Sample records for upstream hypersensitive site

  1. Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

    PubMed Central

    Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

    2003-01-01

    The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

  2. Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

    PubMed Central

    Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

    1997-01-01

    GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

  3. NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

    PubMed Central

    Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

    1995-01-01

    The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

  4. Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

    PubMed Central

    Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

    2011-01-01

    Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

  5. Analysis of chromatin structure of rat alpha1-acid glycoprotein gene; changes in DNase I hypersensitive sites after thyroid hormone, glucocorticoid hormone and turpentine oil treatment.

    PubMed Central

    Matsukawa, T; Kawasaki, H; Tanaka, M; Ohba, Y

    1997-01-01

    Transcription of the ratalpha1-acid glycoprotein (AGP) gene is activated by glucocorticoid, thyroid hormone (T3) and cytokines. Following these treatments, the chromatin structure of this gene was analyzed by means of digestion with DNase I or micrococcal nuclease. Four DNase I hypersensitive sites were observed in the 5'-upstream region of the rat AGP gene of liver cells. They were designated HS1, HS2, HS3 and HS4 (3'-->5'). After T3treatment the sensitivity of HS1 and HS2 increased and after dexamethasone (Dex) treatment that of all four sites did so. Three new sites appeared after turpentine oil treatment, while the sensitivities of HS3 and HS4 increased. We conclude that transcriptional activation of the gene by T3and Dex have very similar mechanisms, but that at the inflammation stage they become slightly different. The increase in sensitivity at HS1 and HS2 after T3treatment in vivo was successfully reproduced in a cell-free system by in vitro treatment with T3. HS1, HS2 and HS3 were also sensitive for micrococcal nuclease. PMID:9185575

  6. Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

    PubMed

    Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

    2010-07-01

    Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

  7. Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers

    PubMed Central

    Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.

    2007-01-01

    Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009

  8. Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

    PubMed

    Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

    2006-08-15

    The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

  9. Nucleosome exclusion from the interspecies-conserved central AT-rich region of the Ars insulator.

    PubMed

    Takagi, Haruna; Inai, Yuta; Watanabe, Shun-ichiro; Tatemoto, Sayuri; Yajima, Mamiko; Akasaka, Koji; Yamamoto, Takashi; Sakamoto, Naoaki

    2012-01-01

    The Ars insulator is a boundary element identified in the upstream region of the arylsulfatase (HpArs) gene in the sea urchin, Hemicentrotus pulcherrimus, and possesses the ability to both block enhancer-promoter communications and protect transgenes from silent chromatin. To understand the molecular mechanism of the Ars insulator, we investigated the correlation between chromatin structure, DNA structure and insulator activity. Nuclease digestion of nuclei isolated from sea urchin embryos revealed the presence of a nuclease-hypersensitive site within the Ars insulator. Analysis of micrococcal nuclease-sensitive sites in the Ars insulator, reconstituted with nucleosomes, showed the exclusion of nucleosomes from the central AT-rich region. Furthermore, the central AT-rich region in naked DNA was sensitive to nucleotide base modification by diethylpyrocarbonate (DEPC). These observations suggest that non-B-DNA structures in the central AT-rich region may inhibit nucleosomal formation, which leads to nuclease hypersensitivity. Furthermore, comparison of nucleotide sequences between the HpArs gene and its ortholog in Strongylocentrotus purpuratus revealed that the central AT-rich region of the Ars insulator is conserved, and this conserved region showed significant enhancer blocking activity. These results suggest that the central AT-rich nucleosome-free region plays an important role in the function of the Ars insulator.

  10. Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

    PubMed

    Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

    2015-09-01

    The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

  11. High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation.

    PubMed

    Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya A; Mergny, Jean-Louis; Salgado, Gilmar F

    2017-05-12

    Non-canonical base pairing within guanine-rich DNA and RNA sequences can produce G-quartets, whose stacking leads to the formation of a G-quadruplex (G4). G4s can coexist with canonical duplex DNA in the human genome and have been suggested to suppress gene transcription, and much attention has therefore focused on studying G4s in promotor regions of disease-related genes. For example, the human KRAS proto-oncogene contains a nuclease-hypersensitive element located upstream of the major transcription start site. The KRAS nuclease-hypersensitive element (NHE) region contains a G-rich element (22RT; 5'-AGGGCGGTGTGGGAATAGGGAA-3') and encompasses a Myc-associated zinc finger-binding site that regulates KRAS transcription. The NEH region therefore has been proposed as a target for new drugs that control KRAS transcription, which requires detailed knowledge of the NHE structure. In this study, we report a high-resolution NMR structure of the G-rich element within the KRAS NHE. We found that the G-rich element forms a parallel structure with three G-quartets connected by a four-nucleotide loop and two short one-nucleotide double-chain reversal loops. In addition, a thymine bulge is found between G8 and G9. The loops of different lengths and the presence of a bulge between the G-quartets are structural elements that potentially can be targeted by small chemical ligands that would further stabilize the structure and interfere or block transcriptional regulators such as Myc-associated zinc finger from accessing their binding sites on the KRAS promoter. In conclusion, our work suggests a possible new route for the development of anticancer agents that could suppress KRAS expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Recognition of the Xenopus ribosomal core promoter by the transcription factor xUBF involves multiple HMG box domains and leads to an xUBF interdomain interaction.

    PubMed

    Leblanc, B; Read, C; Moss, T

    1993-02-01

    The interaction of the ribosomal transcription factor xUBF with the RNA polymerase I core promoter of Xenopus laevis has been studied both at the DNA and protein levels. It is shown that a single xUBF-DNA complex forms over the 40S initiation site (+1) and involves at least the DNA sequences between -20 and +60 bp. DNA sequences upstream of +10 and downstream of +18 are each sufficient to direct complex formation independently. HMG box 1 of xUBF independently recognizes the sequences -20 to -1 and +1 to +22 and the addition of the N-terminal dimerization domain to HMG box 1 stabilizes its interaction with these sequences approximately 10-fold. HMG boxes 2/3 interact with the DNA downstream of +22 and can independently position xUBF across the initiation site. The C-terminal segment of xUBF, HMG boxes 4, 5 or the acidic domain, directly or indirectly interact with HMG box 1, making the core promoter sequences between -11 and -15 hypersensitive to DNase. This interaction also requires the DNA sequences between +17 and +32, i.e. the HMG box 2/3 binding site. The data suggest extensive folding of the core promoter within the xUBF complex.

  13. Preferential cleavage sites for Sau3A restriction endonuclease in human ribosomal DNA.

    PubMed

    Kupriyanova, N S; Kirilenko, P M; Netchvolodov, K K; Ryskov, A P

    2000-07-21

    Previous studies of cloned ribosomal DNA (rDNA) variants isolated from the cosmid library of human chromosome 13 have revealed some disproportion in representativity of different rDNA regions (N. S. Kupriyanova, K. K. Netchvolodov, P. M. Kirilenko, B. I. Kapanadze, N. K. Yankovsky, and A. P. Ryskov, Mol. Biol. 30, 51-60, 1996). Here we show nonrandom cleavage of human rDNA with Sau3A or its isoshizomer MboI under mild hydrolysis conditions. The hypersensitive cleavage sites were found to be located in the ribosomal intergenic spacer (rIGS), especially in the regions of about 5-5.5 and 11 kb upstream of the rRNA transcription start point. This finding is based on sequencing mapping of the rDNA insert ends in randomly selected cosmid clones of human chromosome 13 and on the data of digestion kinetics of cloned and noncloned human genomic rDNA with Sau3A and MboI. The results show that a methylation status and superhelicity state of the rIGS have no effect on cleavage site sensitivity. It is interesting that all primary cleavage sites are adjacent to or entering into Alu or Psi cdc 27 retroposons of the rIGS suggesting a possible role of neighboring sequences in nuclease accessibility. The results explain nonequal representation of rDNA sequences in the human genomic DNA library used for this study. Copyright 2000 Academic Press.

  14. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

  15. Cutaneous basophil anaphylaxis. Immediate vasopermeability increases and anaphylactic degranulation of basophils at delayed hypersensitivity reactions challenged with additional antigen.

    PubMed Central

    Askenase, P W; Debernardo, R; Tauben, D; Kashgarian, M

    1978-01-01

    Many delayed-type reactions contain large infiltrates of basophils whose function is unknown. We have studied these cutaneous basophil hypersensitivity (CBH) reactions in guinea-pigs to ascertain whether basophils that are recruited to delayed reaction sites could be triggered for immediate reactivity. We compared 24 h CBH reactions with nearby skin for immediate hypersensitivity by challenging each site with small amounts of antigen. CBH sites had augmented immediate increases in vascular permeability detected by extravasation of Evan's blue dye. The ability to elicit this augmented anaphylactic phenomenon correlated with the local presence of basophils, and light microscopy at CBH reactions 15 min after antigen challenge showed a 50% decline in basophil counts. Electron microscopy showed that progressive anaphylactic-type degranulation of local basophils occurred within minutes following reintroduction of antigen. There was fusion of vacuoles containing granules, exocytosis of granules, and dissolution of granules, without ultrastructural disruption of cellular integrity. These results establish that basophils in CBH reactions can be triggered with soluble antigen to undergo anaphylactic degranulation, with the immediate release of vasoactive mediators. We have termed this phenomenon 'cutaneous basophil anaphylaxis'. Thus, one function of basophils at sites of delayed hypersensitivity may be to provide the potential for augmented, local, immediate anaphylactic reactivity. Images Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:721140

  16. DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

    PubMed

    Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

    2010-05-07

    Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

  17. An outer membrane protein (porin) as an eliciting antigen for delayed-type hypersensitivity in murine salmonellosis.

    PubMed Central

    Udhayakumar, V; Muthukkaruppan, V R

    1987-01-01

    The porin, an outer membrane protein of Salmonella typhimurium, was found to be a suitable antigen for eliciting delayed-type hypersensitivity in mouse salmonellosis. Histological examination of the reaction site revealed that the porin was superior to other antigenic preparations in eliciting a typical delayed-type hypersensitivity reaction consisting of mononuclear cell infiltration without polymorphonuclear cell contamination. This study indicates the importance of using a suitable protein antigen from S. typhi for human application. Images PMID:3028963

  18. LhnR and upstream operon LhnABC in Agrobacterium vitis regulate the induction of tobacco hypersensitive responses, grape necrosis and swarming motility.

    PubMed

    Zheng, Desen; Hao, Guixia; Cursino, Luciana; Zhang, Hongsheng; Burr, Thomas J

    2012-09-01

    The characterization of Tn5 transposon insertional mutants of Agrobacterium vitis strain F2/5 revealed a gene encoding a predicted LysR-type transcriptional regulator, lhnR (for 'LysR-type regulator associated with HR and necrosis'), and an immediate upstream operon consisting of three open reading frames (lhnABC) required for swarming motility, surfactant production and the induction of a hypersensitive response (HR) on tobacco and necrosis on grape. The operon lhnABC is unique to A. vitis among the sequenced members in Rhizobiaceae. Mutagenesis of lhnR and lhnABC by gene disruption and complementation of ΔlhnR and ΔlhnABC confirmed their roles in the expression of these phenotypes. Mutation of lhnR resulted in complete loss of HR, swarming motility, surfactant production and reduced necrosis, whereas mutation of lhnABC resulted in loss of swarming motility, delayed and reduced HR development and reduced surfactant production and necrosis. The data from promoter-green fluorescent protein (gfp) fusions showed that lhnR suppresses the expression of lhnABC and negatively autoregulates its own expression. It was also shown that lhnABC negatively affects its own expression and positively affects the transcription of lhnR. lhnR and lhnABC constitute a regulatory circuit that coordinates the transcription level of lhnR, resulting in the expression of swarming, surfactant, HR and necrosis phenotypes. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

  19. Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

    PubMed

    Pakravan, Nafiseh; Hassan, Zuhair Mohammad

    2018-03-01

    Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

  20. Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

    PubMed Central

    Gilmartin, G M; Fleming, E S; Oetjen, J

    1992-01-01

    The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

  1. Probing chromatin structure with nuclease sensitivity assays.

    PubMed

    Gregory, R I; Khosla, S; Feil, R

    2001-01-01

    To further our understanding of genomic imprinting it will be essential to identify key control elements, and to investigate their regulation by both epigenetic modifications (such as DNA methylation) and trans-acting factors. So far, sequence elements that regulate parental allele-specific gene expression have been identified in a number of imprinted loci, either because of their differential DNA methylation or through functional studies in transgenic mice (1,2). A systematic search for allele-specific chromatin features constitutes an alternative strategy to identify elements that regulate imprinting. The validity of such an in vivo chromatin approach derives from the fact that in several known imprinting control-elements, a specialized organization of chromatin characterized by nuclease hypersensitivity is present on only one of the two parental chromosome (3). For example, the differentially methylated 5 -portion of the human SNRPN gene-a sequence element that controls imprinting in the Prader-Willi and Angelman syndromes' domain on chromosome 15q11- q13-has strong DNase-I hypersensitive sites on the unmethylated paternal chromosome (4). A differentially methylated region that regulates the imprinting of H19 and that of the neighboring insulin-like growth factor-2 gene on mouse chromosome 7 was also found to have parental chromosome-specific hypersensitive sites (5,6). The precise nature of the allelic nuclease hypersensitivity in these and other imprinted loci remains to be determined in more detail, for example, by applying complementary chromatin methodologies (7,8). However, it is commonly observed that a nuclease hypersensitive site corresponds to a small region where nucleosomes are absent or partially disrupted.

  2. A 10-aa-long sequence in SLP-76 upstream of the Gads binding site is essential for T cell development and function.

    PubMed

    Kumar, Lalit; Feske, Stefan; Rao, Anjana; Geha, Raif S

    2005-12-27

    The adapter SLP-76 is essential for T cell development and function. SLP-76 binds to the src homology 3 domain of Lck in vitro. This interaction depends on amino acids 185-194 of SLP-76. To examine the role of the Lck-binding region of SLP-76 in T cell development and function, SLP-76(-/-) mice were reconstituted with an SLP-76 mutant that lacks amino acids 185-194. Double and single positive thymocytes from reconstituted mice were severely reduced in numbers and exhibited impaired positive selection and increased apoptosis. Peripheral T cells were also reduced in numbers, exhibited impaired phospholipase C-gamma1 and Erk phosphorylation, and failed to flux calcium, secrete IL-2, and proliferate in response to T cell antigen receptor ligation. Delayed cutaneous hypersensitivity responses and Ab responses to T cell-dependent antigen were severely impaired. These results indicate that the Lck binding region of SLP-76 is essential for T cell antigen receptor signaling and normal T cell development and function.

  3. The 3’-Jα Region of the TCRα Locus Bears Gene Regulatory Activity in Thymic and Peripheral T Cells

    PubMed Central

    Kučerová-Levisohn, Martina; Knirr, Stefan; Mejia, Rosa I.; Ortiz, Benjamin D.

    2015-01-01

    Much progress has been made in understanding the important cis-mediated controls on mouse TCRα gene function, including identification of the Eα enhancer and TCRα locus control region (LCR). Nevertheless, previous data have suggested that other cis-regulatory elements may reside in the locus outside of the Eα/LCR. Based on prior findings, we hypothesized the existence of gene regulatory elements in a 3.9-kb region 5’ of the Cα exons. Using DNase hypersensitivity assays and TCRα BAC reporter transgenes in mice, we detected gene regulatory activity within this 3.9-kb region. This region is active in both thymic and peripheral T cells, and selectively affects upstream, but not downstream, gene expression. Together, these data indicate the existence of a novel cis-acting regulatory complex that contributes to TCRα transgene expression in vivo. The active chromatin sites we discovered within this region would remain in the locus after TCRα gene rearrangement, and thus may contribute to endogenous TCRα gene activity, particularly in peripheral T cells, where the Eα element has been found to be inactive. PMID:26177549

  4. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

    1980-01-01

    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  5. Validation of a novel epicutaneous delivery system for patch testing of house dust mite-hypersensitive dogs.

    PubMed

    Olivry, Thierry; Linder, Keith E; Paps, Judy S; Bizikova, Petra; Dunston, Stan; Donne, Nathalie; Mondoulet, Lucie

    2012-12-01

    Patch tests with allergens are used for the evaluation of cellular hypersensitivity to food and environmental allergens in dogs and humans with atopic dermatitis. Viaskin is a novel allergen epicutaneous delivery system that enhances epidermal allergen capture by immune cells. To compare the use of Viaskin and Finn chamber patch tests in dogs hypersensitive to mite allergens. Empty control or Dermatophagoides farinae house dust mite-containing Viaskin or Finn chamber patches were applied to the thoracic skin of six mite-hypersensitive Maltese-beagle crossbred atopic dogs. Lesions were graded 49 and 72 h after patch test application, and skin biopsies were collected after 72 h. Overall microscopic inflammation, eosinophil and T-lymphocyte infiltrations were scored. Positive macroscopic patch test reactions developed at five of six Viaskin application sites and four of six Finn chamber application sites. Median microscopic epidermal and dermal inflammation, as well as eosinophil and CD3 T-lymphocyte dermal scores were always higher in biopsies collected at Viaskin than at Finn chamber sites. Microscopic inflammation scores were significantly higher after mite allergen-containing Viaskin compared with empty patches, but this was not the case for mite-containing Finn chambers compared with control chambers. Scores obtained using Viaskin were not significantly different from those obtained using Finn chambers. Macroscopic and microscopic scores were significantly correlated. In mite-allergic dogs, Viaskin epicutaneous delivery systems appear to induce stronger allergen-specific inflammation than currently used Finn chamber patch tests. Consequently, Viaskin patches might offer a better alternative for screening cellular hypersensitivity to food and environmental allergens. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  6. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin

    PubMed Central

    Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.

    2007-01-01

    DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217

  7. Detections, concentrations, and distributional patterns of compounds of emerging concern in the San Antonio River Basin, Texas, 2011-12

    USGS Publications Warehouse

    Opsahl, Stephen P.; Lambert, Rebecca B.

    2013-01-01

    The distributional patterns of detections and concentrations of individual compounds and compound classes show the influence of wastewater-treatment plant (WWTP) outfalls on the quality of water in the San Antonio River Basin. In the Medina River Subbasin, the minimal influence of wastewater is evident as far downstream as the Macdona site. Downstream from the Macdona site, the Medina River receives treated municipal wastewater from both the Medio Creek Water Recycling Center site from an unnamed tributary at the plant and the Leon Creek Water Recycling Center site from Comanche Creek at the plant, and corresponding increases in both the number of detections and the total concentrations of all measured compounds at all downstream sampling sites were evident. Similarly, the San Antonio River receives treated municipal wastewater as far upstream as the SAR Witte site (San Antonio River at Witte Museum, San Antonio, Tex.) and additional WWTP outfalls along the Medina River upstream from the confluence of the Medina and San Antonio Rivers. Consequently, all samples collected along the main stem of the San Antonio River had higher concentrations of CECs in comparison to sites without upstream WWTPs. Sites in urbanized areas without upstream WWTPs include the Leon 35 site (Leon Creek at Interstate Highway 35, San Antonio, Tex.), the Alazan site (Alazan Creek at Tampico Street, San Antonio, Tex.), and the San Pedro site (San Pedro Creek at Probandt Street, at San Antonio, Tex.). The large number of detections at sites with no upstream wastewater source demonstrated that CECs can be detected in streams flowing through urbanized areas without a large upstream source of treated municipal wastewater. A general lack of detection of pharmaceuticals in streams without upstream outfalls of treated wastewater appears to be typical for streams throughout the San Antonio River Basin and may be a useful indicator of point-source versus nonpoint-source contributions of these compounds in urban streams. Observations of lower concentrations of compounds at the furthest downstream sampling sites in the basin indicate some natural attenuation of these compounds during transport; however, a more focused assessment is needed to make this determination.

  8. Inhibition by Agrobacterium tumefaciens and Pseudomonas savastanoi of development of the hypersensitive response elicited by Pseudomonas syringae pv. phaseolicola.

