01</p> <p>The transition between seismic rupture and aseismic creep is of central interest to better understand the mechanics of subduction processes. A M 8.2 earthquake occurred on April 1st, 2014 in the Iquique seismic gap of Northern Chile. This event was preceded by a 2-week-long foreshock sequence including a M 6.7 earthquake. Repeating earthquakes are found among the foreshock sequence that migrated towards the mainshock area, suggesting a large scale slow-slip event on the megathrust preceding the mainshock. The variations of the recurrence time of repeating earthquakes highlights the diverse seismic and aseismic slip behaviors on different megathrust segments. The repeaters that were active only before the mainshock recurred more often and were distributed in areas of substantial coseismic slip, while other repeaters occurred both before and after the mainshock in the area complementary to the mainshock rupture. The spatial and temporal distribution of the repeating earthquakes illustrate the essential role of propagating aseismic slip in leading up to the mainshock and aftershock activities. Various finite fault models indicate that the coseismic slip generally occurred down-dip from the foreshock activity and the mainshock hypocenter. Source imaging by teleseismic back-projection indicates an initial down-dip propagation stage followed by a rupture-expansion stage. In the first stage, the finite fault models show slow initiation with low amplitude moment rate at low frequency (< 0.1 Hz), while back-projection shows a steady initiation at high frequency (> 0.5 Hz). This indicates frequency-dependent manifestations of seismic radiation in the low-stress foreshock region. In the second stage, the high-frequency rupture remains within an area of low gravity anomaly, suggesting possible upper-crustal structures that promote high-frequency generation. Back-projection also shows an episode of reverse rupture propagation which suggests a delayed failure of asperities in the foreshock area. Our results highlight the complexity of the interactions between large-scale aseismic slow-slip and dynamic ruptures of megathrust earthquakes.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_4");'>4</a></li> <li><a href="#" onclick='return showDiv("page_5");'>5</a></li> <li class="active"><span>6</span></li> <li><a href="#" onclick='return showDiv("page_7");'>7</a></li> <li><a href="#" onclick='return showDiv("page_8");'>8</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_6 --> <div id="page_7" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_5");'>5</a></li> <li><a href="#" onclick='return showDiv("page_6");'>6</a></li> <li class="active"><span>7</span></li> <li><a href="#" onclick='return showDiv("page_8");'>8</a></li> <li><a href="#" onclick='return showDiv("page_9");'>9</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="121"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.bssaonline.org/content/84/3/892.abstract','USGSPUBS'); return false;" href="http://www.bssaonline.org/content/84/3/892.abstract"><span>Foreshocks, aftershocks, and earthquake probabilities: Accounting for the landers earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Jones, Lucile M.</p> <p>1994-01-01</p> <p>The equation to determine the probability that an earthquake occurring near a major fault will be a foreshock to a mainshock on that fault is modified to include the case of aftershocks to a previous earthquake occurring near the fault. The addition of aftershocks to the background seismicity makes its less probable that an earthquake will be a foreshock, because nonforeshocks have become more common. As the aftershocks decay with time, the probability that an earthquake will be a foreshock increases. However, fault interactions between the first mainshock and the major fault can increase the long-term probability of a characteristic earthquake on that fault, which will, in turn, increase the probability that an event is a foreshock, compensating for the decrease caused by the aftershocks.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFMMR41B2702T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFMMR41B2702T"><span>Foreshock search over a long duration using a method of setting appropriate criteria</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Toyomoto, Y.; Kawakata, H.; Hirano, S.; Doi, I.</p> <p>2016-12-01</p> <p>Recently, small foreshocks have been detected using cross-correlation techniques (e.g., Bouchon et al., 2011) in which the foreshocks are identified when the cross-correlation coefficient (CC) exceeded a certain threshold. For some shallow intraplate earthquakes, foreshocks whose hypocenters were estimated to be adjacent to the main shock hypocenter were detected from several tens of minutes before the main shock occurrence (Doi and Kawakata, 2012; 2013). At least two problems remain in the cross-correlation techniques employed. First, previous studies on foreshocks used data whose durations are at most a month (Kato et al., 2013); this is insufficient to check if such events occurred only before the main shock occurrence or not. Second, CC is used for detection criteria without considering validity of the threshold. In this study, we search for foreshocks of an M 5.4 earthquake in central Nagano prefecture in Japan on June 30, 2011 with a vertical-component waveform at N.MWDH (Hi-net) station due to one of the cataloged foreshocks (M 1) as a template to calculate CC. We calculate CC between the template and continuous waveforms of the same component at the same station for two years before the main shock occurrence, and we try to overcome the problems mentioned above. We find that histogram of CC is well modeled with the normal distribution, which is similar to previous studies on tremors (e.g., Ohta and Ide, 2008). According to the model, the expected number of misdetection is less than 1 when CC > 0.63. Therefore, we regard that the waveform is due to a foreshock when CC > 0.63. As a result, foreshocks are detected only within thirteen hours immediately before the main shock occurrence for the two years. By setting an appropriate threshold, we conclude that foreshocks just before the main shock occurrence are not stationary events. Acknowledgments: We use continuous waveform records of NIED high sensitivity seismograph network in Japan (Hi-net) and the JMA unified hypocenter catalogs. This work is supported by MEXT of Japan, under its Earthquake and Volcano Hazards Observation and Research Program.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S51A0583N','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S51A0583N"><span>Initiation process of the Mw 6.2 central Tottori, Japan, earthquake on October 21, 2016: Stress transfer due to its largest foreshock of Mw 4.1</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Noda, S.; Ellsworth, W. L.</p> <p>2017-12-01</p> <p>On October 21, 2016, a strike-slip earthquake with Mw 6.2 occurred in the central Tottori prefecture, Japan. It was preceded by a foreshock sequence that began with a Mw 4.1 event, the largest earthquake for the sequence, and lasted about two hours. According to the JMA catalog, the largest foreshock had a similar focal mechanism as the mainshock and was located in the immediate vicinity of the mainshock hypocenter. The goal of this study is to understand the relationship between the foreshock and the initial rupture of the mainshock. We first determine the relative hypocenter distance between the foreshock and mainshock using the P-wave onsets on Hi-net station records. The initiation points of the two events are likely about 100 m apart according to the current results, but could be closer. Within the location uncertainty, they might either be coplanar or on subparallel planes. Next, we obtain the slip-history models from a kinematic inversion method using empirical Green's functions derived from other foreshocks with M 2.2 - 2.4. The Mw 4.1 foreshock and Mw 6.2 mainshock started in a similar way until approximately 0.2 s after their onsets. For the foreshock, the rapid growth stage completed by 0.2 s even though the rupture propagation continued for 0.4 - 0.5 s longer (note that 0.2 s is significantly shorter than the typical source duration of a Mw 4.1 earthquake). On the other hand, the mainshock rupture continued to grow rapidly after 0.2 s. The comparison between the relative hypocenter locations and the slip models shows that the mainshock nucleated within the area strongly effected by both static and dynamic stress changes created by the foreshock. We also find that the mainshock initially propagated away from the foreshock hypocenter. We consider that the stress transfer process is a key to understand the mainshock nucleation as well as its rupture growth process.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014AGUFM.S21D..03H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014AGUFM.S21D..03H"><span>Numerical Investigation of Earthquake Nucleation on a Laboratory-Scale Heterogeneous Fault with Rate-and-State Friction</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Higgins, N.; Lapusta, N.</p> <p>2014-12-01</p> <p>Many large earthquakes on natural faults are preceded by smaller events, often termed foreshocks, that occur close in time and space to the larger event that follows. Understanding the origin of such events is important for understanding earthquake physics. Unique laboratory experiments of earthquake nucleation in a meter-scale slab of granite (McLaskey and Kilgore, 2013; McLaskey et al., 2014) demonstrate that sample-scale nucleation processes are also accompanied by much smaller seismic events. One potential explanation for these foreshocks is that they occur on small asperities - or bumps - on the fault interface, which may also be the locations of smaller critical nucleation size. We explore this possibility through 3D numerical simulations of a heterogeneous 2D fault embedded in a homogeneous elastic half-space, in an attempt to qualitatively reproduce the laboratory observations of foreshocks. In our model, the simulated fault interface is governed by rate-and-state friction with laboratory-relevant frictional properties, fault loading, and fault size. To create favorable locations for foreshocks, the fault surface heterogeneity is represented as patches of increased normal stress, decreased characteristic slip distance L, or both. Our simulation results indicate that one can create a rate-and-state model of the experimental observations. Models with a combination of higher normal stress and lower L at the patches are closest to matching the laboratory observations of foreshocks in moment magnitude, source size, and stress drop. In particular, we find that, when the local compression is increased, foreshocks can occur on patches that are smaller than theoretical critical nucleation size estimates. The additional inclusion of lower L for these patches helps to keep stress drops within the range observed in experiments, and is compatible with the asperity model of foreshock sources, since one would expect more compressed spots to be smoother (and hence have lower L). In this heterogeneous rate-and-state fault model, the foreshocks interact with each other and with the overall nucleation process through their postseismic slip. The interplay amongst foreshocks, and between foreshocks and the larger-scale nucleation process, is a topic of our future work.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70019048','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70019048"><span>Rupture directivity and slip distribution of the M 4.3 foreshock to the 1992 Joshua Tree earthquake, Southern California</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Mori, J.</p> <p>1996-01-01</p> <p>Details of the M 4.3 foreshock to the Joshua Tree earthquake were studied using P waves recorded on the Southern California Seismic Network and the Anza network. Deconvolution, using an M 2.4 event as an empirical Green's function, corrected for complicated path and site effects in the seismograms and produced simple far-field displacement pulses that were inverted for a slip distribution. Both possible fault planes, north-south and east-west, for the focal mechanism were tested by a least-squares inversion procedure with a range of rupture velocities. The results showed that the foreshock ruptured the north-south plane, similar to the mainshock. The foreshock initiated a few hundred meters south of the mainshock and ruptured to the north, toward the mainshock hypocenter. The mainshock (M 6.1) initiated near the northern edge of the foreshock rupture 2 hr later. The foreshock had a high stress drop (320 to 800 bars) and broke a small portion of the fault adjacent to the mainshock but was not able to immediately initiate the mainshock rupture.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S34B..07Y','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S34B..07Y"><span>Two types of foreshock activities observed on meter-scale laboratory faults: Slow-slip-driven and cascade-up</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Yamashita, F.; Fukuyama, E.; Xu, S.; Kawakata, H.; Mizoguchi, K.; Takizawa, S.</p> <p>2017-12-01</p> <p>We report two types of foreshock activities observed on meter-scale laboratory experiments: slow-slip-driven type and cascade-up type. We used two rectangular metagabbro blocks as experimental specimens, whose nominal contacting area was 1.5 m long and 0.1 m wide. To monitor stress changes and seismic activities on the fault, we installed dense arrays of 32 triaxial rosette strain gauges and 64 PZT seismic sensors along the fault. We repeatedly conducted experiments with the same pair of rock specimens, causing the evolution of damage on the fault. We focus on two experiments successively conducted under the same loading condition (normal stress of 6.7 MPa and loading rate of 0.01 mm/s) but different initial fault surface conditions; the first experiment preserved the gouge generated from the previous experiment while the second experiment started with all gouge removed. Note that the distribution of gouge was heterogeneous, because we did not make the gouge layer uniform. We observed many foreshocks in both experiments, but found that the b-value of foreshocks was smaller in the first experiment with pre-existing gouge (PEG). In the second experiment without PEG, we observed premonitory slow slip associated with nucleation process preceding most main events by the strain measurements. We also found that foreshocks were triggered by the slow slip at the end of the nucleation process. In the experiment with PEG, on the contrary, no clear premonitory slow slips were found. Instead, foreshock activity accelerated towards the main event, as confirmed by a decreasing b-value. Spatiotemporal distribution of foreshock hypocenters suggests that foreshocks migrated and cascaded up to the main event. We infer that heterogeneous gouge distribution caused stress-concentrated and unstable patches, which impeded stable slow slip but promoted foreshocks on the fault. Further, our results suggest that b-value is a useful parameter for characterizing these observations.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70174954','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70174954"><span>The Iquique earthquake sequence of April 2014: Bayesian modeling accounting for prediction uncertainty</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Duputel, Zacharie; Jiang, Junle; Jolivet, Romain; Simons, Mark; Rivera, Luis; Ampuero, Jean-Paul; Riel, Bryan; Owen, Susan E; Moore, Angelyn W; Samsonov, Sergey V; Ortega Culaciati, Francisco; Minson, Sarah E.</p> <p>2016-01-01</p> <p>The subduction zone in northern Chile is a well-identified seismic gap that last ruptured in 1877. On 1 April 2014, this region was struck by a large earthquake following a two week long series of foreshocks. This study combines a wide range of observations, including geodetic, tsunami, and seismic data, to produce a reliable kinematic slip model of the Mw=8.1 main shock and a static slip model of the Mw=7.7 aftershock. We use a novel Bayesian modeling approach that accounts for uncertainty in the Green's functions, both static and dynamic, while avoiding nonphysical regularization. The results reveal a sharp slip zone, more compact than previously thought, located downdip of the foreshock sequence and updip of high-frequency sources inferred by back-projection analysis. Both the main shock and the Mw=7.7 aftershock did not rupture to the trench and left most of the seismic gap unbroken, leaving the possibility of a future large earthquake in the region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19990063683&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D10%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19990063683&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D10%26Ntt%3Dforeshock"><span>Strong Evidence for Stochastic Growth of Langmuir-Like Waves in Earth's Foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cairns, Iver H.; Robinson, P. A.</p> <p>1999-01-01</p> <p>Bursty Langmuir-like waves driven by electron beams in Earth's foreshock have properties which are inconsistent with the standard plasma physics paradigm of uniform exponential growth saturated by nonlinear processes. Here it is demonstrated for a specific period that stochastic growth theory (SGT) quantitatively describes these waves throughout a large fraction of the foreshock. The statistical wave properties are inconsistent with nonlinear processes or self-organized criticality being important. SGT's success in explaining the foreshock waves and type III solar bursts suggests that SGT is widely applicable to wave growth in space, astrophysical, and laboratory plasmas.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014AGUFM.S21D..07O','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014AGUFM.S21D..07O"><span>Comparing Foreshock Characteristics and Foreshock Forecasting in Observed and Simulated Earthquake Catalogs</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ogata, Y.</p> <p>2014-12-01</p> <p>In our previous papers (Ogata et al., 1995, 1996, 2012; GJI), we characterized foreshock activity in Japan, and then presented a model that forecasts the probability that one or more earthquakes form a foreshock sequence; then we tested prospectively foreshock probabilities in the JMA catalog. In this talk, I compare the empirical results with results for synthetic catalogs in order to clarify whether or not these results are consistent with the description of the seismicity by a superposition of background activity and epidemic-type aftershock sequences (ETAS models). This question is important, because it is still controversially discussed whether the nucleation process of large earthquakes is driven by seismically cascading (ETAS-type) or by aseismic accelerating processes. To explore the foreshock characteristics, I firstly applied the same clustering algorithms to real and synthetic catalogs and analyzed the temporal, spatial and magnitude distributions of the selected foreshocks, to find significant differences particularly in the temporal acceleration and magnitude dependence. Finally, I calculated forecast scores based on a single-link cluster algorithm which could be appropriate for real-time applications. I find that the JMA catalog yields higher scores than all synthetic catalogs and that the ETAS models having the same magnitude sequence as the original catalog performs significantly better (more close to the reality) than ETAS-models with randomly picked magnitudes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2010NHESS..10...19P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2010NHESS..10...19P"><span>Strong foreshock signal preceding the L'Aquila (Italy) earthquake (M_w~6.3) of 6~April~2009</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Papadopoulos, G. A.; Charalampakis, M.; Fokaefs, A.; Minadakis, G.</p> <p>2010-01-01</p> <p>We used the earthquake catalogue of INGV extending from 1 January 2006 to 30 June 2009 to detect significant changes before and after the 6 April 2009 L'Aquila mainshock (Mw=6.3) in the seismicity rate, r (events/day), and in b-value. The statistical z-test and Utsu-test were applied to identify significant changes. From the beginning of 2006 up to the end of October 2008 the activity was relatively stable and remained in the state of background seismicity (r=1.14, b=1.09). From 28 October 2008 up to 26 March 2009, r increased significantly to 2.52 indicating weak foreshock sequence; the b-value did not changed significantly. The weak foreshock sequence was spatially distributed within the entire seismogenic area. In the last 10 days before the mainshock, strong foreshock signal became evident in space (dense epicenter concentration in the hanging-wall of the Paganica fault), in time (drastic increase of r to 21.70 events/day) and in size (b-value dropped significantly to 0.68). The significantly high seismicity rate and the low b-value in the entire foreshock sequence make a substantial difference from the background seismicity. Also, the b-value of the strong foreshock stage (last 10 days before mainshock) was significantly lower than that in the aftershock sequence. Our results indicate the important value of the foreshock sequences for the prediction of the mainshock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015E%26PSL.411..177M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015E%26PSL.411..177M"><span>Dual megathrust slip behaviors of the 2014 Iquique earthquake sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Meng, Lingsen; Huang, Hui; Bürgmann, Roland; Ampuero, Jean Paul; Strader, Anne</p> <p>2015-02-01</p> <p>The transition between seismic rupture and aseismic creep is of central interest to better understand the mechanics of subduction processes. A Mw 8.2 earthquake occurred on April 1st, 2014 in the Iquique seismic gap of northern Chile. This event was preceded by a long foreshock sequence including a 2-week-long migration of seismicity initiated by a Mw 6.7 earthquake. Repeating earthquakes were found among the foreshock sequence that migrated towards the mainshock hypocenter, suggesting a large-scale slow-slip event on the megathrust preceding the mainshock. The variations of the recurrence times of the repeating earthquakes highlight the diverse seismic and aseismic slip behaviors on different megathrust segments. The repeaters that were active only before the mainshock recurred more often and were distributed in areas of substantial coseismic slip, while repeaters that occurred both before and after the mainshock were in the area complementary to the mainshock rupture. The spatiotemporal distribution of the repeating earthquakes illustrates the essential role of propagating aseismic slip leading up to the mainshock and illuminates the distribution of postseismic afterslip. Various finite fault models indicate that the largest coseismic slip generally occurred down-dip from the foreshock activity and the mainshock hypocenter. Source imaging by teleseismic back-projection indicates an initial down-dip propagation stage followed by a rupture-expansion stage. In the first stage, the finite fault models show an emergent onset of moment rate at low frequency (< 0.1 Hz), while back-projection shows a steady increase of high frequency power (> 0.5 Hz). This indicates frequency-dependent manifestations of seismic radiation in the low-stress foreshock region. In the second stage, the rupture expands in rich bursts along the rim of a semi-elliptical region with episodes of re-ruptures, suggesting delayed failure of asperities. The high-frequency rupture remains within an area of local high trench-parallel gravity anomaly (TPGA), suggesting the presence of subducting seamounts that promote high-frequency generation. Our results highlight the complexity of the interactions between large-scale aseismic slow-slip and dynamic ruptures of megathrust earthquakes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/15791246','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/15791246"><span>Foreshock sequences and short-term earthquake predictability on East Pacific Rise transform faults.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>McGuire, Jeffrey J; Boettcher, Margaret S; Jordan, Thomas H</p> <p>2005-03-24</p> <p>East Pacific Rise transform faults are characterized by high slip rates (more than ten centimetres a year), predominantly aseismic slip and maximum earthquake magnitudes of about 6.5. Using recordings from a hydroacoustic array deployed by the National Oceanic and Atmospheric Administration, we show here that East Pacific Rise transform faults also have a low number of aftershocks and high foreshock rates compared to continental strike-slip faults. The high ratio of foreshocks to aftershocks implies that such transform-fault seismicity cannot be explained by seismic triggering models in which there is no fundamental distinction between foreshocks, mainshocks and aftershocks. The foreshock sequences on East Pacific Rise transform faults can be used to predict (retrospectively) earthquakes of magnitude 5.4 or greater, in narrow spatial and temporal windows and with a high probability gain. The predictability of such transform earthquakes is consistent with a model in which slow slip transients trigger earthquakes, enrich their low-frequency radiation and accommodate much of the aseismic plate motion.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S43E..03S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S43E..03S"><span>The Kumamoto Mw7.1 mainshock: deep initiation triggered by the shallow foreshocks</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Shi, Q.; Wei, S.</p> <p>2017-12-01</p> <p>The Kumamoto Mw7.1 earthquake and its Mw6.2 foreshock struck the central Kyushu region in mid-April, 2016. The surface ruptures are characterized with multiple fault segments and a mix of strike-slip and normal motion extended from the intersection area of Hinagu and Futagawa faults to the southwest of Mt. Aso. Despite complex surface ruptures, most of the finite fault inversions use two fault segments to approximate the fault geometry. To study the rupture process and the complex fault geometry of this earthquake, we performed a multiple point source inversion for the mainshock using the data on 93 K-net and Kik-net stations. With path calibration from the Mw6.0 foreshock, we selected the frequency ranges for the Pnl waves (0.02 0.26 Hz) and surface waves (0.02 0.12 Hz), as well as the components that can be well modeled with the 1D velocity model. Our four-point-source results reveal a unilateral rupture towards Mt. Aso and varying fault geometries. The first sub-event is a high angle ( 79°) right-lateral strike-slip event at the depth of 16 km on the north end of the Hinagu fault. Notably the two M>6 foreshocks is located by our previous studies near the north end of the Hinagu fault at the depth of 5 9 km, which may give rise to the stress concentration at depth. The following three sub-events are distributed along the surface rupture of the Futagawa fault, with focal depths within 4 10 km. Their focal mechanisms present similar right-lateral fault slips with relatively small dip angles (62 67°) and apparent normal-fault component. Thus, the mainshock rupture initiated from the relatively deep part of the Hinagu fault and propagated through the fault-bend toward NE along the relatively shallow part of the Futagawa fault until it was terminated near Mt. Aso. Based on the four-point-source solution, we conducted a finite-fault inversion and obtained a kinematic rupture model of the mainshock. We then performed the Coulomb Stress analyses on the two foreshocks and the mainshock. The results support that the stress alternation after the foreshocks may have triggered the failure on the fault plane of the Mw7.1 earthquake. Therefore, the 2016 Kumamoto earthquake sequence is dominated by a series of large triggering events whose initiation is associated with the geometric barrier in the intersection of the Futagawa and Hinagu faults.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016EGUGA..18.9283S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016EGUGA..18.9283S"><span>ULF waves in the Martian foreshock: MAVEN observations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Shan, Lican; Mazelle, Christian; Meziane, Karim; Ruhunusiri, Suranga; Espley, Jared; Halekas, Jasper; Connerney, Jack; McFadden, Jim; Mitchell, Dave; Larson, Davin; Brain, Dave; Jakosky, Bruce; Ge, Yasong; Du, Aimin</p> <p>2016-04-01</p> <p>Foreshock ULF waves constitute a significant physical phenomenon of the plasma environment for terrestrial planets. The occurrence of these ULF waves, associated with backstreaming ions reflected and accelerated at the bow shock, implies specific conditions and properties of the shock and its foreshock. Using measurements from MAVEN, we report clear observations of this type of ULF waves in the Martian foreshock. We show from different case studies that the peak frequency of the wave case in spacecraft frame is too far from the local ion cyclotron frequency to be associated with local pickup ions taking into account the Doppler shifted frequency from a cyclotron resonance, the obliquity of the mode, resonance broadening and experimental uncertainties. On the opposite their properties fit very well with foreshock waves driven unstable by backtreaming field-aligned ion beams. The propagation angle is usually less than 30 degrees from ambient magnetic field. The waves also display elliptical and left-hand polarizations with respect to interplanetary magnetic field in the spacecraft frame. It is clear for these cases that foreshock ions are simultaneous present for the ULF wave interval. Such observation is important in order to discriminate with the already well-reported pickup ion (protons) waves associated with exospheric hydrogen in order to quantitatively use the later to study seasonal variations of the hydrogen corona.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70018483','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70018483"><span>Rupture distribution of the 1977 western Argentina earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Langer, C.J.; Hartzell, S.</p> <p>1996-01-01</p> <p>Teleseismic P and SH body waves are used in a finite-fault, waveform inversion for the rupture history of the 23 November 1977 western Argentina earthquake. This double event consists of a smaller foreshock (M0 = 5.3 ?? 1026 dyn-cm) followed about 20 s later by a larger main shock (M0 = 1.5 ?? 1027 dyn-cm). Our analysis indicates that these two events occurred on different fault segments: with the foreshock having a strike, dip, and average rake of 345??, 45??E, and 50??, and the main shock 10??, 45??E, and 80??, respectively. The foreshock initiated at a depth of 17 km and propagated updip and to the north. The main shock initiated at the southern end of the foreshock zone at a depth of 25 to 30 km, and propagated updip and unilaterally to the south. The north-south separation of the centroids of the moment release for the foreshock and main shock is about 60 km. The apparent triggering of the main shock by the foreshock is similar to other earthquakes that have involved the failure of multiple fault segments, such as the 1992 Landers, California, earthquake. Such occurrences argue against the use of individual, mapped, surface fault or fault-segment lengths in the determination of the size and frequency of future earthquakes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70012999','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70012999"><span>FORESHOCKS AND TIME-DEPENDENT EARTHQUAKE HAZARD ASSESSMENT IN SOUTHERN CALIFORNIA.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Jones, Lucile M.</p> <p>1985-01-01</p> <p>The probability that an earthquake in southern California (M greater than equivalent to 3. 0) will be followed by an earthquake of larger magnitude within 5 days and 10 km (i. e. , will be a foreshock) is 6 plus or minus 0. 5 per cent (1 S. D. ), and is not significantly dependent on the magnitude of the possible foreshock between M equals 3 and M equals 5. The probability that an earthquake will be followed by an M greater than equivalent to 5. 0 main shock, however, increases with magnitude of the foreshock from less than 1 per cent at M greater than equivalent to 3 to 6. 5 plus or minus 2. 5 per cent (1 S. D. ) at M greater than equivalent to 5. The main shock will most likely occur in the first hour after the foreshock, and the probability that a main shock will occur in the first hour decreases with elapsed time from the occurrence of the possible foreshock by approximately the inverse of time. Thus, the occurrence of an earthquake of M greater than equivalent to 3. 0 in southern California increases the earthquake hazard within a small space-time window several orders of magnitude above the normal background level.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19900049929&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19900049929&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dforeshock"><span>Simulation studies of plasma waves in the electron foreshock - The generation of Langmuir waves by a gentle bump-on-tail electron distribution</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Dum, C. T.</p> <p>1990-01-01</p> <p>Particle simulation experiments were used to study the basic physical ingredients needed for building a global model of foreshock wave phenomena. In particular, the generation of Langmuir waves by a gentle bump-on-tail electron distribution is analyzed. It is shown that, with appropriately designed simulations experiments, quasi-linear theory can be quantitatively verified for parameters corresponding to the electron foreshock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S21B0714W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S21B0714W"><span>Foreshocks and Aftershocks Detected from Stick-slip Events on a 3 m Biaxial Apparatus and their Relationship to Quasistatic Nucleation and Wear Processes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Wu, S.; Mclaskey, G.</p> <p>2017-12-01</p> <p>We investigate foreshocks and aftershocks of dynamic stick-slip events generated on a newly constructed 3 m biaxial friction apparatus at Cornell University (attached figure). In a typical experiment, two rectangular granite blocks are squeezed together under 4 or 7 MPa of normal pressure ( 4 or 7 million N on a 1 m2 fault surface), and then shear stress is increased until the fault slips 10 - 400 microns in a dynamic rupture event similar to a M -2 to M -3 earthquake. Some ruptures nucleate near the north end of the fault, where the shear force is applied, other ruptures nucleate 2 m from the north end of the fault. The samples are instrumented with 16 piezoelectric sensors, 16 eddy current sensors, and 8 strain gage rosettes, evenly placed along the fault to measure vertical ground motion, local slip, and local stress, respectively. We studied sequences of tens of slip events and identified a total of 194 foreshocks and 66 aftershocks located within 6 s time windows around the stick-slip events and analyzed their timing and locations relative to the quasistatic nucleation process. We found that the locations of the foreshocks and aftershocks were distributed all along the length of the fault, with the majority located at the ends of the fault where local normal and shear stress is highest (caused by both edge effects and the finite stiffness of the steel frame surrounding the granite blocks). We also opened the laboratory fault and inspected the fault surface and found increased wear at the sample ends. To explore the foreshocks' and aftershocks' relationship to the nucleation and afterslip, we compared the occurrence of foreshocks to the local slip rate on the laboratory fault closest to each foreshock in space and time. We found that that majority of foreshocks were generated from local slip rates between 1 and 100 microns/s, though we were not able to resolve slip rate lower than about 1 micron/s. Our experiments provide insight into how foreshocks and aftershocks in natural earthquakes may be influenced both by fault structure and slow slip associated with nucleation or afterslip.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20110011230','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20110011230"><span>Don't go with the Flow: An Invitation to Magnetosheath and Foreshock Studies</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Sibeck, D. G.</p> <p>2010-01-01</p> <p>This talk reviews the predictions of gasdynamic, magnetohydrodynamic, and kinetic models for the magnetosheath and foreshock and compares these predictions with observations by the recent Cluster and THEMIS missions. Topics of interest include: the depletion layer, dawn/dusk asymmetries, the transmission of solar wind discontinuities, the formation of hot flow anomalies and cavities in the foreshock, and flows accelerated by field-line tension. We conclude by discussing opportunities for magnetosheath imaging.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA248332','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA248332"><span>The Role of Hydromagnetic Waves in the Magnetosphere and the Ionosphere</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1991-01-31</p> <p>of right-hand-polarized waves in instabilities, we follow the examples discussed by Wong interplanetary shocks and in the terrestrial foreshock and... foreshock , (Received January 14, 1988;J. Geophys. Res., 90, 1429, 1985. Spangler, S.R., and J.P. Sheerin, Alfv6.n wave revised April 15, 1988;collapse...bow shocks,2 and in the interplanetary shocks and the a four-wave parametric coupling process is a.alyzed for the terrestrial foreshock .3 .4 Moreover</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_5");'>5</a></li> <li><a href="#" onclick='return showDiv("page_6");'>6</a></li> <li class="active"><span>7</span></li> <li><a href="#" onclick='return showDiv("page_8");'>8</a></li> <li><a href="#" onclick='return showDiv("page_9");'>9</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_7 --> <div id="page_8" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_6");'>6</a></li> <li><a href="#" onclick='return showDiv("page_7");'>7</a></li> <li class="active"><span>8</span></li> <li><a href="#" onclick='return showDiv("page_9");'>9</a></li> <li><a href="#" onclick='return showDiv("page_10");'>10</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="141"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.U22B...6L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.U22B...6L"><span>Understanding of Particle Acceleration by Foreshock Transients (invited)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Liu, T. Z.; Angelopoulos, V.; Hietala, H.; Lu, S.; Wilson, L. B., III</p> <p>2017-12-01</p> <p>Although plasma shocks are known to be a major particle accelerator at Earth's environment (e.g., the bow shock) and elsewhere in the universe, how particles are accelerated to very large energies compared to the shock potential is still not fully understood. Significant new information on such acceleration in the vicinity of Earth's bow shock has recently emerged due to the availability of multi-point observations, in particular from Cluster and THEMIS. These have revealed numerous types of foreshock transients, formed by shock-reflected ions, which could play a crucial role in particle pre-acceleration, i.e. before the particles reach the shock to be subjected again to even further acceleration. Foreshock bubbles (FBs) and hot flow anomalies (HFAs), are a subset of such foreshock transients that are especially important due to their large spatial scale (1-10 Earth radii), and their ability to have global effects at Earth.s geospace. These transients can accelerate particles that can become a particle source for the parent shock. Here we introduce our latest progress in understanding particle acceleration by foreshock transients including their statistical characteristics and acceleration mechanisms.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.U22B..06L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.U22B..06L"><span>Understanding of Particle Acceleration by Foreshock Transients</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Liu, T. Z.; Angelopoulos, V.; Hietala, H.; Lu, S.; Wilson, L. B., III</p> <p>2017-12-01</p> <p>Although plasma shocks are known to be a major particle accelerator at Earth's environment (e.g., the bow shock) and elsewhere in the universe, how particles are accelerated to very large energies compared to the shock potential is still not fully understood. Significant new information on such acceleration in the vicinity of Earth's bow shock has recently emerged due to the availability of multi-point observations, in particular from Cluster and THEMIS. These have revealed numerous types of foreshock transients, formed by shock-reflected ions, which could play a crucial role in particle pre-acceleration, i.e. before the particles reach the shock to be subjected again to even further acceleration. Foreshock bubbles (FBs) and hot flow anomalies (HFAs), are a subset of such foreshock transients that are especially important due to their large spatial scale (1-10 Earth radii), and their ability to have global effects at Earth's geospace. These transients can accelerate particles that can become a particle source for the parent shock. Here we introduce our latest progress in understanding particle acceleration by foreshock transients including their statistical characteristics and acceleration mechanisms.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016GeoRL..4310097Y','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016GeoRL..4310097Y"><span>Stress rotations due to the M6.5 foreshock and M7.3 main shock in the 2016 Kumamoto, SW Japan, earthquake sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Yoshida, Keisuke; Hasegawa, Akira; Saito, Tatsuhiko; Asano, Youichi; Tanaka, Sachiko; Sawazaki, Kaoru; Urata, Yumi; Fukuyama, Eiichi</p> <p>2016-10-01</p> <p>A shallow M7.3 event with a M6.5 foreshock occurred along the Futagawa-Hinagu fault zone in Kyushu, SW Japan. We investigated the spatiotemporal variation of the stress orientations in and around the source area of this 2016 Kumamoto earthquake sequence by inverting 1218 focal mechanisms. The results show that the σ3 axis in the vicinity of the fault plane significantly rotated counterclockwise after the M6.5 foreshock and rotated clockwise after the M7.3 main shock in the Hinagu fault segment. This observation indicates that a significant portion of the shear stress was released both by the M6.5 foreshock and M7.3 main shock. It is estimated that the stress release by the M6.5 foreshock occurred in the shallower part of the Hinagu fault segment, which brought the stress concentration in its deeper part. This might have caused the M7.3 main shock rupture mainly along the deeper part of the Hinagu fault segment after 28 h.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA135015','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA135015"><span>Research in Seismology</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1978-03-31</p> <p>detailed analysis of the data is made in an attempt to reach more definitive conclusion on that matter. Analysis of Data The largest foreshock (OT-II:22...represented with a trapezoid of unit area defined with three time segments (2.5, 1.0, 2.5 seconds). The same pattern is seen in the foreshock as shown in...parameters were taken to be the same as in the case of the aftershock. In the previous report it was pointed out that foreshock shows a secondary arrival</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016GeoJI.205..776B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016GeoJI.205..776B"><span>Precursory slow-slip loaded the 2009 L'Aquila earthquake sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Borghi, A.; Aoudia, A.; Javed, F.; Barzaghi, R.</p> <p>2016-05-01</p> <p>Slow-slip events (SSEs) are common at subduction zone faults where large mega earthquakes occur. We report here that one of the best-recorded moderate size continental earthquake, the 2009 April 6 moment magnitude (Mw) 6.3 L'Aquila (Italy) earthquake, was preceded by a 5.9 Mw SSE that originated from the decollement beneath the reactivated normal faulting system. The SSE is identified from a rigorous analysis of continuous GPS stations and occurred on the 12 February and lasted for almost two weeks. It coincided with a burst in the foreshock activity with small repeating earthquakes migrating towards the main-shock hypocentre as well as with a change in the elastic properties of rocks in the fault region. The SSE has caused substantial stress loading at seismogenic depths where the magnitude 4.0 foreshock and Mw 6.3 main shock nucleated. This stress loading is also spatially correlated with the lateral extent of the aftershock sequence.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018LPICo2047.6042G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018LPICo2047.6042G"><span>First Identification of Foreshock Plasma Populations at Mercury</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Glass, A. N.; Tracy, P. J.; Raines, J. M.</p> <p>2018-05-01</p> <p>Observations of foreshock populations at Mercury are presented for the first time utilizing measurements from the Fast Imaging Plasma Spectrometer (FIPS) aboard MESSENGER, and plausible energization mechanisms are suggested and evaluated.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S14B..01A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S14B..01A"><span>Dynamics of delayed triggering in multi-segmented foreshock sequence: Evidence from the 2016 Kumamoto, Japan, earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Arai, H.; Ando, R.; Aoki, Y.</p> <p>2017-12-01</p> <p>The 2016 Kumamoto earthquake sequence hit the SW Japan, from April 14th to 16th and its sequence includes two M6-class foreshocks and the main shock (Mw 7.0). Importantly, the detailed surface displacement caused solely by the two foreshocks could be captured by a SAR observation isolated from the mainshock deformation. The foreshocks ruptured the previously mapped Hinagu fault and their hypocentral locations and the aftershock distribution indicates the involvement of two different subparallel faults. Therefore we assumed that the 1st and the 2nd foreshocks respectively ruptured each of the subparallel faults (faults A and B). One of the interesting points of this earthquake is that the two major foreshocks had a temporal gap of 2.5 hours even though the fault A and B are quite close by each other. This suggests that the stress perturbation due to the 1st foreshock is not large enough to trigger the 2nd one right away but that it's large enough to bring about the following earthquake after a delay time.We aim to reproduce the foreshock sequence such as rupture jumping over the subparallel faults by using dynamic rupture simulations. We employed a spatiotemporal-boundary integral equation method accelerated by the Fast Domain Partitioning Method (Ando, 2016, GJI) since this method allows us to construct a complex fault geometry in 3D media. Our model has two faults and a free ground surface. We conducted rupture simulation with various sets of parameters to identify the optimal condition describing the observation.Our simulation results are roughly categorized into 3 cases with regard to the criticality for the rupture jumping. The case 1 (supercritical case) shows the fault A and B ruptured consecutively without any temporal gap. In the case 2 (nearly critical), the rupture on the fault B started with a temporal gap after the fault A finished rupturing, which is what we expected as a reproduction. In the case 3 (subcritical), only the fault A ruptured and its rupture did not transfer to the fault B. We succeed in reproducing rupture jumping over two faults with a temporal gap due to the nucleation by taking account of a velocity strengthening (direct) effect. With a detailed analysis of the case 2, we can constrain ranges of parameters strictly, and this gives us deeper insights into the physics underlying the delayed foreshock activity.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA588718','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA588718"><span>Determination of Focal Depths of Earthquakes in the Mid-Oceanic Ridges from Amplitude Spectra of Surface Waves</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1969-06-01</p> <p>Foreshock , mainshock and aftershock of the Parkfield, California earthquake of June 28, 1966. b. The Denver earthquake of August 9, 1967. Let us look...into the results of these tests in more details. (1) Test on the main shock, foreshock and aftershock of the Parkfield earthquake of June 28, 1966...According to McEvilly et. al. (1967), the origin times and locations of.these events were the following: Foreshock June 28, 1966, 04:08:56.2 GMT; 350 57.6</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFM.S53A2851A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFM.S53A2851A"><span>Earthquake Predictability: Results From Aggregating Seismicity Data And Assessment Of Theoretical Individual Cases Via Synthetic Data</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Adamaki, A.; Roberts, R.</p> <p>2016-12-01</p> <p>For many years an important aim in seismological studies has been forecasting the occurrence of large earthquakes. Despite some well-established statistical behavior of earthquake sequences, expressed by e.g. the Omori law for aftershock sequences and the Gutenburg-Richter distribution of event magnitudes, purely statistical approaches to short-term earthquake prediction have in general not been successful. It seems that better understanding of the processes leading to critical stress build-up prior to larger events is necessary to identify useful precursory activity, if this exists, and statistical analyses are an important tool in this context. There has been considerable debate on the usefulness or otherwise of foreshock studies for short-term earthquake prediction. We investigate generic patterns of foreshock activity using aggregated data and by studying not only strong but also moderate magnitude events. Aggregating empirical local seismicity time series prior to larger events observed in and around Greece reveals a statistically significant increasing rate of seismicity over 20 days prior to M>3.5 earthquakes. This increase cannot be explained by tempo-spatial clustering models such as ETAS, implying genuine changes in the mechanical situation just prior to larger events and thus the possible existence of useful precursory information. Because of tempo-spatial clustering, including aftershocks to foreshocks, even if such generic behavior exists it does not necessarily follow that foreshocks have the potential to provide useful precursory information for individual larger events. Using synthetic catalogs produced based on different clustering models and different presumed system sensitivities we are now investigating to what extent the apparently established generic foreshock rate acceleration may or may not imply that the foreshocks have potential in the context of routine forecasting of larger events. Preliminary results suggest that this is the case, but that it is likely that physically-based models of foreshock clustering will be a necessary, but not necessarily sufficient, basis for successful forecasting.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015AGUFM.S51A2646C','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015AGUFM.S51A2646C"><span>Spatio-temporal variations of stress drop in and around the asperity of the Mw 6.1, 6 April 2009 L'Aquila earthquake.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Calderoni, G.</p> <p>2015-12-01</p> <p>We investigate the variability of Brune stress drop in the normal fault system activated by the Mw 6.1 L'Aquila earthquake in the complex tectonic setting of the central Apennine. We re-analyze the dataset used by Calderoni et al. [2013], augmented by additional earthquakes and additional records at closer distance stations. We refine the EGF method used by Calderoni et al. [2013] applying more restrictive criteria in the selection of the EGF events and removing outliers based on statistical criteria. We focus on spatio-temporal variations in the Paganica fault before the mainshock. Using 51 earthquakes (9 foreshocks, the mainshock, and 42 aftershocks), we show that, after the Mw 4.1 largest foreshock of 30 March 2009, the Brune stress drop goes down to the lowest values (0.4 MPa). This largest foreshock was indicated as a marker for the onset of the temporal variations in efficiency of fault-zone guided waves (Calderoni et al., 2015) and other independent seismic parameters such as the b value [Papadopoulos et al., 2010; Sugan et al., 2014], and the P-to-S wave velocity ratio [Di Luccio et al., 2010; Lucente et al., 2010]. The low values of stress drop after the Mw 4.1 foreshock are consistent with the increase of pore pressure invoked by other authors to explain the increase of the Vp/Vs ratio and the decrease of Vs in the damage fault zone. In contrast, immediate foreshocks occurring a few hours before the mainshock very close to its nucleation are characterized by the highest values observed for foreshocks (≈5 MPa). These high stress drop foreshocks are located in the fault patch where a low b value anomaly indicates highly stressed rock before the main shock rupture [Sugan et al., 2014]. These results provide further evidence to previous observations before major earthquakes suggesting that stress drop variations can provide insight into the preparatory phase of impending earthquakes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23152938','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23152938"><span>Spatial organization of foreshocks as a tool to forecast large earthquakes.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Lippiello, E; Marzocchi, W; de Arcangelis, L; Godano, C</p> <p>2012-01-01</p> <p>An increase in the number of smaller magnitude events, retrospectively named foreshocks, is often observed before large earthquakes. We show that the linear density probability of earthquakes occurring before and after small or intermediate mainshocks displays a symmetrical behavior, indicating that the size of the area fractured during the mainshock is encoded in the foreshock spatial organization. This observation can be used to discriminate spatial clustering due to foreshocks from the one induced by aftershocks and is implemented in an alarm-based model to forecast m > 6 earthquakes. A retrospective study of the last 19 years Southern California catalog shows that the daily occurrence probability presents isolated peaks closely located in time and space to the epicenters of five of the six m > 6 earthquakes. We find daily probabilities as high as 25% (in cells of size 0.04 × 0.04deg(2)), with significant probability gains with respect to standard models.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19950038009&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19950038009&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dforeshock"><span>Elsaesser variable analysis of fluctuations in the ion foreshock and undisturbed solar wind</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Labelle, James; Treumann, Rudolf A.; Marsch, Eckart</p> <p>1994-01-01</p> <p>Magnetohydrodynamics (MHD) fluctuations in the solar wind have been investigated previously by use of Elsaesser variables. In this paper, we present a comparison of the spectra of Elsaesser variables in the undisturbed solar wind at 1 AU and in the ion foreshock in front of the Earth. Both observations take place under relatively strong solar wind flow speed conditions (approximately equal 600 km/s). In the undisturbed solar wind we find that outward propagating Alfven waves dominate, as reported by other observers. In the ion foreshock the situation is more complex, with neither outward nor inward propagation dominating over the entire range investigated (1-10 mHz). Measurements of the Poynting vectors associated with the fluctuations are consistent with the Elsaesser variable analysis. These results generally support interpretations of the Elsaesser variables which have been made based strictly on solar wind data and provide additional insight into the nature of the ion foreshock turbulence.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3497261','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3497261"><span>Spatial organization of foreshocks as a tool to forecast large earthquakes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Lippiello, E.; Marzocchi, W.; de Arcangelis, L.; Godano, C.</p> <p>2012-01-01</p> <p>An increase in the number of smaller magnitude events, retrospectively named foreshocks, is often observed before large earthquakes. We show that the linear density probability of earthquakes occurring before and after small or intermediate mainshocks displays a symmetrical behavior, indicating that the size of the area fractured during the mainshock is encoded in the foreshock spatial organization. This observation can be used to discriminate spatial clustering due to foreshocks from the one induced by aftershocks and is implemented in an alarm-based model to forecast m > 6 earthquakes. A retrospective study of the last 19 years Southern California catalog shows that the daily occurrence probability presents isolated peaks closely located in time and space to the epicenters of five of the six m > 6 earthquakes. We find daily probabilities as high as 25% (in cells of size 0.04 × 0.04deg2), with significant probability gains with respect to standard models. PMID:23152938</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19830019675','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19830019675"><span>Energetic-ion acceleration and transport in the upstream region of Jupiter: Voyager 1 and 2</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Baker, D. N.; Zwickl, R. D.; Carbary, J. F.; Krimigis, S. M.; Lepping, R. P.</p> <p>1982-01-01</p> <p>Long-lived upstream energetic ion events at Jupiter appear to be very similar in nearly all respects to upstream ion events at Earth. A notable difference between the two planetary systems is the enhanced heavy ion compositional signature reported for the Jovian events. This compositional feature has suggested that ions escaping from the Jovian magnetosphere play an important role in forming upstream ion populations at Jupiter. In contrast, models of energetic upstream ions at Earth emphasize in situ acceleration of reflected solar wind ions within the upstream region itself. Using Voyager 1 and 2 energetic ( approximately 30 keV) ion measurements near the magnetopause, in the magnetosheath, and immediately upstream of the bow shock, the compositional patterns are examined together with typical energy spectra in each of these regions. A model involving upstream Fermi acceleration early in events and emphasizing energetic particle escape in the prenoon part of the Jovian magnetosphere late in events is presented to explain many of the features in the upstream region of Jupiter.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26357267','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26357267"><span>A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Mehmood, Tahir; Bohlin, Jon; Snipen, Lars</p> <p>2015-01-01</p> <p>The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JGRB..122.5325N','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JGRB..122.5325N"><span>Detection of earthquake swarms at subduction zones globally: Insights into tectonic controls on swarm activity</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Nishikawa, T.; Ide, S.</p> <p>2017-07-01</p> <p>Earthquake swarms are characterized by an increase in seismicity rate that lacks a distinguished main shock and does not obey Omori's law. At subduction zones, they are thought to be related to slow-slip events (SSEs) on the plate interface. Earthquake swarms in subduction zones can therefore be used as potential indicators of slow-slip events. However, the global distribution of earthquake swarms at subduction zones remains unclear. Here we present a method for detecting such earthquake sequences using the space-time epidemic-type aftershock-sequence model. We applied this method to seismicity (M ≥ 4.5) recorded in the Advanced National Seismic System catalog at subduction zones during the period of 1995-2009. We detected 453 swarms, which is about 6.7 times the number observed in a previous catalog. Foreshocks of some large earthquakes are also detected as earthquake swarms. In some subduction zones, such as at Ibaraki-Oki, Japan, swarm-like foreshocks and ordinary swarms repeatedly occur at the same location. Given that both foreshocks and swarms are related to SSEs on the plate interface, these regions may have experienced recurring SSEs. We then compare the swarm activity and tectonic properties of subduction zones, finding that swarm activity is positively correlated with curvature of the incoming plate before subduction. This result implies that swarm activity is controlled either by hydration of the incoming plate or by heterogeneity on the plate interface due to fracturing related to slab bending.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70020458','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70020458"><span>Faulting Parameters of the January 16, 1994 Wyomissing Hills, Pennsylvania Earthquakes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Ammon, C.J.; Herrmann, Robert B.; Langston, C.A.; Benz, H.</p> <p>1998-01-01</p> <p>Two events dominated the January 1994, Wyomissing, PA earthquake sequence, an Mw 4.0 foreshock, followed by an Mw 4.6 mainshock. We modeled regional waveforms to estimate the event depth and the moment tensors for the two largest events in the sequence, and examine teleseismic wave-forms recorded on the ARCESS short-period seismic array to estimate the depth and source time function of the mainshock. Our data constrain the depth of the events to be shallower than 5 km, and prefer a depth of 3-5 km. For an assumed depth of 3 km, the mainshock moment tensor is 75% double couple, with (the major double couple) planes striking at 135??N, 347??N, dips of 49??, 46??, and rakes of 68??, 114??. The estimated moment is 8.9 ?? 1022 dyne-cm. The P axis strikes 241??N and plunges 2??, the Tension axis strikes 336??N and plunges 73??. The foreshock inversion results are virtually identical to the mainshock results; for a source depth of three km, we find a major double couple with a strike, dip, and rake of 121??N, 60??, and 66??, respectively. The seismic moment for the foreshock is 1.2 ?? 1022 dyne-cm, which is approximately 13% of the mainshock moment release. These events did not excite high-frequency Lg waves as effectively as typical eastern North American events, and the mainshock had a stress drop in the range of 25-50 bars.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018E%26PSL.482..265W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018E%26PSL.482..265W"><span>Foreshocks and delayed triggering of the 2016 MW7.1 Te Araroa earthquake and dynamic reinvigoration of its aftershock sequence by the MW7.8 Kaikōura earthquake, New Zealand</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Warren-Smith, Emily; Fry, Bill; Kaneko, Yoshihiro; Chamberlain, Calum J.</p> <p>2018-01-01</p> <p>We analyze the preparatory period of the September 2016 MW7.1 Te Araroa foreshock-mainshock sequence in the Northern Hikurangi margin, New Zealand, and subsequent reinvigoration of Te Araroa aftershocks driven by a large distant earthquake (the November 2016 MW7.8 Kaikōura earthquake). By adopting a matched-filter detection workflow using 582 well-defined template events, we generate an improved foreshock and aftershock catalog for the Te Araroa sequence (>8,000 earthquakes over 66 d). Templates characteristic of the MW7.1 sequence (including the mainshock template) detect several highly correlating events (ML2.5-3.5) starting 12 min after a MW5.7 foreshock. These pre-cursory events occurred within ∼1 km of the mainshock and migrate bilaterally, suggesting precursory slip was triggered by the foreshock on the MW7.1 fault patch prior to mainshock failure. We extend our matched-filter routine to examine the interactions between high dynamic stresses resulting from passing surface waves of the November 2016 MW7.8 Kaikōura earthquake, and the evolution of the Te Araroa aftershock sequence. We observe a sudden spike in moment release of the aftershock sequence immediately following peak dynamic Coulomb stresses of 50-150 kPa on the MW7.1 fault plane. The triggered increase in moment release culminated in a MW5.1 event, immediately followed by a ∼3 h temporal stress shadow. Our observations document the preparatory period of a major subduction margin earthquake following a significant foreshock, and quantify dynamic reinvigoration of a distant on-going major aftershock sequence amid a period of temporal clustering of seismic activity in New Zealand.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19950053616&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19950053616&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dforeshock"><span>The electron foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Fitzenreiter, R. J.</p> <p>1995-01-01</p> <p>An overview of the observations of backstreaming electrons in the foreshock and the mechanisms that have been proposed to explain their properties will be presented. A primary characteristic of observed foreshock electrons is that their velocity distributions are spatially structured in a systematic way depending on distance from the magnetic field line which is tangent to the shock. There are two interrelated aspects to explaining the structure of velocity distributions in the foreshock, one involving the acceleration mechanism and the other, propagation from the source to the observing point. First, the source distribution of electrons energized by the shock must be determined along the shock surface. Proposed acceleration mechanisms include magnetic mirroring of incoming solar wind particles and mechanisms involving transmission of particles through the shock. Secondly, the kinematics of observable electrons streaming away from a curved shock with an initial parallel velocity and a downstream perpendicular velocity component due to the motional electric field must be determined. This is the context in which the observations and their explanations will be reviewed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFMSM21A2414L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFMSM21A2414L"><span>MMS Observation of Inverse Energy Dispersion in Shock Drift Acceleration Ions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Lee, S. H.; Sibeck, D. G.; Hwang, K. J.; Wang, Y.; Silveira, M. D.; Mauk, B.; Cohen, I. J.; Chu, C. S.; Mason, G. M.; Gold, R. E.; Burch, J. L.; Giles, B. L.; Torbert, R. B.; Russell, C. T.; Wei, H.