    PubMed Central

    Robinette, D; Matthysse, A G

    1990-01-01

    Injection into tobacco leaves of biotype 1 Agrobacterium tumefaciens or of Pseudomonas savastanoi inhibited the development of a visible hypersensitive response to the subsequent injection at the same site of Pseudomonas syringae pv. phaseolicola. This interference with the hypersensitive response was not seen with injection of bacterial growth medium or Escherichia coli cells. Live A. tumefaciens cells were required for the inhibitory effect. Various mutants and strains of A. tumefaciens were examined to determine the genes involved. Known chromosomal mutations generally had no effect on the ability of A. tumefaciens to inhibit the hypersensitive response, except for chvB mutants which showed a reduced (but still significant) inhibition of the hypersensitive response. Ti plasmid genes appeared to be required for the inhibition of the hypersensitive response. The bacteria did not need to be virulent in order to inhibit the hypersensitive response. Deletion of the vir region from pTi had no effect on the inhibition. However, the T region of the Ti plasmid was required for inhibition. Studies of transposon mutants suggested that the tms but not tmr or ocs genes were required. These genes were not acting after transfer to plant cells since they were effective in strains lacking vir genes and thus unable to transfer DNA to plant cells. The results suggest that the expression of the tms genes in the bacteria may inhibit the development of the hypersensitive response by the plant. An examination of the genes required in P. savastanoi for the inhibition of the hypersensitive response suggested that bacterial production of auxin was also required for the inhibition of the hypersensitive response by these bacteria. Images PMID:2211508

  9. Identification of Regulatory DNA Elements Using Genome-wide Mapping of DNase I Hypersensitive Sites during Tomato Fruit Development.

    PubMed

    Qiu, Zhengkun; Li, Ren; Zhang, Shuaibin; Wang, Ketao; Xu, Meng; Li, Jiayang; Du, Yongchen; Yu, Hong; Cui, Xia

    2016-08-01

    Development and ripening of tomato fruit are precisely controlled by transcriptional regulation, which depends on the orchestrated accessibility of regulatory proteins to promoters and other cis-regulatory DNA elements. This accessibility and its effect on gene expression play a major role in defining the developmental process. To understand the regulatory mechanism and functional elements modulating morphological and anatomical changes during fruit development, we generated genome-wide high-resolution maps of DNase I hypersensitive sites (DHSs) from the fruit tissues of the tomato cultivar "Moneymaker" at 20 days post anthesis as well as break stage. By exploring variation of DHSs across fruit development stages, we pinpointed the most likely hypersensitive sites related to development-specific genes. By detecting binding motifs on DHSs of these development-specific genes or genes in the ascorbic acid biosynthetic pathway, we revealed the common regulatory elements contributing to coordinating gene transcription of plant ripening and specialized metabolic pathways. Our results contribute to a better understanding of the regulatory dynamics of genes involved in tomato fruit development and ripening. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  10. Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

    USGS Publications Warehouse

    Juracek, Kyle E.

    2011-01-01

    Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 691,000 pounds per square mile per year. In general, no pronounced changes in channel width were evident at six streamgage sites located upstream from the reservoir. At the Barnes and Marysville streamgage sites, located upstream from the reservoir, long-term channel-bed degradation followed by stability was indicated. At the Frankfort streamgage site, located upstream from the reservoir, channel-bed aggradation of 1.65 feet from 1969 to 1989 followed by channel-bed degradation of 2.4 feet from 1989 to 2010 was indicated and may represent the passage of a sediment pulse caused by historical disturbances (for example, channelization) in the upstream basin. With the exception of the Frankfort streamgage site, current (2010) conditions at four streamgages located upstream from the reservoir were typified by channel-bed stability. At the Manhattan streamgage site, located downstream from the reservoir, high-flow releases associated with the 1993 flood widened the channel about 60 feet (30 percent). The channel bed at this site degraded 4.2 feet from 1960 to 1998 and since has been relatively stable. For the purpose of computing suspended-sediment concentration and load, the use of turbidity data in a regression model can provide more reliable and reproducible estimates than a regression model that uses discharge as the sole independent variable. Moreover, the use of discharge only to compute suspended-sediment concentration and load may result in overprediction. Stream channel banks, compared to channel beds, likely are a more important source of sediment to Kanopolis and Tuttle Creek Lakes from the upstream basins. Other sediment sources include surface-soil erosion in the basins and shoreline erosion in the reservoirs.

  11. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  12. Activation of cannabinoid CB1 and CB2 receptors suppresses neuropathic nociception evoked by the chemotherapeutic agent vincristine in rats

    PubMed Central

    Rahn, E J; Makriyannis, A; Hohmann, A G

    2007-01-01

    Background and purpose: The ability of cannabinoids to suppress mechanical hypersensitivity (mechanical allodynia) induced by treatment with the chemotherapeutic agent vincristine was evaluated in rats. Sites of action were subsequently identified. Experimental approach: Mechanical hypersensitivity developed over the course of ten daily injections of vincristine relative to groups receiving saline at the same times. Effects of the CB1/CB2 receptor agonist WIN55,212-2, the receptor-inactive enantiomer WIN55,212-3, the CB2-selective agonist (R,S)-AM1241, the opiate agonist morphine and vehicle on chemotherapy-induced neuropathy were evaluated. WIN55,212-2 was administered intrathecally (i.t.) or locally in the hindpaw to identify sites of action. Pharmacological specificity was established using competitive antagonists for CB1 (SR141716) or CB2 receptors (SR144528). Key results: Systemic administration of WIN55,212-2, but not WIN55,212-3, suppressed vincristine-evoked mechanical allodynia. A leftward shift in the dose-response curve was observed following WIN55,212-2 relative to morphine treatment. The CB1 (SR141716) and CB2 (SR144528) antagonists blocked the anti-allodynic effects of WIN55,212-2. (R,S)-AM1241 suppressed vincristine-induced mechanical hypersensitivity through a CB2 mechanism. Both cannabinoid agonists suppressed vincristine-induced mechanical hypersensitivity without inducing catalepsy. Spinal sites of action are implicated in cannabinoid modulation of chemotherapy-induced neuropathy. WIN55,212-2, but not WIN55,212-3, administered i.t. suppressed vincristine-evoked mechanical hypersensitivity at doses that were inactive following local hindpaw administration. Spinal coadministration of both the CB1 and CB2 antagonists blocked the anti-allodynic effects of WIN55,212-2. Conclusions and implications: Cannabinoids suppress the maintenance of vincristine-induced mechanical allodynia through activation of CB1 and CB2 receptors. These anti-allodynic effects are mediated, at least in part, at the level of the spinal cord. PMID:17572696

  13. Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

    PubMed

    Kim, Yea Woon; Kim, AeRi

    2017-07-20

    Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

  14. Aldosterone alters the chromatin structure of the murine endothelin-1 gene.

    PubMed

    Welch, Amanda K; Jeanette Lynch, I; Gumz, Michelle L; Cain, Brian D; Wingo, Charles S

    2016-08-15

    Aldosterone increases sodium reabsorption in the renal collecting duct and systemic blood pressure. Paradoxically, aldosterone also induces transcription of the endothelin-1 (Edn1) gene to increase protein (ET-1) levels, which inhibits sodium reabsorption. Here we investigated changes in the chromatin structure of the Edn1 gene of collecting duct cell lines in response to aldosterone treatment. The Edn1 gene has a CpG island that encompasses the transcription start site and four sites in the 5' regulatory region previously linked to transcriptional regulation. The chromatin structure of the Edn1 gene was investigated using a quantitative PCR-based DNaseI hypersensitivity assay in murine hepatocyte (AML12), renal cortical collecting duct (mpkCCDC14), outer medullary collecting duct1 (OMCD1), and inner medullary collecting duct-3 (IMCD-3) cell lines. The CpG island was uniformly accessible. One calcium-responsive NFAT element remained at low chromatin accessibility in all cell lines under all conditions tested. However, the second calcium responsive NFAT element located at -1563bp upstream became markedly more accessible in IMCD-3 cells exposed to aldosterone. Importantly, one established aldosterone hormone response element HRE at -671bp relative to the transcription start site was highly accessible, and another HRE (-551bp) became more accessible in aldosterone-treated IMCD-3 and OMCD1 cells. The evidence supports a model in which aldosterone activation of the mineralocorticoid receptor (MR) results in the MR-hormone complex binding at HRE at -671bp to open chromatin structure around other regulatory elements in the Edn1 gene. Published by Elsevier Inc.

  15. Dentinal hypersensitivity following scaling and root planing: comparison of low-level laser and topical fluoride treatment.

    PubMed

    Pesevska, Snezana; Nakova, Marija; Ivanovski, Kiro; Angelov, Nikola; Kesic, Ljiljana; Obradovic, Radmila; Mindova, Sonja; Nares, Salvador

    2010-09-01

    The aim of this study is to compare the effectiveness of low-level laser irradiation to traditional topical fluoride treatment for treatment choices of dentinal hypersensitivity following scaling and root planing. The experimental group (15 patients) was treated with low-energy-level diode laser at each site of dentinal hypersensitivity following scaling and root planning. The control group (15 patients) received topical fluoride treatment (protective varnish for desensitization). All the patients were treated at baseline visit, and then at day 2 and 4 after the initial treatment; the pain was subjectively assessed by the patients as strong, medium, medium low, low, or no pain. Total absence of the dental hypersensitivity was reported in 26.66% of the examined group even after the second visit, compared to the control group where complete resolution of the hypersensitivity was not present after the second visit in any of the treated cases. Complete absence of pain was achieved in 86.6% of patients treated with laser and only in 26.6% in the fluoride treated group, after the third visit. Based on our findings, we conclude that low-energy biostimulative laser treatment can be successfully used for treatment of dental hypersensitivity following scaling and root planing.

  16. A new model for antisperm autoimmunity in guine pigs.

    PubMed

    Mazzolli, A B; Bustuoabad, O D; Barrera, C; Mancini, R E

    1976-01-01

    Adult outbread male guinea pigs were autoimmunized without adjuvant. Homogenates were prepared with one of their own testes previously submitted "in vivo" and "in vitro" to thermal injury. Animals received a single or daily repeated intradermal injection without added adjuvant, in one or different skin sites. Guinea pigs daily sensitized in the same site during 30 days showed the presence of: a) dermal granuloma at the site of injection; b) several foci of typical allergic orchitis; c) delayed hypersensitivity detected by inhibition of macrophage migration; d) moderate titres of spermagglutinins and negligible levels of hemagglutinating antibodies. Guinea pigs receiving a single dose in one site only developed delayed hypersensitivity. Animals daily sensitized with the same dose of altered antigen in different sites, or with normal testis antigen either in one or different sites, showed negative results. The correlation among testicular lesion, dermal granuloma and cellular immunity is discussed. It is concluded that testis autosensitization is obtained in the absence of added adjuvant provided that a thermally injured gonad used as antigen is repeatedly injected in the same site.

  17. Activation of NMDA receptors in the brainstem, rostral ventromedial medulla, and nucleus reticularis gigantocellularis mediates mechanical hyperalgesia produced by repeated intramuscular injections of acidic saline in rats.

    PubMed

    Da Silva, Luis F; Desantana, Josimari M; Sluka, Kathleen A

    2010-04-01

    Repeated injections of acidic saline into the gastrocnemius muscle induce both muscle and cutaneous hypersensitivity. We have previously shown that microinjection of local anesthetic into either the rostral ventromedial medulla (RVM) or the nucleus reticularis gigantocellularis (NGC) reverses this muscle and cutaneous hypersensitivity. Although prior studies show that NMDA receptors in the RVM play a clear role in mediating visceral and inflammatory hypersensitivity, the role of NMDA receptors in the NGC or in noninflammatory muscle pain is unclear. Therefore, the present study evaluated involvement of the NMDA receptors in the RVM and NGC in muscle and cutaneous hypersensitivity induced by repeated intramuscular injections of acidic saline. Repeated intramuscular injections of acidic saline, 5 days apart, resulted in a bilateral decrease in the withdrawal thresholds of the paw and muscle in all groups 24 hours after the second injection. Microinjection of NMDA receptor antagonists into the RVM reversed both the muscle and cutaneous hypersensitivity. However, microinjection of NMDA receptor antagonists into the NGC only reversed cutaneous but not muscle hypersensitivity. These results suggest that NMDA receptors in the RVM mediate both muscle and cutaneous hypersensitivity, but those in the NGC mediate only cutaneous hypersensitivity after muscle insult. The current study shows that NMDA receptors in supraspinal facilitatory sites maintain noninflammatory muscle pain. Clinical studies in people with chronic widespread, noninflammatory pain, similarly, show alterations in central excitability. Thus, understanding mechanisms in an animal model could lead to improved treatment for patients with chronic muscle pain. Copyright 2010 American Pain Society. Published by Elsevier Inc. All rights reserved.

  18. DHSpred: support-vector-machine-based human DNase I hypersensitive sites prediction using the optimal features selected by random forest.

    PubMed

    Manavalan, Balachandran; Shin, Tae Hwan; Lee, Gwang

    2018-01-05

    DNase I hypersensitive sites (DHSs) are genomic regions that provide important information regarding the presence of transcriptional regulatory elements and the state of chromatin. Therefore, identifying DHSs in uncharacterized DNA sequences is crucial for understanding their biological functions and mechanisms. Although many experimental methods have been proposed to identify DHSs, they have proven to be expensive for genome-wide application. Therefore, it is necessary to develop computational methods for DHS prediction. In this study, we proposed a support vector machine (SVM)-based method for predicting DHSs, called DHSpred (DNase I Hypersensitive Site predictor in human DNA sequences), which was trained with 174 optimal features. The optimal combination of features was identified from a large set that included nucleotide composition and di- and trinucleotide physicochemical properties, using a random forest algorithm. DHSpred achieved a Matthews correlation coefficient and accuracy of 0.660 and 0.871, respectively, which were 3% higher than those of control SVM predictors trained with non-optimized features, indicating the efficiency of the feature selection method. Furthermore, the performance of DHSpred was superior to that of state-of-the-art predictors. An online prediction server has been developed to assist the scientific community, and is freely available at: http://www.thegleelab.org/DHSpred.html.

  19. DHSpred: support-vector-machine-based human DNase I hypersensitive sites prediction using the optimal features selected by random forest

    PubMed Central

    Manavalan, Balachandran; Shin, Tae Hwan; Lee, Gwang

    2018-01-01

    DNase I hypersensitive sites (DHSs) are genomic regions that provide important information regarding the presence of transcriptional regulatory elements and the state of chromatin. Therefore, identifying DHSs in uncharacterized DNA sequences is crucial for understanding their biological functions and mechanisms. Although many experimental methods have been proposed to identify DHSs, they have proven to be expensive for genome-wide application. Therefore, it is necessary to develop computational methods for DHS prediction. In this study, we proposed a support vector machine (SVM)-based method for predicting DHSs, called DHSpred (DNase I Hypersensitive Site predictor in human DNA sequences), which was trained with 174 optimal features. The optimal combination of features was identified from a large set that included nucleotide composition and di- and trinucleotide physicochemical properties, using a random forest algorithm. DHSpred achieved a Matthews correlation coefficient and accuracy of 0.660 and 0.871, respectively, which were 3% higher than those of control SVM predictors trained with non-optimized features, indicating the efficiency of the feature selection method. Furthermore, the performance of DHSpred was superior to that of state-of-the-art predictors. An online prediction server has been developed to assist the scientific community, and is freely available at: http://www.thegleelab.org/DHSpred.html PMID:29416743

  20. Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

    PubMed

    Sakumi, K; Sekiguchi, M

    1989-01-20

    The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

  1. Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair

    PubMed Central

    Nakanishi, Koji; Yang, Yun-Gui; Pierce, Andrew J.; Taniguchi, Toshiyasu; Digweed, Martin; D'Andrea, Alan D.; Wang, Zhao-Qi; Jasin, Maria

    2005-01-01

    Fanconi anemia (FA) is a recessive disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. Cells from FA patients are hypersensitive to agents that produce DNA crosslinks and, after treatment with these agents, have pronounced chromosome breakage and other cytogenetic abnormalities. Eight FANC genes have been cloned, and the encoded proteins interact in a common cellular pathway. DNA-damaging agents activate the monoubiquitination of FANCD2, resulting in its targeting to nuclear foci that also contain BRCA1 and BRCA2/FANCD1, proteins involved in homology-directed DNA repair. Given the interaction of the FANC proteins with BRCA1 and BRCA2, we tested whether cells from FA patients (groups A, G, and D2) and mouse Fanca–/– cells with a targeted mutation are impaired for this repair pathway. We find that both the upstream (FANCA and FANCG) and downstream (FANCD2) FA pathway components promote homology-directed repair of chromosomal double-strand breaks (DSBs). The FANCD2 monoubiquitination site is critical for normal levels of repair, whereas the ATM phosphorylation site is not. The defect in these cells, however, is mild, differentiating them from BRCA1 and BRCA2 mutant cells. Surprisingly, we provide evidence that these proteins, like BRCA1 but unlike BRCA2, promote a second DSB repair pathway involving homology, i.e., single-strand annealing. These results suggest an early role for the FANC proteins in homologous DSB repair pathway choice. PMID:15650050

  2. Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair.

    PubMed

    Nakanishi, Koji; Yang, Yun-Gui; Pierce, Andrew J; Taniguchi, Toshiyasu; Digweed, Martin; D'Andrea, Alan D; Wang, Zhao-Qi; Jasin, Maria

    2005-01-25

    Fanconi anemia (FA) is a recessive disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. Cells from FA patients are hypersensitive to agents that produce DNA crosslinks and, after treatment with these agents, have pronounced chromosome breakage and other cytogenetic abnormalities. Eight FANC genes have been cloned, and the encoded proteins interact in a common cellular pathway. DNA-damaging agents activate the monoubiquitination of FANCD2, resulting in its targeting to nuclear foci that also contain BRCA1 and BRCA2/FANCD1, proteins involved in homology-directed DNA repair. Given the interaction of the FANC proteins with BRCA1 and BRCA2, we tested whether cells from FA patients (groups A, G, and D2) and mouse Fanca-/- cells with a targeted mutation are impaired for this repair pathway. We find that both the upstream (FANCA and FANCG) and downstream (FANCD2) FA pathway components promote homology-directed repair of chromosomal double-strand breaks (DSBs). The FANCD2 monoubiquitination site is critical for normal levels of repair, whereas the ATM phosphorylation site is not. The defect in these cells, however, is mild, differentiating them from BRCA1 and BRCA2 mutant cells. Surprisingly, we provide evidence that these proteins, like BRCA1 but unlike BRCA2, promote a second DSB repair pathway involving homology, i.e., single-strand annealing. These results suggest an early role for the FANC proteins in homologous DSB repair pathway choice.

  3. Subcutaneous administration of paclitaxel in dogs with cancer: A preliminary study

    PubMed Central

    Silva, Daniella M.; Franciosi, Aline I.; Pezzini, Paula C.F.; Guérios, Simone D.

    2015-01-01

    Intravenous paclitaxel has been underused in dogs due to severe and acute hypersensitivity reactions. Subcutaneous (SC) administration of paclitaxel and its safety are unknown. In this preliminary study, SC administration of paclitaxel was evaluated for hypersensitivity reactions and toxicity in 21 dogs with advanced cancer. Dogs received 1 to 5 paclitaxel doses, ranging from 85 to 170 mg/m2, SC every 14 or 21 days. A total of 40 paclitaxel doses were administered and none of the 21 dogs developed systemic or acute local hypersensitivity reactions. Severe skin lesions at the injection site developed in 2 dogs after the 4th injection at the same location. Grade 4 neutropenia was observed in 50% of the dogs 5 days after the first treatment at 115 mg/m2 (n = 14). Two animals developed Grade 5 diarrhea and died likely due to hemodynamic failure or sepsis. Paclitaxel can be administered SC in dogs with no hypersensitivity reaction. PMID:26246628

  4. Effects of an oil spill on leafpack-inhabiting macroinvertebrates in the Chariton river, Missouri

    USGS Publications Warehouse

    Poulton, B.C.; Callahan, E.V.; Hurtubise, R.D.; Mueller, B.G.

    1998-01-01

    Artificial leaf packs were used to determine the effects of an oil spill on stream macroinvertebrate communities in the Chariton River, Missouri. Plastic mesh leaf retainers with approximately 10 g of leaves from five tree species were deployed at five sites (two upstream of the spill and three downstream) immediately after the spill and one year later. Four macroinvertebrate species dominating the community at upstream sites were virtually eliminated below the spill, including the stonefly Isoperla bilineata, the caddisfly Potamyia flava, the midge Thienemanniella xena, and blackfly larvae (Simulium sp.). Density of collector and shredder functional groups, and number of shredder taxa differed between upstream sites and the two furthest downstream sites during the 1990 sample period (Kruskal-Wallis w/Bonferroni paired comparisons, experiment wise error rate = 0.05). With one exception, no differences between sites were detected in the 1991-1992 sample period, indicating that the benthic community had at least partially recovered from the oil spill after one year. The odds of obtaining a sample with a small abundance of shredders (abundance < median) in 1990 was significantly greater downstream of the spill than upstream, and the odds of obtaining a sample with a small abundance of shredders at downstream sites was greater in 1990 than in 1991-1992. A similar pattern was observed in abundance and taxa richness of the collector functional group. No significant differences between the two sampling periods were detected at upstream sites. Observed effects appeared to be associated with oil sorption and substrate coating, creating conditions unsuitable for successful colonization.