</p> <p>2016-12-01</p> <p>The Energetic Particle Detector (EPD) on the Magnetospheric Multiscale (MMS) spacecraft observed bursts of energetic ions (50 keV-1000 keV) both in the foreshock and in the magnetosheath near the bow shock on December 6, 2015. Three species (protons, helium, and oxygen) exhibit inverse energy dispersions. Angular distributions for all three species indicate acceleration at the perpendicular bow shock. Acceleration that energizes the seed solar population by a factor of 2 and 4 is required for the protons and helium ions, respectively. The energy of the ions increases with θBn (the angle between the IMF and the local shock normal) since the induced electric field that energizes the charged particles increases as θBn increases towards 90°. We compare events upstream and downstream from the bow shock. We compare the MMS observations with those of the solar wind seed populations by the Ultra Low Energy Isotope Spectrometer (ULEIS) instrument on the Advanced Composition Explorer (ACE) mission and by the WIND 3-D Plamsa and Energetic Particle Experiment.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_6");'>6</a></li> <li><a href="#" onclick='return showDiv("page_7");'>7</a></li> <li class="active"><span>8</span></li> <li><a href="#" onclick='return showDiv("page_9");'>9</a></li> <li><a href="#" onclick='return showDiv("page_10");'>10</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_8 --> <div id="page_9" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_7");'>7</a></li> <li><a href="#" onclick='return showDiv("page_8");'>8</a></li> <li class="active"><span>9</span></li> <li><a href="#" onclick='return showDiv("page_10");'>10</a></li> <li><a href="#" onclick='return showDiv("page_11");'>11</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="161"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70022069','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70022069"><span>Characterization of active faulting beneath the Strait of Georgia, British Columbia</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Cassidy, J.F.; Rogers, Gary C.; Waldhauser, F.</p> <p>2000-01-01</p> <p>Southwestern British Columbia and northwestern Washington State are subject to megathrust earthquakes, deep intraslab events, and earthquakes in the continental crust. Of the three types of earthquakes, the most poorly understood are the crustal events. Despite a high level of seismicity, there is no obvious correlation between the historical crustal earthquakes and the mapped surface faults of the region. On 24 June 1997, a ML = 4.6 earthquake occurred 3-4 km beneath the Strait of Georgia, 30 km to the west of Vancouver, British Columbia. This well-recorded earthquake was preceded by 11 days by a felt foreshock (ML = 3.4) and was followed by numerous small aftershocks. This earthquake sequence occurred in one of the few regions of persistent shallow seismic activity in southwestern British Columbia, thus providing an ideal opportunity to attempt to characterize an active near-surface fault. We have computed focal mechanisms and utilized a waveform cross-correlation and joint hypocentral determination routine to obtain accurate relative hypocenters of the mainshock, foreshock, and 53 small aftershocks in an attempt to image the active fault and the extent of rupture associated with this earthquake sequence. Both P-nodal and CMT focal mechanisms show thrust faulting for the mainshock and the foreshock. The relocated hypocenters delineate a north-dipping plane at 2-4 km depth, dipping at 53??, in good agreement with the focal mechanism nodal plane dipping to the north at 47??. The rupture area is estimated to be a 1.3-km-diameter circular area, comparable to that estimated using a Brune rupture model with the estimated seismic moment of 3.17 ?? 1015 N m and the stress drop of 45 bars. The temporal sequence indicates a downdip migration of the seismicity along the fault plane. The results of this study provide the first unambiguous evidence for the orientation and sense of motion for active faulting in the Georgia Strait area of British Columbia.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2008AGUFM.S33A1929Z','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2008AGUFM.S33A1929Z"><span>Simulation studies on the differences between spontaneous and triggered seismicity and on foreshock probabilities</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Zhuang, J.; Vere-Jones, D.; Ogata, Y.; Christophersen, A.; Savage, M. K.; Jackson, D. D.</p> <p>2008-12-01</p> <p>In this study we investigate the foreshock probabilities calculated from earthquake catalogs from Japan, Southern California and New Zealand. Unlike conventional studies on foreshocks, we use a probability-based declustering method to separate each catalog into stochastic versions of family trees, such that each event is classified as either having been triggered by a preceding event, or being a spontaneous event. The probabilities are determined from parameters that provide the best fit of the real catalogue using a space- time epidemic-type aftershock sequence (ETAS) model. The model assumes that background and triggered earthquakes have the same magnitude dependent triggering capability. A foreshock here is defined as a spontaneous event that has one or more larger descendants, and a triggered foreshock is a triggered event that has one or more larger descendants. The proportion of foreshocks in spontaneous events of each catalog is found to be lower than the proportion of triggered foreshocks in triggered events. One possibility is that this is due to different triggering productivity in spontaneous versus triggered events, i.e., a triggered event triggers more children than a spontaneous events of the same magnitude. To understand what causes the above differences between spontaneous and triggered events, we apply the same procedures to several synthetic catalogs simulated by using different models. The first simulation is done by using the ETAS model with parameters and spontaneous rate fitted from the JMA catalog. The second synthetic catalog is simulated by using an adjusted ETAS model that takes into account the triggering effect from events lower than the magnitude. That is, we simulated the catalog with a low magnitude threshold with the original ETAS model, and then we remove the events smaller than a higher magnitude threshold. The third model for simulation assumes that different triggering behaviors exist between spontaneous event and triggered events. We repeat the fitting and reconstruction procedures to all those simulated catalogs. The reconstruction results for the first synthetic catalog do not show the difference between spontaneous events and triggered event or the differences in foreshock probabilities. On the other hand, results from the synthetic catalogs simulated with the second and the third models clearly reconstruct such differences. In summary our results implies that one of the causes of such differences may be neglecting the triggering effort from events smaller than the cut-off magnitude or magnitude errors. For the objective of forecasting seismicity, we can use a clustering model in which spontaneous events trigger child events in a different way from triggered events to avoid over-predicting earthquake risks with foreshocks. To understand the physical implication of this study, we need further careful studies to compare the real seismicity and the adjusted ETAS model, which takes the triggering effect from events below the cut-off magnitude into account.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA059529','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA059529"><span>Relationship between Near-Field and Teleseismic Observations of Seismic Source Parameters</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1978-07-01</p> <p>For example, foreshocks and aftershocks of the Utah-Idaho border and Oroville, California sequences of 1975, as recorded at the Albuquerque SRO station...have been analyzed and compared; in both cases the principal foreshock exhibited the same mechanisms as the main shock, while the aftershocks are</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20020030303&hterms=foreshock&qs=N%3D0%26Ntk%3DAll%26Ntx%3Dmode%2Bmatchall%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20020030303&hterms=foreshock&qs=N%3D0%26Ntk%3DAll%26Ntx%3Dmode%2Bmatchall%26Ntt%3Dforeshock"><span>Stochastic Growth Theory of Spatially-Averaged Distributions of Langmuir Fields in Earth's Foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Boshuizen, Christopher R.; Cairns, Iver H.; Robinson, P. A.</p> <p>2001-01-01</p> <p>Langmuir-like waves in the foreshock of Earth are characteristically bursty and irregular, and are the subject of a number of recent studies. Averaged over the foreshock, it is observed that the probability distribution is power-law P(bar)(log E) in the wave field E with the bar denoting this averaging over position, In this paper it is shown that stochastic growth theory (SGT) can explain a power-law spatially-averaged distributions P(bar)(log E), when the observed power-law variations of the mean and standard deviation of log E with position are combined with the log normal statistics predicted by SGT at each location.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA024359','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA024359"><span>Near Field Small Earthquake Long Period Spectrum</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1976-04-01</p> <p>L. Fredrickson, personal communication). The main shock occurred eight seconds after a magnitude 4.5 foreshock , and according to T. V. McEvilly...the strike (but rat the dip) of this plar^e is in good agreenant with that (IT C90 W) obtained from a faultplane solution for a large foreshock 0</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19990009117&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D10%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19990009117&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D10%26Ntt%3Dforeshock"><span>First Test of Stochastic Growth Theory for Langmuir Waves in Earth's Foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cairns, Iver H.; Robinson, P. A.</p> <p>1997-01-01</p> <p>This paper presents the first test of whether stochastic growth theory (SGT) can explain the detailed characteristics of Langmuir-like waves in Earth's foreshock. A period with unusually constant solar wind magnetic field is analyzed. The observed distributions P(logE) of wave fields E for two intervals with relatively constant spacecraft location (DIFF) are shown to agree well with the fundamental prediction of SGT, that P(logE) is Gaussian in log E. This stochastic growth can be accounted for semi-quantitatively in terms of standard foreshock beam parameters and a model developed for interplanetary type III bursts. Averaged over the entire period with large variations in DIFF, the P(logE) distribution is a power-law with index approximately -1; this is interpreted in terms of convolution of intrinsic, spatially varying P(logE) distributions with a probability function describing ISEE's residence time at a given DIFF. Wave data from this interval thus provide good observational evidence that SGT can sometimes explain the clumping, burstiness, persistence, and highly variable fields of the foreshock Langmuir-like waves.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1997GeoRL..24..369C','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1997GeoRL..24..369C"><span>First test of stochastic growth theory for Langmuir waves in Earth's foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Cairns, Iver H.; Robinson, P. A.</p> <p></p> <p>This paper presents the first test of whether stochastic growth theory (SGT) can explain the detailed characteristics of Langmuir-like waves in Earth's foreshock. A period with unusually constant solar wind magnetic field is analyzed. The observed distributions P(log E) of wave fields E for two intervals with relatively constant spacecraft location (DIFF) are shown to agree well with the fundamental prediction of SGT, that P(log E) is Gaussian in log E. This stochastic growth can be accounted for semi-quantitatively in terms of standard foreshock beam parameters and a model developed for interplanetary type III bursts. Averaged over the entire period with large variations in DIFF, the P(log E) distribution is a power-law with index ˜ -1 this is interpreted in terms of convolution of intrinsic, spatially varying P(log E) distributions with a probability function describing ISEE's residence time at a given DIFF. Wave data from this interval thus provide good observational evidence that SGT can sometimes explain the clumping, burstiness, persistence, and highly variable fields of the foreshock Langmuir-like waves.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70018466','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70018466"><span>Implications of fault constitutive properties for earthquake prediction</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Dieterich, J.H.; Kilgore, B.</p> <p>1996-01-01</p> <p>The rate- and state-dependent constitutive formulation for fault slip characterizes an exceptional variety of materials over a wide range of sliding conditions. This formulation provides a unified representation of diverse sliding phenomena including slip weakening over a characteristic sliding distance D(c), apparent fracture energy at a rupture front, time- dependent healing after rapid slip, and various other transient and slip rate effects. Laboratory observations and theoretical models both indicate that earthquake nucleation is accompanied by long intervals of accelerating slip. Strains from the nucleation process on buried faults generally could not be detected if laboratory values of D, apply to faults in nature. However, scaling of D(c) is presently an open question and the possibility exists that measurable premonitory creep may precede some earthquakes. Earthquake activity is modeled as a sequence of earthquake nucleation events. In this model, earthquake clustering arises from sensitivity of nucleation times to the stress changes induced by prior earthquakes. The model gives the characteristic Omori aftershock decay law and assigns physical interpretation to aftershock parameters. The seismicity formulation predicts large changes of earthquake probabilities result from stress changes. Two mechanisms for foreshocks are proposed that describe observed frequency of occurrence of foreshock-mainshock pairs by time and magnitude. With the first mechanism, foreshocks represent a manifestation of earthquake clustering in which the stress change at the time of the foreshock increases the probability of earthquakes at all magnitudes including the eventual mainshock. With the second model, accelerating fault slip on the mainshock nucleation zone triggers foreshocks.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/11607666','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/11607666"><span>Implications of fault constitutive properties for earthquake prediction.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Dieterich, J H; Kilgore, B</p> <p>1996-04-30</p> <p>The rate- and state-dependent constitutive formulation for fault slip characterizes an exceptional variety of materials over a wide range of sliding conditions. This formulation provides a unified representation of diverse sliding phenomena including slip weakening over a characteristic sliding distance Dc, apparent fracture energy at a rupture front, time-dependent healing after rapid slip, and various other transient and slip rate effects. Laboratory observations and theoretical models both indicate that earthquake nucleation is accompanied by long intervals of accelerating slip. Strains from the nucleation process on buried faults generally could not be detected if laboratory values of Dc apply to faults in nature. However, scaling of Dc is presently an open question and the possibility exists that measurable premonitory creep may precede some earthquakes. Earthquake activity is modeled as a sequence of earthquake nucleation events. In this model, earthquake clustering arises from sensitivity of nucleation times to the stress changes induced by prior earthquakes. The model gives the characteristic Omori aftershock decay law and assigns physical interpretation to aftershock parameters. The seismicity formulation predicts large changes of earthquake probabilities result from stress changes. Two mechanisms for foreshocks are proposed that describe observed frequency of occurrence of foreshock-mainshock pairs by time and magnitude. With the first mechanism, foreshocks represent a manifestation of earthquake clustering in which the stress change at the time of the foreshock increases the probability of earthquakes at all magnitudes including the eventual mainshock. With the second model, accelerating fault slip on the mainshock nucleation zone triggers foreshocks.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70020720','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70020720"><span>Seismicity alert probabilities at Parkfield, California, revisited</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Michael, A.J.; Jones, L.M.</p> <p>1998-01-01</p> <p>For a decade, the US Geological Survey has used the Parkfield Earthquake Prediction Experiment scenario document to estimate the probability that earthquakes observed on the San Andreas fault near Parkfield will turn out to be foreshocks followed by the expected magnitude six mainshock. During this time, we have learned much about the seismogenic process at Parkfield, about the long-term probability of the Parkfield mainshock, and about the estimation of these types of probabilities. The probabilities for potential foreshocks at Parkfield are reexamined and revised in light of these advances. As part of this process, we have confirmed both the rate of foreshocks before strike-slip earthquakes in the San Andreas physiographic province and the uniform distribution of foreshocks with magnitude proposed by earlier studies. Compared to the earlier assessment, these new estimates of the long-term probability of the Parkfield mainshock are lower, our estimate of the rate of background seismicity is higher, and we find that the assumption that foreshocks at Parkfield occur in a unique way is not statistically significant at the 95% confidence level. While the exact numbers vary depending on the assumptions that are made, the new alert probabilities are lower than previously estimated. Considering the various assumptions and the statistical uncertainties in the input parameters, we also compute a plausible range for the probabilities. The range is large, partly due to the extra knowledge that exists for the Parkfield segment, making us question the usefulness of these numbers.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA150752','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA150752"><span>The Downshift of Electron Plasma Oscillations in the Electron Foreshock Region.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1984-10-10</p> <p>gested by Fredricks et al. that these frequency variations were caused by electron density fluctuations associated with oblique magnetohydro...Filbert and Kellogg [1979). The equation for the bow shock is, X = 14.6 - 0.0223 (y2 + Z2) (1) where X, Y, and Z are the geocentric solar ecliptic (GSE...an oblique nonlinear magnetohydrodynamic wave, J. Geophys. Res. Lett., 77, 3598, 1972. Grabbe, C. L., A model for chorus associated electrostatic</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JGRA..122.4895P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JGRA..122.4895P"><span>Foreshock waves as observed in energetic ion flux</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Petrukovich, A. A.; Chugunova, O. M.; Inamori, T.; Kudela, K.; Stetiarova, J.</p> <p>2017-05-01</p> <p>Oscillations of energetic ion fluxes with periods 10-100 s are often present in the Earth's foreshock. Detailed analysis of wave properties with Time History of Events and Macroscale Interactions during Substorms data and comparisons with other data sets confirm that these oscillations are the previously unnoticed part of well-known "30 s" waves but are observed mainly for higher-speed solar wind. Simultaneous magnetic oscillations have similar periods, large amplitudes, and nonharmonic unstable waveforms or shocklet-type appearance, suggesting their nonlinearity, also typical for high solar wind speed. Analysis of the general foreshock data set of Interball project shows that the average flux of the backstreaming energetic ions increases more than 1 order of magnitude, when solar wind speed increases from 400 to 500 km/s.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19950048203&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19950048203&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dforeshock"><span>Fine structure in plasma waves and radiation near the plasma frequency in Earth's foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cairns, Iver H.</p> <p>1994-01-01</p> <p>Novel observations are presented of intrunsic fine structure in the frequency spectrum of electomagnetic (EM) radiation and plasma waves near the electron plasma frequency f(sub p) during a period of unusually high interplanetary magnetic field strength. Measured using the wideband receiver on the International Sun-Earth Explorer (ISEE) 1 spacecraft, fine-structured emissions are observed both in the solar wind and the foreshock, The fine structure is shown to correspond to emissions spaced above f(sub p) near half harmonies of the electon cyclotron frequency f(sub ce), i.e., near f(sub p) + nf(sub ce)/2. These appear to be the first space physics observations of emissions spaced by f(sub ce)/2. Indirect but strong arguments are used to discriminate between EM and electrostatic (ES) signals, to identify whether ISEE 1 is in the solar wind or the foreshock, and to determine the relative frequencies of the emissions and the local f(sub p). The data are consistent with generation of the ES and EM emissions in the foreshock, with subsequent propagation of the EM emissions into the solar wind. It remains possible that some emissions currently identified as ES have significant EM character. The ES and EM emisions often merge into one another with minimal changes in frequency, arguing that their source regions and generation mechanisms are related and imposing significant constraints on theories. The f(sub ce)/2 ES and EM fine structures observed may be intrinsic to the emission mechanisms or to superposition of two series of signals with f(sub ce) spacing that differ in starting frequency by f(sub ce)/2. Present theories for nonlinear wave coupling processes, cyclotron maser emission, and other linear instability processes are all unable to explain multiple EM and/or ES components spaced by approximately f(sub ce)/2 above f(sub p) for f(sub p)/f(sub ce) much greater than 1 and typical for shock beams parameters. Suitable avenues for further theoretical research are identified. Empirically, the observed fine structures appear very similar to those in split bnad and multiple-lane type II solar radio bursts; interpretation of both these type II fine structures in terms of f(sub ce)/2 splitting is suggested, thereby supporting and generalizing a suggestion by Wild (1950). A possible application to continuum radiation is mentioned. The ubiquity of these fine structures in the Earth's f(sub p) radiation and foreshock waves remains unknown. Only the ISEE 1 wideband receiver has sufficient frequency resolution (approximately less than or equal to 100 Hz) to perform a dedicated search. Further study of the ubiquity of these fine structures, of how reliably the splitting corresponds to f(sub ce)/2, and of the other interpretations above is necessary.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=39438','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=39438"><span>Implications of fault constitutive properties for earthquake prediction.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Dieterich, J H; Kilgore, B</p> <p>1996-01-01</p> <p>The rate- and state-dependent constitutive formulation for fault slip characterizes an exceptional variety of materials over a wide range of sliding conditions. This formulation provides a unified representation of diverse sliding phenomena including slip weakening over a characteristic sliding distance Dc, apparent fracture energy at a rupture front, time-dependent healing after rapid slip, and various other transient and slip rate effects. Laboratory observations and theoretical models both indicate that earthquake nucleation is accompanied by long intervals of accelerating slip. Strains from the nucleation process on buried faults generally could not be detected if laboratory values of Dc apply to faults in nature. However, scaling of Dc is presently an open question and the possibility exists that measurable premonitory creep may precede some earthquakes. Earthquake activity is modeled as a sequence of earthquake nucleation events. In this model, earthquake clustering arises from sensitivity of nucleation times to the stress changes induced by prior earthquakes. The model gives the characteristic Omori aftershock decay law and assigns physical interpretation to aftershock parameters. The seismicity formulation predicts large changes of earthquake probabilities result from stress changes. Two mechanisms for foreshocks are proposed that describe observed frequency of occurrence of foreshock-mainshock pairs by time and magnitude. With the first mechanism, foreshocks represent a manifestation of earthquake clustering in which the stress change at the time of the foreshock increases the probability of earthquakes at all magnitudes including the eventual mainshock. With the second model, accelerating fault slip on the mainshock nucleation zone triggers foreshocks. Images Fig. 3 PMID:11607666</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA466900','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA466900"><span>Collaborative Research: Ground Truth of African and Eastern Mediterranean Shallow Seismicity Using SAR Interferometry and Gibbs Sampling Inversion</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>2006-10-05</p> <p>the likely existence of a small foreshock . 2. BACKGROUND 2.1. InSAR The most well-known examples of InSAR used as a geodetic tool involve...the event. We have used the seismic waveforms in the Sultan Dag event to identify a small foreshock preceding the main shock by about 3 seconds</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018GeoRL..45.3768M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018GeoRL..45.3768M"><span>Evidence for Neutrals-Foreshock Electrons Impact at Mars</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Mazelle, C. X.; Meziane, K.; Mitchell, D. L.; Garnier, P.; Espley, J. R.; Hamza, A. M.; Halekas, J.; Jakosky, B. M.</p> <p>2018-05-01</p> <p>Backstreaming electrons emanating from the bow shock of Mars reported from the Mars Atmosphere and Volatile EvolutioN/Solar Wind Electron Analyzer observations show a flux fall off with the distance from the shock. This feature is not observed at the terrestrial foreshock. The flux decay is observed only for electron energy E ≥ 29 eV. A reported recent study indicates that Mars foreshock electrons are produced at the shock in a mirror reflection of a portion of the solar wind electrons. In this context, and given that the electrons are sufficiently energetic to not be affected by the interplanetary magnetic field fluctuations, the observed flux decrease appears problematic. We investigate the possibility that the flux fall off with distance results from the impact of backstreaming electrons with Mars exospheric neutral hydrogen. We demonstrate that the flux fall off is consistent with the electron-atomic hydrogen impact cross section for a large range of energy. A better agreement is obtained for energy where the impact cross section is the highest. One important consequence is that foreshock electrons can play an important role in the production of pickup ions at Mars far exosphere.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19910070190&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19910070190&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dforeshock"><span>Strong plasma turbulence in the earth's electron foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Robinson, P. A.; Newman, D. L.</p> <p>1991-01-01</p> <p>A quantitative model is developed to account for the distribution in magnitude and location of the intense plasma waves observed in the earth's electron foreshock given the observed rms levels of waves. In this model, nonlinear strong-turbulence effects cause solitonlike coherent wave packets to form and decouple from incoherent background beam-excited weak turbulence, after which they convect downstream with the solar wind while collapsing to scales as short as 100 m and fields as high as 2 V/m. The existence of waves with energy densities above the strong-turbulence wave-collapse threshold is inferred from observations from IMP 6 and ISEE 1 and quantitative agreement is found between the predicted distribution of fields in an ensemble of such wave packets and the actual field distribution observed in situ by IMP 6. Predictions for the polarization of plasma waves and the bandwidth of ion-sound waves are also consistent with the observations. It is shown that strong-turbulence effects must be incorporated in any comprehensive theory of the propagation and evolution of electron beams in the foreshock. Previous arguments against the existence of strong turbulence in the foreshock are refuted.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20020033988&hterms=thermal+noise&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dthermal%2Bnoise','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20020033988&hterms=thermal+noise&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dthermal%2Bnoise"><span>Thermal and Driven Stochastic Growth of Langmuir Waves in the Solar Wind and Earth's Foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cairns, Iver H.; Robinson, P. A.; Anderson, R. R.</p> <p>2000-01-01</p> <p>Statistical distributions of Langmuir wave fields in the solar wind and the edge of Earth's foreshock are analyzed and compared with predictions for stochastic growth theory (SGT). SGT quantitatively explains the solar wind, edge, and deep foreshock data as pure thermal waves, driven thermal waves subject to net linear growth and stochastic effects, and as waves in a pure SGT state, respectively, plus radiation near the plasma frequency f(sub p). These changes are interpreted in terms of spatial variations in the beam instability's growth rate and evolution toward a pure SGT state. SGT analyses of field distributions are shown to provide a viable alternative to thermal noise spectroscopy for wave instruments with coarse frequency resolution, and to separate f(sub p) radiation from Langmuir waves.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70193290','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70193290"><span>Listening to the 2011 magnitude 9.0 Tohoku-Oki, Japan, earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Peng, Zhigang; Aiken, Chastity; Kilb, Debi; Shelly, David R.; Enescu, Bogdan</p> <p>2012-01-01</p> <p>The magnitude 9.0 Tohoku-Oki, Japan, earthquake on 11 March 2011 is the largest earthquake to date in Japan’s modern history and is ranked as the fourth largest earthquake in the world since 1900. This earthquake occurred within the northeast Japan subduction zone (Figure 1), where the Pacific plate is subducting beneath the Okhotsk plate at rate of ∼8–9 cm/yr (DeMets et al. 2010). This type of extremely large earthquake within a subduction zone is generally termed a “megathrust” earthquake. Strong shaking from this magnitude 9 earthquake engulfed the entire Japanese Islands, reaching a maximum acceleration ∼3 times that of gravity (3 g). Two days prior to the main event, a foreshock sequence occurred, including one earthquake of magnitude 7.2. Following the main event, numerous aftershocks occurred around the main slip region; the largest of these was magnitude 7.9. The entire foreshocks-mainshock-aftershocks sequence was well recorded by thousands of sensitive seismometers and geodetic instruments across Japan, resulting in the best-recorded megathrust earthquake in history. This devastating earthquake resulted in significant damage and high death tolls caused primarily by the associated large tsunami. This tsunami reached heights of more than 30 m, and inundation propagated inland more than 5 km from the Pacific coast, which also caused a nuclear crisis that is still affecting people’s lives in certain regions of Japan.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EP%26S...69..134H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EP%26S...69..134H"><span>Bayesian inference and interpretation of centroid moment tensors of the 2016 Kumamoto earthquake sequence, Kyushu, Japan</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Hallo, Miroslav; Asano, Kimiyuki; Gallovič, František</p> <p>2017-09-01</p> <p>On April 16, 2016, Kumamoto prefecture in Kyushu region, Japan, was devastated by a shallow M JMA7.3 earthquake. The series of foreshocks started by M JMA6.5 foreshock 28 h before the mainshock. They have originated in Hinagu fault zone intersecting the mainshock Futagawa fault zone; hence, the tectonic background for this earthquake sequence is rather complex. Here we infer centroid moment tensors (CMTs) for 11 events with M JMA between 4.8 and 6.5, using strong motion records of the K-NET, KiK-net and F-net networks. We use upgraded Bayesian full-waveform inversion code ISOLA-ObsPy, which takes into account uncertainty of the velocity model. Such an approach allows us to reliably assess uncertainty of the CMT parameters including the centroid position. The solutions show significant systematic spatial and temporal variations throughout the sequence. Foreshocks are right-lateral steeply dipping strike-slip events connected to the NE-SW shear zone. Those located close to the intersection of the Hinagu and Futagawa fault zones are dipping slightly to ESE, while those in the southern area are dipping to WNW. Contrarily, aftershocks are mostly normal dip-slip events, being related to the N-S extensional tectonic regime. Most of the deviatoric moment tensors contain only minor CLVD component, which can be attributed to the velocity model uncertainty. Nevertheless, two of the CMTs involve a significant CLVD component, which may reflect complex rupture process. Decomposition of those moment tensors into two pure shear moment tensors suggests combined right-lateral strike-slip and normal dip-slip mechanisms, consistent with the tectonic settings of the intersection of the Hinagu and Futagawa fault zones.[Figure not available: see fulltext.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_7");'>7</a></li> <li><a href="#" onclick='return showDiv("page_8");'>8</a></li> <li class="active"><span>9</span></li> <li><a href="#" onclick='return showDiv("page_10");'>10</a></li> <li><a href="#" onclick='return showDiv("page_11");'>11</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_9 --> <div id="page_10" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_8");'>8</a></li> <li><a href="#" onclick='return showDiv("page_9");'>9</a></li> <li class="active"><span>10</span></li> <li><a href="#" onclick='return showDiv("page_11");'>11</a></li> <li><a href="#" onclick='return showDiv("page_12");'>12</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="181"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017Icar..293...45N','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017Icar..293...45N"><span>Kaguya observations of the lunar wake in the terrestrial foreshock: Surface potential change by bow-shock reflected ions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Nishino, Masaki N.; Harada, Yuki; Saito, Yoshifumi; Tsunakawa, Hideo; Takahashi, Futoshi; Yokota, Shoichiro; Matsushima, Masaki; Shibuya, Hidetoshi; Shimizu, Hisayoshi</p> <p>2017-09-01</p> <p>There forms a tenuous region called the wake behind the Moon in the solar wind, and plasma entry/refilling into the wake is a fundamental problem of the lunar plasma science. High-energy ions and electrons in the foreshock of the Earth's magnetosphere were detected at the lunar surface in the Apollo era, but their effects on the lunar night-side environment have never been studied. Here we show the first observation of bow-shock reflected protons by Kaguya (SELENE) spacecraft in orbit around the Moon, confirming that solar wind plasma reflected at the terrestrial bow shock can easily access the deepest lunar wake when the Moon stays in the foreshock (We name this mechanism 'type-3 entry'). In a continuous type-3 event, low-energy electron beams from the lunar night-side surface are not obvious even though the spacecraft location is magnetically connected to the lunar surface. On the other hand, in an intermittent type-3 entry event, the kinetic energy of upward-going field-aligned electron beams decreases from ∼ 80 eV to ∼ 20 eV or electron beams disappear as the bow-shock reflected ions come accompanied by enhanced downward electrons. According to theoretical treatment based on electric current balance at the lunar surface including secondary electron emission by incident electron and ion impact, we deduce that incident ions would be accompanied by a few to several times higher flux of an incident electron flux, which well fits observed downward fluxes. We conclude that impact by the bow-shock reflected ions and electrons raises the electrostatic potential of the lunar night-side surface.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EGUGA..1911201J','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EGUGA..1911201J"><span>Source characterization of moderate induced earthquakes in Oklahoma, USA: A case study of 2013-2016 Cushing earthquake sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ji, Chen; Archuleta, Ralph</p> <p>2017-04-01</p> <p>The significant increase of seismicity rate in the central and eastern United States since 2009 has drawn wide attention for the potential seismic hazard. Unfortunately, most of moderate earthquakes in this region lack near-fault strong motion records, limiting in-depth studies. The 2016/11/07 M 5.0 Cushing, Oklahoma earthquake and its fore/aftershock sequence, which was monitored by four strong motion stations within 10 km of the mainshock epicenter, is the only exception. According to Oklahoma Geological Survey, no M>1.5 earthquake occurred before 2013 within 5 km of the mainshock epicenter, but 110 foreshocks, including two M>4 events, had occurred before the mainshock initiation. The close-fault records also revealed that M>4 foreshocks and mainshock excited unusually high level of strong ground motion. For example, 2015/10/10 Mw 4.3 Cushing earthquake resulted in peak ground acceleration (PGA) and peak ground velocity (PGV) up to 0.6 g and 8.3 cm/s, respectively. Simply correcting the geometric spreading (1/R, R is hypocenter distance) leads to mean PGA and PGV of 0.2 g and 3.6 cm/s at R=10 km, which are 4-8 times of the average values inferred from NGA-West dataset (Archuleta and Ji, 2016). Here we constrain the slip history of Cushing mainshock and its M>4 foreshocks using strong motion waveforms and compare them with the results of other moderate Oklahoma earthquakes. Our preliminary analysis of the mainshock leads to a preferred model of heterogeneous dextral slip on a vertical fault plane orienting N60oE, with three major rupture stages. The rupture initiated at a depth of 4.1 km, within the "cloud" of foreshocks. The first subevent has a rupture duration of 0.7 s and accounts for 20% of total seismic moment (Mw 4.4). After a delay of 0.5 s, a slip patch just outside the foreshock "cloud" and 2-3 km away from the hypocenter broke. From 1.2 s to 1.7 s, 45% of total seismic moment (Mw 4.7) was quickly released. The rest of the seismic moment (35%, Mw 4.6) occurred in the shallower depths (<2 km) within the next 1.5 s. The inverted total seismic moment is 2.6x10^16 Nm (Mw 4.9) and the peak slip is about 0.4 m. The total rupture duration of the inverted model is 3.2 s, about twice the typical value of Mw 4.9 earthquakes. The peak static stress drop estimated using the slip model is 10 MPa, but the energy based average stress drop is only 2 MPa, slightly lower than typical tectonic earthquakes. We note that these rupture characteristics are similar to the results of 2011 Mw 5.6 Prague, Oklahoma earthquake (Sun and Hartzell, 2014). Both of them support the hypothesis that unlike the tectonic earthquakes that occur on mature faults and often have single predominant asperity, the induced moderate earthquakes in Oklahoma can be viewed as cascade ruptures on pre-mature fault planes with multiple isolated asperities close to failure. Such a hypothesis supports the argument that the damage from injection-induced earthquakes will be especially concentrated in the immediate epicentral region (Hough, 2014).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFM.S53B2855A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFM.S53B2855A"><span>3-D Dynamic rupture simulation for the 2016 Kumamoto, Japan, earthquake sequence: Foreshocks and M6 dynamically triggered event</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ando, R.; Aoki, Y.; Uchide, T.; Imanishi, K.; Matsumoto, S.; Nishimura, T.</p> <p>2016-12-01</p> <p>A couple of interesting earthquake rupture phenomena were observed associated with the sequence of the 2016 Kumamoto, Japan, earthquake sequence. The sequence includes the April 15, 2016, Mw 7.0, mainshock, which was preceded by multiple M6-class foreshock. The mainshock mainly broke the Futagawa fault segment striking NE-SW direction extending over 50km, and it further triggered a M6-class earthquake beyond the distance more than 50km to the northeast (Uchide et al., 2016, submitted), where an active volcano is situated. Compiling the data of seismic analysis and InSAR, we presumed this dynamic triggering event occurred on an active fault known as Yufuin fault (Ando et al., 2016, JPGU general assembly). It is also reported that the coseismic slip was significantly large at a shallow portion of Futagawa Fault near Aso volcano. Since the seismogenic depth becomes significantly shallower in these two areas, we presume the geothermal anomaly play a role as well as the elasto-dynamic processes associated with the coseismic rupture. In this study, we conducted a set of fully dynamic simulations of the earthquake rupture process by assuming the inferred 3D fault geometry and the regional stress field obtained referring the stress tensor inversion. As a result, we showed that the dynamic rupture process was mainly controlled by the irregularity of the fault geometry subjected to the gently varying regional stress field. The foreshocks ruptures have been arrested at the juncture of the branch faults. We also show that the dynamic triggering of M-6 class earthquakes occurred along the Yufuin fault segment (located 50 km NE) because of the strong stress transient up to a few hundreds of kPa due to the rupture directivity effect of the M-7 event. It is also shown that the geothermal condition may lead to the susceptible condition of the dynamic triggering by considering the plastic shear zone on the down dip extension of the Yufuin segment, situated in the vicinity of an active volcano.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA143078','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA143078"><span>Geological-Seismological Evaluation of Earthquake Hazards at West Thompson Damsite, Connecticut.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1984-06-01</p> <p>Connecticut, N of 41.61N 72.12W 1.5 - Norwich ( Foreshock ) 29 Jun 80 Connecticut, N of 41.46N 72.09W 1.8 - Norwich 28 Jul 80 Connecticut, N of 41.52N...the event was judged to be either an aftershock or foreshock ; the geographic location is given as north latitude and west longitude, to the nearest 0.10</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20110015558','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20110015558"><span>Dayside Magnetopause Transients Correlated with Changes of the Magnetosheath Magnetic Field Orientation</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Tkachenko, O.; Safrankova, J.; Nemecek, Z.; Sibeck, D. G.</p> <p>2011-01-01</p> <p>The paper analyses one long-term pass (26 August 2007) of the THEMIS spacecraft across the dayside low-latitude magnetopause. THEMIS B, serving partly as a magnetosheath monitor, observed several changes of the magnetic field that were accompanied by dynamic changes of the magnetopause location and/or the structure of magnetopause layers observed by THEMIS C, D, and E, whereas THEMIS A scanned the inner magnetosphere. We discuss the plasma and the magnetic field data with motivation to identify sources of observed quasiperiodic plasma transients. Such events at the magnetopause are usually attributed to pressure pulses coming from the solar wind, foreshock fluctuations, flux transfer events or surface waves. The presented transient events differ in nature (the magnetopause surface deformation, the low-latitude boundary layer thickening, the crossing of the reconnection site), but we found that all of them are associated with changes of the magnetosheath magnetic field orientation and with enhancements or depressions of the plasma density. Since these features are not observed in the data of upstream monitors, the study emphasizes the role of magnetosheath fluctuations in the solar wind-magnetosphere coupling.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1981JGR....86.9325V','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1981JGR....86.9325V"><span>Seismicity parameters preceding moderate to major earthquakes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>von Seggern, David; Alexander, Shelton S.; Baag, Chang-Eob</p> <p>1981-10-01</p> <p>Seismic events reported in the bulletins of the two large arrays, LASA and NORSAR, were merged with those from the NEIS bulletin for the period 1970-1977. Using a lower cutoff of mb = 5.8, 510 `main shocks' within the P range of LASA or NORSAR were selected for this period; and various seismicity trends prior to them were investigated. A search for definite foreshocks, based on a significantly short time delay to the main shock, revealed that the true rate of foreshock occurrence was less than 20%. Foreshocks are almost exclusively associated with shallow (h < 100 km) main shocks. To establish common features, a method of averaging seismicity from many regions was used to suppress the randomness of the seismic behavior of each region. This averaging shows that the seismicity level around the main shock increases somewhat for 10 days before main shocks; this feature peaks in the last 3-4 hours prior to the main shocks. The averaging also reveals that the mean magnitude of events near the main shock increases prior to main shocks but only by a few hundredths of a magnitude unit. Again by averaging, the seismicity about main shocks is shown to tend with time toward the main shock as its origin time is approached, but the average effect is small (˜10% change). By expanding or contracting each region's time scale before averaging to relate to the magnitude of the main shock, these features are enhanced. Using a new variable to track the departures from both spatial and temporal randomness, the Poisson-like behavior of deeper seismicity (>100 km) was demonstrated. For shallow events (<100 km) this variable reveals numerous instances of clustering and spatial-temporal seismic gaps, with little tendency toward a uniformity of behavior prior to main shocks. A statistical test of the validity of seismic precursors was performed for approximately 90 main shock regions which had sufficient seismicity. Using a five-variable vector (interevent time, interevent distance, magnitude, epicentral distance to main shock, and depth difference relative to main shock) for each event in a `precursory' time window of 500 days before the main shock and for each event in a `normal' time window of 500 days before that, the null hypothesis of equal vector means between the two groups was tested. At 90% confidence level, less than 30% of the main shock regions were thus found to exhibit precursory seismicity changes. Appendices are available with entire article on microfiche. Order from American Geophysical Union, 2000 Florida Avenue, N.W., Washington, D.C. 20009. Document J81-007; $1.00. Payment must accompany order.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018PApGe.tmp...38P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018PApGe.tmp...38P"><span>Spatial and Temporal Characteristics of the Microseismicity Preceding the 2016 M L 6.6 Meinong Earthquake in Southern Taiwan</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Pu, Hsin-Chieh</p> <p>2018-02-01</p> <p>Before the M L 6.6 Meinong earthquake in 2016, intermediate-term quiescence (Q i), foreshocks, and short-term quiescence (Q s) were extracted from a comprehensive earthquake catalog. In practice, these behaviors are thought to be the seismic indicators of an earthquake precursor, and their spatiotemporal characteristics may be associated with location, magnitude, and occurrence time of the following main shock. Hence, detailed examinations were carried out to derive the spatiotemporal characteristics of these meaningful seismic behaviors. First, the spatial range of the Q i that occurred for 96 days was revealed in and around the Meinong earthquake. Second, a series of foreshocks was present for 1 day, clustered at the southeastern end of the Meinong earthquake. Third, Q s was present for 3 days and was pronounced after the foreshocks. Although these behaviors were recorded difficultly because the Q i was characterized by microseismicity at the lower cut-off magnitude, between M L 1.2 and 1.6, and most of the foreshocks were comprised of earthquakes with a magnitude lower than 1.8, they carried meaningful precursory indicators preceding the Meinong earthquake. These indicators provide the information of (1) the hypocenter, which was indicated by the area including the Q i, foreshocks, and Q s; (2) the magnitude, which could be associated to the spatial range of the Q i; (3) the asperity locations, which might be related to the areas of extraordinary low seismicity; and (4) a short-term warning leading of 3 days, which could have been announced based on the occurrence of the Q s. Particularly, Q i also appeared before strong inland earthquakes so that Q i might be an anticipative phenomenon before a strong earthquake in Taiwan.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015AGUFM.T41A2846M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015AGUFM.T41A2846M"><span>Systematic Study of Foreshocks and Triggered Earthquakes During the 2010 Mw7.2 El Mayor-Cucapah Earthquake Sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Meng, X.; Peng, Z.; Deng, S.; Castro, R. R.</p> <p>2015-12-01</p> <p>The 2010 Mw7.2 El Mayor-Cucapah earthquake occurred southwest of the Pacific-North America plate boundary in north Baja California. It was preceded by an intensive foreshock sequence, and was followed by numerous aftershocks both on and off the mainshock rupture zone, hence providing us a great opportunity to study the physical mechanisms of foreshock and aftershock triggering. In our previously published work (Meng and Peng, GJI, 2014), we focused on the seismicity rate changes around the Salton Sea Geothermal Field (SSGF) and along the San Jacinto Fault (SJF) following the mainshock. Based on a recently developed matched filter technique, we were able to detect up to 20 times more events than listed in the SCSN catalog. We found that the seismicity rate near SSGF and SJF both experienced significant increase immediately following the mainshock. However, the seismicity rate near SSGF, where static Coulomb stress decreased, dropped below the pre-mainshock level after ~50 days. On the other hand, the seismicity rate near SJF, where static Coulomb stress increased, remained high till the end of our detecting time window. Such pattern indicates that both static and dynamic triggering may coexist, but dominate in different time scales. Motivated by this success, we shift our focus to the foreshock and aftershock sequence of the El Mayor-Cucapah event. We utilize available seismic stations immediately north to US-Mexico boarder and a few stations within Mexico to conduct a similar detection ~40 days before to 40 days after the mainshock. We aim to obtain a complete foreshock sequence and investigate its spatio-temporal evolutions before the mainshock. Moreover, we plan to study similar patterns for aftershocks and the corresponding triggering mechanisms. Updated results will be presented at the meeting.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/16711905','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/16711905"><span>Properties of the probability distribution associated with the largest event in an earthquake cluster and their implications to foreshocks.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Zhuang, Jiancang; Ogata, Yosihiko</p> <p>2006-04-01</p> <p>The space-time epidemic-type aftershock sequence model is a stochastic branching process in which earthquake activity is classified into background and clustering components and each earthquake triggers other earthquakes independently according to certain rules. This paper gives the probability distributions associated with the largest event in a cluster and their properties for all three cases when the process is subcritical, critical, and supercritical. One of the direct uses of these probability distributions is to evaluate the probability of an earthquake to be a foreshock, and magnitude distributions of foreshocks and nonforeshock earthquakes. To verify these theoretical results, the Japan Meteorological Agency earthquake catalog is analyzed. The proportion of events that have 1 or more larger descendants in total events is found to be as high as about 15%. When the differences between background events and triggered event in the behavior of triggering children are considered, a background event has a probability about 8% to be a foreshock. This probability decreases when the magnitude of the background event increases. These results, obtained from a complicated clustering model, where the characteristics of background events and triggered events are different, are consistent with the results obtained in [Ogata, Geophys. J. Int. 127, 17 (1996)] by using the conventional single-linked cluster declustering method.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=232231','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=232231"><span>Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S</p> <p>1997-01-01</p> <p>GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3101680','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3101680"><span>Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.</p> <p>2011-01-01</p> <p>Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1223369','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1223369"><span>Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve</p> <p>2003-01-01</p> <p>The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19970005010','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19970005010"><span>Maximum Langmuir Fields in Planetary Foreshocks Determined from the Electrostatic Decay Threshold</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Robinson, P. A.; Cairns, Iver H.</p> <p>1995-01-01</p> <p>Maximum electric fields of Langmuir waves at planetary foreshocks are estimated from the threshold for electrostatic decay, assuming it saturates beam driven growth, and incorporating heliospheric variation of plasma density and temperature. Comparisons with spacecraft observations yields good quantitative agreement. Observations in type 3 radio sources are also in accord with this interpretation. A single mechanism can thus account for the highest fields of beam driven waves in both contexts.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19930033006&hterms=frequency+modulation&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D80%26Ntt%3Dfrequency%2Bmodulation','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19930033006&hterms=frequency+modulation&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D80%26Ntt%3Dfrequency%2Bmodulation"><span>Theory for low-frequency modulated Langmuir wave packets</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cairns, Iver H.; Robinson, P. A.</p> <p>1992-01-01</p> <p>Langmuir wave packets with low frequency modulations (or beats) observed in the Jovian foreshock are argued to be direct evidence for the Langmuir wave decay L yields L-prime + S. In this decay, 'pump' Langmuir waves L, driven by an electron beam, produce backscattered product Langmuir waves L-prime and ion sound waves S. The L and L-prime waves beat at the frequency and wavevector of the S waves, thereby modulating the wave packets. Beam speeds calculated using the modulated Jovian wave packets (1) are reasonable, at 4-10 times the electron thermal speed, (2) are consistent with theoretical limits on the decay process, and (3) decrease with increasing foreshock depth, as expected theoretically. These results strongly support the theory. The modulation depth of some wave packets suggests saturation by the decay L yields L-prime + S. Applications to modulated Langmuir packets in the Venusian and terrestrial foreshocks and in a type III radio source are proposed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24140641','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24140641"><span>A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong</p> <p>2013-12-01</p> <p>The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014EGUGA..1610224K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014EGUGA..1610224K"><span>Study of intermittent dynamics in the terrestrial foreshock using the Cluster spacecraft records</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Kovács, Péter; Vadász, Gergely; Koppán, András; Vörös, Zoltán</p> <p>2014-05-01</p> <p>The paper concerns with the statistical investigation of the intermittent dynamics in the terrestrial foreshock. We use the 22.5 Hz FGM magnetic data of the four spacecraft of the Cluster mission from periods when the mission orbit traversed the solar wind (January-April in the years of 2001-2010). Intermittency is studied in terms of space and time through a sliding-window probability density function (PDF) analysis of the records. The spatial dependence of the appearance of intermittent fluctuations is monitored according to the distance from the bow shock (BS) and the angle measured between the BS normal and the IMF direction (quasi parallel and perpendicular conditions). Beside the intermittent turbulent fluctuations, the foreshock dynamics is dominated by various wave phenomena, that are, in most cases, more energetic than the turbulent activity. For this reason, a high-pass wavelet filtering is carried out on the time-series for extracting the small-amplitude intermittent fluctuations at high-frequencies. The level of intermittent fluctuations is measured through the deviation of the fourth statistical moments of the time-series increments (i.e. the flatness) from the Gaussian value, 3. Instead of temporal increments, the PDF analysis is also carried out with spatial differences among the records of the four Cluster spacecraft. In this case the Taylor hypothesis has not to be invoked in the interpretation of the obtained results. It is shown that the intermittency level measured by spatial differences decreases logarithmically with the inter-spacecraft distance. The level of intermittent fluctuations in the foreshock is studied in terms of different solar wind conditions. The strongest correlation turns out to be between the intensity of intermittent foreshock dynamics and the solar wind bulk velocity and Alfvén Mach number. The research leading to these results has received funding from the European Community's Seventh Framework Programme ([FP7/2007-2013]) under grant agreement n° 313038/STORM.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22071895','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22071895"><span>Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E</p> <p>2012-01-01</p> <p>Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3234524','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3234524"><span>Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E</p> <p>2012-01-01</p> <p>Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/16645164','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/16645164"><span>Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark</p> <p>2006-08-15</p> <p>The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015EGUGA..17.7723F','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015EGUGA..17.7723F"><span>Foreshocks and aftershocks locations of the 2014 Pisagua, N. Chile earthquake: history of a megathrust earthquake nucleation</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Fuenzalida Velasco, Amaya; Rietbrock, Andreas; Tavera, Hernando; Ryder, Isabelle; Ruiz, Sergio; Thomas, Reece; De Angelis, Silvio; Bondoux, Francis</p> <p>2015-04-01</p> <p>The April 2014 Mw 8.1 Pisagua earthquake occurred in the Northern Chile seismic gap: a region of the South American subduction zone lying between Arica city and the Mejillones Peninsula. It is believed that this part of the subduction zone has not experienced a large earthquake since 1877. Thanks to the identification of this seismic gap, the north of Chile was well instrumented before the Pisagua earthquake, including the Integrated Plate boundary Observatory Chile (IPOC) network and the Chilean local network installed by the Centro Sismologico Nacional (CSN). These instruments were able to record the full foreshock and aftershock sequences, allowing a unique opportunity to study the nucleation process of large megathrust earthquakes. To improve azimuthal coverage of the Pisagua seismic sequence, after the earthquake, in collaboration with the Instituto Geofisico del Peru (IGP) we installed a temporary seismic network in south of Peru. The network comprised 12 short-period stations located in the coastal area between Moquegua and Tacna and they were operative from 1st May 2014. We also installed three stations on the slopes of the Ticsiani volcano to monitor any possible change in volcanic activity following the Pisagua earthquake. In this work we analysed the continuous seismic data recorded by CSN and IPOC networks from 1 March to 30 June to obtain the catalogue of the sequence, including foreshocks and aftershocks. Using an automatic algorithm based in STA/LTA we obtained the picks for P and S waves. Association in time and space defined the events and computed an initial location using Hypo71 and the 1D local velocity model. More than 11,000 events were identified with this method for the whole period, but we selected the best resolved events that include more than 7 observed arrivals with at least 2 S picks of them, to relocate these events using NonLinLoc software. For the main events of the sequence we carefully estimate event locations and we obtained their regional the Moment Tensor solutions by 1-D full waveform inversion of the broadband data using ISOLA software. In this work we analysed the evolution of the seismicity during the whole sequence and the spatial relation with coupling observed by previous geodetics studies.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_8");'>8</a></li> <li><a href="#" onclick='return showDiv("page_9");'>9</a></li> <li class="active"><span>10</span></li> <li><a href="#" onclick='return showDiv("page_11");'>11</a></li> <li><a href="#" onclick='return showDiv("page_12");'>12</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_10 --> <div id="page_11" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_9");'>9</a></li> <li><a href="#" onclick='return showDiv("page_10");'>10</a></li> <li class="active"><span>11</span></li> <li><a href="#" onclick='return showDiv("page_12");'>12</a></li> <li><a href="#" onclick='return showDiv("page_13");'>13</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="201"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70042475','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70042475"><span>Fundamental questions of earthquake statistics, source behavior, and the estimation of earthquake probabilities from possible foreshocks</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Michael, Andrew J.</p> <p>2012-01-01</p> <p>Estimates of the probability that an ML 4.8 earthquake, which occurred near the southern end of the San Andreas fault on 24 March 2009, would be followed by an M 7 mainshock over the following three days vary from 0.0009 using a Gutenberg–Richter model of aftershock statistics (Reasenberg and Jones, 1989) to 0.04 using a statistical model of foreshock behavior and long‐term estimates of large earthquake probabilities, including characteristic earthquakes (Agnew and Jones, 1991). I demonstrate that the disparity between the existing approaches depends on whether or not they conform to Gutenberg–Richter behavior. While Gutenberg–Richter behavior is well established over large regions, it could be violated on individual faults if they have characteristic earthquakes or over small areas if the spatial distribution of large‐event nucleations is disproportional to the rate of smaller events. I develop a new form of the aftershock model that includes characteristic behavior and combines the features of both models. This new model and the older foreshock model yield the same results when given the same inputs, but the new model has the advantage of producing probabilities for events of all magnitudes, rather than just for events larger than the initial one. Compared with the aftershock model, the new model has the advantage of taking into account long‐term earthquake probability models. Using consistent parameters, the probability of an M 7 mainshock on the southernmost San Andreas fault is 0.0001 for three days from long‐term models and the clustering probabilities following the ML 4.8 event are 0.00035 for a Gutenberg–Richter distribution and 0.013 for a characteristic‐earthquake magnitude–frequency distribution. Our decisions about the existence of characteristic earthquakes and how large earthquakes nucleate have a first‐order effect on the probabilities obtained from short‐term clustering models for these large events.