  5. Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

    PubMed

    Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

    2008-06-01

    The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

  6. Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

    PubMed Central

    Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

    2011-01-01

    Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

  7. The SNM1B/APOLLO DNA nuclease functions in resolution of replication stress and maintenance of common fragile site stability.

    PubMed

    Mason, Jennifer M; Das, Ishita; Arlt, Martin; Patel, Neil; Kraftson, Stephanie; Glover, Thomas W; Sekiguchi, JoAnn M

    2013-12-15

    SNM1B/Apollo is a DNA nuclease that has important functions in telomere maintenance and repair of DNA interstrand crosslinks (ICLs) within the Fanconi anemia (FA) pathway. SNM1B is required for efficient localization of key repair proteins, such as the FA protein, FANCD2, to sites of ICL damage and functions epistatically to FANCD2 in cellular survival to ICLs and homology-directed repair. The FA pathway is also activated in response to replication fork stalling. Here, we sought to determine the importance of SNM1B in cellular responses to stalled forks in the absence of a blocking lesion, such as ICLs. We found that depletion of SNM1B results in hypersensitivity to aphidicolin, a DNA polymerase inhibitor that causes replication stress. We observed that the SNM1B nuclease is required for efficient localization of the DNA repair proteins, FANCD2 and BRCA1, to subnuclear foci upon aphidicolin treatment, thereby indicating SNM1B facilitates direct repair of stalled forks. Consistent with a role for SNM1B subsequent to recognition of the lesion, we found that SNM1B is dispensable for upstream events, including activation of ATR-dependent signaling and localization of RPA, γH2AX and the MRE11/RAD50/NBS1 complex to aphidicolin-induced foci. We determined that a major consequence of SNM1B depletion is a marked increase in spontaneous and aphidicolin-induced chromosomal gaps and breaks, including breakage at common fragile sites. Thus, this study provides evidence that SNM1B functions in resolving replication stress and preventing accumulation of genomic damage.

  8. Peroxisome proliferator-activated receptor-gamma agonist rosiglitazone attenuates postincisional pain by regulating macrophage polarization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hasegawa-Moriyama, Maiko, E-mail: hase-mai@m3.kufm.kagoshima-u.ac.jp; Ohnou, Tetsuya; Godai, Kohei

    Highlights: Black-Right-Pointing-Pointer Rosiglitazone attenuated postincisional pain. Black-Right-Pointing-Pointer Rosiglitazone alters macrophage polarization to F4/80{sup +}CD206{sup +} M2 macrophages at the incisional sites. Black-Right-Pointing-Pointer Transplantation of rosiglitazone-treated macrophages produced analgesic effects. -- Abstract: Acute inflammation triggered by macrophage infiltration to injured tissue promotes wound repair and may induce pain hypersensitivity. Peroxisome proliferator-activated receptor {gamma} (PPAR){gamma} signaling is known to regulate heterogeneity of macrophages, which are often referred to as classically activated (M1) and alternatively activated (M2) macrophages. M1 macrophages have considerable antimicrobial activity and produce a wide variety of proinflammatory cytokines. In contrast, M2 macrophages are involved in anti-inflammatory and homeostatic functionsmore » linked to wound healing and tissue repair. Although it has been suggested that PPAR{gamma} agonists attenuate pain hypersensitivity, the molecular mechanism of macrophage-mediated effects of PPAR{gamma} signaling on pain development has not been explored. In this study, we investigated the link between the phenotype switching of macrophage polarization induced by PPAR{gamma} signaling and the development of acute pain hypersensitivity. Local administration of rosiglitazone significantly ameliorated hypersensitivity to heat and mechanical stimuli, and paw swelling. Consistent with the down-regulation of nuclear factor {kappa}B (NF{kappa}B) phosphorylation by rosiglitazone at the incisional sites, the number of F4/80{sup +}iNOS{sup +} M1 macrophages was decreased whereas numbers of F4/80{sup +}CD206{sup +} M2 macrophages were increased in rosiglitazone-treated incisional sites 24 h after the procedure. In addition, gene induction of anti-inflammatory M2-macrophage-associated markers such as arginase1, FIZZ1 and interleukin (IL)-10 were significantly increased, whereas M1-macrophage-related molecules such as integrin {alpha}X, IL-1{beta}, MIP2{alpha} and leptin were decreased at rosiglitazone-treated incisional sites. Moreover, transplantation of rosiglitazone-treated peritoneal macrophages into the incisional sites significantly attenuated hyperalgesia. We speculate that local administration of rosiglitazone significantly alleviated the development of postincisional pain, possibly through regulating macrophage polarity at the inflamed site. PPAR{gamma} signaling in macrophages may be a potential therapeutic target for the treatment of acute pain development.« less

  9. Synthesis of natural flows at selected sites in the upper Missouri River basin, Montana, 1928-89

    USGS Publications Warehouse

    Cary, L.E.; Parrett, Charles

    1996-01-01

    Natural monthly streamflows were synthesized for the years 1928-89 for 43 sites in the upper Missouri River Basin upstream from Fort Peck Lake in Montana. The sites are represented as nodes in a streamflow accounting model being developed by the Bureau of Reclamation. Recorded and historical flows at most sites have been affected by human activities including reservoir storage, diversions for irrigation, and municipal use. Natural flows at the sites were synthesized by eliminating the effects of these activities. Recorded data at some sites do not include the entire study period. The missing flows at these sites were estimated using a statistical procedure. The methods of synthesis varied, depending on upstream activities and information available. Recorded flows were transferred to nodes that did not have streamflow-gaging stations from the nearest station with a sufficient length of record. The flows at one node were computed as the sum of flows from three upstream tributaries. Monthly changes in reservoir storage were computed from monthend contents. The changes in storage were corrected for the effects of evaporation and precipitation using pan-evaporation and precipitation data from climate stations. Irrigation depletions and consumptive use by the three largest municipalities were computed. Synthesized natural flow at most nodes was computed by adding algebraically the upstream depletions and changes in reservoir storage to recorded or historical flow at the nodes.

  10. Genome-wide mapping of DNase I hypersensitive sites in rare cell populations using single-cell DNase sequencing.

    PubMed

    Cooper, James; Ding, Yi; Song, Jiuzhou; Zhao, Keji

    2017-11-01

    Increased chromatin accessibility is a feature of cell-type-specific cis-regulatory elements; therefore, mapping of DNase I hypersensitive sites (DHSs) enables the detection of active regulatory elements of transcription, including promoters, enhancers, insulators and locus-control regions. Single-cell DNase sequencing (scDNase-seq) is a method of detecting genome-wide DHSs when starting with either single cells or <1,000 cells from primary cell sources. This technique enables genome-wide mapping of hypersensitive sites in a wide range of cell populations that cannot be analyzed using conventional DNase I sequencing because of the requirement for millions of starting cells. Fresh cells, formaldehyde-cross-linked cells or cells recovered from formalin-fixed paraffin-embedded (FFPE) tissue slides are suitable for scDNase-seq assays. To generate scDNase-seq libraries, cells are lysed and then digested with DNase I. Circular carrier plasmid DNA is included during subsequent DNA purification and library preparation steps to prevent loss of the small quantity of DHS DNA. Libraries are generated for high-throughput sequencing on the Illumina platform using standard methods. Preparation of scDNase-seq libraries requires only 2 d. The materials and molecular biology techniques described in this protocol should be accessible to any general molecular biology laboratory. Processing of high-throughput sequencing data requires basic bioinformatics skills and uses publicly available bioinformatics software.

  11. Sickle cell disease caused by heterozygosity for Hb S and novel LCR deletion: Report of two patients.

    PubMed

    Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K

    2009-09-01

    The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.

  12. Variation in plant defense against invasive herbivores: evidence for a hypersensitive response in eastern hemlocks (Tsuga canadensis).

    PubMed

    Radville, Laura; Chaves, Arielle; Preisser, Evan L

    2011-06-01

    Herbivores can trigger a wide array of morphological and chemical changes in their host plants. Feeding by some insects induces a defensive hypersensitive response, a defense mechanism consisting of elevated H(2)O(2) levels and tissue death at the site of herbivore feeding. The invasive hemlock woolly adelgid Adelges tsugae ('HWA') and elongate hemlock scale Fiorinia externa ('EHS') feed on eastern hemlocks; although both are sessile sap feeders, HWA causes more damage than EHS. The rapid rate of tree death following HWA infestation has led to the suggestion that feeding induces a hypersensitive response in hemlock trees. We assessed the potential for an herbivore-induced hypersensitive response in eastern hemlocks by measuring H(2)O(2) levels in foliage from HWA-infested, EHS-infested, and uninfested trees. Needles with settled HWA or EHS had higher H(2)O(2) levels than control needles, suggesting a localized hypersensitive plant response. Needles with no direct contact to settled HWA also had high H(2)O(2) levels, suggesting that HWA infestation may induce a systemic defense response in eastern hemlocks. There was no similar systemic defensive response in the EHS treatment. Our results showed that two herbivores in the same feeding guild had dramatically different outcomes on the health of their shared host.

  13. Models of Inflammation: Carrageenan- or Complete Freund's Adjuvant (CFA)-Induced Edema and Hypersensitivity in the Rat.

    PubMed

    McCarson, Kenneth E

    2015-09-01

    Animal models of inflammation are used to assess the production of inflammatory mediators at sites of inflammation, the processing of pain sensation at CNS sites, the anti-inflammatory properties of agents such as nonsteroidal anti-inflammatory drugs (NSAIDs), and the efficacy of putative analgesic compounds in reversing cutaneous hypersensitivity. Detailed in this unit are methods to elicit and measure carrageenan- and complete Freund's adjuvant (CFA)-induced cutaneous inflammation. Due to possible differences between the dorsal root sensory system and the trigeminal sensory system, injections into either the footpad or vibrissal pad are described. In this manner, cutaneous inflammation can be assessed in tissue innervated by the lumbar dorsal root ganglion neurons (footpad) or by the trigeminal ganglion neurons (vibrissal pad). Copyright © 2015 John Wiley & Sons, Inc.

  14. Molecular Mechanisms for Drug Hypersensitivity Induced by the Malaria Parasite’s Chloroquine Resistance Transporter

    PubMed Central

    Baker, Eileen S.; Webster, Michael W.; Lehane, Adele M.; Shafik, Sarah H.; Martin, Rowena E.

    2016-01-01

    Mutations in the Plasmodium falciparum ‘chloroquine resistance transporter’ (PfCRT) confer resistance to chloroquine (CQ) and related antimalarials by enabling the protein to transport these drugs away from their targets within the parasite’s digestive vacuole (DV). However, CQ resistance-conferring isoforms of PfCRT (PfCRTCQR) also render the parasite hypersensitive to a subset of structurally-diverse pharmacons. Moreover, mutations in PfCRTCQR that suppress the parasite’s hypersensitivity to these molecules simultaneously reinstate its sensitivity to CQ and related drugs. We sought to understand these phenomena by characterizing the functions of PfCRTCQR isoforms that cause the parasite to become hypersensitive to the antimalarial quinine or the antiviral amantadine. We achieved this by measuring the abilities of these proteins to transport CQ, quinine, and amantadine when expressed in Xenopus oocytes and complemented this work with assays that detect the drug transport activity of PfCRT in its native environment within the parasite. Here we describe two mechanistic explanations for PfCRT-induced drug hypersensitivity. First, we show that quinine, which normally accumulates inside the DV and therewithin exerts its antimalarial effect, binds extremely tightly to the substrate-binding site of certain isoforms of PfCRTCQR. By doing so it likely blocks the normal physiological function of the protein, which is essential for the parasite’s survival, and the drug thereby gains an additional killing effect. In the second scenario, we show that although amantadine also sequesters within the DV, the parasite’s hypersensitivity to this drug arises from the PfCRTCQR-mediated transport of amantadine from the DV into the cytosol, where it can better access its antimalarial target. In both cases, the mutations that suppress hypersensitivity also abrogate the ability of PfCRTCQR to transport CQ, thus explaining why rescue from hypersensitivity restores the parasite’s sensitivity to this antimalarial. These insights provide a foundation for understanding clinically-relevant observations of inverse drug susceptibilities in the malaria parasite. PMID:27441371

  15. The higher structure of chromatin in the LCR of the beta-globin locus changes during development.

    PubMed

    Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang

    2009-11-27

    The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.

  16. Lack of evidence that the XqYq pairing tips at meiosis in the mouse show hypersensitivity to DNAse I.

    PubMed

    Separovic, E R; Chandley, A C

    1987-01-01

    In situ nick translation procedures have been applied to meiotic metaphase I divisions of the normal and XY, Sxr mouse. Unlike in man, where the pairing tips of the XY bivalent show a special sensitivity to DNAse I nicking, no such sensitivity can be detected for either of these types of mouse. Hypersensitivity in the D-band equivalent region of the X chromosome does, however, exist, this site being early replicating in somatic cells and housing the X inactivation centre (Xce).

  17. Cell-mediated immunity in herpes simplex virus-infected mice: H-2 mapping of the delayed-type hypersensitivity response and the antiviral T cell response.

    PubMed

    Nash, A A; Phelan, J; Wildy, P

    1981-04-01

    An adoptive transfer system was used to investigate the H-2 restriction of delayed-type hypersensitivity (DTH) to herpes simplex virus. A successful DTH transfer was achieved when donor and recipient were compatible at the I-A region, with K and D region compatibility unnecessary. However, the rapid clearance of infectious virus from the inoculation site was found only when the donor and recipients were compatible at H-2K (and presumably D) and I-A regions.

  18. Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

    PubMed Central

    Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

    2014-01-01

    The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

  19. Effects of Hardened Low-Water Crossings on Periphyton and Water Quality in Selected Streams at the Fort Polk Military Reservation, Louisiana, 1998-99 and 2003-04

    USGS Publications Warehouse

    Bryan, Barbara W.; Bryan, C. Frederick; Lovelace, John K.; Tollett, Roland W.

    2007-01-01

    In 2003, the U.S. Geological Survey (USGS), at the request of the U.S. Army Joint Readiness Training Center and Fort Polk, began a follow-up study to determine whether installation and modification of hardened low-water crossings had short-term (less than 1 year) or long-term (greater than 1 year) effects on periphyton or water quality in five streams at the Fort Polk Military Reservation, Louisiana. Periphyton data were statistically analyzed for possible differences between samples collected at upstream and downstream sites and before and after low-water crossings were modified on three streams, Big Brushy Creek, Tributary to East Fork of Sixmile Creek, and Tributary to Birds Creek, during 2003?04. Periphyton data also were analyzed for possible differences between samples collected at upstream and downstream sites on two streams, Tributary to Big Brushy Creek and Little Brushy Creek, during 1998?99 and 2003. Variations in periphyton communities could not be conclusively attributed to the modifications. Most of the significant changes in percent frequency of occurrence and average cell density of the 10 most frequently occurring periphyton taxa were increases at downstream sites after the hardened low-water crossing installations or modifications. However, these changes in the periphyton community are not necessarily deleterious to the community structure. Water-quality data collected from upstream and downstream sites on the five streams during 2003?04 were analyzed for possible differences caused by the hardened crossings. Generally, average water-quality values and concentrations were similar at upstream and downstream sites. When average water-quality values or concentrations changed significantly, they almost always changed significantly at both the upstream and downstream sites. It is probable that observed variations in water quality at both upstream and downstream sites are related to differences in rainfall and streamflow during the sample collection periods rather than an effect of the hardened low-water crossing installations or modifications, but additional study is needed.

  20. Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

    PubMed

    Li, Shisheng; Smerdon, Michael J

    2004-04-02

    Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

  1. Spatial and temporal patterns of micropollutants upstream and downstream of 24 WWTPs across Switzerland

    NASA Astrophysics Data System (ADS)

    Spycher, Barbara; Deuber, Fabian; Kistler, David; Burdon, Frank; Reyes, Marta; Alder, Alfredo C.; Joss, Adriano; Eggen, Rik; Singer, Heinz; Stamm, Christian

    2015-04-01

    Treated wastewater is an important source of micropollutants in many streams. These chemicals consist of very diverse set of compounds that may vary in space and time. In order to improve our understanding of such spatio-temporal patterns of micropollutants in surface waters, we compared upstream and downstream locations at 24 sites across the Swiss Plateau and Jura (12 sites in the 2013 campaign, 12 sites during the 2014 campaign). Each site represents the most upstream treatment plant in the corresponding catchment. This survey is part of the interdisciplinary, Eawag-wide research project EcoImpact that aims at elucidating the ecological effects of micropollutants on stream ecosystems. In 2013, a broad analytical screening was applied to samples collected during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 were analysed for a set of about 60 selected organic micropollutants and 10 heavy metals. The screening results demonstrate that generally pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest part of the organic micropollutants. Pesticides including biocides and plant protection products are also regularly found but at lower concentrations. This presentation will analyse the variability of the micropollutant patterns across the different sites and how upstream conditions and the wastewater composition changes with season.

  2. Recommendations for a wind profiling network to support Space Shuttle launches

    NASA Technical Reports Server (NTRS)

    Zamora, R. J.

    1992-01-01

    The feasibility is examined of a network of clear air radar wind profilers to forecast wind conditions before Space Shuttle launches during winter. Currently, winds are measured only in the vicinity of the shuttle launch site and wind loads on the launch vehicle are estimated using these measurements. Wind conditions upstream of the Cape are not monitored. Since large changes in the wind shear profile can be associated with weather systems moving over the Cape, it may be possible to improve wind forecasts over the launch site if wind measurements are made upstream. A radar wind profiling system is in use at the Space Shuttle launch site. This system can monitor the wind profile continuously. The existing profiler could be combined with a number of radars located upstream of the launch site. Thus, continuous wind measurements would be available upstream and at the Cape. NASA-Marshall representatives have set the requirements for radar wind profiling network. The minimum vertical resolution of the network must be set so that the wind shears over the depths greater than or = 1 km will be detected. The network should allow scientists and engineers to predict the wind profile over the Cape 6 hours before a Space Shuttle launch.

  3. Increased /sup 3/H-spiperone binding sites in mesolimbic area related to methamphetamine-induced behavioral hypersensitivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akiyama, K.; Sato, M.; Otsuki, S.

    1982-02-01

    The specific /sup 3/H-spiperone binding to membrane homogenates of the striatum, mesolimbic area, and frontal cortex was examined in two groups of rats pretreated once daily with saline or 4 mg/kg of methamphetamine (MAP) for 14 days. At 7 days following cessation of chronic pretreatment, all rats received an injection of 4 mg/kg of MAP and were decapitated 1 hr after the injection. In the chronic saline-pretreatment group, the single administration of MAP induced significant changes in the number (Bmax) of specific /sup 3/H-spiperone binding sites (a decrease in the striatum and an increase in the mesolimbic area and frontalmore » cortex), but no significant changes in the affinity (KD) in any brain area. The chronic MAP pretreatment markedly augmented the changes in Bmax in the striatum and mesolimbic area. The increase in specific /sup 3/H-spiperone binding sites in the mesolimbic area is discussed in relation to MAP-induced behavioral hypersensitivity.« less

  4. Characterization of sediment transport upstream and downstream from Lake Emory on the Little Tennessee River near Franklin, North Carolina, 2014–15

    USGS Publications Warehouse

    Huffman, Brad A.; Hazell, William F.; Oblinger, Carolyn J.