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20000092430&hterms=wind+monitor&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dwind%2Bmonitor','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20000092430&hterms=wind+monitor&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dwind%2Bmonitor"><span>The Interaction of Solar wind Discontinuities with the Earth's Bow Shock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Sibeck, David G.</p> <p>2000-01-01</p> <p>Funding from NASA Grant No. NAG54679 was received in three installments. The first year's installment amounted to only one month of salary support and was used to prepare survey plots. The second year's installment allowed us to complete two research papers concerning the interaction of solar wind discontinuities with the Earth's bow shock. In the first (published) paper, we reported that the discontinuities launch slow mode waves into the magnetosheath and the slow mode waves always propagate antisunward through the flank magnetosheath. Because the sunward/antisunward sense of the magnetosheath magnetic field reverses across local noon, so does the (north/south or east/west) sense of the velocity fluctuations associated with the waves. Wind, Geotail, and IMP-8 observations were used for this study. In the second study, we used Wind and Interball-1 observations to demonstrate that pressure pulses in the magnetosheath occur in pairs and that they bound pressure cavities and/or brief intervals of outward magnetopause motion. This paper is now in press. Funding from the third year's installment has been used to investigate the two aspects of the foreshock. Two manuscripts are now in preparation for submission to the Journal of Geophysical Research. The first reports that waves within the foreshock account for many instances of poor correlations between two solar wind monitors. Remaining cases of poor correlation occur during intervals of nearly constant IMF orientations and magnetic field strengths. While the former category pose a significant difficulty for space weather forecasts, the latter do not. The second study surveys IMP-8 observations of the foreshock. We find that diamagnetic cavities are common, particularly during periods of high solar wind velocity and low solar wind density. Plasma densities, temperatures, and magnetic field strengths fall during intervals of enhanced energetic particle fluxes. The cavities are bounded by regions of decelerated solar wind plasma and enhanced densities and magnetic field strengths.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013EGUGA..15.3696O','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013EGUGA..15.3696O"><span>Characteristic of the postseismic deformation following the 2011 Sanriku-Oki earthquake (Mw 7.2) by comparing the 1989 and 1992 Sanriku-Oki events</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ohta, Yusaku; Hino, Ryota; Ariyoshi, Keisuke; Matsuzawa, Toru; Mishina, Masaaki; Sato, Tadahiro; Tachibana, Kenji; Demachi, Tomotsugu; Miura, Satoshi</p> <p>2013-04-01</p> <p>The March 11, 2011, moment magnitude (Mw) 9.0 Tohoku earthquake (hereafter referred to as the mainshock) generated a large tsunami, which caused devastating damage and the loss of more than 15,800 lives. On March 9, 2011 at 2:45 (UTC), an M7.3 interplate earthquake (hereafter referred to as the foreshock) occurred ~45 km northeast of the epicenter of the Mw9.0 mainshock. The focal mechanism estimated by the National Research Institute for Earth Science and Disaster Prevention (NIED) incorporates reverse fault motion with a west-northwest to east-southeast compression axis. This foreshock preceded the 2011 Tohoku earthquake by 51 h. Kato et al. [Science, 2012] pointed out aftershock migration after the foreshock along the trench axis toward the epicenter of the Mw9.0 mainshock on the basis of an earthquake catalog, which was created using a waveform correlation technique. They also estimated aseismic slip amount by the repeating earthquake analysis. Ohta et al. [GRL, 2012] proposed a coseismic and postseismic afterslip model of the foreshock based on a GPS network and ocean bottom pressure gauge sites. The estimated coseismic slip and afterslip areas show complementary spatial distributions. The slip amount for the afterslip is roughly consistent with that determined by repeating earthquake analysis carried out by Kato et al. [2012]. Ohta et al. [2012] also pointed out a volumetric strainmeter time series suggests that this event advanced with a rapid decay time constant compared with other typical large earthquakes. For verification of this exception, we investigated the postseismic deformation characteristic following the 1989 and 1992 Sanriku-Oki earthquake, which occurred 100-150 km north of the epicenter of the 2011 Sanriku-Oki event. We used four components extensometer of the Tohoku University at Miyako (39.59N, 141.98E) on the Sanriku coast for these events. To extract the characteristics of the postseismic deformation, we fitted the logarithmic function. The estimated decay time constant was relatively small compared with the typical interplate earthquakes in a similar fashion to 2011 Sanriku-Oki event. Our result suggests that the short decay time of the postseismic deformation is characteristic of this region. The exact reason of short decay time for these afterslips is unclear at present, but it was possibly controlled by the frictional property on the plate interface, especially effective normal stress controlled by fluid.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018GeoRL..45.2257U','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018GeoRL..45.2257U"><span>Fault Rupture Model of the 2016 Gyeongju, South Korea, Earthquake and Its Implication for the Underground Fault System</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Uchide, Takahiko; Song, Seok Goo</p> <p>2018-03-01</p> <p>The 2016 Gyeongju earthquake (ML 5.8) was the largest instrumentally recorded inland event in South Korea. It occurred in the southeast of the Korean Peninsula and was preceded by a large ML 5.1 foreshock. The aftershock seismicity data indicate that these earthquakes occurred on two closely collocated parallel faults that are oblique to the surface trace of the Yangsan fault. We investigate the rupture properties of these earthquakes using finite-fault slip inversion analyses. The obtained models indicate that the ruptures propagated NNE-ward and SSW-ward for the main shock and the large foreshock, respectively. This indicates that these earthquakes occurred on right-step faults and were initiated around a fault jog. The stress drops were up to 62 and 43 MPa for the main shock and the largest foreshock, respectively. These high stress drops imply high strength excess, which may be overcome by the stress concentration around the fault jog.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19900043504&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19900043504&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dforeshock"><span>Three-dimensional analytical model for the spatial variation of the foreshock electron distribution function - Systematics and comparisons with ISEE observations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Fitzenreiter, R. J.; Scudder, J. D.; Klimas, A. J.</p> <p>1990-01-01</p> <p>A model which is consistent with the solar wind and shock surface boundary conditions for the foreshock electron distribution in the absence of wave-particle effects is formulated for an arbitrary location behind the magnetic tangent to the earth's bow shock. Variations of the gyrophase-averaged velocity distribution are compared and contrasted with in situ ISEE observations. It is found that magnetic mirroring of solar wind electrons is the most important process by which nonmonotonic reduced electron distributions in the foreshock are produced. Leakage of particles from the magnetosheath is shown to be relatively unimportant in determining reduced distributions that are nonmonotonic. The two-dimensional distribution function off the magnetic field direction is the crucial contribution in producing reduced distributions which have beams. The time scale for modification of the electron velocity distribution in velocity space can be significantly influenced by steady state spatial gradients in the background imposed by the curved shock geometry.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/19997128','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/19997128"><span>Enhancer elements upstream of the SHOX gene are active in the developing limb.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun</p> <p>2010-05-01</p> <p>Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2987325','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2987325"><span>Enhancer elements upstream of the SHOX gene are active in the developing limb</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun</p> <p>2010-01-01</p> <p>Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4062490','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4062490"><span>Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho</p> <p>2014-01-01</p> <p>The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19890036888&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19890036888&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D40%26Ntt%3Dforeshock"><span>Simulations relevant to the beam instability in the foreshock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cairns, I. H.; Nishikawa, K.-I.</p> <p>1989-01-01</p> <p>The results presently obtained from two-dimensional simulations of the reactive instability for Maxwellian beams and cutoff distributions are noted to be consistent with recent suggestions that electrons backstreaming into earth's foreshock have steep-sided cutoff distributions, which are initially unstable to the reactive instability, and that the back-reaction to the wave growth causes the instability to pass into its kinetic phase. It is demonstrated that the reactive instability is a bunching instability, and that the reactive instability saturates and passes over into the kinetic phase by particle trapping.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19810030288&hterms=lazarus&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAuthor-Name%26N%3D0%26No%3D90%26Ntt%3Dlazarus','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19810030288&hterms=lazarus&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAuthor-Name%26N%3D0%26No%3D90%26Ntt%3Dlazarus"><span>Deceleration of the solar wind in the earth's foreshock region - Isee 2 and Imp 8 observations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Bonifazi, C.; Moreno, G.; Lazarus, A. J.; Sullivan, J. D.</p> <p>1980-01-01</p> <p>The deceleration of the solar wind in the region of the interplanetary space filled by ions backstreaming from the earth's bow shock and associated waves is studied using a two-spacecraft technique. This deceleration depends on the solar wind bulk velocity; at low velocities (below 300 km/s) the velocity decrease is about 5 km/s, while at higher velocities (above 400 km/s) the decrease may be as large as 30 km/s. The energy balance shows that the kinetic energy loss far exceeds the thermal energy which is possibly gained by the solar wind; therefore at least part of this energy must go into waves and/or into the backstreaming ions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25604083','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25604083"><span>Copy number variation of two separate regulatory regions upstream of SOX9 causes isolated 46,XY or 46,XX disorder of sex development.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kim, Gwang-Jin; Sock, Elisabeth; Buchberger, Astrid; Just, Walter; Denzer, Friederike; Hoepffner, Wolfgang; German, James; Cole, Trevor; Mann, Jillian; Seguin, John H; Zipf, William; Costigan, Colm; Schmiady, Hardi; Rostásy, Moritz; Kramer, Mildred; Kaltenbach, Simon; Rösler, Bernd; Georg, Ina; Troppmann, Elke; Teichmann, Anne-Christin; Salfelder, Anika; Widholz, Sebastian A; Wieacker, Peter; Hiort, Olaf; Camerino, Giovanna; Radi, Orietta; Wegner, Michael; Arnold, Hans-Henning; Scherer, Gerd</p> <p>2015-04-01</p> <p>SOX9 mutations cause the skeletal malformation syndrome campomelic dysplasia in combination with XY sex reversal. Studies in mice indicate that SOX9 acts as a testis-inducing transcription factor downstream of SRY, triggering Sertoli cell and testis differentiation. An SRY-dependent testis-specific enhancer for Sox9 has been identified only in mice. A previous study has implicated copy number variations (CNVs) of a 78 kb region 517-595 kb upstream of SOX9 in the aetiology of both 46,XY and 46,XX disorders of sex development (DSD). We wanted to better define this region for both disorders. By CNV analysis, we identified SOX9 upstream duplications in three cases of SRY-negative 46,XX DSD, which together with previously reported duplications define a 68 kb region, 516-584 kb upstream of SOX9, designated XXSR (XX sex reversal region). More importantly, we identified heterozygous deletions in four families with SRY-positive 46,XY DSD without skeletal phenotype, which define a 32.5 kb interval 607.1-639.6 kb upstream of SOX9, designated XY sex reversal region (XYSR). To localise the suspected testis-specific enhancer, XYSR subfragments were tested in cell transfection and transgenic experiments. While transgenic experiments remained inconclusive, a 1.9 kb SRY-responsive subfragment drove expression specifically in Sertoli-like cells. Our results indicate that isolated 46,XY and 46,XX DSD can be assigned to two separate regulatory regions, XYSR and XXSR, far upstream of SOX9. The 1.9 kb SRY-responsive subfragment from the XYSR might constitute the core of the Sertoli-cell enhancer of human SOX9, representing the so far missing link in the genetic cascade of male sex determination. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2012EGUGA..14.4273O','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2012EGUGA..14.4273O"><span>Co- and postseismic slip distribution for the 2011 March 9 earthquake based on the geodetic data: Role on the initiation of the 2011 Tohoku earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ohta, Y.; Hino, R.; Inazu, D.; Ohzono, M.; Mishina, M.; Nakajima, J.; Ito, Y.; Sato, T.; Tamura, Y.; Fujimoto, H.; Tachibana, K.; Demachi, T.; Osada, Y.; Shinohara, M.; Miura, S.</p> <p>2012-04-01</p> <p>A large foreshock with M7.3 occurred on March 9, 2011 at the subducting Pacific plate interface followed by the M9.0 Tohoku earthquake 51 hours later. We propose a slip distribution of the foreshock deduced from dense inland GPS sites and Ocean Bottom Pressure gauge (OBP) sites. The multiple OBP gauges were installed before the M7.3 foreshock in and around the focal area. We succeed to collect the OBP gauge data in 9 sites, which included two cabled OBPs in off Kamaishi (TM1, TM2). The inland GPS horizontal coseismic displacements are estimated based on baseline analyses to show the broad area of displacement field up to ~30mm directing to the focal area. In contrast, there is no coherent signal in the vertical components. The several OBP sites, for example, P2 and P6 sites located the westward from the epicenter of the foreshock clearly detected the coseismic displacement. The estimated coseismic displacement reached more than 100mm in P6 sites. Intriguingly, GJT3 sites, which the most nearly OBP sites from the epicenter, did not show the significant displacement. Based on the inland GPS sites and OBPs data, we estimated a coseismic slip distribution in the subducting plate interface. The estimated slip distribution can explain observations including the vertical displacement obtained at the OBP sites. The amount of moment release is equivalent to Mw 7.2. The spatio-temporal aftershock distribution of the foreshock shows a southward migration from our estimated fault model. We suggest that aseismic slip occurred after the M7.3 earthquake. The onshore GPS data also supports the occurrence of the afterslip in the southwestward area of the coseismic fault. We estimated the sub-daily coordinates every three hours at the several coastal GPS sites to reveal the time evolutional sequences suggesting the postseismic deformation, especially in the horizontal components. We also examine volumetric strain data at Kinka-san Island, which is situated at the closest distance from the hypocenter. The time series also clearly show the postseismic signal after the M7.3 earthquake. The both of strain meter and GPS time series did not show any acceleration expected as a nucleation process of the M9.0 event; rather, both time series show deceleration of the postseismic deformation before the M9.0 event, even for only two days after the M7.3 earthquake. The OBPs data also indicated the postseismic deformation after the foreshock until the M9 mainshock. Based on the GPS and OBPs data, we estimated the afterslip distribution. The estimated slip distribution is located the southeastern part of the foreshock coseismic distribution. We suggest that aftershocks of the March 9 event may have been caused by stress concentrations along the edge of the afterslip. One of these aftershocks may trigger the huge M 9.0 Tohoku earthquake, although more investigations are required to confirm this scenario.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70048547','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70048547"><span>Foreshocks during the nucleation of stick-slip instability</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>McLaskey, Gregory C.; Kilgore, Brian D.</p> <p>2013-01-01</p> <p>We report on laboratory experiments which investigate interactions between aseismic slip, stress changes, and seismicity on a critically stressed fault during the nucleation of stick-slip instability. We monitor quasi-static and dynamic changes in local shear stress and fault slip with arrays of gages deployed along a simulated strike-slip fault (2 m long and 0.4 m deep) in a saw cut sample of Sierra White granite. With 14 piezoelectric sensors, we simultaneously monitor seismic signals produced during the nucleation phase and subsequent dynamic rupture. We observe localized aseismic fault slip in an approximately meter-sized zone in the center of the fault, while the ends of the fault remain locked. Clusters of high-frequency foreshocks (Mw ~ −6.5 to −5.0) can occur in this slowly slipping zone 5–50 ms prior to the initiation of dynamic rupture; their occurrence appears to be dependent on the rate at which local shear stress is applied to the fault. The meter-sized nucleation zone is generally consistent with theoretical estimates, but source radii of the foreshocks (2 to 70 mm) are 1 to 2 orders of magnitude smaller than the theoretical minimum length scale over which earthquake nucleation can occur. We propose that frictional stability and the transition between seismic and aseismic slip are modulated by local stressing rate and that fault sections, which would typically slip aseismically, may radiate seismic waves if they are rapidly stressed. Fault behavior of this type may provide physical insight into the mechanics of foreshocks, tremor, repeating earthquake sequences, and a minimum earthquake source dimension.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20140006630','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20140006630"><span>Whistler Waves Associated with Weak Interplanetary Shocks</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Velez, J. C. Ramirez; Blanco-Cano, X.; Aguilar-Rodriguez, E.; Russell, C. T.; Kajdic, P.; Jian,, L. K.; Luhmann, J. G.</p> <p>2012-01-01</p> <p>We analyze the properties of 98 weak interplanetary shocks measured by the dual STEREO spacecraft over approximately 3 years during the past solar minimum. We study the occurrence of whistler waves associated with these shocks, which on average are high beta shocks (0.2 < Beta < 10). We have compared the waves properties upstream and downstream of the shocks. In the upstream region the waves are mainly circularly polarized, and in most of the cases (approx. 75%) they propagate almost parallel to the ambient magnetic field (<30 deg.). In contrast, the propagation angle with respect to the shock normal varies in a broad range of values (20 deg. to 90 deg.), suggesting that they are not phase standing. We find that the whistler waves can extend up to 100,000 km in the upstream region but in most cases (88%) are contained in a distance within 30,000 km from the shock. This corresponds to a larger region with upstream whistlers associated with IP shocks than previously reported in the literature. The maximum amplitudes of the waves are observed next to the shock interface, and they decrease as the distance to the shock increases. In most cases the wave propagation direction becomes more aligned with the magnetic field as the distance to the shock increases. These two facts suggest that most of the waves in the upstream region are Landau damping as they move away from the shock. From the analysis we also conclude that it is likely that the generation mechanism of the upstream whistler waves is taking place at the shock interface. In the downstream region, the waves are irregularly polarized, and the fluctuations are very compressive; that is, the compressive component of the wave clearly dominates over the transverse one. The majority of waves in the downstream region (95%) propagate at oblique angles with respect to the ambient magnetic field (>60 deg.). The wave propagation with respect to the shock-normal direction has no preferred direction and varies similarly to the upstream case. It is possible that downstream fluctuations are generated by ion relaxation as suggested in previous hybrid simulation shocks.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=96105&keyword=bile&actType=&TIMSType=+&TIMSSubTypeID=&DEID=&epaNumber=&ntisID=&archiveStatus=Both&ombCat=Any&dateBeginCreated=&dateEndCreated=&dateBeginPublishedPresented=&dateEndPublishedPresented=&dateBeginUpdated=&dateEndUpdated=&dateBeginCompleted=&dateEndCompleted=&personID=&role=Any&journalID=&publisherID=&sortBy=revisionDate&count=50','EPA-EIMS'); return false;" href="https://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=96105&keyword=bile&actType=&TIMSType=+&TIMSSubTypeID=&DEID=&epaNumber=&ntisID=&archiveStatus=Both&ombCat=Any&dateBeginCreated=&dateEndCreated=&dateBeginPublishedPresented=&dateEndPublishedPresented=&dateBeginUpdated=&dateEndUpdated=&dateBeginCompleted=&dateEndCompleted=&personID=&role=Any&journalID=&publisherID=&sortBy=revisionDate&count=50"><span>USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://oaspub.epa.gov/eims/query.page">EPA Science Inventory</a></p> <p></p> <p></p> <p>Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a baseline of fish from refer...</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=13221&keyword=casa&actType=&TIMSType=+&TIMSSubTypeID=&DEID=&epaNumber=&ntisID=&archiveStatus=Both&ombCat=Any&dateBeginCreated=&dateEndCreated=&dateBeginPublishedPresented=&dateEndPublishedPresented=&dateBeginUpdated=&dateEndUpdated=&dateBeginCompleted=&dateEndCompleted=&personID=&role=Any&journalID=&publisherID=&sortBy=revisionDate&count=50','EPA-EIMS'); return false;" href="https://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=13221&keyword=casa&actType=&TIMSType=+&TIMSSubTypeID=&DEID=&epaNumber=&ntisID=&archiveStatus=Both&ombCat=Any&dateBeginCreated=&dateEndCreated=&dateBeginPublishedPresented=&dateEndPublishedPresented=&dateBeginUpdated=&dateEndUpdated=&dateBeginCompleted=&dateEndCompleted=&personID=&role=Any&journalID=&publisherID=&sortBy=revisionDate&count=50"><span>USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://oaspub.epa.gov/eims/query.page">EPA Science Inventory</a></p> <p></p> <p></p> <p>Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a basline of fish from refere...</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28485207','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28485207"><span>Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui</p> <p>2017-06-01</p> <p>The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20120016402','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20120016402"><span>Short Large-Amplitude Magnetic Structures (SLAMS) at Venus</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Collinson, G. A.; Wilson, L. B.; Sibeck, D. G.; Shane, N.; Zhang, T. L.; Moore, T. E.; Coates, A. J.; Barabash, S.</p> <p>2012-01-01</p> <p>We present the first observation of magnetic fluctuations consistent with Short Large-Amplitude Magnetic Structures (SLAMS) in the foreshock of the planet Venus. Three monolithic magnetic field spikes were observed by the Venus Express on the 11th of April 2009. The structures were approx.1.5->11s in duration, had magnetic compression ratios between approx.3->6, and exhibited elliptical polarization. These characteristics are consistent with the SLAMS observed at Earth, Jupiter, and Comet Giacobini-Zinner, and thus we hypothesize that it is possible SLAMS may be found at any celestial body with a foreshock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22666080-dynamics-high-energy-ions-structured-collisionless-shock-front','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22666080-dynamics-high-energy-ions-structured-collisionless-shock-front"><span>DYNAMICS OF HIGH ENERGY IONS AT A STRUCTURED COLLISIONLESS SHOCK FRONT</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Gedalin, M.; Dröge, W.; Kartavykh, Y. Y., E-mail: gedalin@bgu.ac.il</p> <p>2016-07-10</p> <p>Ions undergoing first-order Fermi acceleration at a shock are scattered in the upstream and downstream regions by magnetic inhomogeneities. For high energy ions this scattering is efficient at spatial scales substantially larger than the gyroradius of the ions. The transition from one diffusive region to the other occurs via crossing the shock, and the ion dynamics during this crossing is mainly affected by the global magnetic field change between the upstream and downstream region. We study the effects of the fine structure of the shock front, such as the foot-ramp-overshoot profile and the phase-standing upstream and downstream magnetic oscillations. Wemore » also consider time dependent features, including reformation and large amplitude coherent waves. We show that the influence of the spatial and temporal structure of the shock front on the dependence of the transition and reflection on the pitch angle of the ions is already weak at ion speeds five times the speed of the upstream flow.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2003AGUFMNG11A0176N','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2003AGUFMNG11A0176N"><span>The Extended Concept Of Symmetropy And Its Application To Earthquakes And Acoustic Emissions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Nanjo, K.; Yodogawa, E.</p> <p>2003-12-01</p> <p>There is the notion of symmetropy that can be considered as a powerful tool to measure quantitatively entropic heterogeneity regarding symmetry of a pattern. It can be regarded as a quantitative measure to extract the feature of asymmetry of a pattern (Yodogawa, 1982; Nanjo et al., 2000, 2001, 2002 in press). In previous studies, symmetropy was estimated for the spatial distributions of acoustic emissions generated before the ultimate whole fracture of a rock specimen in the laboratory experiment and for the spatial distributions of earthquakes in the seismic source model with self-organized criticality (SOC). In each of these estimations, the outline of the region in which symmetropy is estimated for a pattern is determined to be equal to that of the rock specimen in which acoustic emissions are generated or that of the SOC seismic source model from which earthquakes emerge. When local seismicities like aftershocks, foreshocks and earthquake swarms in the Earth's crust are considered, it is difficult to determine objectively the outline of the region characterizing these local seismicities without the need of subjectiveness. So, the original concept of symmetropy is not appropriate to be directly applied to such local seismicities and the proper modification of the original one is needed. Here, we introduce the notion of symmetropy for the nonlinear geosciences and extend it for the purpose of the application to local seismicities such as aftershocks, foreshocks and earthquake swarms. We employ the extended concept to the spatial distributions of acoustic emissions generated in a previous laboratory experiment where the failure process in a brittle granite sample can be stabilized by controlling axial stress to maintain a constant rate of acoustic emissions and, as a result, detailed view of fracture nucleation and growth was observed. Moreover, it is applied to the temporal variations of spatial distributions of aftershocks and foreshocks of the main shocks, using natural observable data of earthquakes in and around Japan. Our results show the successful applicability of the extended concept of symmetropy to earthquakes and acoustic emissions. Furthermore, it is pointed out that the concept of symmetropy or the extended one of it might be adapted to any pattern recognition in many fields of science, particularly in the nonlinear geosciences and the sciences of complexity. References: Yodogawa, 1982, Percept. Psychophys., v. 32, p. 230-240; Nanjo et al., 2000, Forma, v. 15, p. 95-101; Nanjo et al., 2001, Forma, v. 16, p. 213-224; Nanjo et al., 2002 in press, Symmetry: Art and Science, v. 2.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_9");'>9</a></li> <li><a href="#" onclick='return showDiv("page_10");'>10</a></li> <li class="active"><span>11</span></li> <li><a href="#" onclick='return showDiv("page_12");'>12</a></li> <li><a href="#" onclick='return showDiv("page_13");'>13</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_11 --> <div id="page_12" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_10");'>10</a></li> <li><a href="#" onclick='return showDiv("page_11");'>11</a></li> <li class="active"><span>12</span></li> <li><a href="#" onclick='return showDiv("page_13");'>13</a></li> <li><a href="#" onclick='return showDiv("page_14");'>14</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="221"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2005JGRA..11011220E','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2005JGRA..11011220E"><span>Quasi-monochromatic ULF foreshock waves as observed by the four-spacecraft Cluster mission: 2. Oblique propagation</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Eastwood, J. P.; Balogh, A.; Lucek, E. A.; Mazelle, C.; Dandouras, I.</p> <p>2005-11-01</p> <p>This paper presents the results of a statistical investigation into the nature of oblique wave propagation in the foreshock. Observations have shown that foreshock ULF waves tend to propagate obliquely to the background magnetic field. This is in contrast to theoretical work, which predicts that the growth rate of the mechanism responsible for the waves is maximized for parallel propagation, at least in the linear regime in homogenous plasma. Here we use data from the Cluster mission to study in detail the oblique propagation of a particular class of foreshock ULF wave, the 30 s quasi-monochromatic wave. We find that these waves persistently propagate at oblique angles to the magnetic field. Over the whole data set, the average value of θkB was found to be 21 ± 14°. Oblique propagation is observed even when the interplanetary magnetic field (IMF) cone angle is small, such that the convective component of the solar wind velocity, vE×B, is comparable to the wave speed. In this subset of the data, the mean value of θkB was 12.9 ± 7.1°. In the subset of data for which the IMF cone angle exceeded 45°, the mean value of θkB was 19.5 ± 10.7°. When the angle between the IMF and the x geocentric solar ecliptic (GSE) direction (i.e., the solar wind vector) is large, the wave k vectors tend to be confined in the plane defined by the x GSE direction and the magnetic field and a systematic deflection is observed. The dependence of θkB on vE×B is also studied.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3973379','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3973379"><span>The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p></p> <p>2014-01-01</p> <p>Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25900885','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25900885"><span>Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu</p> <p>2015-08-01</p> <p>Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20110015544&hterms=reformation+period&qs=N%3D0%26Ntk%3DAll%26Ntx%3Dmode%2Bmatchall%26Ntt%3DThe%2Breformation%2Bperiod','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20110015544&hterms=reformation+period&qs=N%3D0%26Ntk%3DAll%26Ntx%3Dmode%2Bmatchall%26Ntt%3DThe%2Breformation%2Bperiod"><span>THEMIS Observations of a Transient Event at the Magnetopause</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Korotova, G. I.; Sibeck, D. G.; Weatherwax, A.; Angelopoulos, V.; Styazhkin, V.</p> <p>2011-01-01</p> <p>This study focuses on Time History of Events and Macroscale Interactions During Substorms (THEMIS) observations of a long \\duration transient event in the vicinity of the dayside magnetopause at approx.15:34 UT on 18 July 2008 that was characterized by features typical of a magnetospheric flux transfer event (FTE): a bipolar negative-positive 5-7 nT signature in the Bn component, a positive monopolar variation in the Bl and Bm components, a approx.5-7 nT enhancement in the total magnetic field strength, and a transient density and flow enhancement. The interplanetary magnetic field (IMF) was mostly radial and disturbed during the intervals studied; that is, it was favorable for the repeated formation, disappearance and reformation of the foreshock just upstream from the subsolar bow shock. We show that varying IMF directions and solar wind pressures created significant effects that caused the compressions of the magnetosphere and the bow shock and magnetopause motions and triggered the transient event. Global signatures of magnetic impulse events (MIEs) in ground magnetograms during the period suggest a widespread pressure pulse instead of a localized FTE as the cause of the event in the magnetosphere. The directions of propagation and the flow patterns associated with the event also suggest an interpretation in terms of pressure pulses.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20110005632','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20110005632"><span>Volumetric Studies of Earth's Electron Foreshock Using PEACE Data</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Goldstein, Melvyn L.; Gurgiolo, Chris; Fazakersley, Andrew</p> <p>2010-01-01</p> <p>We describe the methodology used to set up and compute spatial derivatives of the electron moments using data acquired by the Plasma Electron And Current Experiment (PEACE) electron data from the four Cluster spacecraft. The results are used to investigate electron vorticity in the foreshock. What is found is that much of the measured vorticity, under nominal conditions, appears to be caused by changes in the flow direction of the return (either reflected or leakage from the magnetosheath) and strahl electron populations as they couple to changes in the magnetic field orientation. This in turn results in deflections in the total bulk velocity.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19900049930&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19900049930&hterms=foreshock&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dforeshock"><span>Simulation studies of plasma waves in the electron foreshock - The transition from reactive to kinetic instability</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Dum, C. T.</p> <p>1990-01-01</p> <p>Particle simulation experiments were used to analyze the electron beam-plasma instability. It is shown that there is a transition from the reactive state of the electron beam-plasma instability to the kinetic instability of Langmuir waves. Quantitative tests, which include an evaluation of the dispersion relation for the evolving non-Maxwellian beam distribution, show that a quasi-linear theory describes the onset of this transition and applies again fully to the kinetic stage. This stage is practically identical to the late stage seen in simulations of plasma waves in the electron foreshock described by Dum (1990).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19960002144','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19960002144"><span>A Numerical Study of the Effect of Wake Passing on Turbine Blade Film Cooling</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Heidmann, James D.</p> <p>1995-01-01</p> <p>Time-accurate and steady three-dimensional viscous turbulent numerical simulations were performed to study the effect of upstream blade wake passing unsteadiness on the performance of film cooling on a downstream axial turbine blade. The simulations modeled the blade as spanwise periodic and of infinite span. Both aerodynamic and heat transfer quantities were explored. A showerhead film cooling arrangement typical of modern gas turbine engines was employed. Showerhead cooling was studied because of its anticipated strong sensitivity to upstream flow fluctuations. The wake was modeled as a region of zero axial velocity on the upstream computational boundary which translated with each iteration. This model is compatible with a planned companion experiment in which the wakes will be produced by a rotating row of cylindrical rods upstream of an annular turbine cascade. It was determined that a steady solution with appropriate upstream swirl and stagnation pressure predicted the span-average film effectiveness quite well. The major difference is a 2 to 3 percent overprediction of span-average film effectiveness by the steady simulation on the pressure surface and in the showerhead region. Local overpredictions of up to 8 percent were observed in the showerhead region. These differences can be explained by the periodic relative lifting of the boundary layer and enhanced mixing in the unsteady simulations.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/19257364','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/19257364"><span>Increased upstream ionization due to formation of a double layer.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Thakur, S Chakraborty; Harvey, Z; Biloiu, I A; Hansen, A; Hardin, R A; Przybysz, W S; Scime, E E</p> <p>2009-01-23</p> <p>We report observations that confirm a theoretical prediction that formation of a current-free double layer in a plasma expanding into a chamber of larger diameter is accompanied by an increase in ionization upstream of the double layer. The theoretical model argues that the increased ionization is needed to balance the difference in diffusive losses upstream and downstream of the expansion region. In our expanding helicon source experiments, we find that the upstream plasma density increases sharply at the same antenna frequency at which the double layer appears.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27725474','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27725474"><span>The 2016 Kumamoto earthquake sequence.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kato, Aitaro; Nakamura, Kouji; Hiyama, Yohei</p> <p>2016-01-01</p> <p>Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An M j 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an M j 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5243951','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5243951"><span>The 2016 Kumamoto earthquake sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>KATO, Aitaro; NAKAMURA, Kouji; HIYAMA, Yohei</p> <p>2016-01-01</p> <p>Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An Mj 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an Mj 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest. PMID:27725474</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22518582-ion-acceleration-quasi-parallel-bow-shock-decoding-signature-injection','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22518582-ion-acceleration-quasi-parallel-bow-shock-decoding-signature-injection"><span>ION ACCELERATION AT THE QUASI-PARALLEL BOW SHOCK: DECODING THE SIGNATURE OF INJECTION</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Sundberg, Torbjörn; Haynes, Christopher T.; Burgess, D.</p> <p></p> <p>Collisionless shocks are efficient particle accelerators. At Earth, ions with energies exceeding 100 keV are seen upstream of the bow shock when the magnetic geometry is quasi-parallel, and large-scale supernova remnant shocks can accelerate ions into cosmic-ray energies. This energization is attributed to diffusive shock acceleration; however, for this process to become active, the ions must first be sufficiently energized. How and where this initial acceleration takes place has been one of the key unresolved issues in shock acceleration theory. Using Cluster spacecraft observations, we study the signatures of ion reflection events in the turbulent transition layer upstream of the terrestrial bowmore » shock, and with the support of a hybrid simulation of the shock, we show that these reflection signatures are characteristic of the first step in the ion injection process. These reflection events develop in particular in the region where the trailing edge of large-amplitude upstream waves intercept the local shock ramp and the upstream magnetic field changes from quasi-perpendicular to quasi-parallel. The dispersed ion velocity signature observed can be attributed to a rapid succession of ion reflections at this wave boundary. After the ions’ initial interaction with the shock, they flow upstream along the quasi-parallel magnetic field. Each subsequent wavefront in the upstream region will sweep the ions back toward the shock, where they gain energy with each transition between the upstream and the shock wave frames. Within three to five gyroperiods, some ions have gained enough parallel velocity to escape upstream, thus completing the injection process.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3105432','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3105432"><span>Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro</p> <p>2011-01-01</p> <p>Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17794569','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17794569"><span>The 1985 central chile earthquake: a repeat of previous great earthquakes in the region?</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Comte, D; Eisenberg, A; Lorca, E; Pardo, M; Ponce, L; Saragoni, R; Singh, S K; Suárez, G</p> <p>1986-07-25</p> <p>A great earthquake (surface-wave magnitude, 7.8) occurred along the coast of central Chile on 3 March 1985, causing heavy damage to coastal towns. Intense foreshock activity near the epicenter of the main shock occurred for 11 days before the earthquake. The aftershocks of the 1985 earthquake define a rupture area of 170 by 110 square kilometers. The earthquake was forecast on the basis of the nearly constant repeat time (83 +/- 9 years) of great earthquakes in this region. An analysis of previous earthquakes suggests that the rupture lengths of great shocks in the region vary by a factor of about 3. The nearly constant repeat time and variable rupture lengths cannot be reconciled with time- or slip-predictable models of earthquake recurrence. The great earthquakes in the region seem to involve a variable rupture mode and yet, for unknown reasons, remain periodic. Historical data suggest that the region south of the 1985 rupture zone should now be considered a gap of high seismic potential that may rupture in a great earthquake in the next few tens of years.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016EGUGA..18.2908H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016EGUGA..18.2908H"><span>Seafloor seismological/geodetic observations in the rupture area of the 2011 Tohoku-oki Earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Hino, Ryota; Shinohara, Masanao; Ito, Yoshihiro</p> <p>2016-04-01</p> <p>A number of important aspects of the 2011 Tohoku-oki earthquake (Mw 9.0) were clarified by the seafloor seismological and geodetic observation above the rupture area of the earthquake. Besides the extraordinarily large coseismic displacements, various kinds of slow slip phenomena associated with intensive micro-seismicity on the plate boundary fault were identified by near field ocean bottom seismographs and seafloor geodetic observation networks. The Tohoku-oki earthquake was preceded by evident foreshock activity with a spatial expansion of this seismicity. The activity became significantly intense after the occurrence of the largest foreshock two days before the mainshock rupture. During the period, clear continuous seafloor deformation was identified caused by the aseismic slip following the largest foreshock. Another different type of aseismic slip event had occurred before this pre-imminent activity had started about a month before the largest foreshock happened. The observed increased seismicity associated with aseismic slip suggests that there must have been some chain reaction like interplay of seismic and interseismic slips before the large earthquake broke out. However, no evident deformation signals were observed indicating acceleration of fault slip immediately before the mainshock. Seafloor geodetic measurements reveals that the postseismic deformation around the rupture area of the Tohoku-oki earthquake shows complex spatial pattern and the complexity is mostly due to significant viscoelastic relaxation induced by the huge coseismic slip. The effects of viscoelastic deformation makes it difficult to identify the deformation associated with the after slip or regaining of interplate coupling and requires us to enhance the abilities of seafloor monitoring to detect the slip activities on the fault. We started an array of seismometer arrays observation including broad-band seismographs to detect and locate slow-slip events and low-frequency tremors. Another observation we started is direct-path acoustic ranging across the trench axis. Slip rate of the shallow fault can be measured by monitoring the change in distance between the benchmarks on the incoming and overrding plates.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2011AGUFM.G51A0868I','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2011AGUFM.G51A0868I"><span>Ocean bottom pressure observations near the source of the 2011 Tohoku earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Inazu, D.; Hino, R.; Suzuki, S.; Osada, Y.; Ohta, Y.; Iinuma, T.; Tsushima, H.; Ito, Y.; Kido, M.; Fujimoto, H.</p> <p>2011-12-01</p> <p>A Mw9.0 earthquake occurred off Miyagi, northeast Japan, on 11 March 2011 (hereafter mainshock). An earthquake of M7.3, considered to be the largest foreshock of the mainshock, occurred on 9 March 2011 near the mainshock hypocenter. A suite of seismic and geodetic variations related to these earthquakes was observed by autonomous, ocean bottom pressure (OBP) gauges at multiple sites (4 sites at present) near the sources within a distance of about 100 km. This paper presents the OBP records with a focus on the earthquakes. Thanks to correcting tides, instrumental drifts, and non-tidal oceanic variations, we can detect OBP signals of tsunamis and vertical seafloor deformation of the order of centimeters with timescales of less than months. In the following we review the detected signals and how to correct the OBP data. The coseismic seafloor displacement and the tsunami accompanied by the mainshock were of the order of meters and large enough to be distinctly identified (Ito et al., 2011, GRL). Co- and post-seismic seafloor displacement and tsunami accompanied by the foreshock were of the order of centimeters which is difficult to be identified from the raw OBP records. The first evident pulses of these tsunamis in the deep sea have durations (periods) of ~20 minutes and ~10 minutes, for the mainshock and the foreshock, respectively. Amounts of seafloor vertical displacement due to post-mainshock deformation reached a few tens of centimeters in two months. It is worth noting that elevation and depression of seafloor were detected at rates of a couple of centimeters in a day after the largest foreshock. The seafloor displacement of centimeters between the largest foreshock and the mainshock can be reasonably identified after correcting non-tidal oceanic variations. The oceanic variations are simulated by a barotropic ocean model driven by atmospheric disturbances (Inazu et al., 2011, Ann. Rep. Earth Simulator Center 2011). The model enables residual OBP time series of non-tidal oceanic variations off Miyagi to be reduced by less than 2 cm. In order to accurately detect signals of centimeters, detiding had better be carefully done analyzing in-situ data rather than using existing ocean tide models such as NAO.99Jb and FES2004. A BAYTAP-G program was used in the present study. Instrumental drifts are modeled by a popularly used, linear and exponential form (Watts and Kontoyiannis, 1990, J. Atmos. Oceanic Tech.). Seismological interpretations of the detected OBP signals of the seafloor displacement and the tsunamis will be demonstrated in the separate papers presented in this meeting.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2748327','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2748327"><span>Association of the 5′-upstream regulatory region of the α7 nicotinic acetylcholine receptor subunit gene (CHRNA7) with schizophrenia</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Stephens, Sarah H.; Logel, Judith; Barton, Amanda; Franks, Alexis; Schultz, Jessica; Short, Margaret; Dickenson, Jane; James, Benjamin; Fingerlin, Tasha E.; Wagner, Brandie; Hodgkinson, Colin; Graw, Sharon; Ross, Randal G.; Freedman, Robert; Leonard, Sherry</p> <p>2009-01-01</p> <p>Background The α7 neuronal nicotinic acetylcholine receptor subunit gene (CHRNA7) is localized in a chromosomal region (15q14) linked to schizophrenia in multiple independent studies. CHRNA7 was selected as the best candidate gene in the region for a well-documented endophenotype of schizophrenia, the P50 sensory processing deficit, by genetic linkage and biochemical studies. Methods Subjects included Caucasian-Non Hispanic and African-American case-control subjects collected in Denver, and schizophrenic subjects from families in the NIMH Genetics Initiative on Schizophrenia. Thirty-five single nucleotide polymorphisms (SNPs) in the 5′-upstream regulatory region of CHRNA7 were genotyped for association with schizophrenia, and for smoking in schizophrenia. Results The rs3087454 SNP, located at position −1831 bp in the upstream regulatory region of CHRNA7, was significantly associated with schizophrenia in the case-control samples after multiple-testing correction (P = 0.0009, African American; P = 0.013, Caucasian-Non Hispanic); the association was supported in family members. There was nominal association of this SNP with smoking in schizophrenia. Conclusions The data support association of regulatory region polymorphisms in the CHRNA7 gene with schizophrenia. PMID:19181484</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17681910','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17681910"><span>Experimental evidence of phase coherence of magnetohydrodynamic turbulence in the solar wind: GEOTAIL satellite data.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Koga, D; Chian, A C-L; Hada, T; Rempel, E L</p> <p>2008-02-13</p> <p>Magnetohydrodynamic (MHD) turbulence is commonly observed in the solar wind. Nonlinear interactions among MHD waves are likely to produce finite correlation of the wave phases. For discussions of various transport processes of energetic particles, it is fundamentally important to determine whether the wave phases are randomly distributed (as assumed in the quasi-linear theory) or have a finite coherence. Using a method based on the surrogate data technique, we analysed the GEOTAIL magnetic field data to evaluate the phase coherence in MHD turbulence in the Earth's foreshock region. The results demonstrate the existence of finite phase correlation, indicating that nonlinear wave-wave interactions are in progress.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22391328-analysis-oxygen-atom-number-density-measurement-high-speed-hydrophilic-treatment-polyimide-using-atmospheric-pressure-microwave-plasma','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22391328-analysis-oxygen-atom-number-density-measurement-high-speed-hydrophilic-treatment-polyimide-using-atmospheric-pressure-microwave-plasma"><span>Analysis by oxygen atom number density measurement of high-speed hydrophilic treatment of polyimide using atmospheric pressure microwave plasma</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Ono, S.</p> <p>2015-03-30</p> <p>This paper describes the fundamental experimental data of the plasma surface modification of the polyimide using atmospheric pressure microwave plasma source. The experimental results were discussed from the point of view of the radical’s behavior, which significantly affects the modification mechanism. The purpose of the study is to examine how the value of the oxygen atom density will affect the hydrophilic treatment in the upstream region of the plasma where gas temperature is very high. The surface modification experiments were performed by setting the polyimide film sample in the downstream region of the plasma. The degree of the modification wasmore » measured by a water contact angle measurement. The water contact angle decreased less than 30 degrees within 1 second treatment time in the upstream region. Very high speed modification was observed. The reason of this high speed modification seems that the high density radical which contributes the surface modification exist in the upstream region of the plasma. This tendency is supposed to the measured relatively high electron density (~10{sup 15}cm{sup −3}) at the center of the plasma. We used the electric heating catalytic probe method for oxygen radical measurement. An absolute value of oxygen radical density was determined by catalytic probe measurement and the results show that ~10{sup 15}cm{sup −3} of the oxygen radical density in the upstream region and decreases toward downstream region. The experimental results of the relation of the oxygen radical density and hydrophilic modification of polyimide was discussed.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23812498','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23812498"><span>Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi</p> <p>2013-10-01</p> <p>Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016EGUGA..1814055F','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016EGUGA..1814055F"><span>Foreshocks and aftershocks of Pisagua 2014 earthquake: time and space evolution of megathrust event.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Fuenzalida Velasco, Amaya; Rietbrock, Andreas; Wollam, Jack; Thomas, Reece; de Lima Neto, Oscar; Tavera, Hernando; Garth, Thomas; Ruiz, Sergio</p> <p>2016-04-01</p> <p>The 2014 Pisagua earthquake of magnitude 8.2 is the first case in Chile where a foreshock sequence was clearly recorded by a local network, as well all the complete sequence including the mainshock and its aftershocks. The seismicity of the last year before the mainshock include numerous clusters close to the epicentral zone (Ruiz et al; 2014) but it was on 16th March that this activity became stronger with the Mw 6.7 precursory event taking place in front of Iquique coast at 12 km depth. The Pisagua earthquake arrived on 1st April 2015 breaking almost 120 km N-S and two days after a 7.6 aftershock occurred in the south of the rupture, enlarging the zone affected by this sequence. In this work, we analyse the foreshocks and aftershock sequence of Pisagua earthquake, from the spatial and time evolution for a total of 15.764 events that were recorded from the 1st March to 31th May 2015. This event catalogue was obtained from the automatic analyse of seismic raw data of more than 50 stations installed in the north of Chile and the south of Peru. We used the STA/LTA algorithm for the detection of P and S arrival times on the vertical components and then a method of back propagation in a 1D velocity model for the event association and preliminary location of its hypocenters following the algorithm outlined by Rietbrock et al. (2012). These results were then improved by locating with NonLinLoc software using a regional velocity model. We selected the larger events to analyse its moment tensor solution by a full waveform inversion using ISOLA software. In order to understand the process of nucleation and propagation of the Pisagua earthquake, we also analysed the evolution in time of the seismicity of the three months of data. The zone where the precursory events took place was strongly activated two weeks before the mainshock and remained very active until the end of the analysed period with an important quantity of the seismicity located in the upper plate and having variations in its focal mechanisms. The evolution of the Pisagua sequence point out a rupture by steps, that we suggest to be related to the properties of the upper plate, as well as along in the subduction interface. The spatial distribution of seismicity was compared to the inter-seismic coupling of previous studies, the regional bathymetry and the slip distribution of both the mainshock and the Magnitude 7.6 event. The results show an important relation between the low coupling zones and the areas lacking large magnitude events</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_10");'>10</a></li> <li><a href="#" onclick='return showDiv("page_11");'>11</a></li> <li class="active"><span>12</span></li> <li><a href="#" onclick='return showDiv("page_13");'>13</a></li> <li><a href="#" onclick='return showDiv("page_14");'>14</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_12 --> <div id="page_13" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_11");'>11</a></li> <li><a href="#" onclick='return showDiv("page_12");'>12</a></li> <li class="active"><span>13</span></li> <li><a href="#" onclick='return showDiv("page_14");'>14</a></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="241"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19740024634','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19740024634"><span>An experimental and numerical study of wave motion and upstream influence in a stratified fluid</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Hurdis, D. A.</p> <p>1974-01-01</p> <p>A system consisting of two superimposed layers of liquid of different densities, with a thin transition layer at the interface, provides a good laboratory model of an ocean thermocline or of an atmospheric inversion layer. This research was to gain knowledge about the propagation of disturbances within these two geophysical systems. The technique used was to observe the propagation of internal waves and of upstream influence within the density-gradient region between the two layers of liquid. The disturbances created by the motion of a vertical flat plate, which was moved longitudinally through this region, were examined both experimentally and numerically. An upstream influence, which resulted from a balance of inertial and gravitational forces, was observed, and it was possible to predict the behavior of this influence with the numerical model. The prediction included a description of the propagation of the upstream influence to steadily increasing distances from the flat plate and the shapes and magnitudes of the velocity profiles.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70192297','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70192297"><span>Artificial seismic acceleration</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Felzer, Karen R.; Page, Morgan T.; Michael, Andrew J.</p> <p>2015-01-01</p> <p>In their 2013 paper, Bouchon, Durand, Marsan, Karabulut, 3 and Schmittbuhl (BDMKS) claim to see significant accelerating seismicity before M 6.5 interplate mainshocks, but not before intraplate mainshocks, reflecting a preparatory process before large events. We concur with the finding of BDMKS that their interplate dataset has significantly more fore- shocks than their intraplate dataset; however, we disagree that the foreshocks are predictive of large events in particular. Acceleration in stacked foreshock sequences has been seen before and has been explained by the cascade model, in which earthquakes occasionally trigger aftershocks larger than themselves4. In this model, the time lags between the smaller mainshocks and larger aftershocks follow the inverse power law common to all aftershock sequences, creating an apparent acceleration when stacked (see Supplementary Information).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17835741','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17835741"><span>Statistical short-term earthquake prediction.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kagan, Y Y; Knopoff, L</p> <p>1987-06-19</p> <p>A statistical procedure, derived from a theoretical model of fracture growth, is used to identify a foreshock sequence while it is in progress. As a predictor, the procedure reduces the average uncertainty in the rate of occurrence for a future strong earthquake by a factor of more than 1000 when compared with the Poisson rate of occurrence. About one-third of all main shocks with local magnitude greater than or equal to 4.0 in central California can be predicted in this way, starting from a 7-year database that has a lower magnitude cut off of 1.5. The time scale of such predictions is of the order of a few hours to a few days for foreshocks in the magnitude range from 2.0 to 5.0.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/14734564','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/14734564"><span>Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Li, Shisheng; Smerdon, Michael J</p> <p>2004-04-02</p> <p>Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29673731','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29673731"><span>Duplication of SOX9 associated with 46,XX ovotesticular disorder of sex development.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>López-Hernández, Berenice; Méndez, Juan Pablo; Coral-Vázquez, Ramón Mauricio; Benítez-Granados, Jesús; Zenteno, Juan Carlos; Villegas-Ruiz, Vanessa; Calzada-León, Raúl; Soderlund, Daniela; Canto, Patricia</p> <p>2018-04-04</p> <p>The purpose of the present study was to investigate whether ten unrelated SRY-negative individuals with this sex differentiation disorder presented a double dose of SOX9 as the cause of their disease. Ten unrelated SRY-negative 46,XX ovotesticular disorder of sexual development (DSD) subjects were molecularly studied. Multiplex-ligation dependent probe amplification (MLPA) and quantitative real-time PCR analysis (qRT-PCR) for SOX9 were performed. The MLPA analysis demonstrated that one patient presented a heterozygous duplication of the entire SOX9 coding region (above 1.3 value of peak ratio), as well as at least a ~ 483 kb upstream duplication. Moreover, no duplication of other SOX9 probes was observed corresponding to the region between -1007 and -1500 kb upstream. A qRT-PCR analysis showed a duplication of at least -581 kb upstream and ~1.63 kb of the coding region that encompasses exon 3. The limits of the duplication were mapped approximately from ~71539762 to 72122741 of Chr17. No molecular abnormalities were found in the remaining nine patients. This study is thought to be the first report regarding a duplication of SOX9 that is associated with the presence of 46,XX ovotesticular DSD, encompassing at least -581 kb upstream, and the almost entire coding region of the gene. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20000021211','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20000021211"><span>UCLA IGPP Space Plasma Simulation Group</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p></p> <p>1998-01-01</p> <p>During the past 10 years the UCLA IGPP Space Plasma Simulation Group has pursued its theoretical effort to develop a Mission Oriented Theory (MOT) for the International Solar Terrestrial Physics (ISTP) program. This effort has been based on a combination of approaches: analytical theory, large scale kinetic (LSK) calculations, global magnetohydrodynamic (MHD) simulations and self-consistent plasma kinetic (SCK) simulations. These models have been used to formulate a global interpretation of local measurements made by the ISTP spacecraft. The regions of applications of the MOT cover most of the magnetosphere: the solar wind, the low- and high-latitude magnetospheric boundary, the near-Earth and distant magnetotail, and the auroral region. Most recent investigations include: plasma processes in the electron foreshock, response of the magnetospheric cusp, particle entry in the magnetosphere, sources of observed distribution functions in the magnetotail, transport of oxygen ions, self-consistent evolution of the magnetotail, substorm studies, effects of explosive reconnection, and auroral acceleration simulations.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70025954','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70025954"><span>Static stress transfer during the 2002 Nenana Mountain-Denali Fault, Alaska, earthquake sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Anderson, G.; Ji, C.</p> <p>2003-01-01</p> <p>On 23 October 2002, the Mw 6.7 Nenana Mountain earthquake occurred in central Alaska. It was followed on 3 November 2002 by the Mw 7.9 Denali Fault mainshock, the largest strike-slip earthquake to occur in North America during the past 150 years. We have modeled static Coulomb stress transfer effects during this sequence. We find that the Nenana Mountain foreshock transferred 30-50 kPa of Coulomb stress to the hypocentral region of the Denali Fault mainshock, encouraging its occurrence. We also find that the two main earthquakes together transferred more than 400 kPa of Coulomb stress to the Cross Creek segment of the Totschunda fault system and to the Denali fault southeast of the mainshock rupture, and up to 80 kPa to the Denali fault west of the Nenana Mountain rupture. Other major faults in the region experienced much smaller static Coulomb stress changes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2011PApGe.168.1255H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2011PApGe.168.1255H"><span>The 2010 M w 7.2 El Mayor-Cucapah Earthquake Sequence, Baja California, Mexico and Southernmost California, USA: Active Seismotectonics along the Mexican Pacific Margin</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Hauksson, Egill; Stock, Joann; Hutton, Kate; Yang, Wenzheng; Vidal-Villegas, J. Antonio; Kanamori, Hiroo</p> <p>2011-08-01</p> <p>The El Mayor-Cucapah earthquake sequence started with a few foreshocks in March 2010, and a second sequence of 15 foreshocks of M > 2 (up to M4.4) that occurred during the 24 h preceding the mainshock. The foreshocks occurred along a north-south trend near the mainshock epicenter. The M w 7.2 mainshock on April 4 exhibited complex faulting, possibly starting with a ~M6 normal faulting event, followed ~15 s later by the main event, which included simultaneous normal and right-lateral strike-slip faulting. The aftershock zone extends for 120 km from the south end of the Elsinore fault zone north of the US-Mexico border almost to the northern tip of the Gulf of California. The waveform-relocated aftershocks form two abutting clusters, each about 50 km long, as well as a 10 km north-south aftershock zone just north of the epicenter of the mainshock. Even though the Baja California data are included, the magnitude of completeness and the hypocentral errors increase gradually with distance south of the international border. The spatial distribution of large aftershocks is asymmetric with five M5+ aftershocks located to the south of the mainshock, and only one M5.7 aftershock, but numerous smaller aftershocks to the north. Further, the northwest aftershock cluster exhibits complex faulting on both northwest and northeast planes. Thus, the aftershocks also express a complex pattern of stress release along strike. The overall rate of decay of the aftershocks is similar to the rate of decay of a generic California aftershock sequence. In addition, some triggered seismicity was recorded along the Elsinore and San Jacinto faults to the north, but significant northward migration of aftershocks has not occurred. The synthesis of the El Mayor-Cucapah sequence reveals transtensional regional tectonics, including the westward growth of the Mexicali Valley and the transfer of Pacific-North America plate motion from the Gulf of California in the south into the southernmost San Andreas fault system to the north. We propose that the location of the 2010 El Mayor-Cucapah, as well as the 1992 Landers and 1999 Hector Mine earthquakes, may have been controlled by the bends in the plate boundary.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.usgs.gov/of/1996/0266/pdf/of96-266.pdf','USGSPUBS'); return false;" href="https://pubs.usgs.gov/of/1996/0266/pdf/of96-266.pdf"><span>Some facts about aftershocks to large earthquakes in California</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Jones, Lucile M.; Reasenberg, Paul A.</p> <p>1996-01-01</p> <p>Earthquakes occur in clusters. After one earthquake happens, we usually see others at nearby (or identical) locations. To talk about this phenomenon, seismologists coined three terms foreshock , mainshock , and aftershock. In any cluster of earthquakes, the one with the largest magnitude is called the mainshock; earthquakes that occur before the mainshock are called foreshocks while those that occur after the mainshock are called aftershocks. A mainshock will be redefined as a foreshock if a subsequent event in the cluster has a larger magnitude. Aftershock sequences follow predictable patterns. That is, a sequence of aftershocks follows certain global patterns as a group, but the individual earthquakes comprising the group are random and unpredictable. This relationship between the pattern of a group and the randomness (stochastic nature) of the individuals has a close parallel in actuarial statistics. We can describe the pattern that aftershock sequences tend to follow with well-constrained equations. However, we must keep in mind that the actual aftershocks are only probabilistically described by these equations. Once the parameters in these equations have been estimated, we can determine the probability of aftershocks occurring in various space, time and magnitude ranges as described below. Clustering of earthquakes usually occurs near the location of the mainshock. The stress on the mainshock's fault changes drastically during the mainshock and that fault produces most of the aftershocks. This causes a change in the regional stress, the size of which decreases rapidly with distance from the mainshock. Sometimes the change in stress caused by the mainshock is great enough to trigger aftershocks on other, nearby faults. While there is no hard "cutoff" distance beyond which an earthquake is totally incapable of triggering an aftershock, the vast majority of aftershocks are located close to the mainshock. As a rule of thumb, we consider earthquakes to be aftershocks if they are located within a characteristic distance from the mainshock. This distance is usually taken to be one or two times the length of the fault rupture associated with the mainshock. For example, if the mainshock ruptured a 100 km length of a fault, subsequent earthquakes up to 100-200 km away from the mainshock rupture would be considered aftershocks. The fault rupture length was approximately 15 km in the 1994 Northridge earthquake, and 430 km in the great 1906 earthquake.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22521951-energetic-particle-pressure-interplanetary-shocks-stereo-observations','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22521951-energetic-particle-pressure-interplanetary-shocks-stereo-observations"><span>ENERGETIC PARTICLE PRESSURE AT INTERPLANETARY SHOCKS: STEREO-A OBSERVATIONS</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Lario, D.; Decker, R. B.; Roelof, E. C.</p> <p>2015-11-10</p> <p>We study periods of elevated energetic particle intensities observed by STEREO-A when the partial pressure exerted by energetic (≥83 keV) protons (P{sub EP}) is larger than the pressure exerted by the interplanetary magnetic field (P{sub B}). In the majority of cases, these periods are associated with the passage of interplanetary shocks. Periods when P{sub EP} exceeds P{sub B} by more than one order of magnitude are observed in the upstream region of fast interplanetary shocks where depressed magnetic field regions coincide with increases of energetic particle intensities. When solar wind parameters are available, P{sub EP} also exceeds the pressure exertedmore » by the solar wind thermal population (P{sub TH}). Prolonged periods (>12 hr) with both P{sub EP} > P{sub B} and P{sub EP} > P{sub TH} may also occur when energetic particles accelerated by an approaching shock encounter a region well upstream of the shock characterized by low magnetic field magnitude and tenuous solar wind density. Quasi-exponential increases of the sum P{sub SUM} = P{sub B} + P{sub TH} + P{sub EP} are observed in the immediate upstream region of the shocks regardless of individual changes in P{sub EP}, P{sub B}, and P{sub TH}, indicating a coupling between P{sub EP} and the pressure of the background medium characterized by P{sub B} and P{sub TH}. The quasi-exponential increase of P{sub SUM} implies a radial gradient ∂P{sub SUM}/∂r > 0 that is quasi-stationary in the shock frame and results in an outward force applied to the plasma upstream of the shock. This force can be maintained by the mobile energetic particles streaming upstream of the shocks that, in the most intense events, drive electric currents able to generate diamagnetic cavities and depressed solar wind density regions.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19940030872','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19940030872"><span>The fine structure of Langmuir waves observed upstream of the bow shock at Venus</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Hospodarsky, G. B.; Gurnett, D. A.; Kurth, W. S.; Kivelson, M. G.; Strangeway, R. J.; Bolton, S. J.</p> <p>1994-01-01</p> <p>Highly structured Langmuir waves, also known as electron plasma oscillations, have been observed in the foreshock of Venus using the plasma wave experiment on the Galileo spacecraft during the gravity assist flyby on February 10, 1990. The Galileo wideband sampling system provides digital electric field waveform measurements at sampling rates up to 201,600 samples per second, much higher than any previous instrument of this type. The main Langmuir wave emission band occurs near the local electron plasma frequency, which was approximately 43 kHz. The Langmuir waves are observed to shift above and below the plasma frequency, sometimes by as much as 20 kHz. The shifts in frequency are closely correlated with the downstream distance from the tangent field line, implying that the shifts are controlled by the electron beam velocity. Considerable fine structure is also evident, with time scales as short as 0.15 milliseconds, corresponding to spatial scales of a few tens of Debye lengths. The frequency spectrum often consists of beat-type waveforms, with beat frequencies ranging from 0.2 to 7 kHz, and in a few cases, isolated wavepackets. The peak electric field strengths are approximately 1 mV/m. These field strengths are too small for strongly nonlinear processes to be important. The beat-type waveforms are suggestive of a parametric decay process.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EGUGA..1913992R','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EGUGA..1913992R"><span>THOR Ion Mass Spectrometer (IMS)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Retinò, Alessandro</p> <p>2017-04-01</p> <p>Turbulence Heating ObserveR (THOR) is the first mission ever flown in space dedicated to plasma turbulence. The Ion Mass Spectrometer (IMS) onboard THOR will provide the first high-time resolution measurements of mass-resolved ions in near-Earth space, focusing on hot ions in the foreshock, shock and magnetosheath turbulent regions. These measurements are required to study how kinetic-scale turbulent fluctuations heat and accelerate different ion species. IMS will measure the full three-dimensional distribution functions of main ion species (H+, He++, O+) in the energy range 10 eV/q to 30 keV/q with energy resolution DE/E down to 10% and angular resolution down to 11.25˚ . The time resolution will be 150 ms for O+, 300 ms for He++ and ˜ 1s for O+, which correspond to ion scales in the the foreshock, shock and magnetosheath regions. Such high time resolution is achieved by mounting four identical IMS units phased by 90˚ in the spacecraft spin plane. Each IMS unit combines a top-hat electrostatic analyzer with deflectors at the entrance together with a time-of-flight section to perform mass selection. Adequate mass-per-charge resolution (M/q)/(ΔM/q) (≥ 8 for He++ and ≥ 3 for O+) is obtained through a 6 cm long Time-of-Flight (TOF) section. IMS electronics includes a fast sweeping high voltage board that is required to make measurements at high cadence. Ion detection includes Micro Channel Plates (MCPs) combined with Application-Specific Integrated Circuits (ASICs) for charge amplification and discrimination and a discrete Time-to-Amplitude Converter (TAC) to determine the ion time of flight. A processor board will be used to for ion events formatting and will interface with the Particle Processing Unit (PPU), which will perform data processing for THOR particle detectors. The IMS instrument is being designed and will be built and calibrated by an international consortium of scientific institutes from France, USA, Germany and Japan and Switzerland.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2012JAESc..45..167Y','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2012JAESc..45..167Y"><span>Tectonic implications and seismicity triggering during the 2008 Baluchistan, Pakistan earthquake sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Yadav, R. B. S.; Gahalaut, V. K.; Chopra, Sumer; Shan, Bin</p> <p>2012-02-01</p> <p>A damaging and widely felt moderate earthquake (Mw 6.4) hit the rural, mountainous region of southwestern Pakistan on October 28, 2008. The main shock was followed by another earthquake of identical magnitude (Mw 6.4) on the next day. The spatial distribution of aftershocks and focal mechanism revealed a NW-SE striking rupture with right-lateral strike-slip motion which is sympathetic to the NNW-SSE striking active mapped Urghargai Fault. The occurrence of strike-slip earthquakes suggests that along with the thrust faults, strike slip faults too are present beneath the fold-and-thrust belt of Sulaiman-Kirthar ranges and accommodates some of the relative motion of the Indian and Eurasian plates. To assess the characteristics of this sequence, the statistical parameters like aftershocks temporal decay, b-value of G-R relationship, partitioning of radiated seismic energy due to aftershocks, and spatial fractal dimension (D-value) have been examined. The b-value is estimated as 1.03 ± 0.42 and suggests the tectonic genesis of the sequence and crustal heterogeneity within rock mass. The low p-value of 0.89 ± 0.07 implies slow decay of aftershocks activity which is probably an evidence for low surface heat flow. A value of spatial fractal dimension of 2.08 ± 0.02 indicates random spatial distribution and that the source is a two-dimensional plane filled-up by fractures. The static coseismic Coulomb stress changes due to the foreshock (Mw 5.3) were found to increase stress by more than 0.04 bars at the hypocenter of the main shock, thus promoting the failure. The cumulative coseismic Coulomb stress changes due to the foreshock and mainshocks suggest that most of the aftershocks occurred in the region of increased Coulomb stress, and to the SE to the mainshock rupture.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19970041597','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19970041597"><span>An Experimental Study of the Near Field Region of a Free Jet with Passive Mixing Tabs</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Bohl, D. G.; Foss, J. F.</p> <p>1997-01-01</p> <p>An experimental study was performed to determine the flow characteristics of a tabbed free jet. Results were acquired in the near field (nominally 2 tab widths upstream to 2 tab widths downstream of the exit plane) of a tabbed jet. Upstream pressure results showed static pressure distributions in both the x-and y-directions along the top surface of the tunnel. Hot-wire measurements showed rapid expansion of the core fluid into the ambient region. Two counter rotating regions of streamwise vorticity were shown on each side of the primary tab. An enhancement of the tabbed jet concept was proposed and tested. Specifically, two tabs, half the scale of the primary tab, were added to the primary tab to provide attachment surfaces for the normally occurring ejection of fluid. The secondary tabs caused a slight increase in the streamwise vorticity created from the upstream static pressure gradient while significantly increasing the re-oriented boundary layer vorticity. The combined pumping effect of the two counter rotating regions of vorticity caused a significant increase in the transport of the jet core fluid into the surrounding region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25486239','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25486239"><span>Identification of hypothalamic arcuate nucleus-specific enhancer region of Kiss1 gene in mice.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Goto, Teppei; Tomikawa, Junko; Ikegami, Kana; Minabe, Shiori; Abe, Hitomi; Fukanuma, Tatsuya; Imamura, Takuya; Takase, Kenji; Sanbo, Makoto; Tomita, Koichi; Hirabayashi, Masumi; Maeda, Kei-ichiro; Tsukamura, Hiroko; Uenoyama, Yoshihisa</p> <p>2015-01-01</p> <p>Pulsatile secretion of GnRH plays a pivotal role in follicular development via stimulating tonic gonadotropin secretion in mammals. Kisspeptin neurons, located in the arcuate nucleus (ARC), are considered to be an intrinsic source of the GnRH pulse generator. The present study aimed to determine ARC-specific enhancer(s) of the Kiss1 gene by an in vivo reporter assay. Three green fluorescent protein (GFP) reporter constructs (long, medium length, and short) were generated by insertion of GFP cDNA at the Kiss1 locus. Transgenic female mice bearing the long and medium-length constructs showed apparent GFP signals in kisspeptin-immunoreactive cells in both the ARC and anteroventral periventricular nucleus, in which another population of kisspeptin neurons are located. On the other hand, transgenic mice bearing 5'-truncated short construct showed few GFP signals in the ARC kisspeptin-immunoreactive cells, whereas they showed colocalization of GFP- and kisspeptin-immunoreactivities in the anteroventral periventricular nucleus. In addition, chromatin immunoprecipitation and chromosome conformation capture assays revealed recruitment of unoccupied estrogen receptor-α in the 5'-upstream region and intricate chromatin loop formation between the 5'-upstream and promoter regions of Kiss1 locus in the ARC. Taken together, the present results indicate that 5'-upstream region of Kiss1 locus plays a critical role in Kiss1 gene expression in an ARC-specific manner and that the recruitment of estrogen receptor-α and formation of a chromatin loop between the Kiss1 promoter and the 5' enhancer region may be required for the induction of ARC-specific Kiss1 gene expression. These results suggest that the 5'-upstream region of Kiss1 locus functions as an enhancer for ARC Kiss1 gene expression in mice.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.usgs.gov/of/1982/0782/report.pdf','USGSPUBS'); return false;" href="https://pubs.usgs.gov/of/1982/0782/report.pdf"><span>Progress report on lithium-related geologic investigations in Bolivia</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Davis, J.R.; Howard, K.A.; Rettig, S.L.; Smith, R.L.; Ericksen, G.E.; Risacher, Francois; Alarcon, Hugo; Morales, Ricardo</p> <p>1982-01-01</p> <p>The September 1, 1981, Samoa Islands Region earthquake occurred at the extreme northern end of the Tonga arc in a region where the Pacific plate may be disjointed along a hinge fault. In the last 50 years, magnitude 7 or greater earthquakes have occurred in this region on the average of once every six years, but four 7+ events have now occurred within the last six years. The mainshock was preceded about two hours earlier by a foreshock that was used as a calibration event for the Joint Epicenter Determination relocation of the mainshock and nearby seismicity occurring within a period seven months prior to and one week after the mainshock. The foreshock, better-located events of the prior seismicity, and most aftershocks are concentrated in a group near the mainshock epicenter, but several more distant aftershocks suggest that the aftershock zone may have been as large as 125 km in length and trended about S35?E. Identification of depth phases from a full suite of broadband records gives source depths of 25-3km for the mainshock and 29.5?3 km for the foreshock using a JB earth model. Source parameters were determined for the mainshock utilizing WWSSN analog and GDSN digital data. The preferred fault plane solution based on P-wave first motion data is a south by southwesterly steeply dipping normal fault, remarkably similar to the mechanism reported by Johnson and Molnar (1972) for the nearby earthquake of April 20, 196B. A waveform inversion technique described by Sipkin (1982), when applied to long-period P waveforms, gives an 'average' point source solution for a purely deviatoric moment rate tensor at a preferred source depth of 22 km. Very similar results were obtained from long-period GDSN body-wave and mantle-wave data using a centroid-moment tensor inversion technique described in Dziewonski, and others (1981). Both techniques provide solutions very close to a double couple source with a south by southwesterly shallow-dipping normal fault mechanism. To obtain the scalar mantle wave moment, GDSN vertical and transverse records 20,000 see in length were processed as described by Buland and Taggart (1981). Averaging all the data from Rayleigh and Love waves yields an estimate of 3.8 x 10^27 dyne-cm (as compared to about 1.9 x 10^27 from body-wave moment tensor inversions) or a moment magnitude (Mr) of 7.6. For the portion of the waveform analysed (50-5B sec), the body-wave inversion performed by Sipkin gives a source time function of duration approximately 28 sec with two peaks in activity. Simultaneous analysis of short-period records, and broadband ground displacements and velocities, a method described by Harvey and Choy (1982) and Choy and Boatwright (1981) revealed a complex rupture consisting of two subevents, of about the same moment, separated in time by about 25 sec, and with durations of about 25 sec each. The two peaks in activity resolved by the body-wave moment tensor inversion correspond to the first of these subevents.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EGUGA..1911233U','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EGUGA..1911233U"><span>A Trial for Detecting the Temporal Variation in Seismic Velocity Accompanied by a Slow Slip Event using Seismic Interferometry of Ambient Noise</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Uemura, Miyuu; Ito, Yoshihiro; Ohta, Kazuaki; Hino, Ryota; Shinohara, Masanao</p> <p>2017-04-01</p> <p>Seismic interferometry is one of the most effective techniques to detect temporal variations in seismic velocity before or after a large earthquake. Some previous studies have been reported on seismic velocity reduction due to the occurrence of large earthquakes (e.g., Wegler et al., 2009; Yamada et al., 2010) as well as preceding them (e.g., Lockner et al., 1977; Yoshimitsu et al., 2009). However, there have only been a few studies thus far which attempt to detect seismic velocity changes associated with slow slip events (SSEs). In this study, we focus on applying seismic interferometry to ambient noise data from ocean bottom seismometers (OBSs) deployed near a subduction zone. Between the end of January 2011 and the largest foreshock occurring on March 9th that precedes the March 11, 2011 Tohoku-Oki earthquake, SSEs and low-frequency tremors were detected offshore Miyagi Prefecture (Ito et al., 2013, 2015; Katakami et al., 2016). We applied our seismic interferometry analysis using ambient noise to recordings from 17 OBS stations that were installed in the vicinity of the 2011 Tohoku-Oki earthquake source region, and only considered the recordings from before that major earthquake. All the OBSs are short-period seismometers with three components which have an eigenfrequency of 4.5 Hz. These OBSs were deployed offshore Miyagi Prefecture between November 2010 and April 2011. Before proceeding with the seismic interferometry analysis, we needed to estimate the two horizontal components of the original deployment orientation for 13 OBSs in (we could not estimate them for 4 OBSs). To obtain the OBS orientation, we used particle orbits of some direct P waves from selected tectonic earthquakes, in order to extract one vertical and two horizontal components. Then, the seismic interferometry analysis consisted of the following steps. First, we applied a band-pass filter of 0.25-2.0 Hz and one-bit technique to the ambient noise signal. Second, we calculated auto-correlation functions (ACFs) for the radial and transverse components using a 5-s time window with lag time from -30 s to 30 s, sampled at intervals of 0.1 s. Using either seven or sixteen days of continuous waveform records or the entire time period, we can construct either a 7-day ACF, a 16-day ACF, or a reference ACF. Finally, we calculated the Correlation Coefficients (CCs) between the 7-day ACF or the 16-day ACF and the reference ACF. There are three important points in our results. First, during the occurrence of the SSE, the values of the CCs decrease. Second, the changes in the values of the CCs display regional differences across the OBS network. Third, the locations of the stations for which the drop of the CC from a value of 1.0 is large corresponds to the seafloor region above the rupture area of the largest foreshock, whereas the locations of the stations for which the drop from the CC of the previous period is large corresponds to the seafloor above the slip area of the SSEs detected before that foreshock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22679550-injection-rapid-diffusive-shock-acceleration-perpendicular-shocks-partially-ionized-plasmas','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22679550-injection-rapid-diffusive-shock-acceleration-perpendicular-shocks-partially-ionized-plasmas"><span>INJECTION TO RAPID DIFFUSIVE SHOCK ACCELERATION AT PERPENDICULAR SHOCKS IN PARTIALLY IONIZED PLASMAS</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Ohira, Yutaka, E-mail: ohira@phys.aoyama.ac.jp</p> <p>2016-08-10</p> <p>We present a three-dimensional hybrid simulation of a collisionless perpendicular shock in a partially ionized plasma for the first time. In this simulation, the shock velocity and upstream ionization fraction are v {sub sh} ≈ 1333 km s{sup −1} and f {sub i} ∼ 0.5, which are typical values for isolated young supernova remnants (SNRs) in the interstellar medium. We confirm previous two-dimensional simulation results showing that downstream hydrogen atoms leak into the upstream region and are accelerated by the pickup process in the upstream region, and large magnetic field fluctuations are generated both in the upstream and downstream regions.more » In addition, we find that the magnetic field fluctuations have three-dimensional structures and the leaking hydrogen atoms are injected into the diffusive shock acceleration (DSA) at the perpendicular shock after the pickup process. The observed DSA can be interpreted as shock drift acceleration with scattering. In this simulation, particles are accelerated to v ∼ 100 v {sub sh} ∼ 0.3 c within ∼100 gyroperiods. The acceleration timescale is faster than that of DSA in parallel shocks. Our simulation results suggest that SNRs can accelerate cosmic rays to 10{sup 15.5} eV (the knee) during the Sedov phase.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4389788','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4389788"><span>Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas</p> <p>2015-01-01</p> <p>Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19830017393','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19830017393"><span>Mean velocities and Reynolds stresses upstream of a simulated wing-fuselage juncture</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Mcmahon, H.; Hubbartt, J.; Kubendran, L. R.</p> <p>1983-01-01</p> <p>Values of three mean velocity components and six turbulence stresses measured in a turbulent shear layer upstream of a simulated wing-fuselage juncture and immediately downstream of the start of the juncture are presented nd discussed. Two single-sensor hot-wire probes were used in the measurements. The separated region just upstream of the wing contains an area of reversed flow near the fuselage surface where the turbulence level is high. Outside of this area the flow skews as it passes around the body, and in this skewed region the magnitude and distribution of the turbulent normal and shear stresses within the shear layer are modified slightly by the skewing and deceleration of the flow. A short distance downstream of the wing leading edge the secondary flow vortext is tightly rolled up and redistributes both mean flow and turbulence in the juncture. The data acquisition technique employed here allows a hot wire to be used in a reversed flow region to indicate flow direction.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_11");'>11</a></li> <li><a href="#" onclick='return showDiv("page_12");'>12</a></li> <li class="active"><span>13</span></li> <li><a href="#" onclick='return showDiv("page_14");'>14</a></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_13 --> <div id="page_14" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_12");'>12</a></li> <li><a href="#" onclick='return showDiv("page_13");'>13</a></li> <li class="active"><span>14</span></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="261"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27982612','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27982612"><span>Nonlinear Waves in the Terrestrial Quasiparallel Foreshock.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Hnat, B; Kolotkov, D Y; O'Connell, D; Nakariakov, V M; Rowlands, G</p> <p>2016-12-02</p> <p>We provide strongly conclusive evidence that the cubic nonlinearity plays an important part in the evolution of the large amplitude magnetic structures in the terrestrial foreshock. Large amplitude nonlinear wave trains at frequencies above the proton cyclotron frequency are identified after nonharmonic slow variations are filtered out by applying the empirical mode decomposition. Numerical solutions of the derivative nonlinear Schrödinger equation, predicted analytically by the use of a pseudopotential approach, are found to be consistent with the observed wave forms. The approximate phase speed of these nonlinear waves, indicated by the parameters of numerical solutions, is of the order of the local Alfvén speed. We suggest that the feedback of the large amplitude fluctuations on background plasma is reflected in the evolution of the pseudopotential.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://issmge2014.ust.hk/~issmge/jun2016/1.Major_projects.pdf','USGSPUBS'); return false;" href="http://issmge2014.ust.hk/~issmge/jun2016/1.Major_projects.pdf"><span>An overview of the geotechnical damage brought by the 2016 Kumamoto Earthquake, Japan</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Hemanta Hazarika,; Takaji Kokusho,; Kayen, Robert E.; Dashti, Shideh; Yutaka Tanoue,; Shuuichi Kuroda and Kentaro Kuribayashi,; Daisuke Matsumoto,; Furuichi, Hideo</p> <p>2016-01-01</p> <p>The 2016 Kumamoto earthquake with a moment magnitude of 7.0 (Japanese intensity = 7) that struck on April 16 brought devastation in many areas of Kumamoto Prefecture and partly in Oita Prefecture in Kyushu Region, Japan. The earthquake succeeds a foreshock of magnitude 6.5 (Japanese intensity = 7) on April 14. The authors conducted two surveys on the devastated areas: one during April 16-17, and the other during May 11-14. This report summarizes the damage brought to geotechnical structures by the two consecutive earthquakes within a span of twenty-eight hours. This report highlights some of the observed damage and identifies reasons for such damage. The geotechnical challenges towards mitigation of losses from such earthquakes are also suggested.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/12062400','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/12062400"><span>Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E</p> <p>2002-04-24</p> <p>The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1241040','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/servlets/purl/1241040"><span>Staged electrostatic precipitator</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Miller, Stanley J.; Almlie, Jay C.; Zhuang, Ye</p> <p>2016-03-01</p> <p>A device includes a chamber having an air inlet and an air outlet. The device includes a plurality of stages including at least a first stage adjacent a second stage. The plurality of stages are disposed in the chamber and each stage has a plurality of discharge electrodes disposed in an interior region and is bounded by an upstream baffle on an end proximate the air inlet and bounded by a downstream baffle on an end proximate the air outlet. Each stage has at least one sidewall between the upstream baffle and the downstream baffle. The sidewall is configured as a collection electrode and has a plurality of apertures disposed along a length between the upstream baffle and the downstream baffle. The upstream baffle of the first stage is positioned in staggered alignment relative to the upstream baffle of the second stage and the downstream baffle of the first stage are positioned in staggered alignment relative to the downstream baffle of the second stage.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/21626230','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/21626230"><span>Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K</p> <p>2011-09-01</p> <p>Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19930049649&hterms=Fast+radio+burst&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D10%26Ntt%3DFast%2Bradio%2Bburst','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19930049649&hterms=Fast+radio+burst&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D10%26Ntt%3DFast%2Bradio%2Bburst"><span>Interplanetary fast shock diagnosis with the radio receiver on Ulysses</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Hoang, S.; Pantellini, F.; Harvey, C. C.; Lacombe, C.; Mangeney, A.; Meuer-Vernet, N.; Perche, C.; Steinberg, J.-L.; Lengyel-Frey, D.; Macdowall, R. J.</p> <p>1992-01-01</p> <p>The radio receiver on Ulysses records the quasi-thermal noise which allows a determination of the density and temperature of the cold (core) electrons of the solar wind. Seven interplanetary fast forward or reverse shocks are identified from the density and temperature profiles, together with the magnetic field profile from the Magnetometer experiment. Upstream of the three strongest shocks, bursts of nonthermal waves are observed at the electron plasma frequency f(peu). The more perpendicular the shock, the longer the time interval during which these upstream bursts are observed. For one of the strongest shocks we also observe two kinds of upstream electromagnetic radiation: radiation at 2 f(peu), and radiation at the downstream electron plasma frequency, which propagates into the less dense upstream regions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29529302','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29529302"><span>Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques</p> <p>2018-04-06</p> <p>The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4187958','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4187958"><span>An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.</p> <p>2014-01-01</p> <p>Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70019416','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70019416"><span>Depth dependence of earthquake frequency-magnitude distributions in California: Implications for rupture initiation</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Mori, J.; Abercrombie, R.E.</p> <p>1997-01-01</p> <p>Statistics of earthquakes in California show linear frequency-magnitude relationships in the range of M2.0 to M5.5 for various data sets. Assuming Gutenberg-Richter distributions, there is a systematic decrease in b value with increasing depth of earthquakes. We find consistent results for various data sets from northern and southern California that both include and exclude the larger aftershock sequences. We suggest that at shallow depth (???0 to 6 km) conditions with more heterogeneous material properties and lower lithospheric stress prevail. Rupture initiations are more likely to stop before growing into large earthquakes, producing relatively more smaller earthquakes and consequently higher b values. These ideas help to explain the depth-dependent observations of foreshocks in the western United States. The higher occurrence rate of foreshocks preceding shallow earthquakes can be interpreted in terms of rupture initiations that are stopped before growing into the mainshock. At greater depth (9-15 km), any rupture initiation is more likely to continue growing into a larger event, so there are fewer foreshocks. If one assumes that frequency-magnitude statistics can be used to estimate probabilities of a small rupture initiation growing into a larger earthquake, then a small (M2) rupture initiation at 9 to 12 km depth is 18 times more likely to grow into a M5.5 or larger event, compared to the same small rupture initiation at 0 to 3 km. Copyright 1997 by the American Geophysical Union.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015E%26PSL.431...75W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015E%26PSL.431...75W"><span>Far-field triggering of foreshocks near the nucleation zone of the 5 September 2012 (MW 7.6) Nicoya Peninsula, Costa Rica earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Walter, Jacob I.; Meng, Xiaofeng; Peng, Zhigang; Schwartz, Susan Y.; Newman, Andrew V.; Protti, Marino</p> <p>2015-12-01</p> <p>On 5 September 2012, a moment magnitude (MW) 7.6 earthquake occurred directly beneath the Nicoya Peninsula, an area with dense seismic and geodetic network coverage. The mainshock ruptured a portion of a previously identified locked patch that was recognized due to a decade-long effort to delineate the megathrust seismic and aseismic processes in this area. Here we conduct a comprehensive study of the seismicity prior to this event utilizing a matched-filter analysis that allows us to decrease the magnitude of catalog completeness by 1 unit. We observe a statistically significant increase in seismicity rate below the Nicoya Peninsula following the 27 August 2012 (MW 7.3) El Salvador earthquake (about 450 km to the northwest and 9 days prior to the Nicoya earthquake). Additionally, we identify a cluster of small-magnitude (<2.2) earthquakes preceding the mainshock by about 35 min and within 15 km of its hypocenter. The immediate foreshock sequence occurred in the same area as those earthquakes triggered shortly after the El Salvador event; though it is not clear whether the effect of triggering from the El Salvador event persisted until the foreshock sequence given the uncertainties in seismicity rates from a relatively small number of earthquakes. If megathrust earthquakes at such distances can induce significant increases in seismicity during the days before another larger event, this sequence strengthens the need for real-time seismicity monitoring for large earthquake forecasting.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/21653197','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/21653197"><span>XX males SRY negative: a confirmed cause of infertility.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta</p> <p>2011-10-01</p> <p>SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2813017','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2813017"><span>CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter</p> <p>2010-01-01</p> <p>The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=330258','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=330258"><span>Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Schuster, W; Unseld, M; Wissinger, B; Brennicke, A</p> <p>1990-01-01</p> <p>The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016SPIE.9773E..0FS','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016SPIE.9773E..0FS"><span>An upstream burst-mode equalization scheme for 40 Gb/s TWDM PON based on optimized SOA cascade</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Sun, Xiao; Chang, Qingjiang; Gao, Zhensen; Ye, Chenhui; Xiao, Simiao; Huang, Xiaoan; Hu, Xiaofeng; Zhang, Kaibin</p> <p>2016-02-01</p> <p>We present a novel upstream burst-mode equalization scheme based on optimized SOA cascade for 40 Gb/s TWDMPON. The power equalizer is placed at the OLT which consists of two SOAs, two circulators, an optical NOT gate, and a variable optical attenuator. The first SOA operates in the linear region which acts as a pre-amplifier to let the second SOA operate in the saturation region. The upstream burst signals are equalized through the second SOA via nonlinear amplification. From theoretical analysis, this scheme gives sufficient dynamic range suppression up to 16.7 dB without any dynamic control or signal degradation. In addition, a total power budget extension of 9.3 dB for loud packets and 26 dB for soft packets has been achieved to allow longer transmission distance and increased splitting ratio.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2009ShWav..19..521B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2009ShWav..19..521B"><span>Separation control by vortex generator devices in a transonic channel flow</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Bur, Reynald; Coponet, Didier; Carpels, Yves</p> <p>2009-12-01</p> <p>An experimental study was conducted in a transonic channel to control by mechanical vortex generator devices the strong interaction between a shock wave and a separated turbulent boundary layer. Control devices—co-rotating and counter-rotating vane-type vortex generators—were implemented upstream of the shock foot region and tested both on a steady shock wave and on a forced shock oscillation configurations. The spanwise spacing of vortex generator devices along the channel appeared to be an important parameter to control the flow separation region. When the distance between each device is decreased, the vortices merging is more efficient to reduce the separation. Their placement upstream of the shock wave is determinant to ensure that vortices have mixed momentum all spanwise long before they reach the separation line, so as to avoid separation cells. Then, vortex generators slightly reduced the amplitude of the forced shock wave oscillation by delaying the upstream displacement of the leading shock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=557584','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=557584"><span>DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Link, Gerhard</p> <p>1984-01-01</p> <p>A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3102270','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3102270"><span>Sense transcription through the S region is essential for immunoglobulin class switch recombination</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine</p> <p>2011-01-01</p> <p>Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5114544','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5114544"><span>Dramatic undercutting of piedmont rivers after the 2008 Wenchuan Ms 8.0 Earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Fan, Niannian; Nie, Ruihua; Wang, Qiang; Liu, Xingnian</p> <p>2016-01-01</p> <p>Changes in river channel erosion or deposition affect the geomorphic evolution, aquatic ecosystems, and river regulation strategies. Fluvial processes are determined by the flow, sediment and boundary conditions, and it has long been expected that increasing sediment supply will induce aggradation. Here, based on thorough field surveys, we show the unexpected undercutting of the piedmont rivers influenced by the 2008 Wenchuan (Ms 8.0) Earthquake. The rivers flow from the Longmen Mountain with significant topographic relief to the flat Chengdu plain. In the upstreams, sediment supply increased because of the landslides triggered by the earthquake, causing deposition in the upstream mountain reaches. However, the downstream plain reaches suffered undercutting instead of deposition, and among those rivers, Shiting River was the most seriously affected, with the largest undercutting depth exceeding 20 m. The reasons for this unexpected undercutting are proposed herein and relate to both natural and anthropogenic causes. In addition, we also demonstrate, at least for certain conditions, such as rivers flowing from large-gradient mountain regions to low-gradient plain regions, that upstream sediment pulses may induce aggradation in upstream and degradation in downstream, causing the longitudinal profile to steepen to accommodate the increasing sediment flux. PMID:27857220</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2012AGUFMSH21B2215S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2012AGUFMSH21B2215S"><span>Waves associated to COMPLEX EVENTS observed by STEREO</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Siu Tapia, A. L.; Blanco-Cano, X.; Kajdic, P.; Aguilar-Rodriguez, E.; Russell, C. T.; Jian, L. K.; Luhmann, J. G.</p> <p>2012-12-01</p> <p>Complex Events are formed by two or more large-scale solar wind structures which interact in space. Typical cases are interactions of: (i) a Magnetic Cloud/Interplanetary Coronal Mass Ejection (MC/ICME) with another MC/ICME transient; and (ii) an ICME followed by a Stream Interaction Region (SIR). Complex Events are of importance for space weather studies and studying them can enhance our understanding of collisionless plasma physics. Some of these structures can produce or enhance southward magnetic fields, a key factor in geomagnetic storm generation. Using data from the STEREO mission during the years 2006-2011, we found 17 Complex Events preceded by a shock wave. We use magnetic field and plasma data to study the micro-scale structure of the shocks, and the waves associated to these shocks and within Complex Events structures. To determine wave characteristics we perform Power Spectra and Minimum Variance Analysis. We also use PLASTIC WAP protons data to study foreshock extensions and the relationship between Complex Regions and particle acceleration to suprathermal energies.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2383903','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2383903"><span>Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins</p> <p>2008-01-01</p> <p>Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_12");'>12</a></li> <li><a href="#" onclick='return showDiv("page_13");'>13</a></li> <li class="active"><span>14</span></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_14 --> <div id="page_15" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_13");'>13</a></li> <li><a href="#" onclick='return showDiv("page_14");'>14</a></li> <li class="active"><span>15</span></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="281"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/18442404','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/18442404"><span>Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins</p> <p>2008-04-28</p> <p>In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26253301','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26253301"><span>Putative carotenoid genes expressed under the regulation of Shine-Dalgarno regions in Escherichia coli for efficient lycopene production.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Jin, Weiyue; Xu, Xian; Jiang, Ling; Zhang, Zhidong; Li, Shuang; Huang, He</p> <p>2015-11-01</p> <p>Putative genes crtE, crtB, and crtI from Deinococcus wulumiqiensis R12, a novel species, were identified by genome mining and were co-expressed using the optimized Shine-Dalgarno (SD) regions to improve lycopene yield. A lycopene biosynthesis pathway was constructed by co-expressing these three genes in Escherichia coli. After optimizing the upstream SD regions and the culture medium, the recombinant strain EDW11 produced 88 mg lycopene g(-1) dry cell wt (780 mg lycopene l(-1)) after 40 h fermentation without IPTG induction, while the strain EDW without optimized SD regions only produced 49 mg lycopene g(-1) dry cell wt (417 mg lycopene l(-1)). Based on the optimization of the upstream SD regions and culture medium, the yield of the strain EDW11 reached a high level during microbial lycopene production until now.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S53C0726F','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S53C0726F"><span>The Iquique 2014 sequence: understanding its nucleation and propagation from the seismicity evolution</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Fuenzalida, A.; Rietbrock, A.; Woollam, J.; Tavera, H.; Ruiz, S.</p> <p>2017-12-01</p> <p>The Northern Chile and Southern Peru region is well known for its high seismic hazard due to the lack of recent major ruptures along long segments of the subduction interface. For this reason the 2014 Iquique Mw 8.1 earthquake that occurred in the Northern Chile seismic gap was expected and high quality seismic and geodetic networks were operating at the time of the event recording the precursory phase of a mega-thrust event with unprecedented detail. In this study we used seismic data collected during the 2014 Iquique sequence to generate a detailed earthquake catalogue. This catalogue consists of more than 15,000 events identified in Northern Chile during the period between 1/3/14 and 31/5/14 and provides full coverage of the immediate foreshock sequence, the main-shock and early after-shock series. The initial catalogue was obtained by automatic data processing and only selecting events with at least two associate S phases to improve the reliability of initial locations. Subsequently, this subset of events was automatically processed again using an optimized STA/LTA triggering algorithm for both P and S-waves and constraining the detection times by estimated arrival times at each station calculated for the preliminary locations. Finally, all events were relocated using a recently developed 1D velocity model and associated station corrections. For events Mw 4 or larger that occurred between the 15/3/14 and 10/04/14, we estimated it regional moment tensor by full-waveform inversion. Our results confirm the seismic activation of the upper plate during the foreshock sequence, as well highlight a crustal activity on the fore-arc during the aftershock series. The seismicity distribution was compared to the previous inter-seismic coupling studies obtained in the region, in which we observe interplay between high and low coupling areas, which are correlated to the seismicity rate. The spatial distribution of the seismicity and the complexities on the mechanisms observed during the sequence can be associated to the observed seamounts belonging to the Iquique ridge by previous marine experiment. To conclude our study, we perform a space and time analysis of the seismicity and we propose several scenarios to explain the nucleation of the earthquake and the way on which the seismicity behave during the sequence.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19900049931&hterms=wave+oscillation&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dwave%2Boscillation','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19900049931&hterms=wave+oscillation&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3Dwave%2Boscillation"><span>Simulation studies of plasma waves in the electron foreshock - The generation of downshifted oscillations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Dum, C. T.</p> <p>1990-01-01</p> <p>The generation of waves with frequencies downshifted from the plasma frequency, as observed in the electron foreshock, is analyzed by particle simulation. Wave excitation differs fundamentally from the familiar excitation of the plasma eigenmodes by a gentle bump-on-tail electron distribution. Beam modes are destabilized by resonant interaction with bulk electrons, provided the beam velocity spread is very small. These modes are stabilized, starting with the higher frequencies, as the beam is broadened and slowed down by the interaction with the wave spectrum. Initially a very cold beam is also capable of exciting frequencies considerably above the plasma frequency, but such oscillations are quickly stabilized. Low-frequency modes persist for a long time, until the bump in the electron distribution is completely 'ironed' out. This diffusion process also is quite different from the familiar case of well-separated beam and bulk electrons. A quantitative analysis of these processes is carried out.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25061132','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25061132"><span>Intense foreshocks and a slow slip event preceded the 2014 Iquique Mw 8.1 earthquake.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ruiz, S; Metois, M; Fuenzalida, A; Ruiz, J; Leyton, F; Grandin, R; Vigny, C; Madariaga, R; Campos, J</p> <p>2014-09-05</p> <p>The subduction zone in northern Chile is a well-identified seismic gap that last ruptured in 1877. The moment magnitude (Mw) 8.1 Iquique earthquake of 1 April 2014 broke a highly coupled portion of this gap. To understand the seismicity preceding this event, we studied the location and mechanisms of the foreshocks and computed Global Positioning System (GPS) time series at stations located on shore. Seismicity off the coast of Iquique started to increase in January 2014. After 16 March, several Mw > 6 events occurred near the low-coupled zone. These events migrated northward for ~50 kilometers until the 1 April earthquake occurred. On 16 March, on-shore continuous GPS stations detected a westward motion that we model as a slow slip event situated in the same area where the mainshock occurred. Copyright © 2014, American Association for the Advancement of Science.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/241040-location-disease-associated-polymorphism-genomic-structure-human-kda-ro-ssa-locus-ssa1','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/241040-location-disease-associated-polymorphism-genomic-structure-human-kda-ro-ssa-locus-ssa1"><span>The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Tsugu, H.; Horowitz, R.; Gibson, N.</p> <p>1994-12-01</p> <p>Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28674280','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28674280"><span>Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji</p> <p>2018-05-03</p> <p>Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014AGUFM.S31D4457G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014AGUFM.S31D4457G"><span>Analysis of seismicity and stress before and after the Mw 8.1 Pisagua, Chile, 2014 earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Grigoli, F.; Cesca, S.; Dahm, T.; Hainzl, S.</p> <p>2014-12-01</p> <p>On April 1st, 2014 at 23:46:50 UTC, a powerful earthquake of magnitude Mw 8.1 occurred offshore the Northern Chile in the region of the North Chilean seismic gap. The epicenter of the earthquake was approximately 50 km offshore the Chilean coast, near the town of Pisagua. Two days after the main event a Mw 7.6 aftershock struck approximately the same area. In order to identify spatio-temporal changes of source parameters and stress before and after the mainshock, we analyzed in detail the local seismicity above magnitude Mw 3.0 within the time period 01/01/2013-30/04/2014 and estimated long term trends in b-values and earthquake productivity. We used data from the IPOC (Integrated Plate boundary Observatory Chile) regional seismic network, consisting of 20 "in land" broadband station deployed and managed by the GFZ-Potsdam. The recorded earthquake catalog shows an intense foreshock activity consisting of more than 1000 M3+ events in the source region. Full waveform techniques are used to derive both locations and focal mechanisms of about 435 seismic events. The location process has been performed by using a waveform stacking method (Grigoli et al 2013, 2014) with a layered velocity model based on CRUST 2.0 (see the attached figure for the location results of one of these events). Moment tensor inversion has been performed by using the KIWI tool software (Cesca et al. 2010), which is based on a two-step inversion approach. The first step consists in the inversion of the amplitude spectra to retrieve the best fitting focal planes, while the second inversion step is carried out in time domain to solve the focal mechanism polarity and to obtain the centroid location and time. Both location and moment tensor inversion resulted in agreement with the geodynamical settings of the region. Mapping the b-value reveals a spatiotemporal anomaly of low b-values characterizing the frequency-magnitude distribution of the foreshocks in the source area of the mainshock. Finally, clustering analysis of the retrieved focal mechanism and a stress tensor inversion has been performed in order to analyze the spatio-temporal evolution of the stress, before and after the mainshock. This work has been funded by the German BMBF "Geothecnologien" project MINE (BMBF03G0737A) and by Hazard and Risk Team (HART) and PBO-Chile of GFZ.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70015489','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70015489"><span>Predicting earthquakes by analyzing accelerating precursory seismic activity</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Varnes, D.J.</p> <p>1989-01-01</p> <p>During 11 sequences of earthquakes that in retrospect can be classed as foreshocks, the accelerating rate at which seismic moment is released follows, at least in part, a simple equation. This equation (1) is {Mathematical expression},where {Mathematical expression} is the cumulative sum until time, t, of the square roots of seismic moments of individual foreshocks computed from reported magnitudes;C and n are constants; and tfis a limiting time at which the rate of seismic moment accumulation becomes infinite. The possible time of a major foreshock or main shock, tf,is found by the best fit of equation (1), or its integral, to step-like plots of {Mathematical expression} versus time using successive estimates of tfin linearized regressions until the maximum coefficient of determination, r2,is obtained. Analyzed examples include sequences preceding earthquakes at Cremasta, Greece, 2/5/66; Haicheng, China 2/4/75; Oaxaca, Mexico, 11/29/78; Petatlan, Mexico, 3/14/79; and Central Chile, 3/3/85. In 29 estimates of main-shock time, made as the sequences developed, the errors in 20 were less than one-half and in 9 less than one tenth the time remaining between the time of the last data used and the main shock. Some precursory sequences, or parts of them, yield no solution. Two sequences appear to include in their first parts the aftershocks of a previous event; plots using the integral of equation (1) show that the sequences are easily separable into aftershock and foreshock segments. Synthetic seismic sequences of shocks at equal time intervals were constructed to follow equation (1), using four values of n. In each series the resulting distributions of magnitudes closely follow the linear Gutenberg-Richter relation log N=a-bM, and the product n times b for each series is the same constant. In various forms and for decades, equation (1) has been used successfully to predict failure times of stressed metals and ceramics, landslides in soil and rock slopes, and volcanic eruptions. Results of more recent experiments and theoretical studies on crack propagation, fault mechanics, and acoustic emission can be closely reproduced by equation (1). Rate-process theory and continuum damage mechanics offer leads toward understanding the physical processes. ?? 1989 Birkha??user Verlag.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013AGUSM.S51A..08A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013AGUSM.S51A..08A"><span>Determining the Probability that a Small Event in Brazil (magnitude 3.5 to 4.5 mb) will be Followed by a Larger Event</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Assumpcao, M.</p> <p>2013-05-01</p> <p>A typical earthquake story in Brazil: A swarm of small earthquakes starts to occur near a small town, reaching magnitude 3.5, causing some alarm but no damage. The freightened population, not used to feeling earthquakes, calls the seismology experts who set up a local network to study the seismicity. To the usual and inevitable question "Are we going to have a larger earthquake?", the usual and standard answer "It is not possible to predict earthquakes; larger earthquakes are possible". Fearing unecessary panic, seismologists often add that "however, large earthquakes are not very likely". This vague answer has proven quite inadequate. "Not very likely" is interpreted by the population and authorities as "not going to happen, and there is not need to do anything". Before L'Aquila 2009, one case of magnitude 3.8 in Eastern Brazil was followed seven months later by a magnitude 4.9 causing serious damage to poorly built houses. One child died and the affected population felt deceived by the seismologists. In order to provide better answers than just a vague "not likely", we examined the Brazilian catalog of earthquakes for all cases of moderate magnitude (3.4 mb or larger) that were followed, up to one year later, by a larger event. We found that the chance of an event with magnitude 3.4 or larger being the foreshock of a larger magntitude is roughly 1/6. The probability of an event being a foreshock varies with magnitude from about 20% for a 3.5 mb to about 5% for a 4.5 mb. Also, given that an event in the range 3.4 to 4.3 is a foreshock, the probability that the mainshock will be 4.7 or larger is 1/6. The probability for a larger event to occur decreases with time after the occurrence of the possible foreshock with a time constant of ~70 days. Perhaps, by giving the population and civil defense a more quantitative answer (such as "the chance of a larger even is like rolling a six in a dice") may help the decision to reinforce poor houses or even evacuate people from very vulnerable houses in the epicentral area.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.G43A0907C','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.G43A0907C"><span>Surface Temperature and Precipitation Affecting GPS Signals Before the 2009 L'Aquila Earthquake (Central Italy).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Crescentini, L.; Amoruso, A.; Chiaraluce, L.</p> <p>2017-12-01</p> <p>This work focuses on GPS time series recorded before the Mw 6.1 earthquake which struck Central Italy in April 2009. It shows how environmental noise effects may be subtle and relevant when investigating relatively small strain signals and how the availability of data from weather stations and water level sensors co-located with GPS stations may provide critical information which must be taken into consideration while dealing with deformation signals.The preparatory phase of a large earthquake may include both seismic (foreshocks) and aseismic (slow slip event, SSE) deforming episodes but, unlike afterslip, no slow event has yet been recorded before moderate earthquakes, even when they occurred close to high-sensitivity strain meters. An exception to this seems to be represented by the 2009 earthquake. The main shock was preceded by a foreshock sequence lasting 6 months; it has been claimed that an analysis of continuous GPS data shows that during the foreshock sequence a 5.9 Mw SSE occurred along a decollement located beneath the reactivated normal fault system. This hypothesized SSE, that started in the middle of February 2009 and lasted for almost two weeks, would have eventually loaded the largest foreshock and the main shock.We show that the strain signal that the SSE would have generated at two laser strainmeters operating at about 20 km NE from the SSE source was essentially undetected. On the contrary, a transient signal is present in temperature and precipitation time series recorded close to the GPS station, MTTO, that has largest signal referred to the SSE, implying that these contaminated the GPS record. This interpretation is corroborated by the strong similarity, during the coldest winter months, between the displacement data of MTTO and a linear combination of filtered temperature and precipitation data, mimicking simple heat conduction and snow accumulation/removal processes. Such a correlation between displacement and environmental data is missing during the other seasons, when it neither snows nor freezes. This lack of correlation seems to exclude simple thermal expansion of the bedrock or the pillar monument itself as a local source of deformation. We hypothesize that thermal effects might be caused by ground freezing and consequent water expansion (about 9%) when liquid water is converted into ice.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2939330','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2939330"><span>Multiple enhancers located in a 1-Mb region upstream of POU3F4 promote expression during inner ear development and may be required for hearing</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Naranjo, Silvia; Voesenek, Krysta; de la Calle-Mustienes, Elisa; Robert-Moreno, Alex; Kokotas, Haris; Grigoriadou, Maria; Economides, John; Van Camp, Guy; Hilgert, Nele; Moreno, Felipe; Alsina, Berta; Petersen, Michael B.; Kremer, Hannie</p> <p>2010-01-01</p> <p>POU3F4 encodes a POU-domain transcription factor required for inner ear development. Defects in POU3F4 function are associated with X-linked deafness type 3 (DFN3). Multiple deletions affecting up to ~900-kb upstream of POU3F4 are found in DFN3 patients, suggesting the presence of essential POU3F4 enhancers in this region. Recently, an inner ear enhancer was reported that is absent in most DFN3 patients with upstream deletions. However, two indications suggest that additional enhancers in the POU3F4 upstream region are required for POU3F4 function during inner ear development. First, there is at least one DFN3 deletion that does not eliminate the reported enhancer. Second, the expression pattern driven by this enhancer does not fully recapitulate Pou3f4 expression in the inner ear. Here, we screened a 1-Mb region upstream of the POU3F4 gene for additional cis-regulatory elements and searched for novel DFN3 mutations in the identified POU3F4 enhancers. We found several novel enhancers for otic vesicle expression. Some of these also drive expression in kidney, pancreas and brain, tissues that are known to express Pou3f4. In addition, we report a new and smallest deletion identified so far in a DFN3 family which eliminates 3.9 kb, comprising almost exclusively the previous reported inner ear enhancer. We suggest that multiple enhancers control the expression of Pou3f4 in the inner ear and these may contribute to the phenotype observed in DFN3 patients. In addition, the novel deletion demonstrates that the previous reported enhancer, although not sufficient, is essential for POU3F4 function during inner ear development. Electronic supplementary material The online version of this article (doi:10.1007/s00439-010-0864-x) contains supplementary material, which is available to authorized users. PMID:20668882</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4249290','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4249290"><span>Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.</p> <p>2014-01-01</p> <p>The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/11342220','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/11342220"><span>Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Tencomnao, T; Yu, R K; Kapitonov, D</p> <p>2001-02-16</p> <p>UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015GeoRL..42.8942D','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015GeoRL..42.8942D"><span>Strong plume fluxes at Mars observed by MAVEN: An important planetary ion escape channel</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Dong, Y.; Fang, X.; Brain, D. A.; McFadden, J. P.; Halekas, J. S.; Connerney, J. E.; Curry, S. M.; Harada, Y.; Luhmann, J. G.; Jakosky, B. M.