    2017-09-06

    Federal, State, and local agencies and organizations have expressed concerns regarding the detrimental effects of excessive sediment transport on aquatic resources and endangered species populations in the upper Little Tennessee River and some of its tributaries. In addition, the storage volume of Lake Emory, which is necessary for flood control and power generation, has been depleted by sediment deposition. To help address these concerns, a 2-year study was conducted in the upper Little Tennessee River Basin to characterize the ambient suspended-sediment concentrations and suspended-sediment loads upstream and downstream from Lake Emory in Franklin, North Carolina. The study was conducted by the U.S. Geological Survey in cooperation with Duke Energy. Suspended-sediment samples were collected periodically, and time series of stage and turbidity data were measured from December 2013 to January 2016 upstream and downstream from Lake Emory. The stage data were used to compute time-series streamflow. Suspended-sediment samples, along with time-series streamflow and turbidity data, were used to develop regression models that were used to estimate time-series suspended-sediment concentrations for the 2014 and 2015 calendar years. These concentrations, along with streamflow data, were used to compute suspended-sediment loads. Selected suspended-sediment samples were collected for analysis of particle-size distribution, with emphasis on high-flow events. Bed-load samples were also collected upstream from Lake Emory.The estimated annual suspended-sediment loads (yields) for the upstream site for the 2014 and 2015 calendar years were 27,000 short tons (92 short tons per square mile) and 63,300 short tons (215 short tons per square mile), respectively. The annual suspended-sediment loads (yields) for the downstream site for 2014 and 2015 were 24,200 short tons (75 short tons per square mile) and 94,300 short tons (292 short tons per square mile), respectively. Overall, the suspended-sediment load at the downstream site was about 28,300 short tons greater than the upstream site over the study period.As expected, high-flow events (the top 5 percent of daily mean flows) accounted for the majority of the sediment load; 80 percent at the upstream site and 90 percent at the downstream site. A similar relation between turbidity (the top 5 percent of daily mean turbidity) and high loads was also noted. In general, when instantaneous streamflows at the upstream site exceeded 5,000 cubic feet per second, increased daily loads were computed at the downstream site. During low to moderate flows, estimated suspended-sediment loads were lower at the downstream site when compared to the upstream site, which suggests that sediment deposition may be occurring in the intervening reach during those conditions. During the high-flow events, the estimated suspended-sediment loads were higher at the downstream site; however, it is impossible to say with certainty whether the increase in loading was due to scouring of lake sediment, contributions from the additional source area, model error, or a combination of one or more of these factors. The computed loads for a one-week period (December 24–31, 2015), during which the two largest high-flow events of the study period occurred, were approximately 52 percent of the 2015 annual sediment load (36 percent of 2-year load) at the upstream site and approximately 72 percent of the 2015 annual sediment load (57 percent of 2-year load) at the downstream site. Six bedload samples were collected during three events; two high-flow events and one base-flow event. The contribution of bedload to the total sediment load was determined to be insignificant for sampled flows. In general, streamflows for long-term streamgages in the study area were below normal for the majority of the study period; however, flows during the last 3 months of the study period were above normal, including the extreme events during the last week of the study period.

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  6. Thermal effects of dams in the Willamette River basin, Oregon

    USGS Publications Warehouse

    Rounds, Stewart A.

    2010-01-01

    Methods were developed to assess the effects of dams on streamflow and water temperature in the Willamette River and its major tributaries. These methods were used to estimate the flows and temperatures that would occur at 14 dam sites in the absence of upstream dams, and river models were applied to simulate downstream flows and temperatures under a no-dams scenario. The dams selected for this study include 13 dams built and operated by the U.S. Army Corps of Engineers (USACE) as part of the Willamette Project, and 1 dam on the Clackamas River owned and operated by Portland General Electric (PGE). Streamflows in the absence of upstream dams for 2001-02 were estimated for USACE sites on the basis of measured releases, changes in reservoir storage, a correction for evaporative losses, and an accounting of flow effects from upstream dams. For the PGE dam, no-project streamflows were derived from a previous modeling effort that was part of a dam-relicensing process. Without-dam streamflows were characterized by higher peak flows in winter and spring and much lower flows in late summer, as compared to with-dam measured flows. Without-dam water temperatures were estimated from measured temperatures upstream of the reservoirs (the USACE sites) or derived from no-project model results (the PGE site). When using upstream data to estimate without-dam temperatures at dam sites, a typical downstream warming rate based on historical data and downstream river models was applied over the distance from the measurement point to the dam site, but only for conditions when the temperature data indicated that warming might be expected. Regressions with measured temperatures from nearby or similar sites were used to extend the without-dam temperature estimates to the entire 2001-02 time period. Without-dam temperature estimates were characterized by a more natural seasonal pattern, with a maximum in July or August, in contrast to the measured patterns at many of the tall dam sites where the annual maximum temperature typically occurred in September or October. Without-dam temperatures also tended to have more daily variation than with-dam temperatures. Examination of the without-dam temperature estimates indicated that dam sites could be grouped according to the amount of streamflow derived from high-elevation, spring-fed, and snowmelt-driven areas high in the Cascade Mountains (Cougar, Big Cliff/Detroit, River Mill, and Hills Creek Dams: Group A), as opposed to flow primarily derived from lower-elevation rainfall-driven drainages (Group B). Annual maximum temperatures for Group A ranged from 15 to 20 degree(s)C, expressed as the 7-day average of the daily maximum (7dADM), whereas annual maximum 7dADM temperatures for Group B ranged from 21 to 25 degrees C. Because summertime stream temperature is at least somewhat dependent on the upstream water source, it was important when estimating without-dam temperatures to use correlations to sites with similar upstream characteristics. For that reason, it also is important to maintain long-term, year-round temperature measurement stations at representative sites in each of the Willamette River basin's physiographic regions. Streamflow and temperature estimates downstream of the major dam sites and throughout the Willamette River were generated using existing CE-QUAL-W2 flow and temperature models. These models, originally developed for the Willamette River water-temperature Total Maximum Daily Load process, required only a few modifications to allow them to run under the greatly reduced without-dam flow conditions. Model scenarios both with and without upstream dams were run. Results showed that Willamette River streamflow without upstream dams was reduced to levels much closer to historical pre-dam conditions, with annual minimum streamflows approximately one-half or less of dam-augmented levels. Thermal effects of the dams varied according to the time of year, from cooling in mid-summer to warm

  7. Spawning chronology, nest site selection and nest success of smallmouth bass during benign streamflow conditions

    USGS Publications Warehouse

    Dauwalter, D.C.; Fisher, W.L.

    2007-01-01

    We documented the nesting chronology, nest site selection and nest success of smallmouth bass Micropterus dolomieu in an upstream (4th order) and downstream (5th order) reach of Baron Fork Creek, Oklahoma. Males started nesting in mid-Apr. when water temperatures increased to 16.9 C upstream, and in late-Apr. when temperatures increased to 16.2 C downstream. Streamflows were low (77% upstream to 82% downstream of mean Apr. streamflow, and 12 and 18% of meanjun. streamflow; 47 and 55 y of record), and decreased throughout the spawning period. Larger males nested first upstream, as has been observed in other populations, but not downstream. Upstream, progeny in 62 of 153 nests developed to swim-up stage. Downstream, progeny in 31 of 73 nests developed to swim-up. Nesting densities upstream (147/km) and downstream (100/km) were both higher than any densities previously reported. Males selected nest sites with intermediate water depths, low water velocity and near cover, behavior that is typical of smallmouth bass. Documented nest failures resulted from human disturbance, angling, and longear sunfish predation. Logistic exposure models showed that water velocity at the nest was negatively related and length of the guarding male was positively related to nest success upstream. Male length and number of degree days were both positively related to nest success downstream. Our results, and those of other studies, suggest that biological factors account for most nest failures during benign (stable, low flow) streamflow conditions, whereas nest failures attributed to substrate mobility or nest abandonment dominate when harsh streamflow conditions (spring floods) coincide with the spawning season.

  8. Risk assessment of imidacloprid use in forest settings on the aquatic macroinvertebrate community.

    PubMed

    Benton, Elizabeth P; Grant, Jerome F; Nichols, Rebecca J; Webster, R Jesse; Schwartz, John S; Bailey, Joseph K

    2017-11-01

    The isolated effects of a single insecticide can be difficult to assess in natural settings because of the presence of numerous pollutants in many watersheds. Imidacloprid use for suppressing hemlock woolly adelgid, Adelges tsugae (Annand) (Hemiptera: Adelgidae), in forests offers a rare opportunity to assess potential impacts on aquatic macroinvertebrates in relatively pristine landscapes. Aquatic macroinvertebrate communities were assessed in 9 streams in Great Smoky Mountains National Park (southern Appalachian Mountains, USA). The streams flow through hemlock conservation areas where imidacloprid soil drench treatments were applied for hemlock woolly adelgid suppression. Sites were located upstream and downstream of the imidacloprid treatments. Baseline species presence data (pre-imidacloprid treatment) were available from previous sample collections at downstream sites. Downstream and upstream sites did not vary in numerous community measures. Although comparisons of paired upstream and downstream sites showed differences in diversity in 7 streams, higher diversity was found more often in downstream sites. Macroinvertebrate functional feeding groups and life habits were similar between downstream and upstream sites. Downstream and baseline stream samples were similar. While some functional feeding group and life habit species richness categories varied, variations did not indicate poorer quality downstream communities. Imidacloprid treatments applied according to US Environmental Protection Agency federal restrictions did not result in negative effects to aquatic macroinvertebrate communities, which indicates that risks of imidacloprid use in forest settings are low. Environ Toxicol Chem 2017;36:3108-3119. © 2017 SETAC. © 2017 SETAC.

  9. Evaluation of T-cell activation in the duodenum of dogs with cutaneous food hypersensitivity.

    PubMed

    Veenhof, Eveline Z; Rutten, Victor P; van Noort, Ronald; Knol, Edward F; Willemse, Ton

    2010-04-01

    To determine whether skin-related clinical signs in cutaneous food hypersensitivity (CFH) coincide with immune reactivity in the intestine in dogs. 11 dogs with CFH without intestinal clinical signs and 8 healthy control dogs. After a provocation and elimination diet, the duodenal gene expression levels of Th1-, Th2- and Treg-related cytokines and transcription factors were investigated by means of quantitative PCR assay. The presence of CD3(+), CD8(+), CD4(+), CD1c(+), gammadelta T-cell receptor(+), and major histocompatibility complex II(+) cells in duodenal epithelium and lamina propria were determined. The expression of Th1-, Th2-, and Treg-related genes in dogs with CFH and healthy control dogs was similar. Although clinical signs disappeared, there was no effect of the elimination diet on cytokines, transcription factors, or cellular phenotypes. No change in T-cell phenotypes or a distinct Th1, Th2, or Treg profile was detected in the duodenum of dogs with only cutaneous clinical signs of food hypersensitivity. This suggested that the intestinal mucosa is not the primary site of T-cell activation that eventually leads to cutaneous food hypersensitivity.

  10. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  11. Barriers impede upstream spawning migration of flathead chub

    USGS Publications Warehouse

    Walters, David M.; Zuellig, Robert E.; Crockett, Harry J.; Bruce, James F.; Lukacs, Paul M.; Fitzpatrick, Ryan M.

    2014-01-01

    Many native cyprinids are declining throughout the North American Great Plains. Some of these species require long reaches of contiguous, flowing riverine habitat for drifting eggs or larvae to develop, and their declining populations have been attributed to habitat fragmentation or barriers (e.g., dams, dewatered channels, and reservoirs) that restrict fish movement. Upstream dispersal is also needed to maintain populations of species with passively drifting eggs or larvae, and prior researchers have suggested that these fishes migrate upstream to spawn. To test this hypothesis, we conducted a mark–recapture study of Flathead Chub Platygobio gracilis within a 91-km reach of continuous riverine habitat in Fountain Creek, Colorado. We measured CPUE, spawning readiness (percent of Flathead Chub expressing milt), and fish movement relative to a channel-spanning dam. Multiple lines of evidence indicate that Flathead Chub migrate upstream to spawn during summer. The CPUE was much higher at the base of the dam than at downstream sites; the seasonal increases in CPUE at the dam closely tracked seasonal increases in spawning readiness, and marked fish moved upstream as far as 33 km during the spawning run. The upstream migration was effectively blocked by the dam. The CPUE of Flathead Chub was much lower upstream of the OHDD than at downstream sites, and <0.2% of fish marked at the dam were recaptured upstream. This study provides the first direct evidence of spawning migration for Flathead Chub and supports the general hypothesis that barriers limit adult dispersal of these and other plains fishes.

  12. Participation of transient receptor potential vanilloid 1 in paclitaxel-induced acute visceral and peripheral nociception in rodents.

    PubMed

    Rossato, Mateus Fortes; Rigo, Flavia Karine; Oliveira, Sara Marchesan; Guerra, Gustavo Petri; Silva, Cássia Regina; Cunha, Thiago Mattar; Gomez, Marcus Vinícius; Ferreira, Juliano; Trevisan, Gabriela

    2018-06-05

    The clinical use of paclitaxel as a chemotherapeutic agent is limited by the severe acute and chronic hypersensitivity caused when it is administered via intraperitoneal or intravenous routes. Thus far, evidence has suggested that transient receptor potential vanilloid-1 (TRPV1) has a key role in the chronic neuropathy induced by paclitaxel. Despite this, the role of TRPV1 in paclitaxel -related acute nociception, especially the development of visceral nociception, has not been evaluated. Thus, the goal of this study was to evaluate the participation of TRPV1 in a model of acute nociception induced by paclitaxel in rats and mice. A single intraperitoneal (i.p.) paclitaxel administration (1 mg/kg, i.p.) produced an immediate visceral nociception response 1 h after administration, caused mechanical and heat hypersensitivity, and diminished burrowing behaviour 24 h after administration. These nociceptive responses were reduced by SB-366791 treatment (0.5 mg/kg, i.p., a TRPV1 antagonist). In addition, TRPV1-positive sensory fibre ablation (using resiniferatoxin, 200 µg/kg, s.c.) reduced visceral nociception and mechanical or heat hypersensitivity caused by paclitaxel injection. Similarly, TRPV1 deficient mice showed a pronounced reduction in mechanical allodynia to paclitaxel acute injection and did not develop heat hypersensitivity. Moreover, 24 h after its injection, paclitaxel induced chemical hypersensitivity to capsaicin (a TRPV1 agonist, 0.01 nmol/site) and increased TRPV1 immunoreactivity in the dorsal root ganglion and sciatic nerve. In conclusion, TRPV1 is involved in mechanical and heat hypersensitivity and spontaneous-pain behaviour induced 24 h after a single paclitaxel injection. This receptor is also involved in visceral nociception induced immediately after paclitaxel administration. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Pharmacological Modulation of the Mitochondrial Electron Transport Chain in Paclitaxel-Induced Painful Peripheral Neuropathy.

    PubMed

    Griffiths, Lisa A; Flatters, Sarah J L

    2015-10-01

    Paclitaxel is an effective first-line chemotherapeutic with the major dose-limiting side effect of painful neuropathy. Mitochondrial dysfunction and oxidative stress have been implicated in paclitaxel-induced painful neuropathy. Here we show the effects of pharmacological modulation of mitochondrial sites that produce reactive oxygen species using systemic rotenone (complex I inhibitor) or antimycin A (complex III inhibitor) on the maintenance and development of paclitaxel-induced mechanical hypersensitivity in adult male Sprague Dawley rats. The maximally tolerated dose (5 mg/kg) of rotenone inhibited established paclitaxel-induced mechanical hypersensitivity. However, some of these inhibitory effects coincided with decreased motor coordination; 3 mg/kg rotenone also significantly attenuated established paclitaxel-induced mechanical hypersensitivity without any motor impairment. The maximally tolerated dose (.6 mg/kg) of antimycin A reversed established paclitaxel-induced mechanical hypersensitivity without any motor impairment. Seven daily doses of systemic rotenone or antimycin A were given either after paclitaxel administration or before and during paclitaxel administration. Rotenone had no significant effect on the development of paclitaxel-induced mechanical hypersensitivity. However, antimycin A significantly inhibited the development of paclitaxel-induced mechanical hypersensitivity when given before and during paclitaxel administration but had no effect when given after paclitaxel administration. These studies provide further evidence of paclitaxel-evoked mitochondrial dysfunction in vivo, suggesting that complex III activity is instrumental in paclitaxel-induced pain. This study provides further in vivo evidence that mitochondrial dysfunction is a key contributor to the development and maintenance of chemotherapy-induced painful neuropathy. This work also indicates that selective modulation of the electron transport chain can induce antinociceptive effects in a preclinical model of paclitaxel-induced pain. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Effect of Rap1 binding on DNA distortion and potassium permanganate hypersensitivity.

    PubMed

    Le Bihan, Yann-Vaï; Matot, Béatrice; Pietrement, Olivier; Giraud-Panis, Marie-Josèphe; Gasparini, Sylvaine; Le Cam, Eric; Gilson, Eric; Sclavi, Bianca; Miron, Simona; Le Du, Marie-Hélène

    2013-03-01

    Repressor activator protein 1 (Rap1) is an essential factor involved in transcription and telomere stability in the budding yeast Saccharomyces cerevisiae. Its interaction with DNA causes hypersensitivity to potassium permanganate, suggesting local DNA melting and/or distortion. In this study, various Rap1-DNA crystal forms were obtained using specifically designed crystal screens. Analysis of the DNA conformation showed that its distortion was not sufficient to explain the permanganate reactivity. However, anomalous data collected at the Mn edge using a Rap1-DNA crystal soaked in potassium permanganate solution indicated that the DNA conformation in the crystal was compatible with interaction with permanganate ions. Sequence-conservation analysis revealed that double-Myb-containing Rap1 proteins all carry a fully conserved Arg580 at a position that may favour interaction with permanganate ions, although it is not involved in the hypersensitive cytosine distortion. Permanganate reactivity assays with wild-type Rap1 and the Rap1[R580A] mutant demonstrated that Arg580 is essential for hypersensitivity. AFM experiments showed that wild-type Rap1 and the Rap1[R580A] mutant interact with DNA over 16 successive binding sites, leading to local DNA stiffening but not to accumulation of the observed local distortion. Therefore, Rap1 may cause permanganate hypersensitivity of DNA by forming a pocket between the reactive cytosine and Arg580, driving the permanganate ion towards the C5-C6 bond of the cytosine.

  15. Effects of aquifer storage and recovery activities on water quality in the Little Arkansas River and Equus Beds Aquifer, south-central Kansas, 2011–14

    USGS Publications Warehouse

    Stone, Mandy L.; Garrett, Jessica D.; Poulton, Barry C.; Ziegler, Andrew C.

    2016-07-18

    The Equus Beds aquifer in south-central Kansas is aprimary water source for the city of Wichita. The Equus Beds aquifer storage and recovery (ASR) project was developed to help the city of Wichita meet increasing current (2016) and future water demands. The Equus Beds ASR project pumps water out of the Little Arkansas River during above-base flow conditions, treats it using drinking-water quality standards as a guideline, and recharges it into the Equus Beds aquifer for later use. Phase II of the Equus Beds ASR project currently (2016) includes a river intake facility and a surface-water treatment facility with a 30 million gallon per day capacity. Water diverted from the Little Arkansas River is delivered to an adjacent presedimentation basin for solids removal. Subsequently, waste from the surface-water treatment facility and the presedimentation basin is returned to the Little Arkansas River through a residuals return line. The U.S. Geological Survey, in cooperation with the city of Wichita, developed and implemented a hydrobiological monitoring program as part of the ASR project to characterize and quantify the effects of aquifer storage and recovery activities on the Little Arkansas River and Equus Beds aquifer water quality.Data were collected from 2 surface-water sites (one upstream and one downstream from the residuals return line), 1 residuals return line site, and 2 groundwater well sites (each having a shallow and deep part): the Little Arkansas River upstream from the ASR facility near Sedgwick, Kansas (upstream surface-water site 375350097262800), about 0.03 mile (mi) upstream from the residuals return line site; the Little Arkansas River near Sedgwick, Kans. (downstream surface-water site 07144100), about 1.68 mi downstream from the residuals return line site; discharge from the Little Arkansas River ASR facility near Sedgwick, Kansas (residuals return line site 375348097262800); 25S 01 W 07BCCC01 SMW–S11 near CW36 (MW–7 shallow groundwater well site 375327097285401); 25S01 W 07BCCC02 DMW–S10 near CW36 (MW–7 deep groundwater well site 375327097285402); 25S 01W 07BCCA01 SMW–S13 near CW36 (MW–8 shallow groundwater well site 375332097284801); and 25S 01W 07BCCA02 DMW–S14 near CW36 (MW–8 deep groundwater well site 375332097284802). The U.S. Geological Survey, in cooperation with the city of Wichita, assessed the effects of the ASR Phase II facility residuals return line discharges on stream quality of the Little Arkansas River by measuring continuous physicochemical properties and collecting discrete water-quality and sediment samples for about 2 years pre- (January 2011 through April 2013) and post-ASR (May 2013 through December 2014) Phase II facility operation upstream and downstream from the ASR Phase II facility. Additionally, habitat variables were quantified and macroinvertebrate and fish communities were sampled upstream and downstream from the ASR Phase II facility during the study period. To assess the effects of aquifer recharge on Equus Beds groundwater quality, continuous physicochemical properties were measured and discrete water-quality samples were collected before and during the onset of Phase II aquifer recharge in two (shallow and deep) groundwater wells.Little Arkansas River streamflow was about 10 times larger after the facility began operating because of greater rainfall. Residuals return line release volumes were a very minimal proportion (0.06 percent) of downstream streamflow volume during the months the ASR facility was operating. Upstream and downstream continuously measured water temperature and dissolved oxygen median differences were smaller post-ASR than pre-ASR. Turbidity generally was smaller at the downstream site throughout the study period and decreased at both sites after the ASR Phase II facility began discharging despite a median residuals return line turbidity that was about an order of magnitude larger than the median turbidity at the downstream site. Upstream and downstream continuously measured turbidity median differences were larger post-ASR than pre-ASR. Median post-ASR continuously measured nitrite plus nitrate and continuously computed total suspended solids and suspended-sediment concentrations were smaller than pre-ASR likely because of higher streamflows and dilution; whereas, median continuously computed dissolved and total organic carbon concentrations were larger likely because of higher streamflows and runoff conditions.None of the discretely measured water-quality constituents (dissolved and suspended solids, primary ions, suspended sediment, nutrients, carbon, trace elements, viral and bacterial indicators, and pesticides) in surface water were significantly different between the upstream and downstream sites after the ASR Phase II facility began discharging; however, pre-ASR calcium, sodium, hardness, manganese, and arsenate concentrations were significantly larger at the upstream site, which indicates that some water-quality conditions at the upstream and downstream sites were more similar post-ASR. Most of the primary constituents that make up dissolved solids decreased at both sites after the ASR Phase II facility began operation. Discretely collected total suspended solids concentrations were similar between the upstream and downstream sites before the facility began operating but were about 27 percent smaller at the downstream site after the facility began operating, despite the total suspended solids concentrations in the residuals return line being 15 times larger than the downstream site.Overall habitat scores were indicative of suboptimal conditions upstream and downstream from the ASR Phase II facility throughout the study period. Substrate fouling and sediment deposition mean scores indicated marginal conditions at the upstream and downstream sites during the study period, demonstrating that sediment deposition was evident pre- and post-ASR and no substantial changes in these habitat characteristics were noted after the ASR Phase II facility began discharging. Macroinvertebrate community composition (evaluated using functional feeding, behavioral, and tolerance metrics) generally was similar between sites during the study period. Fewer macroinvertebrate metrics were significant between the upstream and downstream sites post-ASR (6) than pre-ASR (14), which suggests that macroinvertebate communities were more similar after the ASR facility began discharging. Upstream-downstream comparisons in macroinvertebrate aquatic-life-support metrics had no significant differences for the post-ASR time period and neither site was fully supporting for any of the Kansas Department of Health and Environment aquatic-life-support metrics (Macroinvertebrate Biotic Index; Kansas Biotic Index with tolerances for nutrients and oxygen-demanding substances; Ephemeroptera, Plecoptera, and Trichoptera [EPT] richness; and percentage of EPT species). Overall, using macroinvertebrate aquatic life-support criteria from the Kansas Department of Health and Environment, upstream and downstream sites were classified as partially supporting before and after the onset of ASR facility operations. Fish community trophic status and tolerance groups generally were similar among sites during the study period. Fish community Little Arkansas River Basin Index of Biotic Integrity scores at the upstream and downstream sites were indicative of fair-to-good conditions before the facility began operating and decreased to fair conditions after the facility began operating.Groundwater physicochemical changes concurrent with the beginning of recharge operations at the Sedgwick basin were more pronounced in shallow groundwater. No constituent concentrations in the pre-recharge period in comparison to the post-recharge period increased to concentrations exceeding drinking water regulations; however, nitrate decreased significantly from a pre-recharge exceedance of the U.S. Environmental Protection Agency maximum contaminant level to a post recharge nonexceedance. Shallow groundwater chemical concentrations or rates of detection increased after artificial recharge began for the ions potassium, chloride, and fluoride; phosphorus and organic carbon species; trace elements barium, manganese, nickel, arsenate, arsenic, and boron; agricultural pesticides atrazine, metolachlor, metribuzin, and simazine; organic disinfection byproducts bromodichloromethane and trichloromethane; and gross beta levels. Additionally, water temperature, and pH were larger after recharge began; and total solids and slime-forming bacteria concentrations and densities were smaller. Total solids, nitrate, and selenium significantly decreased; and potassium, chloride, nickel, arsenic, fluoride, phosphorus and carbon species, and gross beta levels significantly increased in shallow groundwater after artificial recharge. Results of biological activity reaction tests indicated that water quality microbiology was different before and after artificial recharge began; at times, these differences may lead to changes in dominant bacterial populations that, in turn, may lead to formation and expansion in populations that may cause bioplugging and other unwanted effects. Calcite, iron (II) hydroxide, hydroxyapatite, and similar minerals, had shifts in saturation indices that generally were from undersaturation toward equilibrium and, in some cases, toward oversaturation. These shifts toward neutral saturation indices might suggest reduced weathering of the minerals present in the Equus Beds aquifer. Chemical weathering in the shallow parts of the aquifer may be accelerated because of the increased water temperatures and the system is more vulnerable to clogged pores and mineral dissolution as the equilibrium state is affected by recharge and withdrawal. When oversaturation is indicated for iron minerals, plugging of aquifer materials may happen.

  16. Tuberculin-induced delayed-type hypersensitivity reaction in a model of hu-PBMC-SCID mice grafted with autologous skin.

    PubMed Central

    Tsicopoulos, A.; Pestel, J.; Fahy, O.; Vorng, H.; Vandenbusche, F.; Porte, H.; Eraldi, L.; Wurtz, A.; Akoum, H.; Hamid, Q.; Wallaert, B.; Tonnel, A. B.

    1998-01-01

    We have developed an animal model to study human delayed-type hypersensitivity reactions. Previous studies in humans have shown after tuberculin injection the presence of a mononuclear cell infiltration, with almost no eosinophils, associated with a preferential Th-1-type cytokine profile. Human skin graft obtained from tuberculin-reactive donors was grafted onto the back of severe combined immunodeficient mice. After healing, mice were reconstituted intraperitoneally with peripheral mononuclear cells. Tuberculin and diluent were injected intradermally, and skin biopsies were performed 72 hours later. Skin grafts were divided into two parts, one for immunohistochemistry and one for in situ hybridization studies. Immunohistochemistry was performed on cryostat sections using the alkaline phosphatase anti-alkaline phosphatase technique. In the tuberculin-injected sites as compared with the diluent-injected sites, there were significant increases in the number of CD45+ pan leukocytes and CD4+, CD8+, CD45RO+ T cells but not in CD68+ monocytes/macrophages and EG2 or MBP+ eosinophils. The activation markers CD25 and HLA-DR were up-regulated in the tuberculin-injected sites. In situ hybridization was performed using 35S-labeled riboprobes for interleukin (IL)-2, interferon (IFN)-gamma, IL-4, and IL-5. After tuberculin injection, a preferential Th-1-type cytokine profile was observed with significant increases in the numbers of IL-2 and IFN-gamma mRNA-expressing cells. These results are similar to those reported after tuberculin-induced delayed-type hypersensitivity in humans, suggesting that this model might be useful to study cutaneous inflammatory reaction. Images Figure 4 PMID:9626072

  17. Tuberculin-induced delayed-type hypersensitivity reaction in a model of hu-PBMC-SCID mice grafted with autologous skin.

    PubMed

    Tsicopoulos, A; Pestel, J; Fahy, O; Vorng, H; Vandenbusche, F; Porte, H; Eraldi, L; Wurtz, A; Akoum, H; Hamid, Q; Wallaert, B; Tonnel, A B

    1998-06-01

    We have developed an animal model to study human delayed-type hypersensitivity reactions. Previous studies in humans have shown after tuberculin injection the presence of a mononuclear cell infiltration, with almost no eosinophils, associated with a preferential Th-1-type cytokine profile. Human skin graft obtained from tuberculin-reactive donors was grafted onto the back of severe combined immunodeficient mice. After healing, mice were reconstituted intraperitoneally with peripheral mononuclear cells. Tuberculin and diluent were injected intradermally, and skin biopsies were performed 72 hours later. Skin grafts were divided into two parts, one for immunohistochemistry and one for in situ hybridization studies. Immunohistochemistry was performed on cryostat sections using the alkaline phosphatase anti-alkaline phosphatase technique. In the tuberculin-injected sites as compared with the diluent-injected sites, there were significant increases in the number of CD45+ pan leukocytes and CD4+, CD8+, CD45RO+ T cells but not in CD68+ monocytes/macrophages and EG2 or MBP+ eosinophils. The activation markers CD25 and HLA-DR were up-regulated in the tuberculin-injected sites. In situ hybridization was performed using 35S-labeled riboprobes for interleukin (IL)-2, interferon (IFN)-gamma, IL-4, and IL-5. After tuberculin injection, a preferential Th-1-type cytokine profile was observed with significant increases in the numbers of IL-2 and IFN-gamma mRNA-expressing cells. These results are similar to those reported after tuberculin-induced delayed-type hypersensitivity in humans, suggesting that this model might be useful to study cutaneous inflammatory reaction.

  18. Synergistic and additive properties of the beta-globin locus control region (LCR) revealed by 5'HS3 deletion mutations: implication for LCR chromatin architecture.

    PubMed

    Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A; Peterson, Kenneth R; Stamatoyannopoulos, George; Li, Qiliang

    2005-08-01

    Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5'HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (beta-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5'HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythroblasts. The 234-bp 5'HS3 deletion abolished histone acetylation throughout the beta-globin locus; recruitment of RNA polymerase II (pol II) to the LCR and beta-globin gene promoter was reduced to a basal level; and formation of all the 5' DNase I hypersensitive sites of the LCR was disrupted. The 2.3-kb 5'HS3 deletion mildly reduced the level of histone acetylation but did not change the profile across the whole locus; the 5' DNase I hypersensitive sites of the LCR were formed, but to a lesser extent; and recruitment of pol II was reduced, but only marginally. These data support the hypothesis that the LCR forms a specific chromatin structure and acts as a single entity. Based on these results we elaborate on a model of LCR chromatin architecture which accommodates the distinct phenotypes of the 5'HS3 and HS3 core deletions.

  19. Sediment transport and water-quality characteristics and loads, White River, northwestern Colorado, water years 1975-88

    USGS Publications Warehouse

    Tobin, R.L.

    1993-01-01

    Streamflow, sediment, and water-quality data are summarized for 6 sites on the White River, Colorado for water years 1975-88. Correlation techniques were used to estimate annual data for unmeasured years. Annual stream discharge in the main stem of the White River ranged from about 200,000 to about 1 million acre-feet. Generally, bedload was less than/= 3.3 percent of total sediment load. Annual suspended-sediment loads ranged from about 2,100 tons at the upstream sites on the North Fork and South Fork of the White River to about 2 million tons at the most downstream site. Average annual suspended-sediment loads ranged from about 11,000 tons at the upstream sites to about 705,000 tons at the most downstream site. Annual capacity losses in a 50,000 acre-ft reservoir could range from less than 0.01 percent near upstream sites to about 2.5 percent near downstream sites. Maximum water temperatures in the White River ranged from less than 20 to 25 C in summer. Specific conductance ranged from 200 to 1,000 microsiemens/cm. Generally, values of pH ranged from 7.6 to 8.8, and concentrations of dissolved oxygen were greater than 6.0 mg/L. In small streamflows, values of pH and dissolved oxygen were affected by biologic processes. Composition of dissolved solids in the White River was mostly calcium, bicarbonate, and(or) sulfate. Changes in the composition of dissolved solids caused by the changes in the concentrations of sodium and sulfate were greatest in small stream discharges. Annual loads of dissolved solids ranged from 21,100 tons in the South Fork to about 480,000 tons at the most downstream site. Total solids transport in the White River was mostly as dissolved solids at upstream sites and mostly as suspended sediment at downstream sites. Concentration ranges of nutrients and trace constituents were determined.

  20. Occurrence and concentrations of selected trace elements and halogenated organic compounds in stream sediments and potential sources of polychlorinated biphenyls, Leon Creek, San Antonio, Texas, 2012–14

    USGS Publications Warehouse

    Wilson, Jennifer T.

    2016-06-23

    Sediment samples collected from Leon Creek by the USGS during 2007–9 and 2012–14 at a total of eight sites following identical field and laboratory methods were evaluated to determine if potential PCB sources could be identified. Total PCB concentrations in the sediment samples collected upstream from the Joint Base site were low or nondetections; while concentrations in the samples collected on and downstream from the Joint Base site were greater. Congeners 180 and 138 constituted the greatest proportion of the PCB mixture in samples collected upstream from, on, and downstream from the Joint Base site. Upstream from the Joint Base site, congeners 180 and 138 constituted 50 percent and 35 percent respectively of the PCBs congeners found in the samples. On and downstream from the Joint Base site, congeners 180 and 138 constituted 80 percent and 13 percent respectively of the PCBs congeners found in the samples. Chi-square (C2) tests also indicate that samples collected from the Loop 410 site were statistically different from samples collected from the Joint Base site and sites downstream. The PCB congener pattern in the Leon Creek samples is most like the congener mixture in Aroclor 1260, which is chemically similar to the PCBs detected in the fish samples that resulted in the 2003 fish consumption advisory.

  1. Reduced recruitment of inflammatory cells in a contact hypersensitivity response in P-selectin-deficient mice

    PubMed Central

    1995-01-01

    The inflammatory response at sites of contact hypersensitivity induced by oxazolone was examined in the ears of P-selectin-deficient and wild- type mice. Accumulation of CD4+ T lymphocytes, monocytes, and neutrophils was reduced significantly in the mutant mice, as well as mast cell degranulation. In contrast, there was no significant difference in vascular permeability or edema between the two genotypes. The results demonstrate a role for P-selectin in recruitment of CD4+ T lymphocytes and show that P-selectin plays a role in long-term inflammation as well as in acute responses. PMID:7539046

  2. Indicators of immunotoxicity in populations of cotton rats (Sigmodon hispidus) inhabiting an abandoned oil refinery.

    PubMed

    McMurry, S T; Lochmiller, R L; McBee, K; Qualls, C W

    1999-03-01

    Wildlife species inhabiting contaminated sites are often exposed to complex mixtures of chemicals, many of which have known effects on physiological and biochemical function. Although sensitivity of the immune system to chemical exposure has been documented in laboratory animal and wildlife species, little work has been conducted on feral wildlife populations inhabiting contaminated sites. Immune function was measured in populations of wild cotton rats (Sigmodon hispidus) inhabiting replicated reference and contaminated study sites at an abandoned oil refinery in Oklahoma four times from 1991 to 1992. Several measures of immunocompetence were examined including immune organ mass and cellularity, hematology, in vivo hypersensitivity, macrophage function, killer cell activity, and lymphoproliferative responsiveness. In vitro proliferation of splenocytes, either spontaneous or induced with concanavalin A (Con A), was the most consistent and reliable indicator of immunotoxicity. Spontaneous proliferation of splenocytes was 48 and 24% higher for cotton rats collected from contaminated than reference sites in September 1991 and September 1992, respectively. Likewise, Con A-induced proliferation of splenocytes ranged form 20 to 53% higher in animals collected from contaminated than reference sites in three of four collection periods. The percentage of splenocytes (mean+/-SE) staining positive for Con A receptors was lower on contaminated sites (73.7+/-1.2%) than reference sites (77.0+/-1.4%) in September 1991. Other measures of immune function including macrophage metabolism, hypersensitivity, blood cellularity, and mass and cellularity of immune organs varied between contaminated and reference sites. Copyright 1999 Academic Press.

  3. Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

    PubMed

    Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

    2015-01-01

    Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

  4. Hypersensitive response of beans to Apion godmani (Coleoptera: Curculionidae).

    PubMed

    Garza, R; Vera, J; Cardona, C; Barcenas, N; Singh, S P

    2001-08-01

    High levels of resistance to Apion godinani Wagner have been reported in bean, Phaseolus vulgaris L., landraces from Mexico. We report on the role of hypersensitivity to A. godmani in five resistant and three susceptible bean genotypes. In susceptible genotypes (cultivars 'Canario 107','Jamapa', and 'Zacatecas 45'), the eggs and first instars of A. godmani were embedded in the pod mesocarp and usually were surrounded by healthy tissue. In contrast, in resistant landraces ('Amarillo 154', 'Amarillo 155', 'J-117', 'Puebla 36', and 'Pinto 168'), necrotic tissues developed concentrically around the oviposition site, encapsulating eggs and dead larvae. An inverse relationship between percentage egg and larval encapsulation at the early immature pod stages and percentage of damaged seeds at harvest was found. Results indicate that hypersensitivity in developing pods plays an important role in antibiosis to A. godmani in beans. This information will facilitate future genetic and biochemical research and provide much needed information concerning the phenotypic basis of resistance to A. godmani in bean.

  5. Asthma, hypersensitivity pneumonitis and other respiratory diseases caused by metalworking fluids.

    PubMed

    Rosenman, Kenneth D

    2009-04-01

    To highlight advances in understanding the respiratory disease associated with metal machining, a common work process involving approximately 1.2 million workers in the USA. Recent studies emphasize that work-related asthma and hypersensitivity pneumonitis continue to be caused by exposure to metalworking fluid. Identification of an individual patient indicates the need for follow-up investigations at the work site to prevent additional disease and/or identify additional effected individuals. Identification of the causal agent for hypersensitivity pneumonitis has centered on microbial contamination of metalworking fluids with a number of studies focusing on Mycobacterium immunogenum. Both asthma and hypersensitivity pneumonitis occur among workers exposed to metalworking fluid. The incidence of these diseases among such workers is unknown. Outbreaks of these conditions continue to be identified among metal machinists. Whether these are true outbreaks associated with some breakdown in workplace controls or, rather the recognition of ongoing endemic disease that is typically misdiagnosed as pneumonia or common adult onset asthma, needs further evaluation. Further work to elucidate the specific causal agent(s) is necessary to affect effective workplace controls. Treating an identified individual case as an index case with a follow-up workplace investigation will only be possible if practicing physicians interact with public health authorities to report newly diagnosed cases.

  6. Regulation of the Candida albicans Cell Wall Damage Response by Transcription Factor Sko1 and PAS Kinase Psk1

    PubMed Central

    Rauceo, Jason M.; Blankenship, Jill R.; Fanning, Saranna; Hamaker, Jessica J.; Deneault, Jean-Sebastien; Smith, Frank J.; Nantel, Andre

    2008-01-01

    The environmental niche of each fungus places distinct functional demands on the cell wall. Hence cell wall regulatory pathways may be highly divergent. We have pursued this hypothesis through analysis of Candida albicans transcription factor mutants that are hypersensitive to caspofungin, an inhibitor of beta-1,3-glucan synthase. We report here that mutations in SKO1 cause this phenotype. C. albicans Sko1 undergoes Hog1-dependent phosphorylation after osmotic stress, like its Saccharomyces cerevisiae orthologues, thus arguing that this Hog1-Sko1 relationship is conserved. However, Sko1 has a distinct role in the response to cell wall inhibition because 1) sko1 mutants are much more sensitive to caspofungin than hog1 mutants; 2) Sko1 does not undergo detectable phosphorylation in response to caspofungin; 3) SKO1 transcript levels are induced by caspofungin in both wild-type and hog1 mutant strains; and 4) sko1 mutants are defective in expression of caspofungin-inducible genes that are not induced by osmotic stress. Upstream Sko1 regulators were identified from a panel of caspofungin-hypersensitive protein kinase–defective mutants. Our results show that protein kinase Psk1 is required for expression of SKO1 and of Sko1-dependent genes in response to caspofungin. Thus Psk1 and Sko1 lie in a newly described signal transduction pathway. PMID:18434592

  7. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  8. Estimating bioaccessibility of trace elements in particles suspended in the Athabasca River using sequential extraction.

    PubMed

    Javed, Muhammad Babar; Shotyk, William

    2018-05-10

    Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Relationships of field habitat measurements, visual habitat indices, and land cover to benthic macroinvertebrates in urbanized streams of the Santa Clara Valley, California

    USGS Publications Warehouse

    Fend, S.V.; Carter, J.L.; Kearns, F.R.

    2005-01-01

    We evaluated several approaches for measuring natural and anthropogenic habitat characteristics to predict benthic macroinvertebrate assemblages over a range of urban intensity at 85 stream sites in the Santa Clara Valley, California. Land cover was summarized as percentage urban land cover and impervious area within upstream buffers and the upstream subwatersheds. Field measurements characterized water chemistry, channel slope, sediment, and riparian canopy. In . addition to applying the visual-based habitat assessment in U.S. Environmental Protection Agency's rapid bioassessment protocol, we developed a simplified urban habitat assessment index based on turbidity, fine sediment deposition, riparian condition, and channel modification. Natural and anthropogenic habitat variables covaried along longitudinal stream gradients and were highly correlated with elevation. At the scale of the entire watershed, benthic macroinvertebrate measures were equally correlated with variables expressing natural gradients and urbanization effects. When natural gradients were reduced by partitioning sites into ecoregion subsection groupings, habitat variables most highly correlated with macroinvertebrate measures differed between upland and valley floor site groups. Among the valley floor sites, channel slope and physical modification of channel and riparian habitats appeared more important than upstream land cover or water quality in determining macroinvertebrate richness and ordination scores. Among upland sites, effects of upstream reservoir releases on habitat quality appeared important. Rapid habitat evaluation methods appeared to be an effective method for describing habitat features important to benthic macroinvertebrates when adapted for the region and the disturbance of interest. ?? 2005 by the American Fisheries Society.