</p> <p>2015-11-01</p> <p>We present observations by the Mars Atmosphere and Volatile EvolutioN (MAVEN) mission of a substantial plume-like distribution of escaping ions from the Martian atmosphere, organized by the upstream solar wind convection electric field. From a case study of MAVEN particle-and-field data during one spacecraft orbit, we identified three escaping planetary ion populations: plume fluxes mainly along the upstream electric field over the north pole region of the Mars-Sun-Electric field (MSE) coordinate system, antisunward ion fluxes in the tail region, and much weaker upstream pickup ion fluxes. A statistical study of O+ fluxes using 3 month MAVEN data shows that the plume is a constant structure with strong fluxes widely distributed in the MSE northern hemisphere, which constitutes an important planetary ion escape channel. The escape rate through the plume is estimated to be ~30% of the tailward escape and ~23% of the total escape for > 25 eV O+ ions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=540051','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=540051"><span>DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László</p> <p>2005-01-01</p> <p>DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/15608291','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/15608291"><span>DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László</p> <p>2005-01-01</p> <p>DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1082148','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/servlets/purl/1082148"><span>Turbine exhaust diffuser flow path with region of reduced total flow area</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Orosa, John A.</p> <p>2012-12-25</p> <p>An exhaust diffuser system and method for a turbine engine includes an inner boundary and an outer boundary with a flow path defined therebetween. The inner boundary is defined at least in part by a hub that has an upstream end and a downstream end. The outer boundary has a region in which the outer boundary extends radially inward toward the hub. The region can begin at a point that is substantially aligned with the downstream end of the hub or, alternatively, at a point that is proximately upstream of the downstream end of the hub. The region directs at least a portion of an exhaust flow in the diffuser toward the hub. As a result, the exhaust diffuser system and method can achieve the performance of a long hub system while enjoying the costs of a short hub system.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2914000','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2914000"><span>Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p></p> <p>2010-01-01</p> <p>Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/20598158','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/20598158"><span>Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K</p> <p>2010-07-04</p> <p>Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_13");'>13</a></li> <li><a href="#" onclick='return showDiv("page_14");'>14</a></li> <li class="active"><span>15</span></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_15 --> <div id="page_16" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_14");'>14</a></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li class="active"><span>16</span></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="301"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17204049','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17204049"><span>Two novel translocation breakpoints upstream of SOX9 define borders of the proximal and distal breakpoint cluster region in campomelic dysplasia.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Leipoldt, M; Erdel, M; Bien-Willner, G A; Smyk, M; Theurl, M; Yatsenko, S A; Lupski, J R; Lane, A H; Shanske, A L; Stankiewicz, P; Scherer, G</p> <p>2007-01-01</p> <p>The semilethal skeletal malformation syndrome campomelic dysplasia (CD) with or without XY sex reversal is caused by mutations within the SOX9 gene on 17q24.3 or by chromosomal aberrations (translocations, inversions or deletions) with breakpoints outside the SOX9 coding region. The previously published CD translocation breakpoints upstream of SOX9 fall into two clusters: a proximal cluster with breakpoints between 50-300 kb and a distal cluster with breakpoints between 899-932 kb. Here, we present clinical, cytogenetic and molecular data from two novel CD translocation cases. Case 1 with karyotype 46,XY,t(1;17)(q42.1;q24.3) has characteristic symptoms of CD, including mild tibial bowing, cryptorchidism and hypospadias. By standard fluorescence in situ hybridization (FISH) and by high-resolution fiber FISH, the 17q breakpoint was mapped 375 kb from SOX9, defining the centromeric border of the proximal breakpoint cluster region. Case 2 with karyotype 46,X,t(Y;17)(q11.2;q24.3) has the acampomelic form of CD and complete XY sex reversal. By FISH and somatic cell hybrid analysis, the 17q breakpoint was mapped 789 kb from SOX9, defining the telomeric border of the distal breakpoint cluster region. We discuss the structure of the 1 Mb cis-control region upstream of SOX9 and the correlation between the position of the 14 mapped translocation breakpoints with respect to disease severity and XY sex reversal.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29019094','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29019094"><span>Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru</p> <p>2017-11-01</p> <p>We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17784094','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17784094"><span>Energetic particles at venus: galileo results.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Williams, D J; McEntire, R W; Krimigis, S M; Roelof, E C; Jaskulek, S; Tossman, B; Wilken, B; Stüdemann, W; Armstrong, T P; Fritz, T A; Lanzerotti, L J; Roederer, J G</p> <p>1991-09-27</p> <p>At Venus the Energetic Particles Detector (EPD) on the Galileo spacecraft measured the differential energy spectra and angular distributions of ions >22 kiloelectron volts (keV) and electrons > 15 keV in energy. The only time particles were observed by EPD was in a series of episodic events [0546 to 0638 universal time (UT)] near closest approach (0559:03 UT). Angular distributions were highly anisotropic, ordered by the magnetic field, and showed ions arriving from the hemisphere containing Venus and its bow shock. The spectra showed a power law form with intensities observed into the 120- to 280-keV range. Comparisons with model bow shock calculations show that these energetic ions are associated with the venusian foreshock-bow shock region. Shock-drift acceleration in the venusian bow shock seems the most likely process responsible for the observed ions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/15117758','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/15117758"><span>RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A</p> <p>2004-11-01</p> <p>RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22522369-asymmetric-magnetic-reconnection-weakly-ionized-chromospheric-plasmas','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22522369-asymmetric-magnetic-reconnection-weakly-ionized-chromospheric-plasmas"><span>ASYMMETRIC MAGNETIC RECONNECTION IN WEAKLY IONIZED CHROMOSPHERIC PLASMAS</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Murphy, Nicholas A.; Lukin, Vyacheslav S., E-mail: namurphy@cfa.harvard.edu</p> <p>2015-06-01</p> <p>Realistic models of magnetic reconnection in the solar chromosphere must take into account that the plasma is partially ionized and that plasma conditions within any two magnetic flux bundles undergoing reconnection may not be the same. Asymmetric reconnection in the chromosphere may occur when newly emerged flux interacts with pre-existing, overlying flux. We present 2.5D simulations of asymmetric reconnection in weakly ionized, reacting plasmas where the magnetic field strengths, ion and neutral densities, and temperatures are different in each upstream region. The plasma and neutral components are evolved separately to allow non-equilibrium ionization. As in previous simulations of chromospheric reconnection,more » the current sheet thins to the scale of the neutral–ion mean free path and the ion and neutral outflows are strongly coupled. However, the ion and neutral inflows are asymmetrically decoupled. In cases with magnetic asymmetry, a net flow of neutrals through the current sheet from the weak-field (high-density) upstream region into the strong-field upstream region results from a neutral pressure gradient. Consequently, neutrals dragged along with the outflow are more likely to originate from the weak-field region. The Hall effect leads to the development of a characteristic quadrupole magnetic field modified by asymmetry, but the X-point geometry expected during Hall reconnection does not occur. All simulations show the development of plasmoids after an initial laminar phase.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19830059897&hterms=wave+oscillation&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dwave%2Boscillation','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19830059897&hterms=wave+oscillation&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dwave%2Boscillation"><span>Upstream electron oscillations and ion overshoot at an interplanetary shock wave</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Potter, D. W.; Parks, G. K.</p> <p>1983-01-01</p> <p>During the passage of a large interplanetary shock on Oct. 13, 1981, the ISEE-1 and -2 spacecraft were in the solar wind outside of the upstream region of the bow shock. The high time resolution data of the University of California particle instruments allow pinpointing the expected electron spike as occurring just before the magnetic ramp. In addition, two features that occur at this shock have not been observed before: electron oscillations associated with low frequency waves upstream of the shock and sharp 'overshoot' (about 1 sec) in the ion fluxes that occur right after the magnetic ramp. This interplanetary shock exhibits many of the same characteristics that are observed at the earth's bow shock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70021830','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70021830"><span>Foreshocks and aftershocks of the Great 1857 California earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Meltzner, A.J.; Wald, D.J.</p> <p>1999-01-01</p> <p>The San Andreas fault is the longest fault in California and one of the longest strike-slip faults anywhere in the world, yet we know little about many aspects of its behavior before, during, and after large earthquakes. We conducted a study to locate and to estimate magnitudes for the largest foreshocks and aftershocks of the 1857 M 7.9 Fort Tejon earthquake on the central and southern segments of the fault. We began by searching archived first-hand accounts from 1857 through 1862, by grouping felt reports temporally, and by assigning modified Mercalli intensities to each site. We then used a modified form of the grid-search algorithm of Bakum and Wentworth, derived from empirical analysis of modern earthquakes, to find the location and magnitude most consistent with the assigned intensities for each of the largest events. The result confirms a conclusion of Sieh that at least two foreshocks ('dawn' and 'sunrise') located on or near the Parkfield segment of the San Andreas fault preceded the mainshock. We estimate their magnitudes to be M ~ 6.1 and M ~ 5.6, respectively. The aftershock rate was below average but within one standard deviation of the number of aftershocks expected based on statistics of modern southern California mainshock-aftershock sequences. The aftershocks included two significant events during the first eight days of the sequence, with magnitudes M ~ 6.25 and M ~ 6.7, near the southern half of the rupture; later aftershocks included a M ~ 6 event near San Bernardino in December 1858 and a M ~ 6.3 event near the Parkfield segment in April 1860. From earthquake logs at Fort Tejon, we conclude that the aftershock sequence lasted a minimum of 3.75 years.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2011AGUFM.U53D0084A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2011AGUFM.U53D0084A"><span>Multi-scale heterogeneity of the 2011 Great Tohoku-oki Earthquake from dynamic simulations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Aochi, H.; Ide, S.</p> <p>2011-12-01</p> <p>In order to explain the scaling issues of earthquakes of different sizes, multi-scale heterogeneity conception is necessary to characterize earthquake faulting property (Ide and Aochi, JGR, 2005; Aochi and Ide, JGR, 2009).The 2011 Great Tohoku-oki earthquake (M9) is characterized by a slow initial phase of about M7, a M8 class deep rupture, and a M9 main rupture with quite large slip near the trench (e.g. Ide et al., Science, 2011) as well as the presence of foreshocks. We dynamically model these features based on the multi-scale conception. We suppose a significantly large fracture energy (corresponding to slip-weakening distance of 3.2 m) in most of the fault dimension to represent the M9 rupture. However we give local heterogeneity with relatively small circular patches of smaller fracture energy, by assuming the linear scaling relation between the radius and fracture energy. The calculation is carried out using 3D Boundary Integral Equation Method. We first begin only with the mainshock (Aochi and Ide, EPS, 2011), but later we find it important to take into account of a series of foreshocks since the 9th March (M7.4). The smaller patches including the foreshock area are necessary to launch the M9 rupture area of large fracture energy. We then simulate the ground motion in low frequencies using Finite Difference Method. Qualitatively, the observed tendency is consistent with our simulations, in the meaning of the transition from the central part to the southern part in low frequencies (10 - 20 sec). At higher frequencies (1-10 sec), further small asperities are inferred in the observed signals, and this feature matches well with our multi-scale conception.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EGUGA..1913069S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EGUGA..1913069S"><span>Foreshocks and aftershocks of the 2014 M8.1 Iquique, northern Chile, megathrust earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Soto, Hugo; Sippl, Christian; Schurr, Bernd; Asch, Günter; Tilmann, Frederik; Comte, Diana; Ruiz, Sergio; Oncken, Onno</p> <p>2017-04-01</p> <p>The M8.1 2014 Iquique earthquake broke a central piece of the long-standing, >500 km long northern Chile seismic gap. The Iquique earthquake sequence started off with a M6.7 thrust event presumably in the upper plate seaward of the Chilean coastline. Deformation was quickly transferred onto the megathrust with three more events of M>6 until it culminated in the mainshock that broke a compact asperity with possibly up to 12 m of slip two weeks later. The mainshock was followed by vigorous aftershock sequence, including a M7.7 event just south of the main slip patch approx. two days later. The whole sequence of events was well recorded by the Integrated Plate Boundary Observatory Chile (IPOC). The IPOC network was complemented quickly after the first large foreshock by 60 additional temporary seismic stations deployed by the University of Chile and the German Research Centre for Geosciences - GFZ. Processing the continuous data with an automated multi-step process for event detection, association and phase picking, we located more than 25,000 events for one month preceding and nine months following the Iquique mainshock. Whereas the foreshocks skirt around the updip limit of the mainshock asperity, the aftershocks agglomerate in two belts, one updip and one downdip of the main asperity offshore the Chilean coast. The deepest events on the plate interface reach 65 km depth in two separated clusters under the coastal cordillera, which show a significant difference in dip, indicating strong long-wavelength slab topography or a slab tear. We will also analyze upper- and deeper intra-plate seismicity and in particular its changes following the Iquique mainshock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=557016','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=557016"><span>Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Gilmartin, G M; Fleming, E S; Oetjen, J</p> <p>1992-01-01</p> <p>The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2000FlDyR..26..289O','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2000FlDyR..26..289O"><span>Generation of long waves in a fluid flowing over a localized topography at a periodically varying velocity</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ohsugi, Yasuo; Funakoshi, Mitsuaki</p> <p>2000-05-01</p> <p>The generation of long waves in a fluid flowing over a localized topography is examined numerically using the forced KdV equation under the assumption that the velocity U of the fluid far from the topography is close to the phase speed of a linear long wave and varies periodically with period T. For T within a few regions, we observe the 1: n entrainment of the wave motion near the topography to period T, in which n upstream-advancing waves are generated in period T. These regions extend and shift to larger T as the average value or amplitude of the variation of U increases. Furthermore, when the entrainment occurs, the spatial region where time-periodic evolution is almost attained extends toward both upstream and downstream directions with increasing time.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19970011569','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19970011569"><span>Optimum Suction Distribution for Transition Control</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Balakumar, P.; Hall, P.</p> <p>1996-01-01</p> <p>The optimum suction distribution which gives the longest laminar region for a given total suction is computed. The goal here is to provide the designer with a method to find the best suction distribution subject to some overall constraint applied to the suction. We formulate the problem using the Lagrangian multiplier method with constraints. The resulting non-linear system of equations is solved using the Newton-Raphson technique. The computations are performed for a Blasius boundary layer on a flat-plate and crossflow cases. For the Blasius boundary layer, the optimum suction distribution peaks upstream of the maximum growth rate region and remains flat in the middle before it decreases to zero at the end of the transition point. For the stationary and travelling crossflow instability, the optimum suction peaks upstream of the maximum growth rate region and decreases gradually to zero.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22667515-statistically-determined-dispersion-relations-magnetic-field-fluctuations-terrestrial-foreshock','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22667515-statistically-determined-dispersion-relations-magnetic-field-fluctuations-terrestrial-foreshock"><span>STATISTICALLY DETERMINED DISPERSION RELATIONS OF MAGNETIC FIELD FLUCTUATIONS IN THE TERRESTRIAL FORESHOCK</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Hnat, B.; O’Connell, D.; Nakariakov, V. M.</p> <p>2016-08-20</p> <p>We obtain dispersion relations of magnetic field fluctuations for two crossings of the terrestrial foreshock by Cluster spacecraft. These crossings cover plasma conditions that differ significantly in their plasma β and in the density of the reflected ion beam, but not in the properties of the encountered ion population, both showing shell-like distribution function. Dispersion relations are reconstructed using two-point instantaneous wave number estimations from pairs of Cluster spacecraft. The accessible range of wave vectors, limited by the available spacecraft separations, extends to ≈2 × 10{sup 4} km. Results show multiple branches of dispersion relations, associated with different powers ofmore » magnetic field fluctuations. We find that sunward propagating fast magnetosonic waves and beam resonant modes are dominant for the high plasma β interval with a dense beam, while the dispersions of the interval with low beam density include Alfvén and fast magnetosonic modes propagating sunward and anti-sunward.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014AGUFMSM52A..03N','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014AGUFMSM52A..03N"><span>The Missing Link Coupling the Foreshock to the Magnetosphere?: Impact of the Magnetosheath Velocity Fluctuations on the Growth of the Kelvin-Helmholtz instability.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Nykyri, K.; Dimmock, A. P.; Pulkkinen, T. I.; Otto, A.; Ma, X.</p> <p>2014-12-01</p> <p>Our statistical study of magnetosheath velocity fluctuations using 6+ years of THEMIS spacecraft measurements in Magnetosheath InterPlanetary Medium (MIPM) reference frame show that amplitudes of the velocity fluctuations are enhanced in the magnetosheath downstream of the quasi-parallel shock. The fluctuation amplitudes can be substantial and frequencies of these flcutuations can vary. We have examined the role of the i) amplitude, ii) frequency, iii) number of the modes, iv) as well as mode combinations of magnetosheath velocity fluctuations on the growth of Kelvin-Helmholtz Instability (KHI) using high-resolution macro-scale MHD simulations in magnetospheric inertial frame. The results show that even for the same magnetic field and plasma parameters across the magnetopause there can be major differences due to 'magnetosheath fluctuation state' on the growth and dynamical evolution of the KHI. This may provide the missing link how foreshock fluctuations couple to the magnetosphere and into the ionosphere</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70003770','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70003770"><span>Including foreshocks and aftershocks in time-independent probabilistic seismic hazard analyses</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Boyd, Oliver S.</p> <p>2012-01-01</p> <p>Time‐independent probabilistic seismic‐hazard analysis treats each source as being temporally and spatially independent; hence foreshocks and aftershocks, which are both spatially and temporally dependent on the mainshock, are removed from earthquake catalogs. Yet, intuitively, these earthquakes should be considered part of the seismic hazard, capable of producing damaging ground motions. In this study, I consider the mainshock and its dependents as a time‐independent cluster, each cluster being temporally and spatially independent from any other. The cluster has a recurrence time of the mainshock; and, by considering the earthquakes in the cluster as a union of events, dependent events have an opportunity to contribute to seismic ground motions and hazard. Based on the methods of the U.S. Geological Survey for a high‐hazard site, the inclusion of dependent events causes ground motions that are exceeded at probability levels of engineering interest to increase by about 10% but could be as high as 20% if variations in aftershock productivity can be accounted for reliably.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2012GeoRL..3916304O','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2012GeoRL..3916304O"><span>Geodetic constraints on afterslip characteristics following the March 9, 2011, Sanriku-oki earthquake, Japan</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ohta, Yusaku; Hino, Ryota; Inazu, Daisuke; Ohzono, Mako; Ito, Yoshihiro; Mishina, Masaaki; Iinuma, Takeshi; Nakajima, Junichi; Osada, Yukihito; Suzuki, Kensuke; Fujimoto, Hiromi; Tachibana, Kenji; Demachi, Tomotsugu; Miura, Satoshi</p> <p>2012-08-01</p> <p>A magnitude 7.3 foreshock occurred at the subducting Pacific plate interface on March 9, 2011, 51 h before the magnitude 9.0 Tohoku earthquake off the Pacific coast of Japan. We propose a coseismic and postseismic afterslip model of the magnitude 7.3 event based on a global positioning system network and ocean bottom pressure gauge sites. The estimated coseismic slip and afterslip areas show complementary spatial distributions; the afterslip distribution is located up-dip of the coseismic slip for the foreshock and northward of hypocenter of the Tohoku earthquake. The slip amount for the afterslip is roughly consistent with that determined by repeating earthquake analysis carried out in a previous study. The estimated moment release for the afterslip reached magnitude 6.8, even within a short time period of 51h. A volumetric strainmeter time series also suggests that this event advanced with a rapid decay time constant compared with other typical large earthquakes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=110903','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=110903"><span>Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Robson, Nicole D.; Telesnitsky, Alice</p> <p>2000-01-01</p> <p>Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22535132','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22535132"><span>Upstream capacity upgrade in TDM-PON using RSOA based tunable fiber ring laser.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Yi, Lilin; Li, Zhengxuan; Dong, Yi; Xiao, Shilin; Chen, Jian; Hu, Weisheng</p> <p>2012-04-23</p> <p>An upstream multi-wavelength shared (UMWS) time division multiplexing passive optical network (TDM-PON) is presented by using a reflective semiconductor amplifier (RSOA) and tunable optical filter (TOF) based directly modulated fiber ring laser as upstream laser source. The stable laser operation is easily achieved no matter what the bandwidth and shape of the TOF is and it can be directly modulated when the RSOA is driven at its saturation region. In this UMWS TDM-PON system, an individual wavelength can be assigned to the user who has a high bandwidth demand by tuning the central wavelength of the TOF in its upgraded optical network unit (ONU), while others maintain their traditional ONU structure and share the bandwidth via time slots, which greatly and dynamically upgrades the upstream capacity. We experimentally demonstrated the bidirectional transmission of downstream data at 10-Gb/s and upstream data at 1.25-Gb/s per wavelength over 25-km single mode fiber (SMF) with almost no power penalty at both ends. A stable performance is observed for the upstream wavelength tuned from 1530 nm to 1595 nm. Moreover, due to the high extinction ratio (ER) of the upstream signal, the burst-mode transmitting is successfully presented and a better time-division multiplexing performance can be obtained by turning off the unused lasers thanks to the rapid formation of the laser in the fiber ring. © 2012 Optical Society of America</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4558856','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4558856"><span>Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung</p> <p>2015-01-01</p> <p>Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4295041','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4295041"><span>Voyager observations of the interaction of the heliosphere with the interstellar medium</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Richardson, John D.</p> <p>2012-01-01</p> <p>This paper provides a brief review and update on the Voyager observations of the interaction of the heliosphere with the interstellar medium. Voyager has found many surprises: (1) a new energetic particle component which is accelerated at the termination shock (TS) and leaks into the outer heliosphere forming a foreshock region; (2) a termination shock which is modulated by energetic particles and which transfers most of the solar wind flow energy to the pickup ions (not the thermal ions); (3) the heliosphere is asymmetric; (4) the TS does not accelerate anomalous cosmic rays at the Voyager locations; and (5) the plasma flow in the Voyagers 1 (V1) and 2 (V2) directions are very different. At V1 the flow was small after the TS and has recently slowed to near zero, whereas at V2 the speed has remained constant while the flow direction has turned tailward. V1 may have entered an extended boundary region in front of the heliopause (HP) in 2010 in which the plasma flow speeds are near zero. PMID:25685423</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_14");'>14</a></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li class="active"><span>16</span></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_16 --> <div id="page_17" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li class="active"><span>17</span></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="321"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFM.S21B2719B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFM.S21B2719B"><span>Rupture process of 2016, 25 January earthquake, Alboran Sea (South Spain, Mw= 6.4) and aftershocks series</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Buforn, E.; Pro, C.; del Fresno, C.; Cantavella, J.; Sanz de Galdeano, C.; Udias, A.</p> <p>2016-12-01</p> <p>We have studied the rupture process of the 25 January 2016 earthquake (Mw =6.4) occurred in South Spain in the Alboran Sea. Main shock, foreshock and largest aftershocks (Mw =4.5) have been relocated using the NonLinLoc algorithm. Results obtained show a NE-SW distribution of foci at shallow depth (less than 15 km). For main shock, focal mechanism has been obtained from slip inversion over the rupture plane of teleseismic data, corresponding to left-lateral strike-slip motion. The rupture starts at 7 km depth and it propagates upward with a complex source time function. In order to obtain a more detailed source time function and to validate the results obtained from teleseismic data, we have used the Empirical Green Functions method (EGF) at regional distances. Finally, results of the directivity effect from teleseismic Rayleigh waves and the EGF method, are consistent with a rupture propagation to the NE. These results are interpreted in terms of the main geological features in the region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25685423','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25685423"><span>Voyager observations of the interaction of the heliosphere with the interstellar medium.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Richardson, John D</p> <p>2013-05-01</p> <p>This paper provides a brief review and update on the Voyager observations of the interaction of the heliosphere with the interstellar medium. Voyager has found many surprises: (1) a new energetic particle component which is accelerated at the termination shock (TS) and leaks into the outer heliosphere forming a foreshock region; (2) a termination shock which is modulated by energetic particles and which transfers most of the solar wind flow energy to the pickup ions (not the thermal ions); (3) the heliosphere is asymmetric; (4) the TS does not accelerate anomalous cosmic rays at the Voyager locations; and (5) the plasma flow in the Voyagers 1 (V1) and 2 (V2) directions are very different. At V1 the flow was small after the TS and has recently slowed to near zero, whereas at V2 the speed has remained constant while the flow direction has turned tailward. V1 may have entered an extended boundary region in front of the heliopause (HP) in 2010 in which the plasma flow speeds are near zero.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20020039730&hterms=activity+Physics&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dactivity%2BPhysics','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20020039730&hterms=activity+Physics&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dactivity%2BPhysics"><span>Theoretical Technology Research for the International Solar Terrestrial Physics (ISTP) Program</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Ashour-Abdalla, Maha; Curtis, Steve (Technical Monitor)</p> <p>2002-01-01</p> <p>During the last four years the UCLA (University of California, Los Angeles) IGPP (Institute of Geophysics and Planetary Physics) Space Plasma Simulation Group has continued its theoretical effort to develop a Mission Oriented Theory (MOT) for the International Solar Terrestrial Physics (ISTP) program. This effort has been based on a combination of approaches: analytical theory, large-scale kinetic (LSK) calculations, global magnetohydrodynamic (MHD) simulations and self-consistent plasma kinetic (SCK) simulations. These models have been used to formulate a global interpretation of local measurements made by the ISTP spacecraft. The regions of applications of the MOT cover most of the magnetosphere: solar wind, low- and high- latitude magnetospheric boundary, near-Earth and distant magnetotail, and auroral region. Most recent investigations include: plasma processes in the electron foreshock, response of the magnetospheric cusp, particle entry in the magnetosphere, sources of observed distribution functions in the magnetotail, transport of oxygen ions, self-consistent evolution of the magnetotail, substorm studies, effects of explosive reconnection, and auroral acceleration simulations. A complete list of the activities completed under the grant follow.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20080032526&hterms=foreshock&qs=N%3D0%26Ntk%3DAll%26Ntx%3Dmode%2Bmatchall%26Ntt%3Dforeshock','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20080032526&hterms=foreshock&qs=N%3D0%26Ntk%3DAll%26Ntx%3Dmode%2Bmatchall%26Ntt%3Dforeshock"><span>NASA's THEMIS Mission: Multipoint Observations of Substorms, the Foreshock, and the Magnetopause</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Sibeck, D. G.; Angelopoulos, V.; Kuznetsova, M.; Glabmeier, K.-H.; McFadden. J. P.</p> <p>2008-01-01</p> <p>From launch on February 17 through the repositioning to final orbits that began in September 2007, the five-spacecraft of the THEMIS mission operated nominally in nearly identical 14.6 RE apogee near-equatorial orbits. On March 23, while aligned from east to west in the duskside magnetotail, the spacecraft observed two substorm sequences in fast survey mode. Timing the motion of these signatures served as an early proof of concept for the main phase of the mission: particle injection and dipolarization signatures propagated duskward from one probe to another, as did auroral intensifications seen by the dedicated array of ground-based observatories. During the summer of 2007, the spacecraft were on the dayside, where the three inner spacecraft (C, D, E) were separated by 100-500 km and the two outer probes (B, -4) by 5,000 - 10,000 km. Here the THEMIS probes repeatedly encountered the magnetopause and bow shock, dissecting flux transfer events (FTEs), determining the instantaneous width of the low-latitude boundary layer, and simultaneously observing hot flow anomalies upstream and downstream from the bow shock at the moment of their inception. From January to March 2008, the spacecraft were in the Earths magnetotail with apogees of 31.0, 19.5, 11.8 (2) and 10.0 RE corresponding to periods of 4, 2, and 1 days. Radial alignments once each four days offered an opportunity to pinpoint when and where substorms begin. This talk reviews THEMIS discoveries to date, with an emphasis on model-data comparisons of FTE characteristics</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17496955','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17496955"><span>The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U</p> <p>2007-01-01</p> <p>Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22231539','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22231539"><span>Novel mechanism of conjoined gene formation in the human genome.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog</p> <p>2012-03-01</p> <p>Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19830046170&hterms=lecture&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dlecture','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19830046170&hterms=lecture&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Dlecture"><span>Upstream waves and particles /Tutorial Lecture/. [from shocks in interplanetary space</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Russell, C. T.; Hoppe, M. M.</p> <p>1983-01-01</p> <p>The plasma waves, MHD waves, energetic electrons and ions associated with the proximity of the region upstream from terrestrial, planetary and interplanetary shocks are discussed in view of observations and current theories concerning their origin. These waves cannot be separated from the study of shock structure. Since the shocks are supersonic, they continually overtake any ULF waves created in the plasma in front of the shock. The upstream particles and waves are also of intrinsic interest because they provide a plasma laboratory for the study of wave-particle interactions in a plasma which, at least at the earth, is accessible to sophisticated probing. Insight may be gained into interstellar medium cosmic ray acceleration through the study of these phenomena.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29476268','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29476268"><span>Landscape-based upstream-downstream prevalence of land-use/cover change drivers in southeastern rift escarpment of Ethiopia.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Temesgen, Habtamu; Wu, Wei; Legesse, Abiyot; Yirsaw, Eshetu; Bekele, Belew</p> <p>2018-02-23</p> <p>Characterized by high population density on a rugged topography, the Gedeo-Abaya landscape dominantly contains a multi-strata traditional agroforests showing the insight of Gedeo farmers on natural resource management practices. Currently, this area has been losing its resilience and is becoming unable to sustain its inhabitants. Based on both RS-derived and GIS-computed land-use/cover changes (LUCC) as well as socioeconomic validations, this article explored the LUCC and agroecological-based driver patterns in Gedeo-Abaya landscape from 1986 to 2015. A combination of geo-spatial technology and cross-sectional survey design were employed to detect the drivers behind these changes. The article discussed that LUCC and the prevalence of drivers are highly diverse and vary throughout agroecological zones. Except for the population, most downstream top drivers are perceived as insignificant in the upstream region and vice versa. In the downstream, land-use/cover (LUC) classes are more dynamic, diverse, and challenged by nearly all anticipated drivers than are upstream ones. Agroforestry LUC has been increasing (by 25% of its initial cover) and is becoming the predominant cover type, although socioeconomic analysis and related findings show its rapid LUC modification. A rapid reduction of woodland/shrubland (63%) occurred in the downstream, while wetland/marshy land increased threefold (158%), from 1986 to 2015 with annual change rates of - 3.7 and + 6%, respectively. Land degradation induced by changes in land use is a serious problem in Africa, especially in the densely populated sub-Saharan regions such as Ethiopia (FAO 2015). Throughout the landscape, LUCC is prominently affecting land-use system of the study landscape due to population pressure in the upstream region and drought/rainfall variability, agribusiness investment, and charcoaling in the downstream that necessitate urgent action.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3562271','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3562271"><span>A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p></p> <p>2012-01-01</p> <p>Background Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication. PMID:23241244</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23241244','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23241244"><span>A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling</p> <p>2012-12-15</p> <p>Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AIPA....6d5113S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AIPA....6d5113S"><span>Enhancing the aggressive intensity of hydrodynamic cavitation through a Venturi tube by increasing the pressure in the region where the bubbles collapse</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Soyama, H.; Hoshino, J.</p> <p>2016-04-01</p> <p>In this paper, we used a Venturi tube for generating hydrodynamic cavitation, and in order to obtain the optimum conditions for this to be used in chemical processes, the relationship between the aggressive intensity of the cavitation and the downstream pressure where the cavitation bubbles collapse was investigated. The acoustic power and the luminescence induced by the bubbles collapsing were investigated under various cavitating conditions, and the relationships between these and the cavitation number, which depends on the upstream pressure, the downstream pressure at the throat of the tube and the vapor pressure of the test water, was found. It was shown that the optimum downstream pressure, i.e., the pressure in the region where the bubbles collapse, increased the aggressive intensity by a factor of about 100 compared to atmospheric pressure without the need to increase the input power. Although the optimum downstream pressure varied with the upstream pressure, the cavitation number giving the optimum conditions was constant for all upstream pressures.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19810021550','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19810021550"><span>Computer analysis of flow perturbations generated by placement of choke bumps in a wind tunnel</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Campbell, R. L.</p> <p>1981-01-01</p> <p>An inviscid analytical study was conducted to determine the upstream flow perturbations caused by placing choke bumps in a wind tunnel. A computer program based on the stream-tube curvature method was used to calculate the resulting flow fields for a nominal free-stream Mach number range of 0.6 to 0.9. The choke bump geometry was also varied to investigate the effect of bump shape on the disturbance produced. Results from the study indicate that a region of significant variation from the free-stream conditions exists upstream of the throat of the tunnel. The extent of the disturbance region was, as a rule, dependent on Mach number and the geometry of the choke bump. In general, the upstream disturbance distance decreased for increasing nominal free-stream Mach number and for decreasing length-to-height ratio of the bump. A polynomial-curve choke bump usually produced less of a disturbance than did a circular-arc bump and going to an axisymmetric configuration (modeling choke bumps on all the tunnel walls) generally resulted in a lower disturbance than with the corresponding two dimensional case.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70189809','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70189809"><span>Paleogeomorphology of the early Colorado River inferred from relationships in Mohave and Cottonwood Valleys, Arizona, California and Nevada</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Pearthree, Philip; House, P. Kyle</p> <p>2014-01-01</p> <p>Geologic investigations of late Miocene–early Pliocene deposits in Mohave and Cottonwood valleys provide important insights into the early evolution of the lower Colorado River system. In the latest Miocene these valleys were separate depocenters; the floor of Cottonwood Valley was ∼200 m higher than the floor of Mohave Valley. When Colorado River water arrived from the north after 5.6 Ma, a shallow lake in Cottonwood Valley spilled into Mohave Valley, and the river then filled both valleys to ∼560 m above sea level (asl) and overtopped the bedrock divide at the southern end of Mohave Valley. Sediment-starved water spilling to the south gradually eroded the outlet as siliciclastic Bouse deposits filled the lake upstream. When sediment accumulation reached the elevation of the lowering outlet, continued erosion of the outlet resulted in recycling of stored lacustrine sediment into downstream basins; depth of erosion of the outlet and upstream basins was limited by the water levels in downstream basins. The water level in the southern Bouse basin was ∼300 m asl (modern elevation) at 4.8 Ma. It must have drained and been eroded to a level <150 m asl soon after that to allow for deep erosion of bedrock divides and basins upstream, leading to removal of large volumes of Bouse sediment prior to massive early Pliocene Colorado River aggradation. Abrupt lowering of regional base level due to spilling of a southern Bouse lake to the Gulf of California could have driven observed upstream river incision without uplift. Rapid uplift of the entire region immediately after 4.8 Ma would have been required to drive upstream incision if the southern Bouse was an estuary.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/2834093','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/2834093"><span>The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Neuhaus, H; Link, G</p> <p>1987-01-01</p> <p>The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JGRA..12211320H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JGRA..12211320H"><span>Flows, Fields, and Forces in the Mars-Solar Wind Interaction</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Halekas, J. S.; Brain, D. A.; Luhmann, J. G.; DiBraccio, G. A.; Ruhunusiri, S.; Harada, Y.; Fowler, C. M.; Mitchell, D. L.; Connerney, J. E. P.; Espley, J. R.; Mazelle, C.; Jakosky, B. M.</p> <p>2017-11-01</p> <p>We utilize suprathermal ion and magnetic field measurements from the Mars Atmosphere and Volatile EvolutioN (MAVEN) mission, organized by the upstream magnetic field, to investigate the morphology and variability of flows, fields, and forces in the Mars-solar wind interaction. We employ a combination of case studies and statistical investigations to characterize the interaction in both quasi-parallel and quasi-perpendicular regions and under high and low solar wind Mach number conditions. For the first time, we include a detailed investigation of suprathermal ion temperature and anisotropy. We find that the observed magnetic fields and suprathermal ion moments in the magnetosheath, bow shock, and upstream regions have observable asymmetries controlled by the interplanetary magnetic field, with particularly large asymmetries found in the ion parallel temperature and anisotropy. The greatest temperature anisotropies occur in quasi-perpendicular regions of the magnetosheath and under low Mach number conditions. These results have implications for the growth and evolution of wave-particle instabilities and their role in energy transport and dissipation. We utilize the measured parameters to estimate the average ion pressure gradient, J × B, and v × B macroscopic force terms. The pressure gradient force maintains nearly cylindrical symmetry, while the J × B force has larger asymmetries and varies in magnitude in comparison to the pressure gradient force. The v × B force felt by newly produced planetary ions exceeds the other forces in magnitude in the magnetosheath and upstream regions for all solar wind conditions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/1694111','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/1694111"><span>Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Berends Sexton, T; Jones, J T; Mullet, J E</p> <p>1990-05-01</p> <p>A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1983JGR....88.4247H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1983JGR....88.4247H"><span>Local seismicity preceding the March 14, 1979, Petatlan, Mexico Earthquake (Ms = 7.6)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Hsu, Vindell; Gettrust, Joseph F.; Helsley, Charles E.; Berg, Eduard</p> <p>1983-05-01</p> <p>Local seismicity surrounding the epicenter of the March 14, 1979, Petatlan, Mexico earthquake was monitored by a network of portable seismographs of the Hawaii Institute of Geophysics from 6 weeks before to 4 weeks after the main shock. Prior to the main shock, the recorded local seismic activity was shallow and restricted within the continental plate above the Benioff zone. The relocated main shock hypocenter also lay above the Benioff zone, suggesting an initial failure within the continental lithosphere. Four zones can be recognized that showed relatively higher seismic activity than the background. Activity within these zones has followed a number of moderate earthquakes that occurred before or after the initial deployment of the network. Three of these moderate earthquakes were near the Mexican coastline and occurred sequentially from southeast to northwest during the three months before the Petatlan earthquake. The Petatlan event occurred along the northwestern extension of this trend. We infer a possible connection between this observed earthquake migration pattern and the subduction of a fracture zone because the 200-km segment that includes the aftershock zones of the Petatlan earthquake and the three preceding moderate earthquakes matches the intersection of the southeastern limb of the Orozco Fracture Zone and the Middle America Trench. The Petatlan earthquake source region includes the region of the last of the three near-coast seismic activities (zone A). Earthquakes of zone A migrated toward the Petatlan main shock epicenter and were separated from it by an aseismic zone about 10 km wide. We designate this group of earthquakes as the foreshocks of the Petatlan earthquake. These foreshocks occurred within the continental lithosphere and their observed characteristics are interpreted as due to the high-stress environment before the main shock. Pre-main shock seismicity of the Petatlan earthquake source region shows a good correlation with the aftershocks in their spatial distribution. This suggests that an asperity existing along the Benioff zone may have affected both the pre-main shock activity in the continental lithosphere and the aftershocks along the Benioff zone. Although major thrust earthquakes at trenches occur along Benioff zones, in the present study we find little activity on this interplate boundary before the Petatlan earthquake. The overlying continental block, on the contrary, is very active seismically. Our data suggest that the activity is probably governed by the stress transmitted from below due to coupling between two plates and the heterogeneity within the continental lithosphere. The continental material is probably the more likely place for precursors.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70169257','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70169257"><span>Amplitude of foreshocks as a possible seismic precursor to earthquakes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Lindh, A.G.</p> <p>1978-01-01</p> <p>In recent years, we have made significant progress in being able to recognize the long-range pattern of events that precede large earthquakes. For example, in a recent issue of the Earthquake Information Bulletin, we saw how the pioneering work of S.A. Fedotov of the U.S.S.R in the Kamchatka-Kurile Islands region has been applied worldwide to forecast where large, shallow earthquakes might occur in the next decades. Indeed, such a "seismic gap" off the coast of Alaska was filled by the 1972 Sitka earthquake. Promising results are slowly accumulating from other techniques that suggest that intermediate-term precursors might also be seen: among these are tilt and geomagnetic anomalies and anomalous land uplift. But the crucial point remains that short-term precursors (days to hours) will be needed in many cases if there is to be a significant saving of lives. </p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22493820-plasma-flow-peripheral-region-detached-plasma-linear-plasma-device','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22493820-plasma-flow-peripheral-region-detached-plasma-linear-plasma-device"><span>Plasma flow in peripheral region of detached plasma in linear plasma device</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Hayashi, Y., E-mail: hayashi-yuki13@ees.nagoya-u.ac.jp; Ohno, N.; Kajita, S.</p> <p>2016-01-15</p> <p>A plasma flow structure is investigated using a Mach probe under detached plasma condition in a linear plasma device NAGDIS-II. A reverse flow along the magnetic field is observed in a steady-state at far-peripheral region of the plasma column in the upstream side from the recombination front. These experimental results indicate that plasma near the recombination front should strongly diffuse across the magnetic field, and it should be transported along the magnetic field in the reverse flow direction. Furthermore, bursty plasma density fluctuations associated with intermittent convective plasma transport are observed in the far-peripheral region of the plasma column inmore » both upstream and downstream sides from the recombination front. Such a nondiffusive transport can contribute to the intermittent reverse plasma flow, and the experimental results indicate that intermittent transports are frequently produced near the recombination front.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19860061048&hterms=Exciter&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D60%26Ntt%3DExciter','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19860061048&hterms=Exciter&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D60%26Ntt%3DExciter"><span>A laboratory study of ion energization by EIC waves and subsequent upstreaming along diverging magnetic field lines</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cartier, S. L.; Dangelo, N.; Merlino, R. L.</p> <p>1986-01-01</p> <p>A laboratory study related to energetic upstreaming ions in the ionosphere-magnetosphere system is described. The experiment was carried out in a cesium Q machine plasma with a region of nonuniform magnetic field. Electrostatic ion cyclotron waves were excited by drawing an electron current to a small biased exciter electrode. In the presence of the instability, ions are heated in the direction perpendicular to B. Using a gridded retarding potential ion energy analyzer, the evolution of the ion velocity distribution was followed as the ions passed through the heating region and subsequently flowed out along the diverging B field lines. As expected, the heated ions transfer their energy from perpendicular to parallel motion as they move through the region of diverging B field. Both their parallel thermal energy and the parallel drift energy increase at the expense of the perpendicular energy.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li class="active"><span>17</span></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_17 --> <div id="page_18" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li class="active"><span>18</span></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="341"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015OcMod..90....1H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015OcMod..90....1H"><span>Methods for freshwater riverine input into regional ocean models</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Herzfeld, M.</p> <p>2015-06-01</p> <p>The input of freshwater at the coast in regional models is a non-trivial exercise that has been studied extensively in the past. Several issues are of relevance; firstly, estuaries process water properties along their length, so that while freshwater may enter at the estuary head, it is no longer fresh at the mouth. Secondly, models create a numerical response that results in excessive upstream or offshore transport compared to what is typically observed. The cause of this has been traced to the lack of landward flow at the coast where freshwater is input. In this study we assess the performance of various methods of freshwater input in coarse resolution regional models where the estuary cannot be explicitly resolved, and present a formulation that attempts to account for upstream flow in the salt wedge and in-estuary mixing that elevates salinity at the mouth.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/15352122','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/15352122"><span>Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C</p> <p>2004-09-01</p> <p>Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=159935','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=159935"><span>Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH</p> <p>1990-01-01</p> <p>We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20080014309','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20080014309"><span>Blade-to-Blade Variations in Shocks Upstream of Both a Forward-Swept and an Aft-Swept Fan</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Podboy, Gary G.; Krupar, Martin J.</p> <p>2006-01-01</p> <p>Detailed laser Doppler velocimeter (LDV) flow field measurements were made upstream of two fans, one forward-swept and one aft-swept, in order to learn more about the shocks which propagate upstream of these rotors when they are operated at supersonic tip speeds. The blade-to-blade variations in the flows associated with these shocks are thought to be responsible for generating Multiple Pure Tone (MPT) noise. The measured blade-to-blade variations are documented in this report through a series of slideshows which show relative Mach number contours computed from the velocity measurements. Data are presented for the forward-swept fan operating at three speeds (corresponding to tip relative Mach numbers of 0.817, 1.074, and 1.189), and for the aft-swept fan operating at two (tip relative Mach numbers of 1.074 and 1.189). These LDV data illustrate how the perturbations in the upstream flow field created by the rotating blades vary with axial position, radial position and rotor speed. As expected, at the highest tested speed the forward-swept fan swallowed the shocks which occur in the tip region, whereas the aftswept fan did not. This resulted in a much smaller flow disturbance just upstream of the tip of the forward-swept fan. Nevertheless, further upstream the two fan flows were much more similar.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EPJWC.14009036T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EPJWC.14009036T"><span>Discrete modelling of front propagation in backward piping erosion</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tran, Duc-Kien; Prime, Noémie; Froiio, Francesco; Callari, Carlo; Vincens, Eric</p> <p>2017-06-01</p> <p>A preliminary discrete numerical model of a REV at the front region of an erosion pipe in a cohesive granular soil is briefly presented. The results reported herein refer to a simulation carried out by coupling the Discrete Element Method (DEM) with the Lattice Boltzmann Method (LBM) for the representation of the granular and fluid phases, respectively. The numerical specimen, consisiting of bonded grains, is tested under fully-saturated conditions and increasing pressure difference between the inlet (confined) and the outlet (unconfined) flow regions. The key role of compression arches of force chains that transversely cross the sample and carry most part of the hydrodynamic actions is pointed out. These arches partition the REV into an upstream region that remains almost intact and a downstream region that gradually degrades and is subsequently eroded in the form of a cluster. Eventually, the collapse of the compression arches causes the upstream region to be also eroded, abruptly, as a whole. A complete presentation of the numerical model and of the results of the simulation can be found in [12].</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20070035072','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20070035072"><span>Shock Characteristics Measured Upstream of Both a Forward-Swept and an Aft-Swept Fan</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Podboy, Gary G.; Krupar, Martin J.; Sutliff, Daniel L.; Horvath, Csaba</p> <p>2007-01-01</p> <p>Three different types of diagnostic data-blade surface flow visualization, shroud unsteady pressure, and laser Doppler velocimeter (LDV)--were obtained on two fans, one forward-swept and one aft-swept, in order to learn more about the shocks which propagate upstream of these rotors when they are operated at transonic tip speeds. Flow visualization data are presented for the forward-swept fan operating at 13831 rpm(sub c), and for the aft-swept fan operating at 12500 and 13831 rpm(sub c) (corresponding to tip rotational Mach numbers of 1.07 and 1.19, respectively). The flow visualization data identify where the shocks occur on the suction side of the rotor blades. These data show that at the takeoff speed, 13831 rpm(sub c), the shocks occurring in the tip region of the forward-swept fan are further downstream in the blade passage than with the aft-swept fan. Shroud unsteady pressure measurements were acquired using a linear array of 15 equally-spaced pressure transducers extending from two tip axial chords upstream to 0.8 tip axial chords downstream of the static position of the tip leading edge of each rotor. Such data are presented for each fan operating at one subsonic and five transonic tip speeds. The unsteady pressure data show relatively strong detached shocks propagating upstream of the aft-swept rotor at the three lowest transonic tip speeds, and weak, oblique pressure disturbances attached to the tip of the aft-swept fan at the two highest transonic tip speeds. The unsteady pressure measurements made with the forward-swept fan do not show strong shocks propagating upstream of that rotor at any of the tested speeds. A comparison of the forward-swept and aft-swept shroud unsteady pressure measurements indicates that at any given transonic speed the pressure disturbance just upstream of the tip of the forward-swept fan is much weaker than that of the aft-swept fan. The LDV data suggest that at 12500 and 13831 rpm(sub c), the forward-swept fan swallowed the passage shocks occurring in the tip region of the blades, whereas the aft-swept fan did not. Due to this difference, the flows just upstream of the two fans were found to be quite different at both of these transonic speeds. Nevertheless, despite distinct differences just upstream of the two rotors, the two fan flows were much more alike about one axial blade chord further upstream. As a result, the LDV data suggest that it is unwise to attempt to determine the effect that the shocks have on far field noise by focusing only on measurements (or CFD predictions) made very near the rotor. Instead, these data suggest that it is important to track the shocks throughout the inlet.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014EGUGA..1613674B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014EGUGA..1613674B"><span>On using TRMM data and rainfall forecasts from meteorological models in data-scarce transboundary catchments - an example of Bangladesh</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Bhattacharya, Biswa; Tohidul Islam, Md.</p> <p>2014-05-01</p> <p>This research focuses on the flood risk of the Haor region in the north-eastern part of Bangladesh. The prediction of the hydrological variables at different spatial and temporal scales in the Haor region is dependent on the influence of several upstream rivers in the Meghalaya catchment in India. Limitation in hydro-meteorological data collection and data sharing issues between the two countries dominate the feasibility of hydrological studies, particularly for near-realtime predictions. One of the possible solutions seems to be in making use of the variety of satellite based and meteorological model products for rainfall. The abundance of a variety of rainfall products provides a good basis of hydrological modelling of a part of the Ganges and Brahmaputra basin. In this research the TRMM data and rainfall forecasts from ECMWF have been compared with the scarce rain gauge data from the upstream Meghalaya catchment. Subsequently, the TRMM data and rainfall forecasts from ECMWF have been used as the meteorological input to a rainfall-runoff model of the Meghalaya catchment. The rainfall-runoff model of Meghalaya has been developed using the DEM data from SRTM. The generated runoff at the outlet of Meghalaya has been used as the upstream boundary condition in the existing rainfall-runoff model of the Haor region. The simulation results have been compared with the existing results based on simulations without any information of the rainfall-runoff in the upstream Meghalaya catchment. The comparison showed that the forecasting lead time has been substantially increased. As per the existing results the forecasting lead time at a number of locations in the catchment was about 6 to 8 hours. With the new results the forecasting lead time has gone up, with different levels of accuracy, to about 24 hours. This additional lead time will be highly beneficial in managing flood risk of the Haor region of Bangladesh. The research shows that satellite based rainfall products and rainfall forecasts from meteorological models can be very useful in flood risk management, particularly for data scarce regions and/or transboundary regions with data sharing issues. Keywords: flood risk management, TRMM, ECMWF, flood forecasting, Haor, Bangladesh. Abbreviations: TRMM: Tropical Rainfall Measuring Mission ECMWF: European Centre for Medium-Range Weather Forecasts DEM: Digital Elevation Model SRTM: Shuttle Radar Topography Mission</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFMSM11B2312S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFMSM11B2312S"><span>Vortex, ULF wave and Aurora Observation after Solar Wind Dynamic Pressure Change</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Shi, Q.</p> <p>2017-12-01</p> <p>Here we will summarize our recent study and show some new results on the Magnetosphere and Ionosphere Response to Dynamic Pressure Change/disturbances in the Solar Wind and foreshock regions. We study the step function type solar wind dynamic pressure change (increase/decrease) interaction with the magnetosphere using THEMIS satellites at both dayside and nightside in different geocentric distances. Vortices generated by the dynamic pressure change passing along the magnetopause are found and compared with model predictions. ULF waves and vortices are excited in the dayside and nightside plasma sheet when dynamic pressure change hit the magnetotail. The related ionospheric responses, such as aurora and TCVs, are also investigated. We compare Global MHD simulations with the observations. We will also show some new results that dayside magnetospheric FLRs might be caused by foreshock structures.Shi, Q. Q. et al. (2013), THEMIS observations of ULF wave excitation in the nightside plasma sheet during sudden impulse events, J. Geophys. Res. Space Physics, 118, doi:10.1029/2012JA017984. Shi, Q. Q. et al. (2014), Solar wind pressure pulse-driven magnetospheric vortices and their global consequences, J. Geophys. Res. Space Physics, 119, doi:10.1002/2013JA019551. Tian, A.M. et al.(2016), Dayside magnetospheric and ionospheric responses to solar wind pressure increase: Multispacecraft and ground observations, J. Geophys. Res., 121, doi:10.1002/2016JA022459. Shen, X.C. et al.(2015), Magnetospheric ULF waves with increasing amplitude related to solar wind dynamic pressure changes: THEMIS observations, J. Geophys. Res., 120, doi:10.1002/2014JA020913Zhao, H. Y. et al. (2016), Magnetospheric vortices and their global effect after a solar wind dynamic pressure decrease, J. Geophys. Res. Space Physics, 121, doi:10.1002/2015JA021646. Shen, X. C., et al. (2017), Dayside magnetospheric ULF wave frequency modulated by a solar wind dynamic pressure negative impulse, J. Geophys. Res., 122, doi:10.1002/2016JA023351.