  10. Mercury accumulation in biota of Thunder Creek, Saskatchewan

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Munro, D.J.; Gummer, W.D.

    Collection of biological organisms was undertaken to investigate the bioaccumulation of mercury in the food chain, the results of which are reported. Two sites were selected on Thunder Creek; the control or background site, site number 2, is located approximately 2.5 km upstream, from site number 1. The selection of organisms for analysis was based on the presence and abundance of each at both locations. Only crayfish (Orconcetes virilis) pearl dace (Semotilus margarita) and brook stickleback (Culaea inconstans) were found to be sufficiently abundant. The importance of the data obtained is the significant difference in concentration between the upstream andmore » downstream sites on Thunder Creek. This difference shows that more mercury is available to the biological community at site number 1 than at site number 2 confirming that mercury in the contaminated sediments is being methylated and taken up into the food chain.« less

  11. A Reconnaissance of selected organic compounds in streams in tribal lands in Central Oklahoma, January-February 2009

    USGS Publications Warehouse

    Becker, Carol J.

    2010-01-01

    The U.S. Geological Survey worked in cooperation with the U.S. Environmental Protection Agency and the Kickapoo Tribe of Oklahoma on two separate reconnaissance projects carried out concurrently. Both projects entailed the use of passive samplers as a sampling methodology to investigate the detection of selected organic compounds at stream sites in jurisdictional areas of several tribes in central Oklahoma during January-February 2009. The focus of the project with the U.S. Environmental Protection Agency was the detection of pesticides and pesticide metabolites using Semipermeable Membrane Devices at five stream sites in jurisdictional areas of several tribes. The project with the Kickapoo Tribe of Oklahoma focused on the detection of pesticides, pesticide metabolites, polycyclic aromatic hydrocarbons, polychlorinated biphenyl compounds, and synthetic organic compounds using Semipermeable Membrane Devices and Polar Organic Chemical Integrative Samplers at two stream sites adjacent to the Kickapoo tribal lands. The seven stream sites were located in central Oklahoma on the Cimarron River, Little River, North Canadian River, Deep Fork, and Washita River. Extracts from SPMDs submerged at five stream sites, in cooperation with the U.S. Environmental Protection Agency, were analyzed for 46 pesticides and 6 pesticide metabolites. Dacthal, a pre-emergent herbicide, was detected at all five sites. Pendimethalin, also a pre-emergent, was detected at one site. The insecticides chlorpyrifos and dieldrin were detected at three sites and p,p'-DDE, a metabolite of the insecticide DDT, also was detected at three sites. SPMDs and POCIS were submerged at the upstream edge and downstream edge of the Kickapoo tribal boundaries. Both sites are downstream from the Oklahoma City metropolitan area and multiple municipal wastewater treatment plants. Extracts from the passive samplers were analyzed for 62 pesticides, 10 pesticide metabolites, 3 polychlorinated biphenyl compounds, 35 polycyclic aromatic hydrocarbons, and 49 synthetic organic compounds. Ten pesticides and four pesticide metabolites were detected at the upstream site and seven pesticides and four pesticide metabolites were detected at the downstream site. Pesticides detected at both sites were atrazine, chlorpyrifos, dacthal, dieldrin, metolachlor, pendimethalin, and trans-nonachlor. Additionally at the upstream site, heptachlor, pentachlorophenol, and prometon were detected. The pesticide metabolites p,p'-DDE, cis-chlordane, and trans-chlordane also were detected at both sites. Polychlorinated biphenyl compounds aroclor-1016/1242, aroclor-1254, and aroclor-1260 were detected at both sites. The upstream site had 16 polycyclic aromatic hydrocarbon detections and the downstream site had 8 detections. Because of chromatographic interference during analysis, a positive identification of 17 polycyclic aromatic hydrocarbons could not be made. Consequently, there may have been a greater number of these compounds detected at both sites. A total of 36 synthetic organic compounds were detected at the two sites adjacent to the Kickapoo tribal lands. The upstream site had 21 synthetic organic compound detections: three detergent metabolites, two fecal indicators, three flame retardants, seven industrial compounds, five compounds related to personal care products, and beta-sitosterol, a plant sterol. Fifteen synthetic organic compounds were detected at the downstream site and included: one fecal indicator, three flame retardants, six industrial compounds, and five compounds related to personal care products.

  12. Optimization Review, Black Butte Mine Superfund Site, Lane County, Oregon

    EPA Pesticide Factsheets

    The BBM Superfund Site (the site) is located in Lane County, Oregon, approximately 35 miles southeast of Eugene and approximately 10 miles upstream from the Cottage Grove Reservoir (CGR). Mercury mining and processing operations were active at the site...

  13. Reservoirs override seasonal variability of phytoplankton communities in a regulated Mediterranean river.

    PubMed

    Tornés, E; Pérez, M C; Durán, C; Sabater, S

    2014-03-15

    Water hydrology, temperature and transparency, as well as nutrient retention downstream of the reservoirs alter the temporal and spatial distribution patterns of phytoplankton communities in regulated rivers. The seasonal dynamics of phytoplankton communities in the Ebro was analysed in contrasting water flow periods in sections upstream and downstream of three large reservoirs, as well as in an intermediate site. Phytoplankton communities changed in response to seasonal variations in the areas not influenced by the reservoirs, but the phytoplankton distribution downstream of the reservoirs was driven by their particular hydrodynamics. The change in environmental conditions promoted by reservoirs influenced the pattern of replacement between diatoms and green algae of the upstream section. Differences in the phytoplankton community structure, abundance and environmental variables between upstream and downstream sites were maximal during low flow periods. Chlorophytes and dinoflagellates were present during low flow periods upstream of the reservoirs and in the intermediate site. Cocconeis cf. placentula characterized the downstream section, associated to the presence of macrophytes in that section. The present study sheds light on the consequences of river regulation under potential scenarios of climate change, and results could be used to anticipate ecological problems in large regulated rivers under these circumstances. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Responses of riparian reptile communities to damming and urbanization

    USGS Publications Warehouse

    Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.

    2013-01-01

    Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.

  15. Assessment of potential effects of water produced from coalbed natural gas development on macroinvertebrate and algal communities in the Powder River and Tongue River, Wyoming and Montana, 2010

    USGS Publications Warehouse

    Peterson, David A.; Hargett, Eric G.; Feldman, David L.

    2011-01-01

    Ongoing development of coalbed natural gas in the Powder River structural basin in Wyoming and Montana led to formation of an interagency aquatic task group to address concerns about the effects of the resulting production water on biological communities in streams of the area. Ecological assessments, made from 2005–08 under the direction of the task group, indicated biological condition of the macroinvertebrate and algal communities in the middle reaches of the Powder was lower than in the upper or lower reaches. On the basis of the 2005–08 results, sampling of the macroinvertebrate and algae communities was conducted at 18 sites on the mainstem Powder River and 6 sites on the mainstem Tongue River in 2010. Sampling-site locations were selected on a paired approach, with sites located upstream and downstream of discharge points and tributaries associated with coalbed natural gas development. Differences in biological condition among site pairs were evaluated graphically and statistically using multiple lines of evidence that included macroinvertebrate and algal community metrics (such as taxa richness, relative abundance, functional feeding groups, and tolerance) and output from observed/expected (O/E) macroinvertebrate models from Wyoming and Montana. Multiple lines of evidence indicated a decline in biological condition in the middle reaches of the Powder River, potentially indicating cumulative effects from coalbed natural gas discharges within one or more reaches between Flying E Creek and Wild Horse Creek in Wyoming. The maximum concentrations of alkalinity in the Powder River also occurred in the middle reaches. Biological condition in the upper and lower reaches of the Powder River was variable, with declines between some site pairs, such as upstream and downstream of Dry Fork and Willow Creek, and increases at others, such as upstream and downstream of Beaver Creek. Biological condition at site pairs on the Tongue River showed an increase in one case, near the Wyoming-Montana border, and a decrease in another case, upstream of Tongue River Reservoir. Few significant differences were noted from upstream to downstream of Prairie Dog Creek, a major tributary to the Tongue River. Further study would be needed to confirm the observed patterns and choose areas to examine in greater detail.

  16. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  17. The KRAS Promoter Responds to Myc-associated Zinc Finger and Poly(ADP-ribose) Polymerase 1 Proteins, Which Recognize a Critical Quadruplex-forming GA-element*

    PubMed Central

    Cogoi, Susanna; Paramasivam, Manikandan; Membrino, Alexandro; Yokoyama, Kazunari K.; Xodo, Luigi E.

    2010-01-01

    The murine KRAS promoter contains a G-rich nuclease hypersensitive element (GA-element) upstream of the transcription start site that is essential for transcription. Pulldown and chromatin immunoprecipitation assays demonstrate that this GA-element is bound by the Myc-associated zinc finger (MAZ) and poly(ADP-ribose) polymerase 1 (PARP-1) proteins. These proteins are crucial for transcription, because when they are knocked down by short hairpin RNA, transcription is down-regulated. This is also the case when the poly(ADP-ribosyl)ation activity of PARP-1 is inhibited by 3,4-dihydro-5-[4-(1-piperidinyl) butoxyl]-1(2H) isoquinolinone. We found that MAZ specifically binds to the duplex and quadruplex conformations of the GA-element, whereas PARP-1 shows specificity only for the G-quadruplex. On the basis of fluorescence resonance energy transfer melting and polymerase stop assays we saw that MAZ stabilizes the KRAS quadruplex. When the capacity of folding in the GA-element is abrogated by specific G → T or G → A point mutations, KRAS transcription is down-regulated. Conversely, guanidine-modified phthalocyanines, which specifically interact with and stabilize the KRAS G-quadruplex, push the promoter activity up to more than double. Collectively, our data support a transcription mechanism for murine KRAS that involves MAZ, PARP-1 and duplex-quadruplex conformational changes in the promoter GA-element. PMID:20457603

  18. Eco-Design of River Fishways for Upstream Passage: Application for Hanfeng Dam, Pengxi River, China

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, Gary E.; Rainey, William S.

    2012-05-20

    This paper provides a scientific approach to eco-design of river fishways to allow upstream movement of fish past new and existing dams in China. This eco-design approach integrates principles of fish ecology/behavior and engineering, a scientific field also known as bio-engineering or eco-hydraulics. We define a fishway as a structure or mechanism to convey fish upstream past a dam. Man-made or natural stream beds can be part of the fishway mechanism. Fish include bony and non-bony fishes, and upstream passage is the concern here, not downstream passage. The problem is dams block access to upstream habitat used for spawning, rearing,more » and refuge, i.e., dams decrease habitat connectivity. A solution to alleviate this problem is to design fishways, preferably while the dam is being designed, but if necessary, as retrofits afterward to provide a route that fish can and will use to pass safely upstream without undue delay. Our eco-design approach for fishways involves eight steps: 1) identify the primary species of importance; 2) understand basic ecology and behavior of these fish; 3) characterize the environmental conditions where passage is or will be blocked; 4 identify fishway alternatives and select a preferred alternative; 5) establish eco-design criteria for the fishway, either from management agencies or, if necessary, developed specifically for the given site; 6) where needed, identify and perform research required to resolve critical uncertainties and finalize the eco-design criteria; 7) apply the eco-design criteria and site-specific considerations to design the fishway, involving peer-review by local stakeholders in the process; 8) build the fishway, monitor its effectiveness, and apply the lessons learned. Example fishways are described showing a range of eco-designs depending on the dam site and fish species of concern. We apply the eco-design principles to recommend an approach and next steps for a fishway to pass fish upstream at Hanfeng Dam, an existing regulating dam forming Hanfeng Lake on the Pengxi River near Kaixian, China.« less

  19. Effects of high salinity wastewater discharges on unionid mussels in the Allegheny River, Pennsylvania

    USGS Publications Warehouse

    Kathleen Patnode,; Hittle, Elizabeth A.; Robert Anderson,; Lora Zimmerman,; Fulton, John W.

    2015-01-01

    We examined the effect of high salinity wastewater (brine) from oil and natural gas drilling on freshwater mussels in the Allegheny River, Pennsylvania, during 2012. Mussel cages (N = 5 per site) were deployed at two sites upstream and four sites downstream of a brine treatment facility on the Allegheny River. Each cage contained 20 juvenile northern riffleshell mussels Epioblasma torulosa rangiana). Continuous specific conductance and temperature data were recorded by water quality probes deployed at each site. To measure the amount of mixing throughout the entire study area, specific conductance surveys were completed two times during low-flow conditions along transects from bank to bank that targeted upstream (reference) reaches, a municipal wastewater treatment plant discharge upstream of the brine-facility discharge, the brine facility, and downstream reaches. Specific conductance data indicated that high specific conductance water from the brine facility (4,000–12,000 µS/cm; mean 7,846) compared to the reference reach (103–188 µS/cm; mean 151) is carried along the left descending bank of the river and that dilution of the discharge via mixing does not occur until 0.5 mi (805 m) downstream. Juvenile northern riffleshell mussel survival was severely impaired within the high specific conductance zone (2 and 34% at and downstream of the brine facility, respectively) and at the municipal wastewater treatment plant (21%) compared to background (84%). We surveyed native mussels (family Unionidae) at 10 transects: 3 upstream, 3 within, and 4 downstream of the high specific conductance zone. Unionid mussel abundance and diversity were lower for all transects within and downstream of the high conductivity zone compared to upstream. The results of this study clearly demonstrate in situ toxicity to juvenile northern riffleshell mussels, a federally endangered species, and to the native unionid mussel assemblage located downstream of a brine discharge to the Allegheny River.

  20. Characterization of Rous sarcoma virus polyadenylation site use in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maciolek, Nicole L.; McNally, Mark T.

    2008-05-10

    Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

  1. PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.

    PubMed

    Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine

    2009-01-01

    To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.

  2. From Midges to Spiders: Mercury Biotransport in Riparian Zones Near the Buffalo River Area of Concern (AOC), USA.

    PubMed

    Pennuto, C M; Smith, M

    2015-12-01

    Riparian communities can receive environmental contaminants from adjacent aquatic 'donor' habitats. We investigated mercury biotransport from aquatic to terrestrial habitats via aquatic insect emergence and uptake by riparian spiders at sites within and upstream of the Buffalo River Area of Concern (AOC), a site with known sediment Hg contamination. Mercury concentration in emerging midges was roughly 10× less than contaminated sediment levels with the AOC, but biomagnification factors from midges to spiders ranged from 2.0 to 2.65 between sites. There was a significantly negative body mass:total mercury relationship in spiders (p < 0.001), indicating that mercury depuration is rapid or tissue dilution occurs in these riparian predators. Spiders contained significantly more mercury than their midge prey and spiders upstream of the AOC had higher mercury concentrations than spiders from within the AOC. Collectively, these data indicate that riparian spiders can be good mercury sentinels in urban environments, and that riparian communities upstream from the AOC may be at greater risk to mercury than has been previously considered.

  3. Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

    PubMed

    Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

    2007-01-05

    High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

  4. Assessing potential effects of highway runoff on receiving-water quality at selected sites in Oregon with the Stochastic Empirical Loading and Dilution Model (SELDM)

    USGS Publications Warehouse

    Risley, John C.; Granato, Gregory E.

    2014-01-01

    6. An analysis of the use of grab sampling and nonstochastic upstream modeling methods was done to evaluate the potential effects on modeling outcomes. Additional analyses using surrogate water-quality datasets for the upstream basin and highway catchment were provided for six Oregon study sites to illustrate the risk-based information that SELDM will produce. These analyses show that the potential effects of highway runoff on receiving-water quality downstream of the outfall depends on the ratio of drainage areas (dilution), the quality of the receiving water upstream of the highway, and the concentration of the criteria of the constituent of interest. These analyses also show that the probability of exceeding a water-quality criterion may depend on the input statistics used, thus careful selection of representative values is important.

  5. Responses of macroinvertebrate community metrics to a wastewater discharge in the Upper Blue River of Kansas and Missouri, USA

    USGS Publications Warehouse

    Poulton, Barry C.; Graham, Jennifer L.; Rasmussen, Teresa J.; Stone, Mandy L.

    2015-01-01

    The Blue River Main wastewater treatment facility (WWTF) discharges into the upper Blue River (725 km2), and is recently upgraded to implement biological nutrient removal. We measured biotic condition upstream and downstream of the discharge utilizing the macroinvertebrate protocol developed for Kansas streams. We examined responses of 34 metrics to determine the best indicators for discriminating site differences and for predicting biological condition. Significant differences between sites upstream and downstream of the discharge were identified for 15 metrics in April and 12 metrics in August. Upstream biotic condition scores were significantly greater than scores at both downstream sites in April (p = 0.02), and in August the most downstream site was classified as non-biologically supporting. Thirteen EPT taxa (Ephemeroptera, Plecoptera, Trichoptera) considered intolerant of degraded stream quality were absent at one or both downstream sites. Increases in tolerance metrics and filtering macroinvertebrates, and a decline in ratio of scrapers to filterers all indicated effects of increased nutrient enrichment. Stepwise regressions identified several significant models containing a suite of metrics with low redundancy (R2 = 0.90 - 0.99). Based on the rapid decline in biological condition downstream of the discharge, the level of nutrient removal resulting from the facility upgrade (10% - 20%) was not enough to mitigate negative effects on macroinvertebrate communities.

  6. Occurrence of polycyclic aromatic hydrocarbons below coal-tar-sealed parking lots and effects on stream benthic macroinvertebrate communities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scoggins, M.; McClintock, N.L.; Gosselink, L.

    2007-12-15

    Parking-lot pavement sealants recently have been recognized as a major source of polycyclic aromatic hydrocarbons (PAHs) in urban stream sediments in Austin, Texas. Laboratory and field studies have shown that PAHs in sediments can be toxic to aquatic organisms and can degrade aquatic communities. After identifying increases in concentrations of PAHs in sediments below seal-coated parking lots, we investigated whether the increases had significant effects on stream biota in 5 Austin streams. We sampled sediment chemistry and biological communities above and below the point at which stormwater runoff from the parking lots discharged into the streams, thus providing 5 upstreammore » reference sites and 5 downstream treatment sites. Differences between upstream and downstream concentrations of total PAH ranged from 3.9 to 32 mg/kg. Analysis of the species occurrence data from pool and riffle habitats indicated a significant decrease in community health at the downstream sites, including decreases in richness, intolerant taxa, Diptera taxa, and density. In pool sediments, Chironomidae density was negatively correlated with PAH concentrations, whereas Oligochaeta density responded positively to PAH concentrations. In general, pool taxa responded more strongly than riffle taxa to PAHs, but riffle taxa responded more broadly than pool taxa. Increases in PAH sediment-toxicity units between upstream and downstream sites explained decreases in taxon richness and density in pools between upstream and downstream sites.« less

  7. Spinal Ceramide and Neuronal Apoptosis in Morphine Antinociceptive Tolerance

    PubMed Central

    Bryant, Leesa; Doyle, Tim; Chen, Zhoumo; Cuzzocrea, Salvatore; Masini, Emanuela; Vinci, M. Cristina; Esposito, Emanuela; Mazzon, Emanuela; Petrusca, Daniela Nicoleta; Petrache, Irina; Salvemini, Daniela

    2009-01-01

    Opiates, like morphine, are the most effective analgesics for treating acute and chronic severe pain, but their use is limited by the development of analgesic tolerance and hypersensitivity to innocuous and noxious stimuli. Because opioids are a mainstay of pain management, restoring their efficacy has great clinical importance. We have recently demonstrated that spinal ceramide, a sphingolipid signaling molecule plays a central role in the development of morphine antinociceptive tolerance. We now report that ceramide up-regulation in dorsal horn tissues in response to chronic morphine administration is associated with significant neuronal apoptosis. Inhibition of ceramide biosynthesis attenuated both the increase in neuronal apoptosis and the development of antinociceptive tolerance. These findings indicate that spinal ceramide upregulation is a key pro-apoptotic event that occurs upstream of the development of morphine antinociceptive tolerance and support the rationale for development of inhibitors of ceramide biosynthesis as adjuncts to opiates for the management of chronic pain. PMID:19631718

  8. Jasmonate Regulates the INDUCER OF CBF EXPRESSION–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 Cascade and Freezing Tolerance in Arabidopsis[W

    PubMed Central

    Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu

    2013-01-01

    The INDUCER OF CBF EXPRESSION (ICE)–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several JASMONATE ZIM-DOMAIN (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance. PMID:23933884

  9. Jasmonate regulates the inducer of cbf expression-C-repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis.

    PubMed

    Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu

    2013-08-01

    The inducer of cbf expression (ICE)-C-repeat binding factor/DRE binding factor1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several jasmonate ZIM-domain (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance.

  10. Alteration of ROS Homeostasis and Decreased Lifespan in S. cerevisiae Elicited by Deletion of the Mitochondrial Translocator FLX1

    PubMed Central

    Giancaspero, Teresa Anna; Dipalo, Emilia; Miccolis, Angelica; Boles, Eckhard; Caselle, Michele; Barile, Maria

    2014-01-01

    This paper deals with the control exerted by the mitochondrial translocator FLX1, which catalyzes the movement of the redox cofactor FAD across the mitochondrial membrane, on the efficiency of ATP production, ROS homeostasis, and lifespan of S. cerevisiae. The deletion of the FLX1 gene resulted in respiration-deficient and small-colony phenotype accompanied by a significant ATP shortage and ROS unbalance in glycerol-grown cells. Moreover, the flx1Δ strain showed H2O2 hypersensitivity and decreased lifespan. The impaired biochemical phenotype found in the flx1Δ strain might be justified by an altered expression of the flavoprotein subunit of succinate dehydrogenase, a key enzyme in bioenergetics and cell regulation. A search for possible cis-acting consensus motifs in the regulatory region upstream SDH1-ORF revealed a dozen of upstream motifs that might respond to induced metabolic changes by altering the expression of Flx1p. Among these motifs, two are present in the regulatory region of genes encoding proteins involved in flavin homeostasis. This is the first evidence that the mitochondrial flavin cofactor status is involved in controlling the lifespan of yeasts, maybe by changing the cellular succinate level. This is not the only case in which the homeostasis of redox cofactors underlies complex phenotypical behaviours, as lifespan in yeasts. PMID:24895546

  11. Antibiotic resistance of native and faecal bacteria isolated from rivers, reservoirs and sewage treatment facilities in Victoria, south-eastern Australia.

    PubMed

    Boon, P I; Cattanach, M

    1999-03-01

    The incidence of resistance to ampicillin, chloramphenicol, kanamycin, nalidixic acid, neomycin and streptomycin was significantly greater (P < 0.001) in native heterotrophic bacteria than in Escherichia coli isolated from a range of sites along the Yarra River in south-eastern Australia. There was no significant difference in the incidence of resistance between native and faecal bacteria to tetracycline. Both groups were almost totally resistant to penicillin. Multivariate analyses indicated little clear spatial pattern in the incidence of resistance in native bacteria from upstream vs downstream sites along the Yarra River. In contrast, E. coli isolated from upstream (rural) sites tended to have a lower incidence of resistance than isolates from downstream (urban) sites. These findings have implications for the use of antibiotic resistance as a bacteriological water quality parameter.

  12. Estimation of constituent concentrations, densities, loads, and yields in lower Kansas River, northeast Kansas, using regression models and continuous water-quality monitoring, January 2000 through December 2003

    USGS Publications Warehouse

    Rasmussen, Teresa J.; Ziegler, Andrew C.; Rasmussen, Patrick P.

    2005-01-01

    The lower Kansas River is an important source of drinking water for hundreds of thousands of people in northeast Kansas. Constituents of concern identified by the Kansas Department of Health and Environment (KDHE) for streams in the lower Kansas River Basin include sulfate, chloride, nutrients, atrazine, bacteria, and sediment. Real-time continuous water-quality monitors were operated at three locations along the lower Kansas River from July 1999 through September 2004 to provide in-stream measurements of specific conductance, pH, water temperature, turbidity, and dissolved oxygen and to estimate concentrations for constituents of concern. Estimates of concentration and densities were combined with streamflow to calculate constituent loads and yields from January 2000 through December 2003. The Wamego monitoring site is located 44 river miles upstream from the Topeka monitoring site, which is 65 river miles upstream from the DeSoto monitoring site, which is 18 river miles upstream from where the Kansas River flows into the Missouri River. Land use in the Kansas River Basin is dominated by grassland and cropland, and streamflow is affected substantially by reservoirs. Water quality at the three monitoring sites varied with hydrologic conditions, season, and proximity to constituent sources. Nutrient and sediment concentrations and bacteria densities were substantially larger during periods of increased streamflow, indicating important contributions from nonpoint sources in the drainage basin. During the study period, pH remained well above the KDHE lower criterion of 6.5 standard units at all sites in all years, but exceeded the upper criterion of 8.5 standard units annually between 2 percent of the time (Wamego in 2001) and 65 percent of the time (DeSoto in 2003). The dissolved oxygen concentration was less than the minimum aquatic-life-support criterion of 5.0 milligrams per liter less than 1 percent of the time at all sites. Dissolved solids, a measure of the dissolved material in water, exceeded 500 milligrams per liter about one-half of the time at the three Kansas River sites. Larger dissolved-solids concentrations upstream likely were a result of water inflow from the highly mineralized Smoky Hill River that is diluted by tributary flow as it moves downstream. Concentrations of total nitrogen and total phosphorus at the three monitoring sites exceeded the ecoregion water-quality criteria suggested by the U.S. Environmental Protection Agency during the entire study period. Median nitrogen and phosphorus concentrations were similar at all three sites, and nutrient load increased moving from the upstream to downstream sites. Total nitrogen and total phosphorus yields were nearly the same from site to site indicating that nutrient sources were evenly distributed throughout the lower Kansas River Basin. About 11 percent of the total nitrogen load and 12 percent of the total phosphorus load at DeSoto during 2000-03 originated from wastewater-treatment facilities. Escherichia coli bacteria densities were largest at the middle site, Topeka. On average, 83 percent of the annual bacteria load at DeSoto during 2000-03 occurred during 10 percent of the time, primarily in conjunction with runoff. The average annual sediment loads at the middle and downstream monitoring sites (Topeka and DeSoto) were nearly double those at the upstream site (Wamego). The average annual sediment yield was largest at Topeka. On average, 64 percent of the annual suspended-sediment load at DeSoto during 2000-03 occurred during 10 percent of the time. Trapping of sediment by reservoirs located on contributing tributaries decreases transport of sediment and sediment-related constituents. The average annual suspended-sediment load in the Kansas River at DeSoto during 2000-03 was estimated at 1.66 million tons. An estimated 13 percent of this load consisted of sand-size particles, so approximately 216,000 tons of sand were transported

  13. Low incidence of anti-drug antibodies in patients with type 2 diabetes treated with once-weekly glucagon-like peptide-1 receptor agonist dulaglutide.

    PubMed

    Milicevic, Z; Anglin, G; Harper, K; Konrad, R J; Skrivanek, Z; Glaesner, W; Karanikas, C A; Mace, K

    2016-05-01

    Therapeutic administration of peptides may result in anti-drug antibody (ADA) formation, hypersensitivity adverse events (AEs) and reduced efficacy. As a large peptide, the immunogenicity of once-weekly glucagon-like peptide-1 (GLP-1) receptor agonist dulaglutide is of considerable interest. The present study assessed the incidence of treatment-emergent dulaglutide ADAs, hypersensitivity AEs, injection site reactions (ISRs), and glycaemic control in ADA-positive patients in nine phase II and phase III trials (dulaglutide, N = 4006; exenatide, N = 276; non-GLP-1 comparators, N = 1141). Treatment-emergent dulaglutide ADAs were detected using a solid-phase extraction acid dissociation binding assay. Neutralizing ADAs were detected using a cell-based assay derived from human endothelial kidney cells (HEK293). A total of 64 dulaglutide-treated patients (1.6% of the population) tested ADA-positive versus eight (0.7%) from the non-GLP-1 comparator group. Of these 64 patients, 34 (0.9%) had dulaglutide-neutralizing ADAs, 36 (0.9%) had native-sequence GLP-1 (nsGLP-1) cross-reactive ADAs and four (0.1%) had nsGLP-1 neutralization ADAs. The incidence of hypersensitivity AEs and ISRs was similar in the dulaglutide versus placebo groups. No dulaglutide ADA-positive patient reported hypersensitivity AEs. Because of the low incidence of ADAs, it was not possible to establish their effect on glycaemic control. © 2016 John Wiley & Sons Ltd.

  14. Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

    PubMed Central

    Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

    1998-01-01

    Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

  15. Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

    PubMed Central

    2014-01-01

    Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

  16. Survival, growth, and movement of subadult humpback chub, Gila cypha, in the Little Colorado River, Arizona

    USGS Publications Warehouse

    Dzul, Maria C.; Yackulic, Charles B.; Stone, Dennis M.; Van Haverbeke, David R.

    2016-01-01

    Ecologists estimate vital rates, such as growth and survival, to better understand population dynamics and identify sensitive life history parameters for species or populations of concern. Here, we assess spatiotemporal variation in growth, movement, density, and survival of subadult humpback chub living in the Little Colorado River, Grand Canyon, AZ from 2001–2002 and 2009–2013. We divided the Little Colorado River into three reaches and used a multistate mark-recapture model to determine rates of movement and differences in survival and density between sites for different cohorts. Additionally, site-specific and year-specific effects on growth were evaluated using a linear model. Results indicate that summer growth was higher for upstream sites compared with downstream sites. In contrast, there was not a consistent spatial pattern across years in winter growth; however, river-wide winter growth was negatively related to the duration of floods from 1 October to 15 May. Apparent survival was estimated to be lower at the most downstream site compared with the upstream sites; however, this could be because in part of increased emigration into the Colorado River at downstream sites. Furthermore, the 2010 cohort (i.e. fish that are age 1 in 2010) exhibited high apparent survival relative to other years. Movement between reaches varied with year, and some years exhibited preferential upstream displacement. Improving understanding of spatiotemporal effects on age 1 humpback chub survival can help inform current management efforts to translocate humpback chub into new locations and give us a better understanding of the factors that may limit this tributary's carrying capacity for humpback chub.

  17. Does biofilm contribute to diel cycling of Zn in High Ore Creek, Montana?

    USGS Publications Warehouse

    Morris, J.M.; Nimick, D.A.; Farag, A.M.; Meyer, J.S.

    2005-01-01

    Concentrations of metals cycle daily in the water column of some mining-impacted streams in the Rocky Mountains of the western USA. We hypothesized that biofilm in High Ore Creek, Montana, USA, sorbs and releases Zn on a diel cycle, and this uptake-and-release cycle controls the total and dissolved (0.45-??m filtered) Zn concentrations. We collected water samples from three sites (upstream, middle and downstream at 0, 350 and 650 m, respectively) along a 650-m reach of High Ore Creek during a 47-h period in August 2002 and from the upstream and downstream sites during a 24-h period in August 2003; we also collected biofilm samples at these sites. In 2002 and 2003, total and dissolved Zn concentrations did not exhibit a diel cycle at the upstream sampling site, which was ???30 m downstream from a settling pond through which the creek flows. However, total and dissolved Zn concentrations exhibited a diel cycle at the middle and downstream sampling sites, with the highest Zn concentrations occurring at dawn and the lowest Zn concentrations occurring during late afternoon (>2-fold range of concentrations at the downstream site). Based on (1) concentrations of Zn in biofilm at the three sites and (2) results of streamside experiments that demonstrated Zn uptake and release by nai??ve biofilm during the light and dark hours of a photocycle, respectively, we conclude that Zn uptake in photosynthetic biofilms could contribute a large percentage to the cycling of Zn concentrations in the water column in High Ore Creek. ?? Springer 2005.

  18. Rice hypersensitive induced reaction protein 1 (OsHIR1) associates with plasma membrane and triggers hypersensitive cell death.

    PubMed

    Zhou, Liang; Cheung, Ming-Yan; Li, Man-Wah; Fu, Yaping; Sun, Zongxiu; Sun, Sai-Ming; Lam, Hon-Ming

    2010-12-30

    In plants, HIR (Hypersensitive Induced Reaction) proteins, members of the PID (Proliferation, Ion and Death) superfamily, have been shown to play a part in the development of spontaneous hypersensitive response lesions in leaves, in reaction to pathogen attacks. The levels of HIR proteins were shown to correlate with localized host cell deaths and defense responses in maize and barley. However, not much was known about the HIR proteins in rice. Since rice is an important cereal crop consumed by more than 50% of the populations in Asia and Africa, it is crucial to understand the mechanisms of disease responses in this plant. We previously identified the rice HIR1 (OsHIR1) as an interacting partner of the OsLRR1 (rice Leucine-Rich Repeat protein 1). Here we show that OsHIR1 triggers hypersensitive cell death and its localization to the plasma membrane is enhanced by OsLRR1. Through electron microscopy studies using wild type rice plants, OsHIR1 was found to mainly localize to the plasma membrane, with a minor portion localized to the tonoplast. Moreover, the plasma membrane localization of OsHIR1 was enhanced in transgenic rice plants overexpressing its interacting protein partner, OsLRR1. Co-localization of OsHIR1 and OsLRR1 to the plasma membrane was confirmed by double-labeling electron microscopy. Pathogen inoculation studies using transgenic Arabidopsis thaliana expressing either OsHIR1 or OsLRR1 showed that both transgenic lines exhibited increased resistance toward the bacterial pathogen Pseudomonas syringae pv. tomato DC3000. However, OsHIR1 transgenic plants produced more extensive spontaneous hypersensitive response lesions and contained lower titers of the invading pathogen, when compared to OsLRR1 transgenic plants. The OsHIR1 protein is mainly localized to the plasma membrane, and its subcellular localization in that compartment is enhanced by OsLRR1. The expression of OsHIR1 may sensitize the plant so that it is more prone to HR and hence can react more promptly to limit the invading pathogens' spread from the infection sites.

  19. pDHS-SVM: A prediction method for plant DNase I hypersensitive sites based on support vector machine.

    PubMed

    Zhang, Shanxin; Zhou, Zhiping; Chen, Xinmeng; Hu, Yong; Yang, Lindong

    2017-08-07

    DNase I hypersensitive sites (DHSs) are accessible chromatin regions hypersensitive to cleavages by DNase I endonucleases. DHSs are indicative of cis-regulatory DNA elements (CREs), all of which play important roles in global gene expression regulation. It is helpful for discovering CREs by recognition of DHSs in genome. To accelerate the investigation, it is an important complement to develop cost-effective computational methods to identify DHSs. However, there is a lack of tools used for identifying DHSs in plant genome. Here we presented pDHS-SVM, a computational predictor to identify plant DHSs. To integrate the global sequence-order information and local DNA properties, reverse complement kmer and dinucleotide-based auto covariance of DNA sequences were applied to construct the feature space. In this work, fifteen physical-chemical properties of dinucleotides were used and Support Vector Machine (SVM) was employed. To further improve the performance of the predictor and extract an optimized subset of nucleotide physical-chemical properties positive for the DHSs, a heuristic nucleotide physical-chemical property selection algorithm was introduced. With the optimized subset of properties, experimental results of Arabidopsis thaliana and rice (Oryza sativa) showed that pDHS-SVM could achieve accuracies up to 87.00%, and 85.79%, respectively. The results indicated the effectiveness of proposed method for predicting DHSs. Furthermore, pDHS-SVM could provide a helpful complement for predicting CREs in plant genome. Our implementation of the novel proposed method pDHS-SVM is freely available as source code, at https://github.com/shanxinzhang/pDHS-SVM. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Neglected sources of pharmaceuticals in river water--footprints of a Reggae festival.

    PubMed

    Daneshvar, Atlasi; Svanfelt, Jesper; Kronberg, Leif; Weyhenmeyer, Gesa A

    2012-02-01

    Wastewater treatment plants (WWTPs) are commonly considered as the main source of pharmaceuticals in surface waters. Here, however, we show that an open-air festival, attracting approximately 10,000 visitors per year at the shores of River Fyris upstream of Uppsala WWTP, can temporarily result in a higher pharmaceutical input into the river water than the WWTP. Studying the influence of Uppsala Reggae festival on the occurrence of ten commonly used acidic and basic pharmaceuticals upstream, in the effluent, and downstream of the Uppsala WWTP, we found that occasional heavy rainfalls during the festival in 2008 severely increased the mass flows of all pharmaceuticals at the WWTP upstream site. Also, strong increases in ammonium (210-fold), nitrate (21-fold), and total nitrogen (21-fold) mass flows were observed. The pharmaceutical mass flows at the upstream site were up to 3.4 times higher than those observed in the WWTP effluent. In contrast, in 2009, the festival was not accompanied with rainfalls and no major additional input of pharmaceuticals and nitrogen was observed. The findings of this study give new insights into risk assessments and are relevant for monitoring programmes.

  1. Heparin allergy: delayed-type non-IgE-mediated allergic hypersensitivity to subcutaneous heparin injection.

    PubMed

    Trautmann, Axel; Seitz, Cornelia S

    2009-08-01

    Itching erythematous or eczematous plaques around injection sites are quite frequent side effects of heparin treatment and clinical symptoms of delayed-type non-IgE-mediated allergic hypersensitivity (DTH) to heparin. For diagnosis, intradermal, patch, and subcutaneous challenge tests with heparins are suitable. In most cases, changing the subcutaneous therapy from unfractionated to low molecular weight heparin or treatment with heparinoids does not provide improvement because of extensive cross-reactivity. Hirudin polypeptides, which exhibit a different chemical structure, are a safe therapeutic alternative for subcutaneous application, however. Importantly, despite DTH to subcutaneously injected heparins, most patients tolerate heparin intravenously. Moreover, in case of therapeutic necessity and DTH to heparins, the simple shift from subcutaneous to intravenous heparin administration without prior testing may be justified.

  2. Glucocorticoid sensitivity, disuse, and the regulation of muscle mass

    NASA Technical Reports Server (NTRS)

    Almon, R. R.; Dubois, D. C.

    1983-01-01

    A new noninvasive immobilization procedure to be used on rats has been developed to study immobilization-induced muscle hypersensitivity to normal glucocorticoid concentration, subsequent muscle atrophy, and atrophy recovery. The immobilization procedure involves encasing the hind limb in a light-weight plasticlike cast (10 percent the usual plaster weight), completely resistant to animal gnawing. The effects of right-angle immobilization of the ankle on the slow fiber soleus, and the fast fiber extensor digitorum longus, resemble the effects of weightlessness. The increased concentration of glucocorticoid receptor sites in immobilized and denervated muscle is discussed, along with the chronic loss of muscle mass that occurs in practically all dystrophies. It is concluded that lack of mechanical work in a zero gravity environment is a major cause of glucocorticoid hypersensitivity in the body's musculature.

  3. Two alternative ways of start site selection in human norovirus reinitiation of translation.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2014-04-25

    The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

  4. Distribution and abundance of stream fishes in relation to barriers: implications for monitoring stream recovery after barrier removal

    USGS Publications Warehouse

    Zydlewski, Joseph D.; Coghlan, Stephen M.; Gardner, C.; Saunders, R.

    2011-01-01

    Dams are ubiquitous in coastal regions and have altered stream habitats and the distribution and abundance of stream fishes in those habitats by disrupting hydrology, temperature regime and habitat connectivity. Dam removal is a common restoration tool, but often the response of the fish assemblage is not monitored rigorously. Sedgeunkedunk Stream, a small tributary to the Penobscot River (Maine, USA), has been the focus of a restoration effort that includes the removal of two low-head dams. In this study, we quantified fish assemblage metrics along a longitudinal gradient in Sedgeunkedunk Stream and also in a nearby reference stream. By establishing pre-removal baseline conditions and associated variability and the conditions and variability immediately following removal, we can characterize future changes in the system associated with dam removal. Over 2 years prior to dam removal, species richness and abundance in Sedgeunkedunk Stream were highest downstream of the lowest dam, lowest immediately upstream of that dam and intermediate farther upstream; patterns were similar in the reference stream. Although seasonal and annual variation in metrics within each site was substantial, the overall upstream-to-downstream pattern along the stream gradient was remarkably consistent prior to dam removal. Immediately after dam removal, we saw significant decreases in richness and abundance downstream of the former dam site and a corresponding increase in fish abundance upstream of the former dam site. No such changes occurred in reference sites. Our results show that by quantifying baseline conditions in a small stream before restoration, the effects of stream restoration efforts on fish assemblages can be monitored successfully. These data set the stage for the long-term assessment of Sedgeunkedunk Stream and provide a simple methodology for assessment in other restoration projects.