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EGUGA..1913953K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EGUGA..1913953K"><span>Search for repeating events at the plate interface in the seismic sequence of the 2014 Mw8.1 Iquique earthquake, Chile</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Kummerow, Joern; Asch, Guenter; Sens-Schönfelder, Christoph; Schurr, Bernd; Tilmann, Frederik; Shapiro, Serge A.</p> <p>2017-04-01</p> <p>The 2014 Mw8.1 Iquique earthquake occurred along a segment of the northern Chile- southern Peru seismic gap which had not ruptured for more than 100 years. A specific feature of this event is the observation of prominent foreshock clusters with successively increasing seismic moment releases starting several months before the main shock (e.g., Schurr et al., 2014). The entire seismic sequence, including also the aftershock seismicity, was monitored exceptionally well by the Integrated Plate Boundary Observatory Chile (IPOC). Here, we present results from a systematic, long-term search for repeating seismic events along the plate interface in the source region of the 1 April 2014 (Mw8.1) Iquique main shock. Repeating earthquakes are widely assumed to indicate recurrent ruptures on the same fault patch and to accommodate aseismic slip in the creeping portions around the seismic patch. According to this concept, the analysis of repeating events and of their temporal behaviour provides a tool to estimate the amount of creep. We use the IPOC and two additional local seismic networks and select recorded waveforms of several hundreds of located earthquakes within the foreshock and aftershock series as template events. Waveforms are windowed around the P and S phases and bandpass-filtered for different frequency bands. Window starts are defined by manually revised P onset times. We then run a newly implemented correlation detector on the resampled, continuous seismic data to find highly similar waveforms for each template event. Repeating earthquakes are finally identified by a combination of estimated source dimensions, high waveform similarity and precise relative relocations of the events within each multiplet group. The analysis of the spatial and temporal patterns of the detected repeating earthquake sequences allows to test the proposed idea of progressive unlocking of the plate boundary before the Iquique main shock.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S23B0800S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S23B0800S"><span>Dynamic Triggering of Seismic Events and Their Relation to Slow Slip in Interior Alaska</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Sims, N. E.; Holtkamp, S. G.</p> <p>2017-12-01</p> <p>We conduct a search for dynamically triggered events in the Minto Flats Fault Zone (MFFZ), a left-lateral strike-slip zone expressed as multiple, partially overlapping faults, in central Alaska. We focus on the MFFZ because we have observed slow slip processes (earthquake swarms and Very Low Frequency Earthquakes) and interaction between earthquake swarms and larger main-shock (MS) events in this area before. We utilize the Alaska Earthquake Center catalog to identify potential earthquake swarms and dynamically triggered foreshock and mainshock events along the fault zone. We find 30 swarms occurring in the last two decades, five of which we classify as foreshock (FS) swarms due to their close proximity in both time and space to MS events. Many of the earthquake swarms cluster around 15-20 km depth, which is near the seismic-aseismic transition along this fault zone. Additionally, we observe instances of large teleseismic events such as the M8.6 2012 Sumatra earthquake and M7.4 2012 Guatemala earthquake triggering seismic events within the MFFZ, with the Sumatra earthquake triggering a mainshock event that was preceded by an ongoing earthquake swarm and the Guatemala event triggering earthquake swarms that subsequently transition into a larger mainshock event. In both cases an earthquake swarm transitioned into a mainshock-aftershock event and activity continued for several days after the teleseismic waves had passed, lending some evidence to delayed dynamic triggering of seismic events. We hypothesize that large dynamic transient strain associated with the passage of teleseismic surface waves is triggering slow slip processes near the base of the seismogenic zone. These triggered aseismic transient events result in earthquake swarms, which sometimes lead to the nucleation of larger earthquakes. We utilize network matched filtering to build more robust catalogs of swarm earthquake families in this region to search for additional swarm-like or triggered activity in response to teleseismic surface waves, and to test dynamic triggering hypotheses.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=553352','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=553352"><span>The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel</p> <p>1987-01-01</p> <p>Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015AGUFMSH53A2479J','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015AGUFMSH53A2479J"><span>Abundance and Source Population of Suprathermal Heavy Ions in Corotating Interaction Regions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Jensema, R. J.; Desai, M. I.; Broiles, T. W.; Dayeh, M. A.</p> <p>2015-12-01</p> <p>In this study we analyze the abundances of suprathermal heavy ions in 75 Corotating Interaction Region (CIR) events between January 1st 1995 and December 31st 2008. We correlate the heavy ion abundances in these CIRs with those measured in the solar wind and suprathermal populations upstream of these events. Our analysis reveals that the CIR suprathermal heavy ion abundances vary by nearly two orders of magnitude over the solar activity cycle, with higher abundances (e.g., Fe/O) occurring during solar maximum and depleted values occurring during solar minimum. The abundances are also energy dependent, with larger abundances at higher energies, particularly during solar maximum. Following the method used by Mason et al. 2008, we correlate the CIR abundances with the corresponding solar wind and suprathermal values measured during 6-hour intervals for upstream periods spanning 10 days prior to the start of each CIR event. This correlation reveals that suprathermal heavy ions are better correlated with upstream suprathermal abundances measured at the same energy compared with the solar wind heavy ion abundances. Using the 6-hour averaging method, we also identified timeframes of maximum correlation between the CIR and the upstream suprathermal abundances, and find that the time of maximum correlation depends on the energy of the suprathermal ions. We discuss the implications of these results in terms of previous studies of CIR and suprathermal particles, and CIR seed populations and acceleration mechanisms.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1176417','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1176417"><span>Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn</p> <p>2005-01-01</p> <p>Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFMPP43D..07L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFMPP43D..07L"><span>Coral-inferred Variability of Upstream Kuroshio Current from 1953-2004 AD</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Li, X.; Yi, L.; Shen, C. C.; Hsin, Y. C.</p> <p>2016-12-01</p> <p>The Kuroshio Current (KC), one of the most important western boundary currents in the North Pacific Ocean, strongly impacts regional climate in East Asia and upper-ocean thermal structure. However, the responses of KC to regional and remote climate forcing are poorly understood owing to lacking of long-term KC observations. Here, we present a sea surface temperature (SST) record from 1953 to 2004 AD derived from monthly skeletal δ18O data of a living coral Porites core, drilled in Nanwan, southern Taiwan (22°N, 121°E), located on the western front of the Upstream KC. The increased/reduced Kuroshio transport would generate stronger/weaker upwelling in Southern Taiwan, which can cause lower/higher SST. Agreement between dynamics of interannual coral δ18O and modern KC data shows that the regional coral δ18O can be used as a promising proxy for Upstream KC intensity. The KC-induced SST anomaly record reveals prominent interannual and decadal variability predominantly controlled by the bifurcation latitude of North Equatorial Current. We also find that the reconstructed KC intensity at east of Taiwan and south of Japan have nearly simultaneous interannual changes, suggesting the same dominant forcing(s) for the entire KC system. Additional work is needed to understand the KC system with respect to the interannual to decadal climate variability and the influences of global warming.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=27717','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=27717"><span>Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.</p> <p>2000-01-01</p> <p>The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S21B0699M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S21B0699M"><span>Spatiotemporal Analysis of the Foreshock-Mainshock-Aftershock Sequence of the 6 July 2017 M5.8 Lincoln, Montana Earthquake</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>McMahon, N. D.; Stickney, M.; Aster, R. C.; Yeck, W.; Martens, H. R.; Benz, H.</p> <p>2017-12-01</p> <p>On 6 July 2017, a Mw 5.8 earthquake occurred 11 km southeast of Lincoln, Montana. The event was widely-felt from Edmonton, Alberta, Canada (750 km north), Seattle, Washington (800 km west), the Idaho/Utah and Idaho/Nevada borders (550 km south), and Rapid City, South Dakota (750 km east). This is the largest earthquake to occur in the state since the 1959 M 7.3 Hebgen Lake event 250 km to the southeast. In the three weeks following the 6 July 2017 Mw 5.8 main shock, the U.S. Geological Survey and Montana Bureau of Mines and Geology located more than 300 aftershocks. Preliminary observations show most of these aftershocks form a short NNE zone that suggests that the main shock may have slipped on a NNE left-lateral fault. A smaller number of aftershocks extend along a longer WNW-trending zone. These faults are part of the Lewis and Clark line, a prominent zone of Middle Proterozoic to Holocene age strike-slip, dip slip, and oblique slip faulting trending 400 km east-southeast from northern Idaho to east of Helena, Montana, and terminating southeast of this earthquake. We use identified aftershock waveforms as templates to examine the data from 1 June 2017 through 27 July 2017 with cross-correlation techniques on nearby permanent and temporary seismic stations deployed shortly after the mainshock to identify foreshocks and additional small aftershocks. Locating these events allows us to study subsurface geology, map fault structures, and provide insight on the spatial and temporal evolution of the earthquake sequence, which may continue to produce aftershocks for years. Other notable earthquakes in the region include a damaging M 6.6 earthquake 100 km to the south in June 1925, M 6.2 and M 6.0 earthquakes near Helena, Montana in October 1935 that caused significant damage and four fatalities, and a M 5.6 earthquake 170 km to the south in July 2005 that caused minor damage in Dillon and the surrounding region. We hope this work not only allows us to map the involved faults and detail hazards associated with them, but helps to raise awareness in general about the underrepresented hazard associated with intraplate seismicity and the reactivation of older preexisting faults that have few, if any, Quaternary expressions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26220934','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26220934"><span>Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung</p> <p>2015-07-27</p> <p>Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016APS..GECHT6035S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016APS..GECHT6035S"><span>On judgement of electron transfer between two regions divided by the separatrix of confronting divergent magnetic fields applied to an inductively coupled plasma</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Sugawara, Hirotake; Yamamoto, Tappei</p> <p>2016-09-01</p> <p>In order to quantitatively evaluate the electron confinement effect of the confronting divergent magnetic fields (CDMFs) applied to an inductively coupled plasma, we analyzed the electron transfer between two regions divided by the separatrix of the CDMFs in Ar at 0.67 Pa at 300 K using a Monte Carlo method. A conventional transfer judgement was simply based on the electron passage across the separatrix from the upstream source region to the downstream diffusion region. An issue was an overestimation of the transfer due to temporary stay of electrons in the downstream region. Electrons may pass the downstream region during their gyration even in case they are effectively bound to the upstream region, where their guiding magnetic flux lines run. More than half of the transfers were temporary ones and such seeming transfers were relevantly excluded from the statistics by introducing a newly chosen criterion based on the passage of electron gyrocenters across the separatrix and collisional events in the downstream region. Simulation results showed a tendency that the ratio of the temporary transfers excluded was higher under stronger magnetic fields because of higher cyclotron frequency. Work supported by JSPS Kakenhi Grant Number 16K05626.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017ECSS..196...10S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017ECSS..196...10S"><span>Spatial and temporal distribution of metals in suspended particulate matter of the Kali estuary, India</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Suja, S.; Kessarkar, Pratima M.; Fernandes, Lina L.; Kurian, Siby; Tomer, Arti</p> <p>2017-09-01</p> <p>Major (Al, Fe, Mn, Ti, Mg) and trace (Cu, Zn, Pb, Cr, Ni, Co, Zr, Rb, Sr, Ba, Li, Be, Sc, V, Ga, Nb, Mo, Sn, Sb, Cs, Hf, Ta, Bi, Th, U) elements and particulate organic carbon (POC) concentrations in surface suspended particulate matter (SPM) of the Kali estuary, (central west coast of India) were studied during the pre-monsoon, monsoon and post monsoon seasons to infer estuarine processes, source of SPM and Geoaccumulation Index (Igeo) assigned pollutionIgeo levels. Distribution of SPM indicates the presence of the estuarine turbidity maximum (ETM) during all three seasons near the river mouth and a second ETM during the post monsoon time in the upstream associated with salinities gradient. The SPM during the monsoon is finer grained (avg. 53 μm), characterized by uniformly low normalized elemental concentration, whereas the post and pre monsoon are characterized by high normalized elemental concentration with coarser grain size (avg. 202 μm and 173 μm respectively) with highest ratios in the upstream estuary. The elemental composition and principal component analysis for the upstream estuary SPM support more contribution from the upstream catchment area rocks during the monsoon season; there is additional contribution from the downstream catchment area during the pre and post monsoon period due to the tidal effect. The Kali estuarine SPM has higher Al, Fe, Mn, Ti, Mg, Ni, Co, Ba, Li and V with respect to Average World River SPM (WRSPM). Igeo values for the SPM indicate Kali Estuary to be severely enriched with Mn and moderately enriched with Cu, Zn, Ni, Co, U and Mo in the upstream estuary during pre and post monsoon seasons. Seasonal changes in salinity gradient (reduced freshwater flow due to closing of the dam gates), reduced velocity at meandering region of the estuary and POC of 1.6-2.3% resulted in co-precipitation of trace elements that were further fortified by flocculation and coagulation throughout the water column resulting in metal trapping in the upstream region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018P%26SS..153...89E','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018P%26SS..153...89E"><span>Coronal mass ejection hits mercury: A.I.K.E.F. hybrid-code results compared to MESSENGER data</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Exner, W.; Heyner, D.; Liuzzo, L.; Motschmann, U.; Shiota, D.; Kusano, K.; Shibayama, T.</p> <p>2018-04-01</p> <p>Mercury is the closest orbiting planet around the sun and is therefore embedded in an intensive and highly varying solar wind. In-situ data from the MESSENGER spacecraft of the plasma environment near Mercury indicates that a coronal mass ejection (CME) passed the planet on 23 November 2011 over the span of the 12 h MESSENGER orbit. Slavin et al. (2014) derived the upstream parameters of the solar wind at the time of that orbit, and were able to explain the observed MESSENGER data in the cusp and magnetopause segments of MESSENGER's trajectory. These upstream parameters will be used for our first simulation run. We use the hybrid code A.I.K.E.F. which treats ions as individual particles and electrons as a mass-less fluid, to conduct hybrid simulations of Mercury's magnetospheric response to the impact of the CME on ion gyro time scales. Results from the simulation are in agreement with magnetic field measurements from the inner day-side magnetosphere and the bow-shock region. However, at the planet's nightside, Mercury's plasma environment seemed to be governed by different solar wind conditions, in conclusion, Mercury's interaction with the CME is not sufficiently describable by only one set of upstream parameters. Therefore, to simulate the magnetospheric response while MESSENGER was located in the tail region, we use parameters obtained from the MHD solar wind simulation code SUSANOO (Shiota et al. (2014)) for our second simulation run. The parameters of the SUSANOO model achieve a good agreement of the data concerning the plasma tail crossing and the night-side approach to Mercury. However, the polar and closest approach are hardly described by both upstream parameters, namely, neither upstream dataset is able to reproduce the MESSENGER crossing of Mercury's magnetospheric cusp. We conclude that the respective CME was too variable on the timescale of the MESSENGER orbit to be described by only two sets of upstream conditions. Our results suggest locally strong and highly variable dynamics of the CME on timescales of 15 min while MESSENGER was near closest approach.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li class="active"><span>18</span></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_18 --> <div id="page_19" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li class="active"><span>19</span></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="361"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013Chaos..23b3117P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013Chaos..23b3117P"><span>Natural time analysis of critical phenomena: The case of pre-fracture electromagnetic emissions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Potirakis, S. M.; Karadimitrakis, A.; Eftaxias, K.</p> <p>2013-06-01</p> <p>Criticality of complex systems reveals itself in various ways. One way to monitor a system at critical state is to analyze its observable manifestations using the recently introduced method of natural time. Pre-fracture electromagnetic (EM) emissions, in agreement to laboratory experiments, have been consistently detected in the MHz band prior to significant earthquakes. It has been proposed that these emissions stem from the fracture of the heterogeneous materials surrounding the strong entities (asperities) distributed along the fault, preventing the relative slipping. It has also been proposed that the fracture of heterogeneous material could be described in analogy to the critical phase transitions in statistical physics. In this work, the natural time analysis is for the first time applied to the pre-fracture MHz EM signals revealing their critical nature. Seismicity and pre-fracture EM emissions should be two sides of the same coin concerning the earthquake generation process. Therefore, we also examine the corresponding foreshock seismic activity, as another manifestation of the same complex system at critical state. We conclude that the foreshock seismicity data present criticality features as well.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19920030321&hterms=Automata&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3DAutomata','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19920030321&hterms=Automata&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D20%26Ntt%3DAutomata"><span>A scale-invariant cellular-automata model for distributed seismicity</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Barriere, Benoit; Turcotte, Donald L.</p> <p>1991-01-01</p> <p>In the standard cellular-automata model for a fault an element of stress is randomly added to a grid of boxes until a box has four elements, these are then redistributed to the adjacent boxes on the grid. The redistribution can result in one or more of these boxes having four or more elements in which case further redistributions are required. On the average added elements are lost from the edges of the grid. The model is modified so that the boxes have a scale-invariant distribution of sizes. The objective is to model a scale-invariant distribution of fault sizes. When a redistribution from a box occurs it is equivalent to a characteristic earthquake on the fault. A redistribution from a small box (a foreshock) can trigger an instability in a large box (the main shock). A redistribution from a large box always triggers many instabilities in the smaller boxes (aftershocks). The frequency-size statistics for both main shocks and aftershocks satisfy the Gutenberg-Richter relation with b = 0.835 for main shocks and b = 0.635 for aftershocks. Model foreshocks occur 28 percent of the time.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23822482','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23822482"><span>Natural time analysis of critical phenomena: the case of pre-fracture electromagnetic emissions.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Potirakis, S M; Karadimitrakis, A; Eftaxias, K</p> <p>2013-06-01</p> <p>Criticality of complex systems reveals itself in various ways. One way to monitor a system at critical state is to analyze its observable manifestations using the recently introduced method of natural time. Pre-fracture electromagnetic (EM) emissions, in agreement to laboratory experiments, have been consistently detected in the MHz band prior to significant earthquakes. It has been proposed that these emissions stem from the fracture of the heterogeneous materials surrounding the strong entities (asperities) distributed along the fault, preventing the relative slipping. It has also been proposed that the fracture of heterogeneous material could be described in analogy to the critical phase transitions in statistical physics. In this work, the natural time analysis is for the first time applied to the pre-fracture MHz EM signals revealing their critical nature. Seismicity and pre-fracture EM emissions should be two sides of the same coin concerning the earthquake generation process. Therefore, we also examine the corresponding foreshock seismic activity, as another manifestation of the same complex system at critical state. We conclude that the foreshock seismicity data present criticality features as well.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70192465','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70192465"><span>Wastewater disposal and the earthquake sequences during 2016 near Fairview, Pawnee, and Cushing, Oklahoma</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>McGarr, Arthur F.; Barbour, Andrew</p> <p>2017-01-01</p> <p>Each of the three earthquake sequences in Oklahoma in 2016—Fairview, Pawnee, and Cushing—appears to have been induced by high-volume wastewater disposal within 10 km. The Fairview M5.1 main shock was part of a 2 year sequence of more than 150 events of M3, or greater; the main shock accounted for about half of the total moment. The foreshocks and aftershocks of the M5.8 Pawnee earthquake were too small and too few to contribute significantly to the cumulative moment; instead, nearly all of the moment induced by wastewater injection was focused on the main shock. The M5.0 Cushing event is part of a sequence that includes 48 earthquakes of M3, or greater, that are mostly foreshocks. The cumulative moment for each of the three sequences during 2016, as well as that for the 2011 Prague, Oklahoma, and nine other sequences representing a broad range of injected volume, are all limited by the total volumes of wastewater injected locally.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3347164','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3347164"><span>Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Nafissi, Maryam; Chau, Jeannette; Xu, Jimin</p> <p>2012-01-01</p> <p>Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19940023299','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19940023299"><span>Flowfield dynamics in blunt fin-induced shock wave/turbulent boundary layer interactions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Dolling, David S.; Brusniak, Leon</p> <p>1994-01-01</p> <p>Fluctuating wall pressure measurements have been made on centerline upstream of a blunt fin in a Mach 5 turbulent boundary layer. By examining the ensemble averaged wall pressure distributions for different separation shock foot positions, it has been shown that local fluctuating wall pressure measurements are due to a distinct pressure distribution, Rho(sub i), which undergoes a stretching and flattening effect as its upstream boundary translates aperiodically between the upstream influence and separation lines. The locations of the maxima and minima in the wall pressure standard deviation can be accurately predicted using this distribution, providing quantitative confirmation of the model. This model also explains the observed cross-correlations and ensemble average measurements within the interaction. Using the Rho(sub i) model, wall pressure signals from under the separated flow region were used to reproduce the position-time history of the separation shock foot. Further, the negative time delay peak in the cross-correlation between the predicted and actual shock foot histories suggests that the separated region fluctuations precede shock foot motion. The unsteady behavior of the primary horseshoe vortex and its relation to the unsteady separation shock are described.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70043579','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70043579"><span>A barrier to upstream migration in the fish passage of Itaipu Dam (Canal da Piracema), Paraná River basin</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>,; Fontes Júnior, Hélio Martins; Makrakis, Sergio; Gomes, Luiz Carlos; Latini, João Dirço</p> <p>2012-01-01</p> <p>The majority of the fish passages built in the Neotropical region are characterised by low efficiency and high selectivity; in many cases, the benefits to fish populations are uncertain. Studies conducted in the Canal da Piracema at Itaipu dam on the Parana River indicate that the system component designated as the Discharge channel in the Bela Vista River (herein named Canal de deságue no rio Bela Vista or CABV), a 200 m long technical section, was the main barrier to the upstream migration. The aim of this study was to evaluate the degree of restriction imposed by the CABV on upstream movements of Prochilodus lineatus and Leporinus elongatus, Characiformes. Fish were tagged with passive integrated transponders (PIT tags) and released both downstream and upstream of this critical section. Individuals of both species released downstream of the CABV took much more time to reach the upper end of the system (43.6 days vs. 15.9 days), and passed in much lower proportions (18% vs. 60.8%) than those tagged upstream of this component. Although more work is needed to differentiate between fishway effects and natural variation in migratory motivation, the results clearly demonstrate passage problems at the CABV.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EP%26S...69....7K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EP%26S...69....7K"><span>Earthquake rupture properties of the 2016 Kumamoto earthquake foreshocks ( M j 6.5 and M j 6.4) revealed by conventional and multiple-aperture InSAR</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Kobayashi, Tomokazu</p> <p>2017-01-01</p> <p>By applying conventional cross-track InSAR and multiple-aperture InSAR (MAI) techniques with ALOS-2 SAR data to foreshocks of the 2016 Kumamoto earthquake, ground displacement fields in range (line-of-sight) and azimuth components have been successfully mapped. The most concentrated crustal deformation with ground displacement exceeding 15 cm is located on the western side of the Hinagu fault zone. A locally distributed displacement which appears along the strike of the Futagawa fault can be identified in and around Mashiki town, suggesting that a different local fault slip also contributed toward foreshocks. Inverting InSAR, MAI, and GNSS data, distributed slip models are obtained that show almost pure right-lateral fault motion on a plane dipping west by 80° for the Hinagu fault and almost pure normal fault motion on a plane dipping south by 70° for the local fault beneath Mashiki town. The slip on the Hinagu fault reaches around the junction of the Hinagu and Futagawa faults. The slip in the north significantly extends down to around 10 km depth, while in the south the slip is concentrated near the ground surface, perhaps corresponding to the M j 6.5 and the M j 6.4 events, respectively. The focal mechanism of the distributed slip model for the Hinagu fault alone shows pure right-lateral motion, which is inconsistent with the seismically estimated mechanism that includes a significant non-double couple component. On the other hand, when taking the contribution of normal fault motion into account, the focal mechanism appears similar to that of the seismic analysis. This result may suggest that local fault motion occurred just beneath Mashiki town, simultaneously with the M j 6.5 event, thereby increasing the degree of damage to the town.[Figure not available: see fulltext.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015EGUGA..1712398P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015EGUGA..1712398P"><span>ULF foreshock under radial IMF: THEMIS observations and global kinetic simulation Vlasiator results compared</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Palmroth, Minna; Rami, Vainio; Archer, Martin; Hietala, Heli; Afanasiev, Alexandr; Kempf, Yann; Hoilijoki, Sanni; von Alfthan, Sebastian</p> <p>2015-04-01</p> <p>For decades, a certain type of ultra low frequency waves with a period of about 30 seconds have been observed in the Earth's quasi-parallel foreshock. These waves, with a wavelength of about an Earth radius, are compressive and propagate with an average angle of 20 degrees with respect of the interplanetary magnetic field (IMF). The latter property has caused trouble to scientists as the growth rate for the instability causing the waves is maximized along the magnetic field. So far, these waves have been characterized by single or multi-spacecraft methods and 2-dimensional hybrid-PIC simulations, which have not fully reproduced the wave properties. Vlasiator is a newly developed, global hybrid-Vlasov simulation, which solves the six-dimensional phase space utilising the Vlasov equation for protons, while electrons are a charge-neutralising fluid. The outcome of the simulation is a global reproduction of ion-scale physics in a holistic manner where the generation of physical features can be followed in time and their consequences can be quantitatively characterised. Vlasiator produces the ion distribution functions and the related kinetic physics in unprecedented detail, in the global scale magnetospheric scale with a resolution of a couple of hundred kilometres in the ordinary space and 20 km/s in the velocity space. We run Vlasiator under a radial IMF in five dimensions consisting of the three-dimensional velocity space embedded in the ecliptic plane. We observe the generation of the 30-second ULF waves, and characterize their evolution and physical properties in time. We compare the results both to THEMIS observations and to the quasi-linear theory. We find that Vlasiator reproduces the foreshock ULF waves in all reported observational aspects, i.e., they are of the observed size in wavelength and period, they are compressive and propagate obliquely to the IMF. In particular, we discuss the issues related to the long-standing question of oblique propagation.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017Icar..287..131H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017Icar..287..131H"><span>Pluto-Charon solar wind interaction dynamics</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Hale, J. P. M.; Paty, C. S.</p> <p>2017-05-01</p> <p>This work studies Charon's effects on the Pluto-solar wind interaction using a multifluid MHD model which simulates the interactions of Pluto and Charon with the solar wind as well as with each other. Specifically, it investigates the ionospheric dynamics of a two body system in which either one or both bodies possess an ionosphere. Configurations in which Charon is directly upstream and directly downstream of Pluto are considered. Depending on ionospheric and solar wind conditions, Charon could periodically pass into the solar wind flow upstream of Pluto. The results of this study demonstrate that in these circumstances Charon modifies the upstream flow, both in the case in which Charon possesses an ionosphere, and in the case in which Charon is without an ionosphere. This modification amounts to a change in the gross structure of the interaction region when Charon possesses an ionosphere but is more localized when Charon lacks an ionosphere. Furthermore, evidence is shown that supports Charon acting to partially shield Pluto from the solar wind when it is upstream of Pluto, resulting in a decrease in ionospheric loss by Pluto.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3560312','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3560312"><span>Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin</p> <p>2012-01-01</p> <p>Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5655738','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5655738"><span>Consumption‐Based Conservation Targeting: Linking Biodiversity Loss to Upstream Demand through a Global Wildlife Footprint</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Berlow, Eric; Conlisk, Erin; Erb, Karlheinz; Iha, Katsunori; Martinez, Neo; Newman, Erica A.; Plutzar, Christoph; Smith, Adam B.; Harte, John</p> <p>2016-01-01</p> <p>Abstract Although most conservation efforts address the direct, local causes of biodiversity loss, effective long‐term conservation will require complementary efforts to reduce the upstream economic pressures, such as demands for food and forest products, which ultimately drive these downstream losses. Here, we present a wildlife footprint analysis that links global losses of wild birds to consumer purchases across 57 economic sectors in 129 regions. The United States, India, China, and Brazil have the largest regional wildlife footprints, while per‐person footprints are highest in Mongolia, Australia, Botswana, and the United Arab Emirates. A US$100 purchase of bovine meat or rice products occupies approximately 0.1 km2 of wild bird ranges, displacing 1–2 individual birds, for 1 year. Globally significant importer regions, including Japan, the United Kingdom, Germany, Italy, and France, have large footprints that drive wildlife losses elsewhere in the world and represent important targets for consumption‐focused conservation attention. PMID:29104616</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19920027404&hterms=distribution+Fermi-dirac&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Ddistribution%2BFermi-dirac','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19920027404&hterms=distribution+Fermi-dirac&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D30%26Ntt%3Ddistribution%2BFermi-dirac"><span>Ion pickup, scattering, and stochastic acceleration in the cometary environment of P/Giacobini-Zinner</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Barbosa, D. D.</p> <p>1991-01-01</p> <p>Observations and theory related to the scattering and acceleration of cometary pickup ions are reviewed with emphasis on Comet P/Giacobini-Zinner. A comparison of the regions upstream and downstream of the bow shock is made to assess the relative merits of each as a site for stochastic acceleration of ions above the pickup energy through interaction with low-frequency MHD waves. In the far upstream region the data are most consistent with a model where pickup ions generate a low level of MHD waves but remain relatively scatter-free. In the downstream region intense magnetic fluctuations gives rise to rapid isotropization of the ions and a second-order stochastic acceleration. The properties of the MHD power spectrum are related to the energetic ion spectrum in the framework of a leaky box model where the bulk of the acceleration occurs downstream of the shock throughout the cometosheath. Good agreement of the observations with theory is evident for both P/Giacobini-Zinner and P/Halley.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018GeoRL..45.2706D','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018GeoRL..45.2706D"><span>Basal Settings Control Fast Ice Flow in the Recovery/Slessor/Bailey Region, East Antarctica</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Diez, Anja; Matsuoka, Kenichi; Ferraccioli, Fausto; Jordan, Tom A.; Corr, Hugh F.; Kohler, Jack; Olesen, Arne V.; Forsberg, René</p> <p>2018-03-01</p> <p>The region of Recovery Glacier, Slessor Glacier, and Bailey Ice Stream, East Antarctica, has remained poorly explored, despite representing the largest potential contributor to future global sea level rise on a centennial to millennial time scale. Here we use new airborne radar data to improve knowledge about the bed topography and investigate controls of fast ice flow. Recovery Glacier is underlain by an 800 km long trough. Its fast flow is controlled by subglacial water in its upstream and topography in its downstream region. Fast flow of Slessor Glacier is controlled by the presence of subglacial water on a rough crystalline bed. Past ice flow of adjacent Recovery and Slessor Glaciers was likely connected via the newly discovered Recovery-Slessor Gate. Changes in direction and speed of past fast flow likely occurred for upstream parts of Recovery Glacier and between Slessor Glacier and Bailey Ice Stream. Similar changes could also reoccur here in the future.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20020070662','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20020070662"><span>Characterizing the Severe Turbulence Environments Associated With Commercial Aviation Accidents. Part 1; 44 Case Study Synoptic Observational Analyses</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Kaplan, Michael L.; Huffman, Allan W.; Lux, Kevin M.; Charney, Joseph J.; Riordan, Allan J.; Lin, Yuh-Lang; Proctor, Fred H. (Technical Monitor)</p> <p>2002-01-01</p> <p>A 44 case study analysis of the large-scale atmospheric structure associated with development of accident-producing aircraft turbulence is described. Categorization is a function of the accident location, altitude, time of year, time of day, and the turbulence category, which classifies disturbances. National Centers for Environmental Prediction Reanalyses data sets and satellite imagery are employed to diagnose synoptic scale predictor fields associated with the large-scale environment preceding severe turbulence. These analyses indicate a predominance of severe accident-producing turbulence within the entrance region of a jet stream at the synoptic scale. Typically, a flow curvature region is just upstream within the jet entrance region, convection is within 100 km of the accident, vertical motion is upward, absolute vorticity is low, vertical wind shear is increasing, and horizontal cold advection is substantial. The most consistent predictor is upstream flow curvature and nearby convection is the second most frequent predictor.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2211499','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2211499"><span>Localization of TFIIB binding regions using serial analysis of chromatin occupancy</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon</p> <p>2007-01-01</p> <p>Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017Geomo.293..211P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017Geomo.293..211P"><span>The fluvial sediment budget of a dammed river (upper Muga, southern Pyrenees)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Piqué, G.; Batalla, R. J.; López, R.; Sabater, S.</p> <p>2017-09-01</p> <p>Many rivers in the Mediterranean region are regulated for urban and agricultural purposes. Reservoir presence and operation results in flow alteration and sediment discontinuity, altering the longitudinal structure of the fluvial system. This study presents a 3-year sediment budget of a highly dammed Mediterranean river (the Muga, southern Pyrenees), which has experienced flow regulation since the 1969 owing to a 61-hm3 reservoir. Flow discharge and suspended sediment concentration were monitored immediately upstream and downstream from the reservoir, whereas bedload transport was estimated by means of bedload formulae and estimated from regional data. Results show how the dam modifies river flow, reducing the magnitude of floods and shortening its duration. At the same time, duration of low flows increases. The downstream flow regime follows reservoir releases that are mostly driven by the irrigation needs in the lowlands. Likewise, suspended sediment and bedload transport are shown to be notably affected by the dam. Sediment transport upstream was mainly associated with floods and was therefore concentrated in short periods of time (i.e., > 90% of the sediment load occurred in < 1% of the time). Downstream from the dam, sediments were transported more constantly (i.e., 90% of the load was carried during 50% of the time). Total sediment load upstream from the dam equalled 23,074 t, while downstream it was < 1000 t. Upstream, sediment load was equally distributed between suspension and bedload (i.e., 10,278 and 12,796 t respectively), whereas suspension dominated sediment transport downstream. More than 95% of the sediments transported from the upstream basins were trapped in the reservoir, a fact that explains the sediment deficit and the river bed armouring observed downstream. Overall, the dam disrupted the natural water and sediment fluxes, generating a highly modified environment downstream. Below the dam, the whole ecosystem shifted to stable conditions owing to the reduction of water and sediment loads.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70065876','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70065876"><span>Geographic variability in elevation and topographic constraints on the distribution of native and nonnative trout in the Great Basin</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Warren, Dana R.; Dunham, Jason B.; Hockman-Wert, David</p> <p>2014-01-01</p> <p>Understanding local and geographic factors influencing species distributions is a prerequisite for conservation planning. Our objective in this study was to model local and geographic variability in elevations occupied by native and nonnative trout in the northwestern Great Basin, USA. To this end, we analyzed a large existing data set of trout presence (5,156 observations) to evaluate two fundamental factors influencing occupied elevations: climate-related gradients in geography and local constraints imposed by topography. We applied quantile regression to model upstream and downstream distribution elevation limits for each trout species commonly found in the region (two native and two nonnative species). With these models in hand, we simulated an upstream shift in elevation limits of trout distributions to evaluate potential consequences of habitat loss. Downstream elevation limits were inversely associated with latitude, reflecting regional gradients in temperature. Upstream limits were positively related to maximum stream elevation as expected. Downstream elevation limits were constrained topographically by valley bottom elevations in northern streams but not in southern streams, where limits began well above valley bottoms. Elevation limits were similar among species. Upstream shifts in elevation limits for trout would lead to more habitat loss in the north than in the south, a result attributable to differences in topography. Because downstream distributions of trout in the north extend into valley bottoms with reduced topographic relief, trout in more northerly latitudes are more likely to experience habitat loss associated with an upstream shift in lower elevation limits. By applying quantile regression to relatively simple information (species presence, elevation, geography, topography), we were able to identify elevation limits for trout in the Great Basin and explore the effects of potential shifts in these limits that could occur in response to changing climate conditions that alter streams directly (e.g., through changes in temperature and precipitation) or indirectly (e.g., through changing water use).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2010AGUFM.S53C1989T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2010AGUFM.S53C1989T"><span>Modeling Events in the Lower Imperial Valley Basin</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tian, X.; Wei, S.; Zhan, Z.; Fielding, E. J.; Helmberger, D. V.</p> <p>2010-12-01</p> <p>The Imperial Valley below the US-Mexican border has few seismic stations but many significant earthquakes. Many of these events, such as the recent El Mayor-Cucapah event, have complex mechanisms involving a mixture of strike-slip and normal slip patterns with now over 30 aftershocks with magnitude over 4.5. Unfortunately, many earthquake records from the Southern Imperial Valley display a great deal of complexity, ie., strong Rayleigh wave multipathing and extended codas. In short, regional recordings in the US are too complex to easily separate source properties from complex propagation. Fortunately, the Dec 30 foreshock (Mw=5.9) has excellent recordings teleseismically and regionally, and moreover is observed with InSAR. We use this simple strike-slip event to calibrate paths. In particular, we are finding record segments involving Pnl (including depth phases) and some surface waves (mostly Love waves) that appear well behaved, ie., can be approximated by synthetics from 1D local models and events modeled with the Cut-and-Paste (CAP) routine. Simple events can then be identified along with path calibration. Modeling the more complicated paths can be started with known mechanisms. We will report on both the aftershocks and historic events.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/20000571-formation-burnout-region-partially-premixed-methane-air-flame-upstream-heat-loss','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/20000571-formation-burnout-region-partially-premixed-methane-air-flame-upstream-heat-loss"><span>NO formation in the burnout region of a partially premixed methane-air flame with upstream heat loss</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Mokhov, A.V.; Levinsky, H.B.</p> <p></p> <p>Measurements of temperature and NO concentration in laminar, partially premixed methane-air flames stabilized on a ceramic burner in coflow are reported. The NO concentration and temperature were determined by laser-induced fluorescence (LIF) and coherent anti-Stokes Raman scattering (CARS), respectively. Upstream heat loss to the burner was varied by changing the exit velocity of the fuel-air mixture at a constant equivalence ratio of 1,3; this alters the structure of the flame from an axisymmetric Bunsen-type to a strongly stabilized flat flame. To facilitate analysis of the results, a method is derived for separating the effects of dilution from those of chemicalmore » reaction based on the relation between the measured temperature and the local mixture fraction, including the effects of upstream heat loss. Using this method, the amount of NO formed during burnout of the hot, fuel-rich combustion products can be ascertained. In the Bunsen-type flame, it is seen that {approximately}40 ppm of NO are produced in this burnout region, at temperatures between {approximately}2,100 K and {approximately}1,900 K, probably via the Zeldovich mechanism. Reducing the exit velocity of 12 cm/s reduces the flame temperature substantially, and effectively eliminates this contribution. At velocities of 12 and 8 cm/s, {approximately}10 ppm of NO are formed in the burnout region, even though the gas temperatures are too low for Zeldovich NO to be significant. Although the mechanism responsible for these observations is as yet unclear, the results are consistent with the idea that the low temperatures in the fuel-rich gases caused by upstream heat loss retard the conversion of HCN (formed via the Fenimore mechanism) to NO, with this residual HCN then being converted to NO during burnout.« less</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li class="active"><span>19</span></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_19 --> <div id="page_20" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li class="active"><span>20</span></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="381"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3575287','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3575287"><span>Regulatory elements of Caenorhabditis elegans ribosomal protein genes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p></p> <p>2012-01-01</p> <p>Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29212449','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29212449"><span>Maternal variant in the upstream of FOXP3 gene on the X chromosome is associated with recurrent infertility in Japanese Black cattle.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Arishima, Taichi; Sasaki, Shinji; Isobe, Tomohiro; Ikebata, Yoshihisa; Shimbara, Shinichi; Ikeda, Shogo; Kawashima, Keisuke; Suzuki, Yutaka; Watanabe, Manabu; Sugano, Sumio; Mizoshita, Kazunori; Sugimoto, Yoshikazu</p> <p>2017-12-06</p> <p>Repeat breeding, which is defined as cattle failure to conceive after three or more inseminations in the absence of clinical abnormalities, is a substantial problem in cattle breeding. To identify maternal genetic variants of repeat breeding in Japanese Black cattle, we selected 29 repeat-breeding heifers that failed to conceive following embryo transfer (ET) and conducted a genome-wide association study (GWAS) using the traits. We found that a single-nucleotide polymorphism (SNP; g.92,377,635A > G) in the upstream region of the FOXP3 gene on the X chromosome was highly associated with repeat breeding and failure to conceive following ET (P = 1.51 × 10 -14 ). FOXP3 is a master gene for differentiation of regulatory T (T reg ) cells that function in pregnancy maintenance. Reporter assay results revealed that the activity of the FOXP3 promoter was lower in reporter constructs with the risk-allele than in those with the non-risk-allele by approximately 0.68 fold. These findings suggest that the variant in the upstream region of FOXP3 with the risk-allele decreased FOXP3 transcription, which in turn, could reduce the number of maternal T reg cells and lead to infertility. The frequency of the risk-allele in repeat-breeding heifers is more than that in cows, suggesting that the risk-allele could be associated with infertility in repeat-breeding heifers. This GWAS identified a maternal variant in the upstream region of FOXP3 that was associated with infertility in repeat-breeding Japanese Black cattle that failed to conceive using ET. The variant affected the level of FOXP3 mRNA expression. Thus, the results suggest that the risk-allele could serve as a useful marker to reduce and eliminate animals with inferior fertility in Japanese Black cattle.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014EGUGA..16.7716D','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014EGUGA..16.7716D"><span>Assessment of sediment yield in a sloping Mediterranean watershed in Cyprus</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Djuma, Hakan; Bruggeman, Adriana; Camera, Corrado</p> <p>2014-05-01</p> <p>In the Mediterranean region, water catchment sediment yield as a result of erosion is higher than in many other regions in Europe due to the climatic conditions, topography, lithology and land-use. Modelling sediment transport is difficult due to intermittent stream flow and highly irregular rainfall conditions in this region. The objective of this study is to quantify sediment yield of a highly sloping Mediterranean environment. This study is conducted in the Peristerona Watershed in Cyprus, which has ephemeral water flow. In the downstream area a series of check dams have been placed across the stream to slow the flow and increase groundwater recharge. The surface area of the watershed, upstream of the check dams, is 103 km2 with elevation changing between 1540 m and 280 m and a mean local slope higher than 40% for the mountainous part and lower than 8% for the plain. The long-term average annual precipitation ranges from 755 mm in the upstream area to 276 mm in the plain. The surface extent of the sediment that was deposited at the most upstream check dam during two seasons was measured with a Differential Global Positioning System. The depth of the sediment was measured with utility poles and bulk density samples from the sediment profile were collected. The sediment had a surface area of 12600 m2 and an average depth of 0.23 m. The mean of the sediment dry bulk density samples was 1.05 t m-3 with a standard deviation of 0.11. Based on these values, area specific sediment yield was computed as 1 t ha-1 per year for the entire catchment area upstream of the check dam, assuming a check dam sediment trap efficiency of 15%. Erosion in the watershed is currently modeled with PESERA using detailed watershed data.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19850011513','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19850011513"><span>Research study of space plasma boundary processes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Greenstadt, E. W.; Taylor, W. W. L.</p> <p>1984-01-01</p> <p>Representation of the Earth's bow shock and magnetopause and their geometrically determined macrostructure was investigated. Computer graphic depictions of the global distributions of bow shock structures and elementary animation of the dynamics of those distributions in the changing solar wind were developed. The shock-foreshock boundary and subcritical bow shocks as observed by ISEE 1 and 2 are discussed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015AGUFMSM31C2534H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015AGUFMSM31C2534H"><span>Fine Spectral Properties of Langmuir Waves Observed Upstream of the Saturn's Bowshock by the Cassini Wideband Receiver</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Hospodarsky, G. B.; Pisa, D.; Santolik, O.; Kurth, W. S.; Soucek, J.; Basovnik, M.; Gurnett, D. A.; Arridge, C. S.</p> <p>2015-12-01</p> <p>Langmuir waves are commonly observed in the upstream regions of planetary and interplanetary shock. Solar wind electrons accelerated at the shock front are reflected back into the solar wind and can form electron beams. In regions with beams, the electron distribution becomes unstable and electrostatic waves can be generated. The process of generation and the evolution of electrostatic waves strongly depends on the solar wind electron distribution and generally exhibits complex behavior. Langmuir waves can be identified as intense narrowband emission at a frequency very close to the local plasma frequency and weaker broadband waves below and above the plasma frequency deeper in the downstream region. We present a detailed study of Langmuir waves detected upstream of the Saturnian bowshock by the Cassini spacecraft. Using data from the Radio and Plasma Wave Science (RPWS), Magnetometer (MAG) and Cassini Plasma Spectrometer (CAPS) instruments we have analyzed several periods containing the extended waveform captures by the Wideband Receiver. Langmuir waves are a bursty emission highly controlled by variations in solar wind conditions. Unfortunately due to a combination of instrumental field of view and sampling period, it is often difficult to identify the electron distribution function that is unstable and able to generate Langmuir waves. We used an electrostatic version of particle-in-cell simulation of the Langmuir wave generation process to reproduce some of the more subtle observed spectral features and help understand the late stages of the instability and interactions in the solar wind plasma.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/18806471','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/18806471"><span>Analysis of C. elegans VIG-1 expression.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong</p> <p>2008-12-31</p> <p>Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24311385','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24311385"><span>Compound heterozygous deletions in pseudoautosomal region 1 in an infant with mild manifestations of langer mesomelic dysplasia.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Tsuchiya, Takayoshi; Shibata, Minoru; Numabe, Hironao; Jinno, Tomoko; Nakabayashi, Kazuhiko; Nishimura, Gen; Nagai, Toshiro; Ogata, Tsutomu; Fukami, Maki</p> <p>2014-02-01</p> <p>Haploinsufficiency of SHOX on the short arm pseudoautosomal region (PAR1) leads to Leri-Weill dyschondrosteosis (LWD), and nullizygosity of SHOX results in Langer mesomelic dysplasia (LMD). Molecular defects of LWD/LMD include various microdeletions in PAR1 that involve exons and/or the putative upstream or downstream enhancer regions of SHOX, as well as several intragenic mutations. Here, we report on a Japanese male infant with mild manifestations of LMD and hitherto unreported microdeletions in PAR1. Clinical analysis revealed mesomelic short stature with various radiological findings indicative of LMD. Molecular analyses identified compound heterozygous deletions, that is, a maternally inherited ∼46 kb deletion involving the upstream region and exons 1-5 of SHOX, and a paternally inherited ∼500 kb deletion started from a position ∼300 kb downstream from SHOX. In silico analysis revealed that the downstream deletion did not affect the known putative enhancer regions of SHOX, although it encompassed several non-coding elements which were well conserved among various species with SHOX orthologs. These results provide the possibility of the presence of a novel enhancer for SHOX in the genomic region ∼300 to ∼800 kb downstream of the start codon. © 2013 Wiley Periodicals, Inc.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.usgs.gov/sir/2007/5288/','USGSPUBS'); return false;" href="https://pubs.usgs.gov/sir/2007/5288/"><span>Salinity Trends in the Upper Colorado River Basin Upstream From the Grand Valley Salinity Control Unit, Colorado, 1986-2003</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Leib, Kenneth J.; Bauch, Nancy J.</p> <p>2008-01-01</p> <p>In 1974, the Colorado River Basin Salinity Control Act was passed into law. This law was enacted to address concerns regarding the salinity content of the Colorado River. The law authorized various construction projects in selected areas or 'units' of the Colorado River Basin intended to reduce the salinity load in the Colorado River. One such area was the Grand Valley Salinity Control Unit in western Colorado. The U. S. Geological Survey has done extensive studies and research in the Grand Valley Salinity Control Unit that provide information to aid the U.S. Bureau of Reclamation and the Natural Resources Conservation Service in determining where salinity-control work may provide the best results, and to what extent salinity-control work was effective in reducing salinity concentrations and loads in the Colorado River. Previous studies have indicated that salinity concentrations and loads have been decreasing downstream from the Grand Valley Salinity Control Unit, and that the decreases are likely the result of salinity control work in these areas. Several of these reports; however, also document decreasing salinity loads upstream from the Grand Valley Salinity Control Unit. This finding was important because only a small amount of salinity-control work was being done in areas upstream from the Grand Valley Salinity Control Unit at the time the findings were reported (late 1990?s). As a result of those previous findings, the U.S. Bureau of Reclamation entered into a cooperative agreement with the U.S. Geological Survey to investigate salinity trends in selected areas bracketing the Grand Valley Salinity Control Unit and regions upstream from the Grand Valley Salinity Control Unit. The results of the study indicate that salinity loads were decreasing upstream from the Grand Valley Salinity Control Unit from 1986 through 2003, but the rates of decrease have slowed during the last 10 years. The average rate of decrease in salinity load upstream from the Grand Valley Salinity Control Unit was 10,700 tons/year. This accounts for approximately 27 percent of the decrease observed downstream from the Grand Valley Salinity Control Unit. Salinity loads were decreasing at the fastest rate (6,950 tons/year) in Region 4, which drains an area between the Colorado River at Cameo, Colorado (station CAMEO) and Colorado River above Glenwood Springs, Colorado (station GLEN) streamflow-gaging stations. Trends in salinity concentration and streamflow were tested at station CAMEO to determine if salinity concentration, streamflow, or both are controlling salinity loads upstream from the Grand Valley Salinity Control Unit. Trend tests of individual ion concentrations were included as potential indicators of what sources (based on mineral composition) may be controlling trends in the upper Colorado. No significant trend was detected for streamflow from 1986 to 2003 at station CAMEO; however, a significant downward trend was detected for salinity concentration. The trend slope indicates that salinity concentration is decreasing at a median rate of about 3.54 milligrams per liter per year. Five major ions (calcium, magnesium, sodium, sulfate, and chloride) were tested for trends. The results indicate that processes within source areas with rock and soil types (or other unidentified sources) bearing calcium, sodium, and sulfate had the largest effect on the downward trend in salinity load upstream from station CAMEO. Downward trends in salinity load resulting from ground-water sources and/or land-use change were thought to be possible reasons for the observed decreases in salinity loads; however, the cause or causes of the decreasing salinity loads are not fully understood. A reduction in the amount of ground-water percolation from Region 4 (resulting from work done through Federal irrigation system improvement programs as well as privately funded irrigation system improvements) has helped reduce annual salinity load from Region 4 by approxima</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015PIAHS.370...45A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015PIAHS.370...45A"><span>Upstream structural management measures for an urban area flooding in Turkey</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Akyurek, Z.; Bozoğlu, B.; Sürer, S.; Mumcu, H.</p> <p>2015-06-01</p> <p>In recent years, flooding has become an increasing concern across many parts of the world of both the general public and their governments. The climate change inducing more intense rainfall events occurring in short period of time lead flooding in rural and urban areas. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is performed. MIKE21 with flexible grid is used in 2-dimensional shallow water flow modelling. 1 × 1000-1 scaled maps with the buildings for the urbanized area and 1 × 5000-1 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of 500 m3 s-1 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The upstream structural base precautions against flooding are modelled. The effect of four main upstream catchments on the flooding in the downstream urban area are modelled as different scenarios. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in one of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=65615','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=65615"><span>B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Selinger, David A.; Chandler, Vicki L.</p> <p>2001-01-01</p> <p>The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/pages/biblio/1354798-cis-regulatory-module-activating-transcription-suspensor-contains-five-cis-regulatory-elements','SCIGOV-DOEP'); return false;" href="https://www.osti.gov/pages/biblio/1354798-cis-regulatory-module-activating-transcription-suspensor-contains-five-cis-regulatory-elements"><span>A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/pages">DOE PAGES</a></p> <p>Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.</p> <p>2015-03-22</p> <p>Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1354798','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1354798"><span>A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.</p> <p></p> <p>Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017MMTB...48.3388G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017MMTB...48.3388G"><span>Effect of Temperature and Fluid Flow on Dendrite Growth During Solidification of Al-3 Wt Pct Cu Alloy by the Two-Dimensional Cellular Automaton Method</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Gu, Cheng; Wei, Yanhong; Liu, Renpei; Yu, Fengyi</p> <p>2017-12-01</p> <p>A two-dimensional cellular automaton-finite volume model was developed to simulate dendrite growth of Al-3 wt pct Cu alloy during solidification to investigate the effect of temperature and fluid flow on dendrite morphology, solute concentration distribution, and dendrite growth velocity. Different calculation conditions that may influence the results of the simulation, including temperature and flow, were considered. The model was also employed to study the effect of different undercoolings, applied temperature fields, and forced flow velocities on solute segregation and dendrite growth. The initial temperature and fluid flow have a significant impact on the dendrite morphologies and solute profiles during solidification. The release of energy is operated with solidification and results in the increase of temperature. A larger undercooling leads to larger solute concentration near the solid/liquid interface and solute concentration gradient at the same time-step. Solute concentration in the solid region tends to increase with the increase of undercooling. Four vortexes appear under the condition when natural flow exists: the two on the right of the dendrite rotate clockwise, and those on the left of the dendrite rotate counterclockwise. With the increase of forced flow velocity, the rejected solute in the upstream region becomes easier to be washed away and enriched in the downstream region, resulting in acceleration of the growth of the dendrite in the upstream and inhibiting the downstream dendrite growth. The dendrite perpendicular to fluid flow shows a coarser morphology in the upstream region than that of the downstream. Almost no secondary dendrite appears during the calculation process.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25796517','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25796517"><span>A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B</p> <p>2015-06-01</p> <p>Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/8891345','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/8891345"><span>Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A</p> <p>1996-10-01</p> <p>Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70148134','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70148134"><span>Identification of American shad spawning sites and habitat use in the Pee Dee River, North Carolina and South Carolina</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Harris, Julianne E.; Hightower, Joseph E.</p> <p>2011-01-01</p> <p>We examined spawning site selection and habitat use by American shad Alosa sapidissima in the Pee Dee River, North Carolina and South Carolina, to inform future management in this flow-regulated river. American shad eggs were collected in plankton tows, and the origin (spawning site) of each egg was estimated; relocations of radio-tagged adults on spawning grounds illustrated habitat use and movement in relation to changes in water discharge rates. Most spawning was estimated to occur in the Piedmont physiographic region within a 25-river-kilometer (rkm) section just below the lowermost dam in the system; however, some spawning also occurred downstream in the Coastal Plain. The Piedmont region has a higher gradient and is predicted to have slightly higher current velocities and shallower depths, on average, than the Coastal Plain. The Piedmont region is dominated by large substrates (e.g., boulders and gravel), whereas the Coastal Plain is dominated by sand. Sampling at night (the primary spawning period) resulted in the collection of young eggs (≤1.5 h old) that more precisely identified the spawning sites. In the Piedmont region, most radio-tagged American shad remained in discrete areas (average linear range = 3.6 rkm) during the spawning season and generally occupied water velocities between 0.20 and 0.69 m/s, depths between 1.0 and 2.9 m, and substrates dominated by boulder or bedrock and gravel. Tagged adults made only small-scale movements with changes in water discharge rates. Our results demonstrate that the upstream extent of migration and an area of concentrated spawning occur just below the lowermost dam. If upstream areas have similar habitat, facilitating upstream access for American shad could increase the spawning habitat available and increase the population's size.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19880012663','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19880012663"><span>Modifications to the Langley 8-foot transonic pressure tunnel for the laminar flow control experiment</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Harris, Charles D.; Brooks, Cuyler W., Jr.</p> <p>1988-01-01</p> <p>Modifications to the NASA Langley 8 Foot Transonic Pressure Tunnel in support of the Lamina Flow Control (LFC) Experiment included the installation of a honeymoon and five screens in the settling chamber upstream of the test section 41-long test section liner that extended from the upstream end of the test section contraction region, through the best section, and into the diffuser. The honeycomb and screens were installed as permanent additions to the facility, and the liner was a temporary addition to be removed at the conclusion of the LFC Experiment. These modifications are briefly described.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015SPIE.9662E..1LP','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015SPIE.9662E..1LP"><span>Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew</p> <p>2015-09-01</p> <p>An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19770003411','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19770003411"><span>Application of finite element approach to transonic flow problems</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Hafez, M. M.; Murman, E. M.; Wellford, L. C., Jr.</p> <p>1976-01-01</p> <p>A variational finite element model for transonic small disturbance calculations is described. Different strategy is adopted in subsonic and supersonic regions, and blending elements are introduced between different regions. In the supersonic region, no upstream effect is allowed. If rectangular elements with linear shape functions are used, the model is similar to Murman's finite difference operators. Higher order shape functions, nonrectangular elements, and discontinuous approximation of shock waves are also discussed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20170004873&hterms=ji&qs=N%3D0%26Ntk%3DAll%26Ntx%3Dmode%2Bmatchall%26Ntt%3D%2528ji%2529','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20170004873&hterms=ji&qs=N%3D0%26Ntk%3DAll%26Ntx%3Dmode%2Bmatchall%26Ntt%3D%2528ji%2529"><span>Turbulence Heating ObserveR: - Satellite Mission Proposal</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Vaivads, A.; Retino, A.; Soucek, J.; Khotyaintsev, Yu V.; Valentini, F.; Escoubet, C. P.; Alexandrova, O.; Andre, M.; Bale, S. D.; Balikhin, M.; <a style="text-decoration: none; " href="javascript:void(0); " onClick="displayelement('author_20170004873'); toggleEditAbsImage('author_20170004873_show'); toggleEditAbsImage('author_20170004873_hide'); "> <img style="display:inline; width:12px; height:12px; " src="images/arrow-up.gif" width="12" height="12" border="0" alt="hide" id="author_20170004873_show"> <img style="width:12px; height:12px; display:none; " src="images/arrow-down.gif" width="12" height="12" border="0" alt="hide" id="author_20170004873_hide"></p> <p>2016-01-01</p> <p>The Universe is permeated by hot, turbulent, magnetized plasmas. Turbulent plasma is a major constituent of active galactic nuclei, supernova remnants, the intergalactic and interstellar medium, the solar corona, the solar wind and the Earths magnetosphere, just to mention a few examples. Energy dissipation of turbulent fluctuations plays a key role in plasma heating and energization, yet we still do not understand the underlying physical mechanisms involved. THOR is a mission designed to answer the questions of how turbulent plasma is heated and particles accelerated, how the dissipated energy is partitioned and how dissipation operates in different regimes of turbulence. THOR is a single-spacecraft mission with an orbit tuned to maximize data return from regions in near-Earth space magnetosheath, shock, foreshock and pristine solar wind featuring different kinds of turbulence. Here we summarize the THOR proposal submitted on 15 January 2015 to the Call for a Medium-size mission opportunity in ESAs Science Programme for a launch in 2025 (M4). THOR has been selected by European Space Agency (ESA) for the study phase.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li class="active"><span>20</span></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_20 --> <div id="page_21" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li class="active"><span>21</span></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="401"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19930033847&hterms=lazarus&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAuthor-Name%26N%3D0%26No%3D50%26Ntt%3Dlazarus','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19930033847&hterms=lazarus&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAuthor-Name%26N%3D0%26No%3D50%26Ntt%3Dlazarus"><span>Pc3 activity at low geomagnetic latitudes - A comparison with solar wind observations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Villante, U.; Lepidi, S.; Vellante, M.; Lazarus, A. J.; Lepping, R. P.</p> <p>1992-01-01</p> <p>On an hourly time-scale the different roles of the solar wind and interplanetary magnetic field (IMF) parameters on ground micropulsation activity can be better investigated than at longer time-scales. A long-term comparison between ground measurements made at L'Aquila and IMP 8 observations confirms the solar wind speed as the key parameter for the onset of pulsations even at low latitudes, although additional control of the energy transfer from the interplanetary medium to the earth's magnetosphere is clearly exerted by the cone angle. Above about 20 mHz the frequency of pulsations is confirmed to be closely related to the IMF magnitude while, in agreement with model predictions, the IMF magnitude is related to the amplitude of the local fundamental resonant mode. We provide an interesting example in which high resolution measurements simultaneously obtained in the foreshock region and on the ground show that external transversal fluctuations do not penetrate deep into the low latitude magnetosphere.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17756007','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17756007"><span>Voyager planetary radio astronomy at neptune.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Warwick, J W; Evans, D R; Peltzer, G R; Peltzer, R G; Romig, J H; Sawyer, C B; Riddle, A C; Schweitzer, A E; Desch, M D; Kaiser, M L; Farrell, W M; Carr, T D; de Pater, I; Staelin, D H; Gulkis, S; Poynter, R L; Boischot, A; Genova, F; Leblanc, Y; Lecacheux, A; Pedersen, B M; Zarka, P</p> <p>1989-12-15</p> <p>Detection of very intense short radio bursts from Neptune was possible as early as 30 days before closest approach and at least 22 days after closest approach. The bursts lay at frequencies in the range 100 to 1300 kilohertz, were narrowband and strongly polarized, and presumably originated in southern polar regions ofthe planet. Episodes of smooth emissions in the frequency range from 20 to 865 kilohertz were detected during an interval of at least 10 days around closest approach. The bursts and the smooth emissions can be described in terms of rotation in a period of 16.11 +/- 0.05 hours. The bursts came at regular intervals throughout the encounter, including episodes both before and after closest approach. The smooth emissions showed a half-cycle phase shift between the five episodes before and after closest approach. This experiment detected the foreshock of Neptune's magnetosphere and the impacts of dust at the times of ring-plane crossings and also near the time of closest approach. Finally, there is no evidence for Neptunian electrostatic discharges.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/20787382-formation-electrostatic-structures-wakefield-acceleration-ultrarelativistic-plasma-flows-electron-acceleration-cosmic-ray-energies','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/20787382-formation-electrostatic-structures-wakefield-acceleration-ultrarelativistic-plasma-flows-electron-acceleration-cosmic-ray-energies"><span>Formation of electrostatic structures by wakefield acceleration in ultrarelativistic plasma flows: Electron acceleration to cosmic ray energies</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Dieckmann, M.E.; Shukla, P.K.; Eliasson, B.</p> <p>2006-06-15</p> <p>The ever increasing performance of supercomputers is now enabling kinetic simulations of extreme astrophysical and laser produced plasmas. Three-dimensional particle-in-cell (PIC) simulations of relativistic shocks have revealed highly filamented spatial structures and their ability to accelerate particles to ultrarelativistic speeds. However, these PIC simulations have not yet revealed mechanisms that could produce particles with tera-electron volt energies and beyond. In this work, PIC simulations in one dimension (1D) of the foreshock region of an internal shock in a gamma ray burst are performed to address this issue. The large spatiotemporal range accessible to a 1D simulation enables the self-consistent evolutionmore » of proton phase space structures that can accelerate particles to giga-electron volt energies in the jet frame of reference, and to tens of tera-electron volt in the Earth's frame of reference. One potential source of ultrahigh energy cosmic rays may thus be the thermalization of relativistically moving plasma.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19800024516','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19800024516"><span>Theory of time-dependent rupture in the Earth</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Das, S.; Scholz, C. H.</p> <p>1980-01-01</p> <p>Fracture mechanics is used to develop a theory of earthquake mechanism which includes the phenomenon of subcritical crack growth. The following phenomena are predicted: slow earthquakes, multiple events, delayed multiple events (doublets), postseismic rupture growth and afterslip, foreshocks, and aftershocks. The theory predicts a nucleation stage prior to an earthquake, and suggests a physical mechanism by which one earthquake may 'trigger' another.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/16089622','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/16089622"><span>Distribution of the largest aftershocks in branching models of triggered seismicity: theory of the universal Båth law.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Saichev, A; Sornette, D</p> <p>2005-05-01</p> <p>Using the epidemic-type aftershock sequence (ETAS) branching model of triggered seismicity, we apply the formalism of generating probability functions to calculate exactly the average difference between the magnitude of a mainshock and the magnitude of its largest aftershock over all generations. This average magnitude difference is found empirically to be independent of the mainshock magnitude and equal to 1.2, a universal behavior known as Båth's law. Our theory shows that Båth's law holds only sufficiently close to the critical regime of the ETAS branching process. Allowing for error bars +/- 0.1 for Båth's constant value around 1.2, our exact analytical treatment of Båth's law provides new constraints on the productivity exponent alpha and the branching ratio n: 0.9 approximately < alpha < or =1. We propose a method for measuring alpha based on the predicted renormalization of the Gutenberg-Richter distribution of the magnitudes of the largest aftershock. We also introduce the "second Båth law for foreshocks:" the probability that a main earthquake turns out to be the foreshock does not depend on its magnitude rho.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014AGUFM.S34B..06S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014AGUFM.S34B..06S"><span>Pre-, Co-, and Post-Seismic Fault Slip in the Northern Chile Seismic Gap Associated with the April 1, 2014 (Mw 8.2) Pisagua Earthquake.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Simons, M.; Duputel, Z.; Fielding, E. J.; Galetzka, J.; Genrich, J. F.; Jiang, J.; Jolivet, R.; Kanamori, H.; Moore, A. W.; Ortega Culaciati, F. H.; Owen, S. E.; Riel, B. V.; Rivera, L. A.; Carrizo, D.; Cotte, N.; Jara, J.; Klotz, J.; Norabuena, E. O.; Ortega, I.; Socquet, A.; Samsonov, S. V.; Valderas Bermejo, M.</p> <p>2014-12-01</p> <p>The April 1, 2014 (Mw 8.2) Pisagua Earthquake occurred in Northern Chile, within a long recognized seismic gap in the Central Andean region that last experienced major megathrust events in 1868 and 1877. We built a continuous GPS network starting in 2005, with the ultimate goal of understanding the kinematics and dynamics of this portion of the subduction zone. Using observations from this network, as well as others in the region, combined with InSAR, seismic and tsunami observations, we obtain estimates of inter-seismic, co-seismic and initial post-seismic fault slip using an internally consistent Bayesian unregularized approach. We evaluate the extent of spatial overlap between regions of fault slip during this different time periods. Of particular interest to this event is the extent and nature of any geodetic evidence for transient slow fault slip preceding the Pisagua Earthquake mainshock. To this end, we compare daily and high rate GPS solutions, the former of which shows long period transient motion started about 15 days before the mainshock and with maximum registered amplitude of 14.2 +/- 2 [mm] at site PSGA. Contrary to published findings, we find that pre-seismic deformation seen by the GPS network can be explained as coseismic motion associated with the multiple foreshocks.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2001ExFl...31..542R','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2001ExFl...31..542R"><span>Wave structure in the radial film flow with a circular hydraulic jump</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Rao, A.; Arakeri, J. H.</p> <p></p> <p>A circular hydraulic jump is commonly seen when a circular liquid jet impinges on a horizontal plate. Measurements of the film thickness, jump radius and the wave structure for various jet Reynolds numbers are reported. Film thickness measurements are made using an electrical contact method for regions both upstream and downstream of the jump over circular plates without a barrier at the edge. The jump radius and the separation bubble length are measured for various flow rates, plate edge conditions, and radii. Flow visualization using high-speed photography is used to study wave structure and transition. Waves on the jet amplify in the film region upstream of the jump. At high flow rates, the waves amplify enough to cause three-dimensional breakdown and what seems like transition to turbulence. This surface wave induced transition is different from the traditional route and can be exploited to enhance heat and mass transfer rates.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1078311','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/servlets/purl/1078311"><span>Concentric tube support assembly</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Rubio, Mark F.; Glessner, John C.</p> <p>2012-09-04</p> <p>An assembly (45) includes a plurality of separate pie-shaped segments (72) forming a disk (70) around a central region (48) for retaining a plurality of tubes (46) in a concentrically spaced apart configuration. Each segment includes a support member (94) radially extending along an upstream face (96) of the segment and a plurality of annularly curved support arms (98) transversely attached to the support member and radially spaced apart from one another away from the central region for receiving respective upstream end portions of the tubes in arc-shaped spaces (100) between the arms. Each segment also includes a radial passageway (102) formed in the support member for receiving a fluid segment portion (106) and a plurality of annular passageways (104) formed in the support arms for receiving respective arm portions (108) of the fluid segment portion from the radial passageway and for conducting the respective arm portions into corresponding annular spaces (47) formed between the tubes retained by the disk.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1176536','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/servlets/purl/1176536"><span>Magnetic resonance imaging of living systems by remote detection</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Wemmer, David; Pines, Alexander; Bouchard, Louis; Xu, Shoujun; Harel, Elad; Budker, Dmitry; Lowery, Thomas; Ledbetter, Micah</p> <p>2013-10-29</p> <p>A novel approach to magnetic resonance imaging is disclosed. Blood flowing through a living system is prepolarized, and then encoded. The polarization can be achieved using permanent or superconducting magnets. The polarization may be carried out upstream of the region to be encoded or at the place of encoding. In the case of an MRI of a brain, polarization of flowing blood can be effected by placing a magnet over a section of the body such as the heart upstream of the head. Alternatively, polarization and encoding can be effected at the same location. Detection occurs at a remote location, using a separate detection device such as an optical atomic magnetometer, or an inductive Faraday coil. The detector may be placed on the surface of the skin next to a blood vessel such as a jugular vein carrying blood away from the encoded region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.fs.usda.gov/treesearch/pubs/28253','TREESEARCH'); return false;" href="https://www.fs.usda.gov/treesearch/pubs/28253"><span>Detecting the Upstream Extent of Fish in the Redwood Region of Northern California</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.fs.usda.gov/treesearch/">Treesearch</a></p> <p>Aaron K. Bliesner; E. George Robison</p> <p>2007-01-01</p> <p>The point at which fish use ends represents a key ecological and regulatory demarcation on state and private forest land in the Redwood region. Currently, the end of fish use and other key demarcations with stream classification are measured or estimated based on judgments of Registered Professional Foresters and aquatic biologists with little guidance from empirical...</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/10558866','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/10558866"><span>Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U</p> <p>1999-11-19</p> <p>As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28917213','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28917213"><span>Hydraulic connectivity and evaporation control the water quality and sources of chromophoric dissolved organic matter in Lake Bosten in arid northwest China.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Zhou, Lei; Zhou, Yongqiang; Hu, Yang; Cai, Jian; Bai, Chengrong; Shao, Keqiang; Gao, Guang; Zhang, Yunlin; Jeppesen, Erik; Tang, Xiangming</p> <p>2017-12-01</p> <p>Lake Bosten is the largest oligosaline lake in arid northwestern China, and water from its tributaries and evaporation control the water balance of the lake. In this study, water quality and chromophoric dissolved organic matter (CDOM) absorption and fluorescence were investigated in different seasons to elucidate how hydraulic connectivity and evaporation may affect the water quality and variability of CDOM in the lake. Mean suspended solids and turbidity were significantly higher in the upstream tributaries than in the lake, the difference being notably more pronounced in the wet than in the dry season. A markedly higher mean first principal component (PC1) score, which was significantly positively related to protein-like components, and a considerably lower fluorescence peak integration ratio - I C :I T , indicative of the terrestrial humic-like CDOM contribution percentage, were observed in the lake than in the upstream tributaries. Correspondingly, notably higher contribution percentages of terrestrial humic-like components were observed in the river mouth areas than in the remaining lake regions. Furthermore, significantly higher mean turbidity, and notably lower mean conductivity and salinity, were recorded in the southwestern Kaidu river mouth than in the remaining lake regions in the wet season. Notably higher mean salinity is recorded in Lake Bosten than in upstream tributaries. Autochthonous protein-like associated amino-acids and also PC1 scores increased significantly with increasing salinity. We conclude that the dynamics of water quality and CDOM composition in remote arid Lake Bosten are strongly driven by evaporation and also the hydraulic connectivity between the upstream tributaries and the downstream lake. Copyright © 2017 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EGUGA..19.7488L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EGUGA..19.7488L"><span>How do blockings relate to heavy precipitation events in Europe?</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Lenggenhager, Sina; Romppainen, Olivia; Brönnimann, Stefan; Croci-Maspoli, Mischa</p> <p>2017-04-01</p> <p>Atmospheric blockings are quasi-stationary high pressure systems that persist for several days. Due to their longevity, blockings can be key features for extreme weather events. While several studies have shown their relevant role for temperatures extremes, the link between blockings and extreme precipitation and floods is still poorly understood. A case study of a Swiss lake flood event in the year 2000 reveals how different processes connected to blockings can favour the development of a flood. First upstream blocks helped to form strongly elongated troughs that are known to be associated with heavy precipitation events south of the Alps. Second recurrent precipitation events upstream of a block led to a moistening of the catchment and an increase of the lake level. Third the progression of the upstream weather systems was slowed and thereby the precipitation period over a catchment prolonged. Additionally, cloud diabatic processes in the flood region contributed to the establishment and maintenance of blocking anticyclones. Based on this case study we extend our analysis to all of Europe. Focusing on flood relevant precipitation events, i.e. extreme precipitation events that last for several days and affect larger areas, we show that different regions in Europe have very distinct seasonal precipitation patterns. Hence there is a strong seasonality in the occurrence of extreme events, depending on the geographical region. We further suggest that for different precipitation regimes, the preferred location of blockings varies strongly. Heavy precipitation events in southern France, for example, are often observed during Scandinavian blockings, while heavy precipitation events in south-eastern Europe coincide more often with eastern North-Atlantic blockings.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29481812','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29481812"><span>Food poisoning associated with ingestion of wild wasp broods in the upstream region of the Lancang river valley, Yunnan province, China.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Jiang, Li; Huang, Tian</p> <p>2018-04-01</p> <p>Food poisoning due to wild wasp broods ingestion has long been noted in the upstream region of the Lancang river valley, Yunnan province, China. This study describes the epidemiological and clinical features of the poisoning and possible causes. Surveillance data collected between 2008 and 2016 were analyzed to produce demographic data on patients, information on clinical presentations, wasp species identification, and estimations of possible risk factors for symptomatic cases. Eleven poisoning events were associated with the ingestion of wild wasp broods, including 46 exposed persons with 31 symptomatic living cases and 8 deceased cases that were reported in the Yunnan province between 2008 and 2016. Poisoning cases were only detected in the upstream region of the Lancang river valley in the autumn. The severity of the symptoms was correlated with an evident dose-effect relationship regarding the quantity ingested. The mean latent period from wild wasp broods ingestion to the onset of the symptoms was 10 h for symptomatic living cases and 7 h for deceased cases, respectively. Both gastrointestinal and neurological symptoms were commonly observed in the poisoning cases. The toxin source may be indirectly caused by the wasp broods due to the prevalence of local poisonous plants, such as Tripterygium wilfordii Hook F, Tripterygium hypoglaucum Hutch and Vaccinium bracteatum Thunb. Educational programs at the start of wasp harvest season in September in the high-risk area should be carried out to reduce the incidence of poisonings. Copyright © 2018 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22389481','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22389481"><span>Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S</p> <p>2012-05-01</p> <p>The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22677340','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22677340"><span>Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda</p> <p>2012-09-01</p> <p>Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014JGRC..119.2462L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014JGRC..119.2462L"><span>Wind-induced interannual variability of sea level slope, along-shelf flow, and surface salinity on the Northwest Atlantic shelf</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Li, Yun; Ji, Rubao; Fratantoni, Paula S.; Chen, Changsheng; Hare, Jonathan A.; Davis, Cabell S.; Beardsley, Robert C.</p> <p>2014-04-01</p> <p>In this study, we examine the importance of regional wind forcing in modulating advective processes and hydrographic properties along the Northwest Atlantic shelf, with a focus on the Nova Scotian Shelf (NSS)-Gulf of Maine (GoM) region. Long-term observational data of alongshore wind stress, sea level slope, and along-shelf flow are analyzed to quantify the relationship between wind forcing and hydrodynamic responses on interannual time scales. Additionally, a simplified momentum balance model is used to examine the underlying mechanisms. Our results show significant correlation among the observed interannual variability of sea level slope, along-shelf flow, and alongshore wind stress in the NSS-GoM region. A mechanism is suggested to elucidate the role of wind in modulating the sea level slope and along-shelf flow: stronger southwesterly (northeastward) winds tend to weaken the prevailing southwestward flow over the shelf, building sea level in the upstream Newfoundland Shelf region, whereas weaker southwesterly winds allow stronger southwestward flow to develop, raising sea level in the GoM region. The wind-induced flow variability can influence the transport of low-salinity water from the Gulf of St. Lawrence to the GoM, explaining interannual variations in surface salinity distributions within the region. Hence, our results offer a viable mechanism, besides the freshening of remote upstream sources, to explain interannual patterns of freshening in the GoM.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA345763','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA345763"><span>China Report, Science & Technology</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1987-04-30</p> <p>Distribution of Scientists, Engineers Discussed (CHINA DAILY, various dates) 37 Little Freedom of Movement , by Niu Qiuxia 37 ’Imbalanced...the masses to monitor foreshocks. "A few years ago we had such concoctions as ’indigenous telluric electricity,’ ’indigenous geomagnetism,’ and...skills. It is easier and more feasible than movements of skilled personnel. One might say that it is using "nearby water to slake nearby thirst</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016PhDT.......116T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016PhDT.......116T"><span>In-situ Plasma Analysis of Ion Kinetics in the Solar Wind and Hermean Magnetosphere</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Tracy, Patrick J.</p> <p></p> <p>The heating of the solar wind and its interaction with the unique planetary magnetosphere of Mercury is the primary focus of this work. The first aspect of this study focused on the heavy ion population of the solar wind (A > 4 amu), and how well the signature of the heating process responsible for creating the solar wind is preserved in this heavy ion population. We found that this signature in the heavy ion population is primarily erased (thermalized) via Coulomb collisional interactions with solar wind protons. The heavy ions observed in collisionally young solar wind reveal a clear, stable dependence on mass, along with non-thermal heating that is not in agreement with current predictions based on turbulent transport and kinetic dissipation. Due to its weak magnetic dipole, the solar wind can impinge on the surface of Mercury, one of the processes contributing to the desorption of neutrals and, through ionization, ions that make up the planet's exosphere. Differentiating between surface mechanisms and analyzing magnetospheric plasma dynamics requires the quantification of a variety of ion species. A detailed forward model and a robust statistical method were created to identify new ion signatures in the measurement space of the FIPS instrument, formerly orbiting Mercury onboard the MESSENGER spacecraft. The recovery of new heavy ions species, including Al, Ne, Si, and Mg, along with tentative recoveries of S, Ar, K, and C, enable in depth studies of the plasma dynamics in the Hermean magnetosphere. The interaction of the solar wind with the bow shock of the Hermean magnetosphere leads to the creation of a foreshock region. New tools and methods were created to enable the analysis of the diffuse and Field Aligned Beam (FAB) populations in unique parameter regime of the Hermean foreshock. One result suggests that the energization process for the observed FABs can be explained by Shock Drift Acceleration, and not limited by the small spatial size of Mercury's bow shock. Analysis of diffuse populations shows that a connection time limited diffusive shock acceleration is likely responsible for the behavior of the observed energy distributions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S43D0894S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S43D0894S"><span>Search for Anisotropy Changes Associated with Two Large Earthquakes in Japan and New Zealand</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Savage, M. K.; Graham, K.; Aoki, Y.; Arnold, R.</p> <p>2017-12-01</p> <p>Seismic anisotropy is often considered to be an indicator of stress in the crust, because the closure of cracks due to differential stress leads to waves polarized parallel to the cracks travelling faster than the orthogonal direction. Changes in shear wave splitting have been suggested to result from stress changes at volcanoes and earthquakes. However, the effects of mineral or structural alignment, and the difficulty of distinguishing between changes in anisotropy along an earthquake-station path from distinguishing changes in the path itself, have made such findings controversial. Two large earthquakes in 2016 provide unique datasets to test the use of shear wave splitting for measuring variations in stress because clusters of closely-spaced earthquakes occurred both before and after a mainshock. We use the automatic, objective splitting analysis code MFAST to speed process and minimize unwitting observer bias when determining time variations. The sequence of earthquakes related to the M=7.2 Japanese Kumamoto earthquake of 14 April 2016 includes both foreshocks, mainshocks and aftershocks. The sequence was recorded by the NIED permanent network, which already contributed background seismic anisotropy measurements in a previous study of anisotropy and stress in Kyushu. Preliminary measurements of shear wave splitting from earthquakes that occurred in 2016 show results at some stations that clearly differ from those of the earlier study. They also change between earthquakes recorded before and after the mainshock. Further work is under way to determine whether the changes are more likely due to changes in stress during the observation time, or due to spatial changes in anisotropy combined with changes in earthquake locations. Likewise, background seismicity and also foreshocks and aftershocks in the 2013 Cook Strait earthquake sequence including two M=6.5 earthquakes in 2013 in New Zealand were in the same general region as aftershocks of the M=7.8 Kaikoura earthquake that occurred on 14 November 2016. Here again, preliminary analysis suggests the possibility that we are observing changes in stress, but detailed analysis is needed to confirm that.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li class="active"><span>21</span></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_21 --> <div id="page_22" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li class="active"><span>22</span></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="421"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017EGUGA..1911462O','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017EGUGA..1911462O"><span>Study pre-earthquake features in the Earth atmosphere-ionosphere environment associated with 2016 Amatrice-Norcia (Central Italy) seismic sequence</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ouzounov, Dimitar; Pulinets, Sergey; Giuliani, Gioacchino; Hernández-Pajares, Manuel; García-Rigo, Alberto</p> <p>2017-04-01</p> <p>The 2016 Amatrice-Norcia (Central Italy) seismic sequence (M6.3, M6.1 and M6.5), became one of the unusual and important modern earthquake events. Recent studies indicate (including April 6th 2009 Abruzzo earthquake) an enhanced coupling between the atmospheric boundary layer and the ionosphere, which have been proposed to be related with large (>M6) earthquakes. This relationship has been studied for the 2016 Central Italy sequence using an integrated set of observations of five physical and environmental parameters. We present observational data from January to November 2016 of five physical parameters- radon, seismicity, temperature of the atmosphere boundary layer, outgoing earth infrared radiation and GPS/TEC and their temporal and spatial variations several days before the onset of the Amatrice-Norcia earthquake sequence. The Aug 24 M6.2 foreshock was situated about 70 kilometers from the 2 stations of radon near L'Aquila. These data show an increase prior to the main earthquake beginning in July-August this enhancement of radon coincides (with some delay) with an increase in the atmospheric chemical potential (Aug 11) measured near the epicentral area from satellite. And subsequently from Aug12 there was an association with the acceleration of outgoing infrared radiation observed on the top of the atmosphere from EOS satellite (Aug 16). The GPS/Total Electron Content data indicate an increase of electron concentration in ionosphere on August 22 and October 26, 1-2 days before the M6.2 foreshock and the M6.5 main shock on Oct 30, 2016. Both ground and satellite data have in common that they were evident in about the last ten days before the M6.2 foreshock of Aug 24 and continuously up to the main shock of Oct 30, although the radon variations started 2 months earlier. We examined the possible correlation between different pre-earthquake signals in the frame of a multidisciplinary investigation of Lithosphere -Atmosphere -Ionosphere coupling concept.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.usgs.gov/ds/451/','USGSPUBS'); return false;" href="https://pubs.usgs.gov/ds/451/"><span>Local and Cumulative Impervious Cover of Massachusetts Stream Basins</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Brandt, Sara L.; Steeves, Peter A.</p> <p>2009-01-01</p> <p>Impervious surfaces such as paved roads, parking lots, and building roofs can affect the natural streamflow patterns and ecosystems of nearby streams. This dataset summarizes the percentage of impervious area for watersheds across Massachusetts by using a newly available statewide 1-m binary raster dataset of impervious surface for 2005. In order to accurately capture the wide spatial variability of impervious surface, it was necessary to delineate a new set of finely discretized basin boundaries for Massachusetts. This new set of basins was delineated at a scale finer than that of the existing 12-digit Hydrologic Unit Code basins (HUC-12s) of the national Watershed Boundary Dataset. The dataset consists of three GIS shapefiles. The Massachusetts nested subbasins and the hydrologic units data layers consist of topographically delineated boundaries and their associated percentage of impervious cover for all of Massachusetts except Cape Cod, the Islands, and the Plymouth-Carver region. The Massachusetts groundwater-contributing areas data layer consists of groundwater contributing-area boundaries for streams and coastal areas of Cape Cod and the Plymouth-Carver region. These boundaries were delineated by using groundwater-flow models previously published by the U.S. Geological Survey. Subbasin and hydrologic unit boundaries were delineated statewide with the exception of Cape Cod and the Plymouth-Carver Region. For the purpose of this study, a subbasin is defined as the entire drainage area upstream of an outlet point. Subbasins draining to multiple outlet points on the same stream are nested. That is, a large downstream subbasin polygon comprises all of the smaller upstream subbasin polygons. A hydrologic unit is the intervening drainage area between a given outlet point and the outlet point of the next upstream unit (Fig. 1). Hydrologic units divide subbasins into discrete, nonoverlapping areas. Each hydrologic unit corresponds to a subbasin delineated from the same outlet point; the hydrologic unit and the subbasin share the same unique identifier attribute. Because the same set of outlet points was used for the delineation of subbasins and hydrologic units, the linework for both data layers is identical; however, polygon attributes differ because for a given outlet point, the subbasin polygon area is the sum of all the upstream hydrologic units. Impervious surface summarized for a subbasin represents the percentage of impervious surface area of the entire upstream watershed, whereas the impervious surface for a hydrologic unit represents the percentage of impervious surface area for the intervening drainage area between two outlet points.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013AGUFMSM12A..06M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013AGUFMSM12A..06M"><span>Asymmetric Magnetic Reconnection in the Solar Atmosphere</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Murphy, N. A.; Miralles, M. P.; Ranquist, D. A.; Pope, C. L.; Raymond, J. C.; Lukin, V. S.; McKillop, S.; Shen, C.; Winter, H. D.; Reeves, K. K.; Lin, J.</p> <p>2013-12-01</p> <p>Models of solar flares and coronal mass ejections typically predict the development of an elongated current sheet in the wake behind the rising flux rope. In reality, reconnection in these current sheets will be asymmetric along the inflow, outflow, and out-of-plane directions. We perform resistive MHD simulations to investigate the consequences of asymmetry during solar reconnection. We predict several observational signatures of asymmetric reconnection, including flare loops with a skewed candle flame shape, slow drifting of the current sheet into the strong field upstream region, asymmetric footpoint speeds and hard X-ray emission, and rolling motions within the erupting flux rope. There is net plasma flow across the magnetic field null along both the inflow and outflow directions. We compare simulations to SDO/AIA, Hinode/XRT, and STEREO observations of flare loop shapes, current sheet drifting, and rolling motions during prominence eruptions. Simulations of the plasmoid instability with different upstream magnetic fields show that the reconnection rate remains enhanced even during the asymmetric case. The islands preferentially grow into the weak field upstream region. The islands develop net vorticity because the outflow jets impact them obliquely rather than directly. Asymmetric reconnection in the chromosphere occurs when emerging flux interacts with pre-existing overlying flux. We present initial results on asymmetric reconnection in partially ionized chromospheric plasmas. Finally, we discuss how comparisons to observations are necessary to understand the role of three-dimensional effects.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013AGUFMSM12A0006M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013AGUFMSM12A0006M"><span>Asymmetric Magnetic Reconnection in the Solar Atmosphere</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Murphy, N. A.; Miralles, M. P.; Ranquist, D. A.; Pope, C. L.; Raymond, J. C.; Lukin, V. S.; McKillop, S. C.; Shen, C.; Winter, H. D.; Reeves, K. K.; Lin, J.</p> <p>2013-12-01</p> <p>Models of solar flares and coronal mass ejections typically predict the development of an elongated current sheet in the wake behind the rising flux rope. In reality, reconnection in these current sheets will be asymmetric along the inflow, outflow, and out-of-plane directions. We perform resistive MHD simulations to investigate the consequences of asymmetry during solar reconnection. We predict several observational signatures of asymmetric reconnection, including flare loops with a skewed candle flame shape, slow drifting of the current sheet into the strong field upstream region, asymmetric footpoint speeds and hard X-ray emission, and rolling motions within the erupting flux rope. There is net plasma flow across the magnetic field null along both the inflow and outflow directions. We compare simulations to SDO/AIA, Hinode/XRT, and STEREO observations of flare loop shapes, current sheet drifting, and rolling motions during prominence eruptions. Simulations of the plasm! oid instability with different upstream magnetic fields show that the reconnection rate remains enhanced even during the asymmetric case. The islands preferentially grow into the weak field upstream region. The islands develop net vorticity because the outflow jets impact them obliquely rather than directly. Asymmetric reconnection in the chromosphere occurs when emerging flux interacts with pre-existing overlying flux. We present initial results on asymmetric reconnection in partially ionized chromospheric plasmas. Finally, we discuss how comparisons to observations are necessary to understand the role of three-dimensional effects.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2010AGUFM.H31E1054B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2010AGUFM.H31E1054B"><span>Distributional Impacts of Large Dams in China</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Bao, X.</p> <p>2010-12-01</p> <p>Dams on a river are believed to have heterogeneous impacts to the upstream, local and downstream areas. Generally, irrigation dams will bring benefits to the downstream by facilitating more irrigation, while it will bring negative impacts to upstream due to inundation or no impact to local area as a combination result of population dislocation and economic benefits. This paper checked the impacts of large dams (above 100 meters) on the upstream, downstream and local area, using 2000-2008 county level data in China. Robust heterogeneous impacts of different categories of dams (mainly dams serving for irrigation, hydropower, or other purposes) were found on different areas, using IV regression approaches. Dams higher than 100 meters are significantly and heterogeneously impacting agricultural production, urban employment and rural per capita income. Its beneficial impact on agriculture production is significant for downstream especially in continuous drought years. But its impacts on social welfare indicators, such as primary school enrollment and hospital beds, are not heterogeneously different across regions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/20090002666','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/20090002666"><span>Method for creating an aeronautic sound shield having gas distributors arranged on the engines, wings, and nose of an aircraft</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Corda, Stephen (Inventor); Smith, Mark Stephen (Inventor); Myre, David Daniel (Inventor)</p> <p>2008-01-01</p> <p>The present invention blocks and/or attenuates the upstream travel of acoustic disturbances or sound waves from a flight vehicle or components of a flight vehicle traveling at subsonic speed using a local injection of a high molecular weight gas. Additional benefit may also be obtained by lowering the temperature of the gas. Preferably, the invention has a means of distributing the high molecular weight gas from the nose, wing, component, or other structure of the flight vehicle into the upstream or surrounding air flow. Two techniques for distribution are direct gas injection and sublimation of the high molecular weight solid material from the vehicle surface. The high molecular weight and low temperature of the gas significantly decreases the local speed of sound such that a localized region of supersonic flow and possibly shock waves are formed, preventing the upstream travel of sound waves from the flight vehicle.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016MNRAS.461.3864A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016MNRAS.461.3864A"><span>Shock-turbulence interaction in core-collapse supernovae</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Abdikamalov, Ernazar; Zhaksylykov, Azamat; Radice, David; Berdibek, Shapagat</p> <p>2016-10-01</p> <p>Nuclear shell burning in the final stages of the lives of massive stars is accompanied by strong turbulent convection. The resulting fluctuations aid supernova explosion by amplifying the non-radial flow in the post-shock region. In this work, we investigate the physical mechanism behind this amplification using a linear perturbation theory. We model the shock wave as a one-dimensional planar discontinuity and consider its interaction with vorticity and entropy perturbations in the upstream flow. We find that, as the perturbations cross the shock, their total turbulent kinetic energy is amplified by a factor of ˜2, while the average linear size of turbulent eddies decreases by about the same factor. These values are not sensitive to the parameters of the upstream turbulence and the nuclear dissociation efficiency at the shock. Finally, we discuss the implication of our results for the supernova explosion mechanism. We show that the upstream perturbations can decrease the critical neutrino luminosity for producing explosion by several per cent.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JTurb..18..338F','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JTurb..18..338F"><span>Optimal frequency-response sensitivity of compressible flow over roughness elements</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Fosas de Pando, Miguel; Schmid, Peter J.</p> <p>2017-04-01</p> <p>Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2006JFM...549..385B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2006JFM...549..385B"><span>Passive propulsion in vortex wakes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Beal, D. N.; Hover, F. S.; Triantafyllou, M. S.; Liao, J. C.; Lauder, G. V.</p> <p></p> <p>A dead fish is propelled upstream when its flexible body resonates with oncoming vortices formed in the wake of a bluff cylinder, despite being well outside the suction region of the cylinder. Within this passive propulsion mode, the body of the fish extracts sufficient energy from the oncoming vortices to develop thrust to overcome its own drag. In a similar turbulent wake and at roughly the same distance behind a bluff cylinder, a passively mounted high-aspect-ratio foil is also shown to propel itself upstream employing a similar flow energy extraction mechanism. In this case, mechanical energy is extracted from the flow at the same time that thrust is produced. These results prove experimentally that, under proper conditions, a body can follow at a distance or even catch up to another upstream body without expending any energy of its own. This observation is also significant in the development of low-drag energy harvesting devices, and in the energetics of fish dwelling in flowing water and swimming behind wake-forming obstacles.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S21B0703P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S21B0703P"><span>Making Initial Earthquake Catalogs from a Temporary Seismic Network for Monitoring Aftershocks</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Park, J.; Kang, T. S.; Kim, K. H.; Rhie, J.; Kim, Y.</p> <p>2017-12-01</p> <p>The ML 5.1 foreshock and the ML 5.8 mainshock earthquakes occurred consecutively in Gyeongju, the southeastern part of the Korean Peninsula, on September 12, 2016. A temporary seismic network was installed quickly to observe aftershocks followed this mainshock event in the vicinity of the epicenter. The network was consisting of 27 stations equipped with broadband sensors initially and it has been operated in off-line system which required a periodic manual backup of the recorded data. We detected P-triggers and associated events by using SeisComP3 to make an initial catalogue of aftershock events rapidly. If necessary, manual picking was performed to obtain precise P- and S-arrival times from a module, scolv, included in SeisComP3. For cross-checking of reliable identification of seismic phases, a seismic python package, PhasePApy, was applied in parallel with SeisComP3. Then we get the precise relocated coordinates and depth of the aftershock events using the velellipse algorithm. The resulting dataset comprises of an initial aftershock catalog. The catalog will provide the means to address some important questions and issues on seismogenesis in this intraplate seismicity region including the 2016 Gyeongju earthquake sequence and to improve seismic hazard estimation of the region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=20110023543&hterms=mercury&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D80%26Ntt%3Dmercury','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=20110023543&hterms=mercury&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D80%26Ntt%3Dmercury"><span>Kinetic-Scale Magnetic Turbulence and Finite Larmor Radius Effects at Mercury</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Uritsky, V. M.; Slavin, J. A.; Khazanov, G. V.; Donovan, E. F.; Boardsen, S. A.; Anderson, B. J.; Korth, H.</p> <p>2011-01-01</p> <p>We use a nonstationary generalization of the higher-order structure function technique to investigate statistical properties of the magnetic field fluctuations recorded by MESSENGER spacecraft during its first flyby (01/14/2008) through the near-Mercury space environment, with the emphasis on key boundary regions participating in the solar wind - magnetosphere interaction. Our analysis shows, for the first time, that kinetic-scale fluctuations play a significant role in the Mercury's magnetosphere up to the largest resolvable timescale (approx.20 s) imposed by the signal nonstationariry, suggesting that turbulence at this plane I is largely controlled by finite Larmor radius effects. In particular, we report the presence of a highly turbulent and extended foreshock system filled with packets of ULF oscillations, broad-band intermittent fluctuations in the magnetosheath, ion-kinetic turbulence in the central plasma sheet of Mercury's magnetotail, and kinetic-scale fluctuations in the inner current sheet encountered at the outbound (dawn-side) magnetopause. Overall, our measurements indicate that the Hermean magnetosphere, as well as the surrounding region, are strongly affected by non-MHD effects introduced by finite sizes of cyclotron orbits of the constituting ion species. Physical mechanisms of these effects and their potentially critical impact on the structure and dynamics of Mercury's magnetic field remain to be understood.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19840034524&hterms=debye+length&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D50%26Ntt%3Ddebye%2Blength','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19840034524&hterms=debye+length&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D50%26Ntt%3Ddebye%2Blength"><span>Short wavelength ion waves upstream of the earth's bow shock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Fuselier, S. A.; Gurnett, D. A.</p> <p>1984-01-01</p> <p>The identification and explanation of short wavelength antenna interference effects observed in spacecraft plasma wave data have provided an important new method of determining limits on the wavelength, direction of propagation, and Doppler shift of short wavelength electrostatic waves. Using the ISEE-1 wideband electric field data, antenna interference effects have been identified in the ion waves upstream of the earth's bow shock. This identification implies that wavelengths of the upstream ion waves are shorter than the antenna length. The interference effects also provide new measurements of the direction of propagation of the ion waves. The new measurements show that the wave vectors of the ion waves are not parallel to the interplanetary magnetic field (IMF) as previously reported. The direction of propagation does not appear to be controlled by the IMF. In addition, analysis of the Doppler shift of the short wavelength ion waves has provided a measurement of the dispersion relation. The upper limit of the rest frame frequency was found to be on the order of the ion plasma frequency. At this frequency, the wavelength is on the order of a few times the Debye length. The results of this study now provide strong evidence that the ion waves in the upstream region are Doppler-shifted ion acoustic waves. Previously announced in STAR as N83-36328</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/21043632-upstream-open-reading-frames-regulate-expression-nuclear-wnt13-isoforms','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/21043632-upstream-open-reading-frames-regulate-expression-nuclear-wnt13-isoforms"><span>Upstream open reading frames regulate the expression of the nuclear Wnt13 isoforms</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Tang Tao; Rector, Kyle; Barnett, Corey D.</p> <p>2008-02-22</p> <p>Wnt proteins control cell survival and cell fate during development. Although Wnt expression is tightly regulated in a spatio-temporal manner, the mechanisms involved both at the transcriptional and translational levels are poorly defined. We have identified a downstream translation initiation codon, AUG(+74), in Wnt13B and Wnt13C mRNAs responsible for the expression of Wnt13 nuclear forms. In this report, we demonstrate that the expression of the nuclear Wnt13C form is translationally regulated in response to stress and apoptosis. Though the 5'-leaders of both Wnt13C and Wnt13B mRNAs have an inhibitory effect on translation, they did not display an internal ribosome entrymore » site activity as demonstrated by dicistronic reporter assays. However, mutations or deletions of the upstream AUG(-99) and AUG(+1) initiation codons abrogate these translation inhibitory effects, demonstrating that Wnt13C expression is controlled by upstream open reading frames. Since long 5'-untranslated region with short upstream open reading frames characterize other Wnt transcripts, our present data on the translational control of Wnt13 expression open the way to further studies on the translation control of Wnt expression as a modulator of their subcellular localization and activity.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018E%26ES..144a2052S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018E%26ES..144a2052S"><span>The economic benefits of vegetation in the upstream area of Ciliwung watershed</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Saridewi, T. R.; Nazaruddin</p> <p>2018-04-01</p> <p>Ciliwung watershed has strategic values since its entire downstream area is located in the Special Administrative Region of Jakarta (DKI Jakarta), the capital of Indonesia. This causes forest and farmland areas are converted into open areas or built-up areas. The existence of these areas provides enormous environmental and economic benefits. Economic benefit values are very important to be considered in developing a policy development plan, but they have not been calculated yet. This study aims to determine the economic benefits provided by trees and other vegetation anddevelops a development policy that takes into account simultaneously ecological and economic aspects. The study is conducted in the upstream Ciliwung watershed, by using land cover patterns in 1989, 2000, 2010 and 2014, and employs GIS and CITY green analysis. The results show that conversion of forest and farmland areas reduces the ability of Ciliwung upstream watershed to store water. Therefore, its ability to reduce the flow of surface has been decreased. This creates a decrease in the cost savings of annual stormwater, from US 15,175,721 in 1989 to US 13,317,469 in 2014. The Environmental Services Payment Policy (PES) for upstream community groups managing the watershed has been considered as a fairly effective policy.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=109473','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=109473"><span>Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Haut, Donald D.; Pintel, D. J.</p> <p>1998-01-01</p> <p>Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=309431','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=309431"><span>Organizational differences between cytoplasmic male sterile and male fertile Brassica mitochondrial genomes are confined to a single transposed locus.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>L'Homme, Y; Brown, G G</p> <p>1993-01-01</p> <p>Comparison of the physical maps of male fertile (cam) and male sterile (pol) mitochondrial genomes of Brassica napus indicates that structural differences between the two mtDNAs are confined to a region immediately upstream of the atp6 gene. Relative to cam mtDNA, pol mtDNA possesses a 4.5 kb segment at this locus that includes a chimeric gene that is cotranscribed with atp6 and lacks an approximately 1kb region located upstream of the cam atp6 gene. The 4.5 kb pol segment is present and similarly organized in the mitochondrial genome of the common nap B.napus cytoplasm; however, the nap and pol DNA regions flanking this segment are different and the nap sequences are not expressed. The 4.5 kb CMS-associated pol segment has thus apparently undergone transposition during the evolution of the nap and pol cytoplasms and has been lost in the cam genome subsequent to the pol-cam divergence. This 4.5 kb segment comprises the single DNA region that is expressed differently in fertile, pol CMS and fertility restored pol cytoplasm plants. The finding that this locus is part of the single mtDNA region organized differently in the fertile and male sterile mitochondrial genomes provides strong support for the view that it specifies the pol CMS trait. Images PMID:8388101</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26423656','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26423656"><span>Copy number variation in the region harboring SOX9 gene in dogs with testicular/ovotesticular disorder of sex development (78,XX; SRY-negative).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek</p> <p>2015-10-01</p> <p>Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4589768','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4589768"><span>Copy number variation in the region harboring SOX9 gene in dogs with testicular/ovotesticular disorder of sex development (78,XX; SRY-negative)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek</p> <p>2015-01-01</p> <p>Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1. PMID:26423656</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=330591','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=330591"><span>Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Sasaki, H; Yokoyama, E; Kuroiwa, A</p> <p>1990-01-01</p> <p>The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/21509535','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/21509535"><span>Characterization of Cer-1 cis-regulatory region during early Xenopus development.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António</p> <p>2011-05-01</p> <p>Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li class="active"><span>22</span></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_22 --> <div id="page_23" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li class="active"><span>23</span></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="441"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016JSR...118...35G','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016JSR...118...35G"><span>Present-day palynomorph deposits in an estuarine context: The case of the Loire Estuary</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ganne, A.; Leroyer, C.; Penaud, A.; Mojtahid, M.</p> <p>2016-12-01</p> <p>Estuaries are dynamic systems that collect terrestrial, aerial, fluvial, and marine inputs, including organic microfossils, which, when fossilized and observed on palynological slides, are also referred to as palynomorphs (pollen and non-pollen palynomorphs including dinoflagellate cysts or dinocysts). To understand these organic microfossil deposit arrangements across the Loire estuary, palynomorph counts were undertaken in 31 surface sediments collected across longitudinal and perpendicular transects of the Loire active riverbed, from the upper inner estuary to the river mouth. Main results suggest a large homogeneity of the pollen content throughout the entire upstream-downstream transect, with a dominance of arboreal taxa (Pinus, Quercus, Alnus) and Poaceae. Also, perpendicular transects across the channel show a great similarity between the muddy surface layers and the underlying consolidated clay layers. This is probably due to: i) homogeneity of the landscape at a regional scale (large catchment area of the Loire River), and ii) complex hydrodynamic processes involving strong mixing of the palynological signal. Furthermore, despite scarce woodlands in the regional landscape, arboreal pollen (especially Pinus and Quercus) represents > 60% of the total pollen percentages. This could be explained by several factors: i) generally higher arboreal pollen production and dispersion as compared to herbaceous taxa, ii) distant inputs from marine areas downstream and/or forested regions far upstream, and iii) differential selection or inheritance from underlying sediments. Differentiation between the outer and inner estuarine environments was furthermore possible using a ratio of terrestrial versus marine palynological indicators. Among the dinocyst assemblages (marine realm), the euryhaline species Lingulodinium machaerophorum predominates; this taxon being very sensitive to strong water column stratification. Also, total dinocyst concentration increased upstream, which may result from the tidal forcing pushing salinity upriver beneath outflowing river water, and thus signing the estuarine turbidity maximum influence within the Loire River.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=358888','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=358888"><span>Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L</p> <p>1993-01-01</p> <p>The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/19875790','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/19875790"><span>Assessing selenium contamination in the irrigated stream-aquifer system of the Arkansas River, Colorado.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Gates, Timothy K; Cody, Brent M; Donnelly, Joseph P; Herting, Alexander W; Bailey, Ryan T; Mueller Price, Jennifer</p> <p>2009-01-01</p> <p>Prudent interventions for reducing selenium (Se) in groundwater and streams within an irrigated river valley must be guided by a sound understanding of current field conditions. An emerging picture of the nature of Se contamination within the Lower Arkansas River Valley in Colorado is provided by data from a large number of groundwater and surface water sampling locations within two study regions along the river. Measurements show that dissolved Se concentrations in the river are about double the current Colorado Department of Public Health and Environment (CDPHE) chronic standard of 4.6 microg L(-1) for aquatic habitat in the upstream region and exceed the standard by a factor of 2 to 4 in the downstream region. Groundwater concentrations average about 57.7 microg L(-1) upstream and 33.0 microg L(-1) downstream, indicating a large subsurface source for irrigation-induced dissolution and mobilization of Se loads to the river and its tributaries. Inverse correlation was found between Se concentration and the distance to the closest identified shale in the direction upstream along the principal groundwater flow gradient. The data also exhibited, among other relationships, a moderate to strong correlation between dissolved Se and total dissolved solids in groundwater and surface water, a strong correlation with uranium in groundwater, and power relationships with nitrate in groundwater. The relationship to nitrate, derived primarily from N fertilizers, reveals the degree to which dissolved Se depends on oxidation and inhibited reduction due to denitrification and suggests that there are prospects for reducing dissolved Se through nitrate control. Current and future results from these ongoing studies will help provide a foundation for modeling and for the discovery of best management practices (BMPs) in irrigated agriculture that can diminish Se contamination.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25768785','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25768785"><span>Foreshock and aftershocks in simple earthquake models.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kazemian, J; Tiampo, K F; Klein, W; Dominguez, R</p> <p>2015-02-27</p> <p>Many models of earthquake faults have been introduced that connect Gutenberg-Richter (GR) scaling to triggering processes. However, natural earthquake fault systems are composed of a variety of different geometries and materials and the associated heterogeneity in physical properties can cause a variety of spatial and temporal behaviors. This raises the question of how the triggering process and the structure interact to produce the observed phenomena. Here we present a simple earthquake fault model based on the Olami-Feder-Christensen and Rundle-Jackson-Brown cellular automata models with long-range interactions that incorporates a fixed percentage of stronger sites, or asperity cells, into the lattice. These asperity cells are significantly stronger than the surrounding lattice sites but eventually rupture when the applied stress reaches their higher threshold stress. The introduction of these spatial heterogeneities results in temporal clustering in the model that mimics that seen in natural fault systems along with GR scaling. In addition, we observe sequences of activity that start with a gradually accelerating number of larger events (foreshocks) prior to a main shock that is followed by a tail of decreasing activity (aftershocks). This work provides further evidence that the spatial and temporal patterns observed in natural seismicity are strongly influenced by the underlying physical properties and are not solely the result of a simple cascade mechanism.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.usgs.gov/of/1979/0932/report.pdf','USGSPUBS'); return false;" href="https://pubs.usgs.gov/of/1979/0932/report.pdf"><span>Catalog of Oroville, California, earthquakes; June 7, 1975 to July 31, 1976</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Mantis, Constance; Lindh, Allan; Savage, William; Marks, Shirley</p> <p>1979-01-01</p> <p>On August 1, 1975, at 2020 GMT a magnitude 5.7 (ML) earthquake occurred 15 km south of Oroville, California, in the western foothills of the Sierra Nevada. It was preceded by 61 foreshocks that began on June 7, 1975, and was followed by thousands of aftershocks. Several studies have reported locations or analyses of various subsets of the Oroville sequence, including Morrison and others (1975), Savage and others (1975), Lester and others (1975), Toppozada and others (1975), Ryall and others (1975), Bufe and others (1976), Morrison and others (1976), and Lahr and others (1976). In this report arrival time data have been compiled from the original records at several institutions to produce a single catalog of the Oroville sequence from June 7, 1975, through July 31, 1976. This study has four objectives: to compile a list of earthquakes in the Oroville sequence that is as complete as possible above the minimum magnitude threshold of approximately 1.0;to determine accurate and uniform hypocentral coordinates for the earthquakes;to determine reliable and consistent magnitude values for the sequence; andto provide a statistically uniform basis for further investigation of the physical processes involved in the Oroville sequence as revealed by the parameters of the foreshocks and aftershocks.The basis and procedures for the data analysis are described in this report.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AGUFM.S23F..08L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AGUFM.S23F..08L"><span>Modeling Aftershocks and Foreshocks by Time-Dependent Friction Laws</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Lippiello, E.; Landes, F.</p> <p>2017-12-01</p> <p>The transition with depth from rate-weakening to rate-strengthening rheology represents a viable mechanism to explain both afterslip and the temporal and spatial organization of aftershocks(Avouac, Annu. Rev. Eart Planet Sci. 2015).On the other hand, elastic models for seismic faults, as the Burridge-Knopoff model, are able to reproduce the Gutenberg-Richter (GR) law (de Arcangelis et al., Phys. Rep. 2016). Here we show that the two approaches can be combined in a minimal model containing only a parameter controlling the heterogeneities of the friction force. The key ingredient is the presence of a time-dependent friction on a temporal scale intermediate between the instantaneous scale of fracture propagation and the very slow one of the driving rate. Several features of aftershocks as the GR law, the productivity law, the spatial clustering and the temporal decay of the aftershock number, appear universal properties independent of details of model parameters and friction law. Quantitative agreement with the Omori law constraints the friction law according to a velocity strengthening rheology. The model also provides agreement with recent experimental results on the statistical properties of foreshock occurrence (Lippiello et al. , Pageoph, 2017). We then obtain insights on the nucleation phase preceding mainshocks which we compare with existing models (Ohnaka, Tectonophysics 1992).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=107263','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=107263"><span>Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.</p> <p>1998-01-01</p> <p>Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26170415','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26170415"><span>Mutations That Stimulate flhDC Expression in Escherichia coli K-12.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Fahrner, Karen A; Berg, Howard C</p> <p>2015-10-01</p> <p>Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/15962237','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/15962237"><span>Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E</p> <p>2005-08-01</p> <p>The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1224524','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1224524"><span>Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.</p> <p>2005-01-01</p> <p>The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/6519657-rivera-ocean-seismic-experiment-rose-overview','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/6519657-rivera-ocean-seismic-experiment-rose-overview"><span></span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Ewing, J.I.; Meyer, R.P.</p> <p></p> <p>The Rivera Ocean Seismic Experiment (ROSE) was designed as a combined sea and land seismic program to utilize both explosive and earthquakes to study a number of features of the structure and evolution of a mid-ocean ridge, a major oceanic fracture zone, and the transition region between ocean and continent. The primary region selected for the experiment included the Rivera Fracture Zone, the crest and eastern flank of the East Pacific north of the Rivera and adjacent areas of Baja California and mainland Mexico. The experiment included: (1) study of the East Pacific Rise south of the Orozco Fracture Zonemore » primarily using ocean bottom recording and explosive sources. (2) a seismicity program at the Orozco, and (3) a land-based program of recording natural events along the coastal region of Mexico. A considerable amount of useful data was obtained in each of the three subprograms. In the marine parts of the experiment we were able to address a variety of problems including structure and evolution of young oceanic crust and mantle, structure and dynamics of the East Pacific Rise, seismicity of the Orozco Fracture Zone, and partitioning of energy transmission between the ocean volume and the crust/lithosphere. On land, the fortuitous occurrence of the Petatlan M7.6 earthquake of March 14, 1979, permitted the acquisition of an excellent data set of foreshocks and aftershocks of this large event, which provide new insight into the filling of a major seismic gap in the region. This overview describes the scientific rationale and the design of the experiments, along with some general results.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2012AGUFMEP23B0803R','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2012AGUFMEP23B0803R"><span>Are catchment-wide erosion rates really "Catchment-Wide"? Effects of grain size on erosion rates determined from 10Be</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Reitz, M. A.; Seeber, L.; Schaefer, J. M.; Ferguson, E. K.</p> <p>2012-12-01</p> <p>Early studies pioneering the method for catchment wide erosion rates by measuring 10Be in alluvial sediment were taken at river mouths and used the sand size grain fraction from the riverbeds in order to average upstream erosion rates and measure erosion patterns. Finer particles (<0.0625 mm) were excluded to reduce the possibility of a wind-blown component of sediment and coarser particles (>2 mm) were excluded to better approximate erosion from the entire upstream catchment area (coarse grains are generally found near the source). Now that the sensitivity of 10Be measurements is rapidly increasing, we can precisely measure erosion rates from rivers eroding active tectonic regions. These active regions create higher energy drainage systems that erode faster and carry coarser sediment. In these settings, does the sand-sized fraction fully capture the average erosion of the upstream drainage area? Or does a different grain size fraction provide a more accurate measure of upstream erosion? During a study of the Neto River in Calabria, southern Italy, we took 8 samples along the length of the river, focusing on collecting samples just below confluences with major tributaries, in order to use the high-resolution erosion rate data to constrain tectonic motion. The samples we measured were sieved to either a 0.125 mm - 0.710 mm fraction or the 0.125 mm - 4 mm fraction (depending on how much of the former was available). After measuring these 8 samples for 10Be and determining erosion rates, we used the approach by Granger et al. [1996] to calculate the subcatchment erosion rates between each sample point. In the subcatchments of the river where we used grain sizes up to 4 mm, we measured very low 10Be concentrations (corresponding to high erosion rates) and calculated nonsensical subcatchment erosion rates (i.e. negative rates). We, therefore, hypothesize that the coarser grain sizes we included are preferentially sampling a smaller upstream area, and not the entire upstream catchment, which is assumed when measurements are based solely on the sand sized fraction. To test this hypothesis, we used samples with a variety of grain sizes from the Shillong Plateau. We sieved 5 samples into three grain size fractions: 0.125 mm - 710 mm, 710 mm - 4 mm, and >4 mm and measured 10Be concentrations in each fraction. Although there is some variation in the grain size fraction that yields the highest erosion rate, generally, the coarser grain size fractions have higher erosion rates. More significant are the results when calculating the subcatchment erosion rates, which suggest that even medium sized grains (710 mm - 4 mm) are sampling an area smaller than the entire upstream area; this finding is consistent with the nonsensical results from the Neto River study. This result has numerous implications for the interpretations of 10Be erosion rates: most importantly, an alluvial sample may not be averaging the entire upstream area, even when using the sand size fraction - resulting erosion rates more pertinent for that sample point rather than the entire catchment.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1609179','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1609179"><span>Loss of imprinting at the Dlk1-Gtl2 locus caused by insertional mutagenesis in the Gtl2 5' region</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Steshina, Ekaterina Y; Carr, Michael S; Glick, Elena A; Yevtodiyenko, Aleksey; Appelbe, Oliver K; Schmidt, Jennifer V</p> <p>2006-01-01</p> <p>Background The Dlk1 and Gtl2 genes define a region of mouse chromosome 12 that is subject to genomic imprinting, the parental allele-specific expression of a gene. Although imprinted genes play important roles in growth and development, the mechanisms by which imprinting is established and maintained are poorly understood. Differentially methylated regions (DMRs), which carry methylation on only one parental allele, are involved in imprinting control at many loci. The Dlk1-Gtl2 region contains three known DMRs, the Dlk1 DMR in the 3' region of Dlk1, the intergenic DMR 15 kb upstream of Gtl2, and the Gtl2 DMR at the Gtl2 promoter. Three mouse models are analyzed here that provide new information about the regulation of Dlk1-Gtl2 imprinting. Results A previously existing insertional mutation (Gtl2lacZ), and a targeted deletion in which the Gtl2 upstream region was replaced by a Neo cassette (Gtl2Δ5'Neo), display partial lethality and dwarfism upon paternal inheritance. Molecular characterization shows that both mutations cause loss of imprinting and changes in expression of the Dlk1, Gtl2 and Meg8/Rian genes. Dlk1 levels are decreased upon paternal inheritance of either mutation, suggesting Dlk1 may be causative for the lethality and dwarfism. Loss of imprinting on the paternal chromosome in both Gtl2lacZ and Gtl2Δ5'Neo mice is accompanied by the loss of paternal-specific Gtl2 DMR methylation, while maternal loss of imprinting suggests a previously unknown regulatory role for the maternal Gtl2 DMR. Unexpectedly, when the Neo gene is excised, Gtl2Δ5' animals are of normal size, imprinting is unchanged and the Gtl2 DMR is properly methylated. The exogenous DNA sequences integrated upstream of Gtl2 are therefore responsible for the growth and imprinting effects. Conclusion These data provide further evidence for the coregulation of the imprinted Dlk1 and Gtl2 genes, and support a role for Dlk1 as an important neonatal growth factor. The ability of the Gtl2lacZ and Gtl2Δ5'Neo mutations to cause long-range changes in imprinting and gene expression suggest that regional imprinting regulatory elements may lie in proximity to the integration site. PMID:17014736</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26812351','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26812351"><span>Predicting the Maximum Earthquake Magnitude from Seismic Data in Israel and Its Neighboring Countries.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Last, Mark; Rabinowitz, Nitzan; Leonard, Gideon</p> <p>2016-01-01</p> <p>This paper explores several data mining and time series analysis methods for predicting the magnitude of the largest seismic event in the next year based on the previously recorded seismic events in the same region. The methods are evaluated on a catalog of 9,042 earthquake events, which took place between 01/01/1983 and 31/12/2010 in the area of Israel and its neighboring countries. The data was obtained from the Geophysical Institute of Israel. Each earthquake record in the catalog is associated with one of 33 seismic regions. The data was cleaned by removing foreshocks and aftershocks. In our study, we have focused on ten most active regions, which account for more than 80% of the total number of earthquakes in the area. The goal is to predict whether the maximum earthquake magnitude in the following year will exceed the median of maximum yearly magnitudes in the same region. Since the analyzed catalog includes only 28 years of complete data, the last five annual records of each region (referring to the years 2006-2010) are kept for testing while using the previous annual records for training. The predictive features are based on the Gutenberg-Richter Ratio as well as on some new seismic indicators based on the moving averages of the number of earthquakes in each area. The new predictive features prove to be much more useful than the indicators traditionally used in the earthquake prediction literature. The most accurate result (AUC = 0.698) is reached by the Multi-Objective Info-Fuzzy Network (M-IFN) algorithm, which takes into account the association between two target variables: the number of earthquakes and the maximum earthquake magnitude during the same year.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4727930','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4727930"><span>Predicting the Maximum Earthquake Magnitude from Seismic Data in Israel and Its Neighboring Countries</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p></p> <p>2016-01-01</p> <p>This paper explores several data mining and time series analysis methods for predicting the magnitude of the largest seismic event in the next year based on the previously recorded seismic events in the same region. The methods are evaluated on a catalog of 9,042 earthquake events, which took place between 01/01/1983 and 31/12/2010 in the area of Israel and its neighboring countries. The data was obtained from the Geophysical Institute of Israel. Each earthquake record in the catalog is associated with one of 33 seismic regions. The data was cleaned by removing foreshocks and aftershocks. In our study, we have focused on ten most active regions, which account for more than 80% of the total number of earthquakes in the area. The goal is to predict whether the maximum earthquake magnitude in the following year will exceed the median of maximum yearly magnitudes in the same region. Since the analyzed catalog includes only 28 years of complete data, the last five annual records of each region (referring to the years 2006–2010) are kept for testing while using the previous annual records for training. The predictive features are based on the Gutenberg-Richter Ratio as well as on some new seismic indicators based on the moving averages of the number of earthquakes in each area. The new predictive features prove to be much more useful than the indicators traditionally used in the earthquake prediction literature. The most accurate result (AUC = 0.698) is reached by the Multi-Objective Info-Fuzzy Network (M-IFN) algorithm, which takes into account the association between two target variables: the number of earthquakes and the maximum earthquake magnitude during the same year. PMID:26812351</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013EaSci..26..301E','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013EaSci..26..301E"><span>Continuous-cyclic variations in the b-value of the earthquake frequency-magnitude distribution</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>El-Isa, Z. H.</p> <p>2013-10-01</p> <p>Seismicity of the Earth ( M ≥ 4.5) was compiled from NEIC, IRIS and ISC catalogues and used to compute b-value based on various time windows. It is found that continuous cyclic b-variations occur on both long and short time scales, the latter being of much higher value and sometimes in excess of 0.7 of the absolute b-value. These variations occur not only yearly or monthly, but also daily. Before the occurrence of large earthquakes, b-values start increasing with variable gradients that are affected by foreshocks. In some cases, the gradient is reduced to zero or to a negative value a few days before the earthquake occurrence. In general, calculated b-values attain maxima 1 day before large earthquakes and minima soon after their occurrence. Both linear regression and maximum likelihood methods give correlatable, but variable results. It is found that an expanding time window technique from a fixed starting point is more effective in the study of b-variations. The calculated b-variations for the whole Earth, its hemispheres, quadrants and the epicentral regions of some large earthquakes are of both local and regional character, which may indicate that in such cases, the geodynamic processes acting within a certain region have a much regional effect within the Earth. The b-variations have long been known to vary with a number of local and regional factors including tectonic stresses. The results reported here indicate that geotectonic stress remains the most significant factor that controls b-variations. It is found that for earthquakes with M w ≥ 7, an increase of about 0.20 in the b-value implies a stress increase that will result in an earthquake with a magnitude one unit higher.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19750005993','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19750005993"><span>Analysis of the dynamic response of a supersonic inlet to flow-field perturbations upstream of the normal shock</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Cole, G. L.; Willoh, R. G.</p> <p>1975-01-01</p> <p>A linearized mathematical analysis is presented for determining the response of normal shock position and subsonic duct pressures to flow-field perturbations upstream of the normal shock in mixed-compression supersonic inlets. The inlet duct cross-sectional area variation is approximated by constant-area sections; this approximation results in one-dimensional wave equations. A movable normal shock separates the supersonic and subsonic flow regions, and a choked exit is assumed for the inlet exit condition. The analysis leads to a closed-form matrix solution for the shock position and pressure transfer functions. Analytical frequency response results are compared with experimental data and a method of characteristics solution.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19870015758&hterms=pick+rate&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D90%26Ntt%3Dpick%2Brate','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19870015758&hterms=pick+rate&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D90%26Ntt%3Dpick%2Brate"><span>The Comet Giacobini-Zinner magnetotail: Axial stresses and inferred near-nucleus properties</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Mccomas, D. J.; Gosling, J. T.; Bame, S. J.; Slavin, J. A.; Smith, E. J.; Steinberg, J. L.</p> <p>1986-01-01</p> <p>Utilizing the electron and magnetic field data from the ICE tail traversal of comet Giacobini-Zinner along with the MHD equations, a steady state, stress balance model of the cometary magnetotail was developed, and used to infer important but unmeasured ion properties within the magnetotail at ICE and upstream at the average point along each streamline where cometary ions are picked-up. The derived tailward ion flow speed at ICE is quite constant at approx. -20 to -30 km/sec across the entire tail. The flow velocity, ion temperature, density, and ion source rates upstream from the lobes (current sheet) at the average pick-up locations are approx. -75 km/sec (approx. -12), approx. 4 million K (approx. 100,000), approx. 20 cc (approx. 400), and approx. 15 cu cm/sec. Gradients in the plasma properties between the two regions are quite strong. Implications of inferred plasma properties for the near-nucleus region and for cometary magnetotail formation are examined.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19910061169&hterms=LAYER+LIMIT&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D50%26Ntt%3DLAYER%2BLIMIT','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19910061169&hterms=LAYER+LIMIT&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D50%26Ntt%3DLAYER%2BLIMIT"><span>The effect of varying Mach number on crossing, glancing shocks/turbulent boundary-layer interactions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Hingst, W. R.; Williams, K. E.</p> <p>1991-01-01</p> <p>Two crossing side-wall shocks interacting with a supersonic tunnel wall boundary layer have been investigated over a Mach number range of 2.5 to 4.0. The investigation included a range of equal shock strengths produced by shock generators at angles from 4.0 to 12.0 degrees. Results of flow visualization show that the interaction is unseparated at the low shock generator angles. With increasing shock strength, the flow begins to form a separated region that grows in size and moves forward and eventually the model unstarts. The wall static pressures show a symmetrical compression that merges on the centerline upstream of the inviscid shock locations and becomes more 1D downstream. The region of the 1D pressure gradient moves upstream with increasing shock strengths until it coincides with the leading edge of the shock generators at the limit before model unstart. At the limiting conditions the wall pressure gradients are primarily in the axial direction throughout.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/10091329','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/10091329"><span>A murC gene from coryneform bacteria.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K</p> <p>1999-02-01</p> <p>The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li class="active"><span>23</span></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_23 --> <div id="page_24" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li class="active"><span>24</span></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="461"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3857964','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3857964"><span>A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.</p> <p>2013-01-01</p> <p>Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24921298','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24921298"><span>Suppression of Rayleigh backscattering noise using cascaded-SOA and microwave photonic filter for 10 Gb/s loop-back WDM-PON.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Feng, Hanlin; Ge, Jia; Xiao, Shilin; Fok, Mable P</p> <p>2014-05-19</p> <p>In this paper, we present a novel Rayleigh backscattering (RB) noise mitigation scheme based on central carrier suppression for 10 Gb/s loop-back wavelength division multiplexing passive optical network (WDM-PON). Microwave modulated multi-subcarrier optical signal is used as downstream seeding light, while cascaded semiconductor optical amplifier (SOA) are used in the optical network unit (ONU) for suppressing the central carrier of the multi-subcarrier upstream signal. With central carrier suppression, interference generated by carrier RB noise at low frequency region is eliminated successfully. Transmission performance over 45 km single mode fiber (SMF) is studied experimentally, and the optical-signal-to-Rayleigh-noise-ratio (OSRNR) can be reduced to 15 dB with central carrier suppression ratio (CCSR) of 21 dB. Receiver sensitivity is further improved by 6 dB with the use of microwave photonic filter (MPF) for suppressing residual upstream microwave signal and residual carrier RB at high frequency region.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22599936-particle-cell-simulation-study-scaling-asymmetric-magnetic-reconnection-plane-flow-shear','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22599936-particle-cell-simulation-study-scaling-asymmetric-magnetic-reconnection-plane-flow-shear"><span>Particle-in-cell simulation study of the scaling of asymmetric magnetic reconnection with in-plane flow shear</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Doss, C. E.; Cassak, P. A., E-mail: Paul.Cassak@mail.wvu.edu; Swisdak, M.</p> <p>2016-08-15</p> <p>We investigate magnetic reconnection in systems simultaneously containing asymmetric (anti-parallel) magnetic fields, asymmetric plasma densities and temperatures, and arbitrary in-plane bulk flow of plasma in the upstream regions. Such configurations are common in the high-latitudes of Earth's magnetopause and in tokamaks. We investigate the convection speed of the X-line, the scaling of the reconnection rate, and the condition for which the flow suppresses reconnection as a function of upstream flow speeds. We use two-dimensional particle-in-cell simulations to capture the mixing of plasma in the outflow regions better than is possible in fluid modeling. We perform simulations with asymmetric magnetic fields,more » simulations with asymmetric densities, and simulations with magnetopause-like parameters where both are asymmetric. For flow speeds below the predicted cutoff velocity, we find good scaling agreement with the theory presented in Doss et al. [J. Geophys. Res. 120, 7748 (2015)]. Applications to planetary magnetospheres, tokamaks, and the solar wind are discussed.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015AGUFMNH51B1865A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015AGUFMNH51B1865A"><span>Upstream Structural Management Measures for an Urban Area Flooding in Turkey and their Consequences on Flood Risk Management</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Akyurek, Z.; Bozoglu, B.; Girayhan, T.</p> <p>2015-12-01</p> <p>Flooding has the potential to cause significant impacts to economic activities as well as to disrupt or displace populations. Changing climate regimes such as extreme precipitation events increase flood vulnerability and put additional stresses on infrastructure. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is done. MIKE21 with flexible grid is used in 2- dimensional shallow water flow modelling. 1/1000 scaled maps with the buildings for the urbanized area and 1/5000 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of Q5 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The effects of the available structures like bridges across the river on the flooding are presented. The upstream structural measures are studied on scenario basis. Four sub-catchments of Terme River are considered as contributing the downstream flooding. The existing circumstance of the Terme River states that the meanders of the river have a major effect on the flood situation and lead to approximately 35% reduction in the peak discharge between upstream and downstream of the river. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in at least two of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed. Flood risk is obtained by using the flood hazard maps and water depth-damage functions plotted for a variety of building types and occupancies. The estimated mean annual hazard for the area is calculated as $340 000 and it is estimated that the upstream structural management measures can decrease the direct economic risk 11% for the 500 return period flood.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/273458-genomic-structure-promoter-identification-chromosomal-mapping-mouse-nuclear-orphan-receptor-expressed-embryos-adult-testes','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/273458-genomic-structure-promoter-identification-chromosomal-mapping-mouse-nuclear-orphan-receptor-expressed-embryos-adult-testes"><span>Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Lee, C.H.; Wei, Li-Na; Copeland, N.G.</p> <p></p> <p>We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24324617','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24324617"><span>Transcriptional activation of Mina by Sp1/3 factors.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark</p> <p>2013-01-01</p> <p>Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3851307','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3851307"><span>Transcriptional Activation of Mina by Sp1/3 Factors</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark</p> <p>2013-01-01</p> <p>Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/19847826','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/19847826"><span>pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo</p> <p>2009-11-23</p> <p>Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70032011','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70032011"><span>Probable flood predictions in ungauged coastal basins of El Salvador</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Friedel, M.J.; Smith, M.E.; Chica, A.M.E.; Litke, D.</p> <p>2008-01-01</p> <p>A regionalization procedure is presented and used to predict probable flooding in four ungauged coastal river basins of El Salvador: Paz, Jiboa, Grande de San Miguel, and Goascoran. The flood-prediction problem is sequentially solved for two regions: upstream mountains and downstream alluvial plains. In the upstream mountains, a set of rainfall-runoff parameter values and recurrent peak-flow discharge hydrographs are simultaneously estimated for 20 tributary-basin models. Application of dissimilarity equations among tributary basins (soft prior information) permitted development of a parsimonious parameter structure subject to information content in the recurrent peak-flow discharge values derived using regression equations based on measurements recorded outside the ungauged study basins. The estimated joint set of parameter values formed the basis from which probable minimum and maximum peak-flow discharge limits were then estimated revealing that prediction uncertainty increases with basin size. In the downstream alluvial plain, model application of the estimated minimum and maximum peak-flow hydrographs facilitated simulation of probable 100-year flood-flow depths in confined canyons and across unconfined coastal alluvial plains. The regionalization procedure provides a tool for hydrologic risk assessment and flood protection planning that is not restricted to the case presented herein. ?? 2008 ASCE.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3243562','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3243562"><span>Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.</p> <p>2011-01-01</p> <p>Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2990329','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2990329"><span>Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.</p> <p>2006-01-01</p> <p>The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015JPhCS.625a2014B','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015JPhCS.625a2014B"><span>A wind-tunnel investigation of wind-turbine wakes in yawed conditions</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Bastankhah, Majid; Porté-Agel, Fernando</p> <p>2015-06-01</p> <p>Wind-tunnel experiments were performed to study the performance of a model wind turbine and its wake characteristics in a boundary layer under different operating conditions, including different yaw angles and tip speed ratios. High-resolution particle image- velocimetry (PIV) was used to measure the three velocity components in a horizontal plane at hub height covering a broad streamwise range from upstream of the turbine to the far- wake region. Additionally, thrust and power coefficients of the turbine were measured under different conditions. These power and thrust measurements, together with the highly-resolved flow measurements, enabled us to systematically study different wake properties. The near-wake region is found to have a highly complex structure influenced by different factors such as tip speed ratio and wake rotation. In particular, for higher tip speed ratios, a noticeable speed-up region is observed in the central part of near wake, which greatly affects the flow distribution in this region. In this regard, the behavior of the near wake for turbines with similar thrust coefficients but different tip speed ratios can vary widely. In contrast, it is shown that the mean streamwise velocity in the far wake of the turbine with zero yaw angle has a self-similar Gaussian distribution, and the strength of wake in this region is consistent with the magnitude of the thrust coefficient. With increasing yaw angle, as expected, the power and thrust coefficients decrease, and the wake deflection increases. The measurements also reveal that, in addition to turbulent momentum flux, lateral mean momentum flux boosts the flow entrainment in only one side of the wake, which results in a faster wake recovery in that side. It is also found that the induced velocity upstream of a yawed turbine has a non-symmetric distribution, and its distribution is in agreement with the available model in the literature. Moreover, the results suggest that in order to accurately predict the load distribution in yawed conditions, both normal and tangential (with respect to the rotor plane) components of the induced velocity upstream of the turbine should be taken into account.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/10445505','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/10445505"><span>Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Yamasu, K; Wilt, F H</p> <p>1999-02-01</p> <p>The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22732326','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22732326"><span>A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J</p> <p>2012-09-01</p> <p>Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/21284852','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/21284852"><span>Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Nadjar-Boger, Elisabeth; Funkenstein, Bruria</p> <p>2011-02-01</p> <p>Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018PIAHS.379..403L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018PIAHS.379..403L"><span>Connections between meteorological and hydrological droughts in a semi-arid basin of the middle Yellow River</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Li, Binquan; Zhu, Changchang; Liang, Zhongmin; Wang, Guoqing; Zhang, Yu</p> <p>2018-06-01</p> <p>Differences between meteorological and hydrological droughts could reflect the regional water consumption by both natural elements and human water-use. The connections between these two drought types were analyzed using the Standardized Precipitation Evapotranspiration Index (SPEI) and Standardized Streamflow Index (SSI), respectively. In a typical semi-arid basin of the middle Yellow River (Qingjianhe River basin), annual precipitation and air temperature showed significantly downward and upward trends, respectively, with the rates of -2.37 mm yr-1 and 0.03 °C yr-1 (1961-2007). Under their synthetic effects, water balance variable (represented by SPEI) showed obviously downward (drying) trend at both upstream and whole basin areas. For the spatial variability of precipitation, air temperature and the calculated SPEI, both upstream and downstream areas experienced very similar change characteristics. Results also suggested that the Qingjianhe River basin experienced near normal condition during the study period. As a whole, this semi-arid basin mainly had the meteorological drought episodes in the mid-1960s, late-1990s and the 2000s depicted by 12-month SPEI. The drying trend could also be depicted by the hydrological drought index (12-month SSI) at both upstream and downstream stations (Zichang and Yanchuan), but the decreasing trends were not significant. A correlation analysis showed that hydrological system responds rapidly to the change of meteorological conditions in this semi-arid region. This finding could be an useful implication to drought research for those semi-arid basins with intensive human activities.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=362267','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=362267"><span>Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Stone, D E; Craig, E A</p> <p>1990-01-01</p> <p>To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2009AGUFMNH12A..07J','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2009AGUFMNH12A..07J"><span>Report of the International Commission on Earthquake Forecasting for Civil Protection (Invited)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Jordan, T. H.</p> <p>2009-12-01</p> <p>The destructive L’Aquila earthquake of 6 April 2009 (Mw 6.3) illustrates the challenges of operational earthquake forecasting. The earthquake ruptured a mapped normal fault in a region identified by long-term forecasting models as one of the most seismically dangerous in Italy; it was the strongest of a rich sequence that started several months earlier and included a M3.9 foreshock less than five hours prior to the mainshock. According to widely circulated news reports, the earthquake had been predicted by a local resident using unpublished radon-based techniques, provoking a public controversy prior to the event that intensified in its wake. Several weeks after the earthquake, the Italian Department of Civil Protection appointed an international commission with the mandate to report on the current state of knowledge of prediction and forecasting and guidelines for operational utilization. The commission included geoscientists from China, France, Germany, Greece, Italy, Japan, Russia, United Kingdom, and United States with experience in earthquake forecasting and prediction. This presentation by the chair of the commission will report on its findings and recommendations.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/pages/biblio/1347920-turbulence-heating-observer-satellite-mission-proposal','SCIGOV-DOEP'); return false;" href="https://www.osti.gov/pages/biblio/1347920-turbulence-heating-observer-satellite-mission-proposal"><span>Turbulence Heating ObserveR – satellite mission proposal</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/pages">DOE PAGES</a></p> <p>Vaivads, A.; Retinò, A.; Soucek, J.; ...</p> <p>2016-09-22</p> <p>The Universe is permeated by hot, turbulent, magnetized plasmas. Turbulent plasma is a major constituent of active galactic nuclei, supernova remnants, the intergalactic and interstellar medium, the solar corona, the solar wind and the Earth’s magnetosphere, just to mention a few examples. Furthermore, energy dissipation of turbulent fluctuations plays a key role in plasma heating and energization, yet we still do not understand the underlying physical mechanisms involved.THOR is a mission designed to answer the questions of how turbulent plasma is heated and particles accelerated, how the dissipated energy is partitioned and how dissipation operates in different regimes of turbulence.THOR is amore » single-spacecraft mission with an orbit tuned to maximize data return from regions in near-Earth space – magnetosheath, shock, foreshock and pristine solar wind – featuring different kinds of turbulence. We summarize theTHOR proposal submitted on 15 January 2015 to the ‘Call for a Medium-size mission opportunity in ESAs Science Programme for a launch in 2025 (M4)’.THOR has been selected by European Space Agency (ESA) for the study phase.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1347920','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1347920"><span>Turbulence Heating ObserveR – satellite mission proposal</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Vaivads, A.; Retinò, A.; Soucek, J.</p> <p></p> <p>The Universe is permeated by hot, turbulent, magnetized plasmas. Turbulent plasma is a major constituent of active galactic nuclei, supernova remnants, the intergalactic and interstellar medium, the solar corona, the solar wind and the Earth’s magnetosphere, just to mention a few examples. Furthermore, energy dissipation of turbulent fluctuations plays a key role in plasma heating and energization, yet we still do not understand the underlying physical mechanisms involved.THOR is a mission designed to answer the questions of how turbulent plasma is heated and particles accelerated, how the dissipated energy is partitioned and how dissipation operates in different regimes of turbulence.THOR is amore » single-spacecraft mission with an orbit tuned to maximize data return from regions in near-Earth space – magnetosheath, shock, foreshock and pristine solar wind – featuring different kinds of turbulence. We summarize theTHOR proposal submitted on 15 January 2015 to the ‘Call for a Medium-size mission opportunity in ESAs Science Programme for a launch in 2025 (M4)’.THOR has been selected by European Space Agency (ESA) for the study phase.« less</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li class="active"><span>24</span></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_24 --> <div id="page_25" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li class="active"><span>25</span></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="481"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/14603312','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/14603312"><span>Enhancements of energetic particles near the heliospheric termination shock.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>McDonald, Frank B; Stone, Edward C; Cummings, Alan C; Heikkila, Bryant; Lal, Nand; Webber, William R</p> <p>2003-11-06</p> <p>The spacecraft Voyager 1 is at a distance greater than 85 au from the Sun, in the vicinity of the termination shock that marks the abrupt slowing of the supersonic solar wind and the beginning of the extended and unexplored distant heliosphere. This shock is expected to accelerate 'anomalous cosmic rays', as well as to re-accelerate Galactic cosmic rays and low-energy particles from the inner Solar System. Here we report a significant increase in the numbers of energetic ions and electrons that persisted for seven months beginning in mid-2002. This increase differs from any previously observed in that there was a simultaneous increase in Galactic cosmic ray ions and electrons, anomalous cosmic rays and low-energy ions. The low-intensity level and spectral energy distribution of the anomalous cosmic rays, however, indicates that Voyager 1 still has not reached the termination shock. Rather, the observed increase is an expected precursor event. We argue that the radial anisotropy of the cosmic rays is expected to be small in the foreshock region, as is observed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1986751','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1986751"><span>Functional Architecture of T7 RNA Polymerase Transcription Complexes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Nayak, Dhananjaya; Guo, Qing; Sousa, Rui</p> <p>2007-01-01</p> <p>Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19820004170','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19820004170"><span>Interaction of upstream flow distortions with high Mach number cascades</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Englert, G. W.</p> <p>1981-01-01</p> <p>Features of the interaction of flow distortions, such as gusts and wakes with blade rows of advance type fans and compressors having high tip Mach numbers are modeled. A typical disturbance was assumed to have harmonic time dependence and was described, at a far upstream location, in three orthogonal spatial coordinates by a double Fourier series. It was convected at supersonic relative to a linear cascade described as an unrolled annulus. Conditions were selected so that the component of this velocity parallel to the axis of the turbomachine was subsonic, permitting interaction between blades through the upstream as well as downstream flow media. A strong, nearly normal shock was considered in the blade passages which was allowed curvature and displacement. The flows before and after the shock were linearized relative to uniform mean velocities in their respective regions. Solution of the descriptive equations was by adaption of the Wiener-Hopf technique, enabling a determination of distortion patterns through and downstream of the cascade as well as pressure distributions on the blade and surfaces. Details of interaction of the disturbance with the in-passage shock were discussed. Infuences of amplitude, wave length, and phase of the disturbance on lifts and moments of cascade configurations are presented. Numerical results are clarified by reference to an especially orderly pattern of upstream vertical motion in relation to the cascade parameters.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=344663','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=344663"><span>Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M</p> <p>1984-01-01</p> <p>Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017APS..DPPP11110S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017APS..DPPP11110S"><span>Observation of the effects of stronger magnetic fields on warm, higher energy electrons and ion beams transiting a double layer in a helicon plasma</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Scharer, John; Sung, Yung-Ta; Li, Yan</p> <p>2017-10-01</p> <p>Fast, two-temperature electrons (>80 eV, Te =13 eV tail, 4 eV bulk) with substantial tail density fractions are created at low (< = 1.7 mtorr) Ar pressure @ 340 G in the antenna region with nozzle mirror ratio of 1.4 on MadHeX @ 900W. These distributions including a fast tail are observed upstream of a double layer. The fast, untrapped tail electrons measured downstream of the double layer have a higher temperature of 13 eV than the trapped, upstream electrons of 4 eV temperature. Upstream plasma potential fluctuations of + - 30 percent are observed. An RF-compensated Langmuir probe is used to measure the electron temperatures and densities and OES, mm wave IF and an RPA for the IEDF are also utilized. As the magnetic field is increased to 1020 G, an increase in the electron temperature and density upstream of the double layer is observed with Te= 15-25 eV with a primarily single temperature mode. Accelerated ion beam energies in the range of 65-120 eV are observed as the magnetic field is increased from 340 to 850 G. The role of the nozzle, plasma double layer and helicon wave coupling on the EEDF and ion acceleration will be discussed. Research supported in part by the University of Wisconsin.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27531611','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27531611"><span>Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning</p> <p>2016-08-01</p> <p>miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=310662&Lab=NERL&keyword=MATH&actType=&TIMSType=+&TIMSSubTypeID=&DEID=&epaNumber=&ntisID=&archiveStatus=Both&ombCat=Any&dateBeginCreated=&dateEndCreated=&dateBeginPublishedPresented=&dateEndPublishedPresented=&dateBeginUpdated=&dateEndUpdated=&dateBeginCompleted=&dateEndCompleted=&personID=&role=Any&journalID=&publisherID=&sortBy=revisionDate&count=50','EPA-EIMS'); return false;" href="https://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=310662&Lab=NERL&keyword=MATH&actType=&TIMSType=+&TIMSSubTypeID=&DEID=&epaNumber=&ntisID=&archiveStatus=Both&ombCat=Any&dateBeginCreated=&dateEndCreated=&dateBeginPublishedPresented=&dateEndPublishedPresented=&dateBeginUpdated=&dateEndUpdated=&dateBeginCompleted=&dateEndCompleted=&personID=&role=Any&journalID=&publisherID=&sortBy=revisionDate&count=50"><span>: Signal Decomposition of High Resolution Time Series River data to Separate Local and Regional Components of Conductivity</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://oaspub.epa.gov/eims/query.page">EPA Science Inventory</a></p> <p></p> <p></p> <p>Signal processing techniques were applied to high-resolution time series data obtained from conductivity loggers placed upstream and downstream of a wastewater treatment facility along a river. Data was collected over 14-60 days, and several seasons. The power spectral densit...</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://rosap.ntl.bts.gov/view/dot/29740','DOTNTL'); return false;" href="https://rosap.ntl.bts.gov/view/dot/29740"><span>Analysis and prediction of spatiotemporal impact of traffic incidents for better mobility and safety in transportation systems.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntlsearch.bts.gov/tris/index.do">DOT National Transportation Integrated Search</a></p> <p></p> <p>2015-12-01</p> <p>The goal of this research is to develop a machine learning framework to predict the spatiotemporal impact : of traffic accidents on the upstream traffic and surrounding region. The main objective of the framework : is, given a road accident, to forec...</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AGUFMSM41D2463L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AGUFMSM41D2463L"><span>The effects of upstream plasma properties on Titan's ionosphere</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ledvina, S. A.; Brecht, S. H.</p> <p>2016-12-01</p> <p>Cassini observations have found that the plasma and magnetic field conditions upstream of Titan are far more complex than they were thought to be after the Voyager encounter. Rymer et al., (2009) used the Cassini Plasma Spectrometer (CAPS) electron observations to classify the plasma conditions along Titan's orbit into 5 types (Plasma Sheet, Lobe, Mixed, Magnetosheath and Misc.). Nemeth et al., (2011) found that the CAPS ion observations could also be separated into the same plasma regions as defined by Rymer et al. Additionally the T-96 encounter found Titan in the solar wind adding a sixth classification. Understanding the effects of the variable upstream plasma conditions on Titan's plasma interaction and the evolution of Titan's ionosphere/atmosphere is one of the main objectives of the Cassini mission. To compliment the mission we perform hybrid simulations of Titan's plasma interaction to examine how the properties of the incident plasma (composition, density, temperature etc…) affect Titan's ionosphere. We examine how much ionospheric plasma is lost from Titan as well as the amount of mass and energy deposited into Titan's atmosphere.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014ExFl...55.1658K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014ExFl...55.1658K"><span>Unsteady loading of a vertical-axis turbine in the interaction with an upstream deflector</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Kim, Daegyoum; Gharib, Morteza</p> <p>2014-01-01</p> <p>Torque generation and flow distribution of a lift-based vertical-axis turbine with an upstream deflecting plate are investigated in water tunnel experiments. The deployment of a deflector in front of a lift-based turbine is a promising approach to increase local flow velocity and enhance energy conversion efficiency without consideration for complicated control. For the turbine with the deflector, the phase during which the blade passes near the front end of the turbine has a major contribution to torque increase from the case without the deflector. Meanwhile, the deflector can have a negative effect in torque generation at the phase when the blade moves upstream against free stream if the turbine is placed close to the deflector in a crosswise direction. The change of nearby flow distribution by the deflector is also examined to find its correlation with torque generation. When the blade rotates through the near-wake region of the deflector, the blade can collides with the vortical structure shed from the deflector. This interaction causes significant torque fluctuation.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/21143640-identification-p53-response-element-promoter-proline-oxidase-gene','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/21143640-identification-p53-response-element-promoter-proline-oxidase-gene"><span>Identification of a p53-response element in the promoter of the proline oxidase gene</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Maxwell, Steve A.; Kochevar, Gerald J.</p> <p>2008-05-02</p> <p>Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24494485','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24494485"><span>Assessment and management of the performance risk of a pilot reclaimed water disinfection process.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Zhou, Guangyu; Zhao, Xinhua; Zhang, Lei; Wu, Qing</p> <p>2013-10-01</p> <p>Chlorination disinfection has been widely used in reclaimed water treatment plants to ensure water quality. In order to assess the downstream quality risk of a running reclaimed water disinfection process, a set of dynamic equations was developed to simulate reactions in the disinfection process concerning variables of bacteria, chemical oxygen demand (COD), ammonia and monochloramine. The model was calibrated by the observations obtained from a pilot disinfection process which was designed to simulate the actual process in a reclaimed water treatment plant. A Monte Carlo algorithm was applied to calculate the predictive effluent quality distributions that were used in the established hierarchical assessment system for the downstream quality risk, and the key factors affecting the downstream quality risk were defined using the Regional Sensitivity Analysis method. The results showed that the seasonal upstream quality variation caused considerable downstream quality risk; the effluent ammonia was significantly influenced by its upstream concentration; the upstream COD was a key factor determining the process effluent risk of bacterial, COD and residual disinfectant indexes; and lower COD and ammonia concentrations in the influent would mean better downstream quality.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23328964','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23328964"><span>LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Hobson, Neil; Deyholos, Michael K</p> <p>2013-04-01</p> <p>Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=365441','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=365441"><span>The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Williams, N P; Mueller, P P; Hinnebusch, A G</p> <p>1988-01-01</p> <p>Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/264551','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/biblio/264551"><span>Fuel combustion exhibiting low NO{sub x} and CO levels</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Keller, J.O.; Bramlette, T.T.; Barr, P.K.</p> <p>1996-07-30</p> <p>Method and apparatus are disclosed for safely combusting a fuel in such a manner that very low levels of NO{sub x} and CO are produced. The apparatus comprises an inlet line containing a fuel and an inlet line containing an oxidant. Coupled to the fuel line and to the oxidant line is a mixing means for thoroughly mixing the fuel and the oxidant without combusting them. Coupled to the mixing means is a means for injecting the mixed fuel and oxidant, in the form of a large-scale fluid dynamic structure, into a combustion region. Coupled to the combustion region is a means for producing a periodic flow field within the combustion region to mix the fuel and the oxidant with ambient gases in order to lower the temperature of combustion. The means for producing a periodic flow field can be a pulse combustor, a rotating band, or a rotating cylinder within an acoustic chamber positioned upstream or downstream of the region of combustion. The mixing means can be a one-way flapper valve; a rotating cylinder; a rotating band having slots that expose open ends of said fuel inlet line and said oxidant inlet line simultaneously; or a set of coaxial fuel annuli and oxidizer annuli. The means for producing a periodic flow field may or may not be in communication with an acoustic resonance. When employed, the acoustic resonance may be upstream or downstream of the region of combustion. 14 figs.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19870011824','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19870011824"><span>Flowfield measurements in a separated and reattached flat plate turbulent boundary layer</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Patrick, William P.</p> <p>1987-01-01</p> <p>The separation and reattachment of a large-scale, two-dimensional turbulent boundary layer at low subsonic speed on a flat plate has been studied experimentally. The separation bubble was 55 cm long and had a maximum bubble thickness, measured to the height of the mean dividing streamline, of 17 cm, which was twice the thickness of the inlet boundary layer. A combination of laser velocimetry, hot-wire anemometry, pneumatic probing techniques, and flow visualization were used as diagnostics. Principal findings were that an outer inviscid rotational flow was defined which essentially convected over the blockage associated with the inner, viscously dominated bubble recirculation region. A strong backflow region in which the flow moved upstream 100 percent of the time was measured near the test surface over the central 35 percent of the bubble. A laminar backflow boundary layer having pseudo-turbulent characteristics including a log-linear velocity profile was generated under the highly turbulent backflow. Velocity profile shapes in the reversed flow region matched a previously developed universal backflow profile at the upstream edge of the separation region but not in the steady backflow region downstream. A smoke flow visualization movie and hot-film measurements revealed low frequency nonperiodic flapping at reattachment. However, forward flow fraction data at reattachment and mean velocity profiles in the redeveloping boundary layer downstream of reattachment correlated with backward-facing step data when the axial dimension was scaled by the distance from the maximum bubble thickness to reattachment.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1994PNAS...91.7340A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1994PNAS...91.7340A"><span>Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.</p> <p>1994-07-01</p> <p>We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015AGUFMSM31A2479H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015AGUFMSM31A2479H"><span>The Interaction Between the Magnetosphere of Mars and that of Comet Siding Spring</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Holmstrom, M.; Futaana, Y.; Barabash, S. V.</p> <p>2015-12-01</p> <p>On 19 October 2014 the comet Siding Spring flew by Mars. This was a unique opportunity to study the interaction between a cometary and a planetary magnetosphere. Here we model the magnetosphere of the comet using a hybrid plasma solver (ions as particles, electrons as a fluid). The undisturbed upstream solar wind ion conditions are estimated from observations by ASPERA-3/IMA on Mars Express during several orbits. It is found that Mars probably passed through a solar wind that was disturbed by the comet during the flyby. The uncertainty derives from that the size of the disturbed solar wind region in the comet simulation is sensitive to the assumed upstream solar wind conditions, especially the solar wind proton density.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17769077','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17769077"><span>Earth's Bow Shock: Elapsed-Time Observations by Two Closely Spaced Satellites.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Greenstadt, E W; Green, I M; Colburn, D S</p> <p>1968-11-22</p> <p>Coordinated observations of the earth's bow shock were made as Vela 3A and Explorer 33 passed within 6 earth radii of each other. Elapsed time measurements of shock motion give directly determined velocities in the range 1 to 10 kilometers per second and establish the existence of two regions, one of large amplitude magnetic "shock" oscillations and another of smaller, sunward, upstream oscillations. Each region is as thick as 1 earth radius, or more.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.fs.usda.gov/treesearch/pubs/9053','TREESEARCH'); return false;" href="https://www.fs.usda.gov/treesearch/pubs/9053"><span>Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.fs.usda.gov/treesearch/">Treesearch</a></p> <p>Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna</p> <p>2004-01-01</p> <p>A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li class="active"><span>25</span></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_25 --> <div class="footer-extlink text-muted" style="margin-bottom:1rem; text-align:center;">Some links on this page may take you to non-federal websites. Their policies may differ from this site.</div> </div><!-- container --> <a id="backToTop" href="#top"> Top </a> <footer> <nav> <ul class="links"> <li><a href="/sitemap.html">Site Map</a></li> <li><a href="/website-policies.html">Website Policies</a></li> <li><a href="https://www.energy.gov/vulnerability-disclosure-policy" target="_blank">Vulnerability Disclosure Program</a></li> <li><a href="/contact.html">Contact Us</a></li> </ul> </nav> </footer> <script type="text/javascript"><!-- // var lastDiv = ""; function showDiv(divName) { // hide last div if (lastDiv) { document.getElementById(lastDiv).className = "hiddenDiv"; } //if value of the box is not nothing and an object with that name exists, then change the class if (divName && document.getElementById(divName)) { document.getElementById(divName).className = "visibleDiv"; lastDiv = divName; } } //--> </script> <script> /** * Function that tracks a click on an outbound link in Google Analytics. * This function takes a valid URL string as an argument, and uses that URL string * as the event label. */ var trackOutboundLink = function(url,collectionCode) { try { h = window.open(url); setTimeout(function() { ga('send', 'event', 'topic-page-click-through', collectionCode, url); }, 1000); } catch(err){} }; </script> <!-- Google Analytics --> <script> (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){ (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o), m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m) })(window,document,'script','//www.google-analytics.com/analytics.js','ga'); ga('create', 'UA-1122789-34', 'auto'); ga('send', 'pageview'); </script> <!-- End Google Analytics --> <script> showDiv('page_1') </script> </body> </html>