  5. Change in the Structure of Escherichia coli Population and the Pattern of Virulence Genes along a Rural Aquatic Continuum

    PubMed Central

    Petit, Fabienne; Clermont, Olivier; Delannoy, Sabine; Servais, Pierre; Gourmelon, Michèle; Fach, Patrick; Oberlé, Kenny; Fournier, Matthieu; Denamur, Erick; Berthe, Thierry

    2017-01-01

    The aim of this study was to investigate the diversity of the Escherichia coli population, focusing on the occurrence of pathogenic E. coli, in surface water draining a rural catchment. Two sampling campaigns were carried out in similar hydrological conditions (wet period, low flow) along a river continuum, characterized by two opposite density gradients of animals (cattle and wild animals) and human populations. While the abundance of E. coli slightly increased along the river continuum, the abundance of both human and ruminant-associated Bacteroidales markers, as well as the number of E. coli multi-resistant to antibiotics, evidenced a fecal contamination originating from animals at upstream rural sites, and from humans at downstream urban sites. A strong spatial modification of the structure of the E. coli population was observed. At the upstream site close to a forest, a higher abundance of the B2 phylogroup and Escherichia clade strains were observed. At the pasture upstream site, a greater proportion of both E and B1 phylogroups was detected, therefore suggesting a fecal contamination of mainly bovine origin. Conversely, in downstream urban sites, A, D, and F phylogroups were more abundant. To assess the occurrence of intestinal pathogenic strains, virulence factors [afaD, stx1, stx2, eltB (LT), estA (ST), ipaH, bfpA, eae, aaiC and aatA] were screened among 651 E. coli isolates. Intestinal pathogenic strains STEC O174:H21 (stx2) and EHEC O26:H11 (eae, stx1) were isolated in water and sediments close to the pasture site. In contrast, in the downstream urban site aEPEC/EAEC and DAEC of human origin, as well as extra-intestinal pathogenic E. coli belonging to clonal group A of D phylogroup, were sampled. Even if the estimated input of STEC (Shiga toxin-producing E. coli) – released in water at the upstream pasture site – at the downstream site was low, we show that STEC could persist in sediment. These results show that, the run-off of small cattle farms contributed, as much as the wastewater effluent, in the dissemination of pathogenic E. coli in both water and sediments, even if the microbiological quality of the water was good or to average quality according to the French water index. PMID:28458656

  6. Dynamical optical imaging monocytes/macrophages migration and activation in contact hypersensitivity (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Zhang, Zhihong

    2017-02-01

    Inflammatory monocytes/macrophages (Mon/Mφ) play an important role in cutaneous allergic inflammation. However, their migration and activation in dermatitis and how they accelerate the inflammatory reaction are largely unknown. Optical molecular imaging is the most promising tool for investigating the function and motility of immune cells in vivo. We have developed a multi-scale optical imaging approach to evaluate the spatio-temporal dynamic behavior and properties of immune cells from the whole field of organs to the cellular level at the inflammatory site in delayed type hypersensitivity reaction. Here, we developed some multi-color labeling mouse models based on the endogenous labeling with fluorescent proteins and the exogenous labeling with fluorescent dyes. We investigated the cell movement, cell interaction and function of immunocytes (e.g. Mon/Mφ, DC, T cells and neutrophils) in the skin allergy inflammation (e.g., contact hypersensitivity) by using intravital microscopy. The long-term imaging data showed that after inflammatory Mon/Mφ transendothelial migration in dermis, they migrating in interstitial space of dermis. Depletion of blood monocyte with clodronate liposome extremely reduced the inflammatory reaction. Our finding provided further insight into inflammatory Mon/Mφ mediating the inflammatory cascade through functional migration in allergic contact dermatitis.

  7. Epidemiology of Hypersensitivity Pneumonitis among an Insured Population in the United States: A Claims-based Cohort Analysis.

    PubMed

    Fernández Pérez, Evans R; Kong, Amanda M; Raimundo, Karina; Koelsch, Tilman L; Kulkarni, Rucha; Cole, Ashley L

    2018-04-01

    Hypersensitivity pneumonitis is a complex lung disease resulting from repeated inhalation of a variety of antigens. Limited data exist regarding its epidemiology. To describe the trends in the annual incidence and prevalence of hypersensitivity pneumonitis in the United States. We developed novel claims-based coding algorithms to identify hypersensitivity pneumonitis, chronic hypersensitivity pneumonitis, and fibrotic hypersensitivity pneumonitis cases using the 2004 to 2013 MarketScan Commercial and Medicare Supplemental healthcare claims databases. Algorithm validity and reliability were assessed with clinical data from National Jewish Health. We calculated yearly cumulative incidence and prevalence overall and by age. For the subgroup with vital status, Kaplan-Meier methods were used to analyze survival stratified by evidence of fibrosis. We identified 7,498 cases that met our hypersensitivity pneumonitis definition over the 10-year study period, including 3,902 with chronic hypersensitivity pneumonitis and 1,852 with fibrotic hypersensitivity pneumonitis. On the basis of the clinical-radiological adjudication of the validation sample, 38 cases (95%) were confirmed as hypersensitivity pneumonitis. The mean age was 52 years, and 58% were women. The 1-year prevalence rates for hypersensitivity pneumonitis ranged from 1.67 to 2.71 per 100,000 persons, and 1-year cumulative incidence rates ranged from 1.28 to 1.94 per 100,000 persons. The prevalence increased with age, ranging from 0.95 per 100,000 among 0- to 9-year-olds to 11.2 per 100,000 among those aged 65 years and older. Between 56 and 68% of hypersensitivity pneumonitis cases in each year were classified as chronic hypersensitivity pneumonitis (prevalence, 0.91-1.70 per 100,000 persons; cumulative incidence, 0.63-1.08 per 100,000 persons). Fewer had fibrotic hypersensitivity pneumonitis (prevalence, 0.41-0.80 per 100,000 persons; cumulative incidence: 0.29-0.43 per 100,000 persons). Most cases (74%) were classified as unspecified hypersensitivity pneumonitis. Older age, male sex, and fibrosis were associated with higher mortality rates in unadjusted analyses. Using U.S. administrative claims-based data, we developed an algorithm with a high sensitivity and specificity for hypersensitivity pneumonitis. Between 2004 and 2013, hypersensitivity pneumonitis was more common among women and those older than 65 years. Most cases were classified as chronic hypersensitivity pneumonitis. Approximately one-fourth met our criteria for fibrotic hypersensitivity pneumonitis, which was associated with a higher mortality rate.

  8. Effects of urbanization on water quality in the Kansas River, Shunganunga Creek Basin, and Soldier Creek, Topeka, Kansas, October 1993 through September 1995

    USGS Publications Warehouse

    Pope, L.M.; Putnam, J.E.

    1997-01-01

    A study of urban-related water-qulity effects in the Kansas River, Shunganunga Creek Basin, and Soldier Creek in Topeka, Kansas, was conducted from October 1993 through September 1995. The purpose of this report is to assess the effects of urbanization on instream concentrations of selected physical and chemical constituents within the city of Topeka. A network of seven sampling sites was established in the study area. Samples principally were collected at monthly intervals from the Kansas River and from the Shunganunga Creek Basin, and at quarterly intervals from Soldier Creek. The effects of urbanization werestatistically evaluated from differences in constituent concentrations between sites on the same stream. No significant differences in median concentrations of dissolved solids, nutrients, or metals and trace elements, or median densities offecal bacteria were documented between sampling sites upstream and downstream from the major urbanized length of the Kansas River in Topeka.Discharge from the city's primary wastewater- treatment plant is the largest potential source of contamination to the Kansas River. This discharge increased concentrations of dissolved ammonia, totalphosphorus, and densities of fecal bacteria.Calculated dissolved ammonia as nitrogen concentrations in water from the Kansas River ranged from 0.03 to 1.1 milligrams per liter after receiving treatment-plant discharge. However, most of the calculated concentrations wereconsiderably less than 50 percent of Kansas Department of Health and Environment water- quality criteria, with a median value of 20 percent.Generally, treatment-plant discharge increased calculated total phosphorus concentrations in water from the Kansas River by 0.01 to 0.04 milligrams per liter, with a median percentage increase of 7.6 percent. The calculated median densities of fecal coliform and fecal Streptococci bacteria in water from the Kansas River increased from 120 and 150colonies per 100 milliliters of water, respectively, before treatment-plant discharge to a calculated 4,900 and 4,700 colonies per 100 milliliters of water, respectively, after discharge. Median concentrations of dissolved solids were not significantly different between three sampling sites in the Shunganunga Creek Basin. Median concentrations of dissolved nitrate as nitrogen, total phosphorus, and dissolved orthophosphate were significantly larger in water from the upstream- most Shunganunga Creek sampling site than in water from either of the other sampling sites in the Shunganunga Creek Basin probably because of the site's proximity to a wastewater-treatment plant.Median concentrations of dissolved nitrate as nitrogen and total phosphorus during 1993-95 at upstream sampling sites were either significantlylarger than during 1979-81 in response to increase of wastewater-treatment plant discharge or smaller because of the elimination of wastewater-treatment plant discharge. Median concentrations of dissolved ammonia as nitrogen were significantly less during 1993-95 than during 1979-81. Median concentrations of total aluminum, iron, maganese, and molybdenum were significantly larger in water from the downstream-mostShunganunga Creek sampling site than in water from the upstream-most sampling site. This probably reflects their widespread use in the urbanenvironment between the upstream and downstream Shunganunga Creek sampling sites. Little water-quality effect from the urbanization was indicated by results from the Soldier Creek sampling site. Median concentrations of most water-quality constituents in water from this sampling site were the smallest in water from any sampling site in the study area. Herbicides were detected in water from all sampling sites. Some of the more frequently detected herbicides included acetochlor, alachlor,atrazine, cyanazine, EPTC, metolachlor, prometon, simazine, and tebuthiuron. Detected insecticides including chlordane,

  9. Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

    USGS Publications Warehouse

    Fallon, James D.; Yaeger, Christine S.

    2009-01-01

    Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1.7 percent), ammonia plus organic nitrogen (13 percent), total phosphorus (62 percent), and suspended sediment (11 percent) during the study. All constituents had seasonal peaks in spring and fall. The large loads during the fall resulted from unusually large precipitation and streamflow patterns. This caused the two greatest streamflow peaks at both sites to occur during October (2004 and 2005). In Seguchie Creek, bed-sediment concentrations of five metals and trace elements (arsenic, cadmium, chromium, lead, and zinc) exceeded the Interim Sediment Quality Guidelines (ISQG) set by the Canadian Council of Ministers of the Environment. Bed-sediment samples from the upstream site had more exceedances of ISQGs for metals and trace elements than did samples from the downstream site (seven and two exceedances, respectively). Bed-sediment samples from the downstream site had more exceedances of ISQGs (20 exceedances) for semivolatile organic compounds than did samples from the upstream site (8 exceedances), indicating different sources for organic compounds than for metals and trace elements. Concentrations of 11 semivolatile organic compounds exceeded ISQGs: ancenaphthene, acenaphthylene, anthracene, benzo[a]anthracene, benzo[a]pyrene, chrysene, fluoranthene, fluorene, naphthalene, phenanthrene, and pyrene. In bed-sediment samples collected from three wetlands, concentrations of all six metals exceeded ISQGs: arsenic, cadmium, chromium, copper, lead, and zinc. Concentrations of three semivolatile organic compounds exceeded ISQGs: flouranthene, phenanthrene, and pyrene. Results indicate that areas appearing relatively undisturbed and of high resource value can have degraded quality from previous unknown land use.

  10. Differential responses of primary auditory cortex in autistic spectrum disorder with auditory hypersensitivity.

    PubMed

    Matsuzaki, Junko; Kagitani-Shimono, Kuriko; Goto, Tetsu; Sanefuji, Wakako; Yamamoto, Tomoka; Sakai, Saeko; Uchida, Hiroyuki; Hirata, Masayuki; Mohri, Ikuko; Yorifuji, Shiro; Taniike, Masako

    2012-01-25

    The aim of this study was to investigate the differential responses of the primary auditory cortex to auditory stimuli in autistic spectrum disorder with or without auditory hypersensitivity. Auditory-evoked field values were obtained from 18 boys (nine with and nine without auditory hypersensitivity) with autistic spectrum disorder and 12 age-matched controls. Autistic disorder with hypersensitivity showed significantly more delayed M50/M100 peak latencies than autistic disorder without hypersensitivity or the control. M50 dipole moments in the hypersensitivity group were larger than those in the other two groups [corrected]. M50/M100 peak latencies were correlated with the severity of auditory hypersensitivity; furthermore, severe hypersensitivity induced more behavioral problems. This study indicates auditory hypersensitivity in autistic spectrum disorder as a characteristic response of the primary auditory cortex, possibly resulting from neurological immaturity or functional abnormalities in it. © 2012 Wolters Kluwer Health | Lippincott Williams & Wilkins.

  11. Modification of suburban carbon and nitrogen fluxes by a coupled channel/floodplain system assessed using in situ sensors

    NASA Astrophysics Data System (ADS)

    Wollheim, W. M.; Pellerin, B. A.; Saraceno, J.; Hopkinson, C.; Hope, A.; Morse, N.

    2010-12-01

    Biogeochemical fluxes in human dominated streams and rivers are highly impacted, but effects can be attenuated downstream through natural ecosystem processes. We deployed in situ nitrate, fdom, and chlorophyll sensors to characterize biogeochemical fluxes draining a suburban catchment, and modifications by a channel-floodplain system located immediately downstream. The upstream site reflects the suburban signal; the downstream site reflects the influence of the channel/floodplain on the suburban signal. FDOM showed a diurnal signal at both sites, but was stronger downstream, likely indicating new DOC production within the channel-floodplain system, which contained a small pond. In situ chlorophyll concentrations were also highly correlated with FDOM. FDOM showed a stronger storm response upstream than downstream, indicating terrestrial sources are mobilized by storms and subsequent dampening of the pulse by the floodplain. Nitrate concentrations consistently dropped from 0.6 to 0.7 mg/l upstream to less than 0.4 mg/l downstream, indicating likely nitrogen retention or removal over a relatively short distance (~500m). Use of in situ sensors is likely to greatly advance our understanding of biogeochemical processes in aquatic systems.

  12. A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

    PubMed Central

    Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

    2000-01-01

    Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

  13. Characterization of Stormflows and Wastewater Treatment-Plant Effluent Discharges on Water Quality, Suspended Sediment, and Stream Morphology for Fountain and Monument Creek Watersheds, Colorado, 1981-2006

    USGS Publications Warehouse

    Mau, David P.; Stogner, Sr., Robert W.; Edelmann, Patrick

    2007-01-01

    In 1998, the U.S. Geological Survey, in cooperation with Colorado Springs City Engineering, began a study of the Fountain and Monument Creek watersheds to characterize water quality and suspended-sediment conditions in the watershed for different flow regimes, with an emphasis on characterizing water quality during storm runoff. Water-quality and suspended-sediment samples were collected in the Fountain and Monument Creek watersheds from 1981 through 2006 to evaluate the effects of stormflows and wastewater-treatment effluent on Fountain and Monument Creeks in the Colorado Springs, Colorado, area. Water-quality data were collected at 11 sites between 1981 and 2001, and 14 tributary sites were added in 2003 to increase spatial coverage and characterize water quality throughout the watersheds. Suspended-sediment samples collected daily at 7 sites from 1998 through 2001, 6 sites daily from 2003 through 2006, and 13 tributary sites intermittently from 2003 through 2006 were used to evaluate the effects of stormflow on suspended-sediment concentrations, discharges, and yields. Data were separated into three flow regimes: base flow, normal flow, and stormflow. Stormflow concentrations from 1998 through 2006 were compared to Colorado acute instream standards and, with the exception of a few isolated cases, did not exceed water-quality standards for inorganic constituents that were analyzed. However, stormflow concentrations of both fecal coliform and Escherichia coli (E. coli) frequently exceeded water-quality standards during 1998 through 2006 on main-stem and tributary sites by more than an order of magnitude. There were two sites on Cottonwood Creek, a tributary to Monument Creek, with elevated concentrations of dissolved nitrite plus nitrate: site 07103985 (TbCr), a tributary to Cottonwood Creek and site 07103990 (lower_CoCr), downstream from site 07103985 (TbCr), and near the confluence with Monument Creek. During base-flow and normal-flow conditions, the median concentrations of dissolved nitrite plus nitrate ranged from 5.1 to 6.1 mg/L and were 4 to 7 times larger than concentrations at the nearest upstream site on Monument Creek, site 07103970 (MoCr_Woodmen). The source of these larger dissolved nitrite plus nitrate concentrations has not been identified, but the fact that all measurements had elevated dissolved nitrite plus nitrate concentrations indicates a relatively constant source. Most stormflow concentrations of dissolved trace elements were smaller than concentrations from base-flow or normal-flow samples. However, median concentrations of total arsenic, copper, lead, manganese, nickel, and zinc generally were much larger during periods of stormflow than during base flow or normal flow. Concentrations of dissolved and total copper, total manganese, total nickel, dissolved and total selenium, and dissolved and total zinc ranged from 3 to 27 times larger at site 07103707 (FoCr_8th) than site 07103700 (FoCr_Manitou) during base flow, indicating a large source of trace elements between these two sites. Both of these sites are located on Fountain Creek, upstream from the confluence with Monument Creek. The likely source area is Gold Hill Mesa, a former tailings pile for a gold refinery located just upstream from the confluence with Monument Creek, and upstream from site 07103707 (FoCr_8th). Farther downstream in Fountain Creek, stormflow samples for total copper, manganese, lead, nickel, and zinc were larger at the downstream site near the city of Security, site 07105800 (FoCr_Security), than at the upstream site near Janitell Road, site 07105530 (FoCr_Janitell), compared with other main-stem sites and indicated a relatively large source of these metals between the two sites. Nitrogen, phosphorus, and trace-element loads substantially increased during stormflow. Suspended-sediment concentrations, discharges, and yields associated with stormflow were significantly larger than those associated with normal flow. The Apr

  14. High cytokinin levels induce a hypersensitive-like response in tobacco.

    PubMed

    Novák, Jan; Pavlů, Jaroslav; Novák, Ondřej; Nožková-Hlaváčková, Vladimíra; Špundová, Martina; Hlavinka, Jan; Koukalová, Šárka; Skalák, Jan; Černý, Martin; Brzobohatý, Břetislav

    2013-07-01

    Cytokinins are positive regulators of shoot development. However, it has previously been demonstrated that efficient activation of the cytokinin biosynthesis gene ipt can cause necrotic lesions and wilting in tobacco leaves. Some plant pathogens reportedly use their ability to produce cytokinins in disease development. In response to pathogen attacks, plants can trigger a hypersensitive response that rapidly kills cells near the infection site, depriving the pathogen of nutrients and preventing its spread. In this study, a diverse set of processes that link ipt activation to necrotic lesion formation were investigated in order to evaluate the potential of cytokinins as signals and/or mediators in plant defence against pathogens. The binary pOp-ipt/LhGR system for dexamethasone-inducible ipt expression was used to increase endogenous cytokinin levels in transgenic tobacco. Changes in the levels of cytokinins and the stress hormones salicylic, jasmonic and abscisic acid following ipt activation were determined by ultra-performance liquid chromatography-electrospray tandem mass spectrometry (UPLC-MS/MS). Trends in hydrogen peroxide content and lipid peroxidation were monitored using the potassium iodide and malondialdehyde assays. The subcellular distribution of hydrogen peroxide was investigated using 3,3'-diaminobenzidine staining. The dynamics of transcripts related to photosynthesis and pathogen response were analysed by reverse transcription followed by quantitative PCR. The effects of cytokinins on photosynthesis were deciphered by analysing changes in chlorophyll fluorescence and leaf gas exchange. Plants can produce sufficiently high levels of cytokinins to trigger fast cell death without any intervening chlorosis - a hallmark of the hypersensitive response. The results suggest that chloroplastic hydrogen peroxide orchestrates the molecular responses underpinning the hypersensitive-like response, including the inhibition of photosynthesis, elevated levels of stress hormones, oxidative membrane damage and stomatal closure. Necrotic lesion formation triggered by ipt activation closely resembles the hypersensitive response. Cytokinins may thus act as signals and/or mediators in plant defence against pathogen attack.

  15. Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

    PubMed Central

    Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

    1988-01-01

    Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

  16. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    PubMed

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  17. Prevalence of dentine hypersensitivity: A cross-sectional study in rural Punjabi Indians

    PubMed Central

    Dhaliwal, Jagjit Singh; Palwankar, Pooja; Khinda, Paramjit K.; Sodhi, Sachinjeet K.

    2012-01-01

    Aims and Objectives: To study the prevalence of dentine hypersensitivity and related risk factors in rural population of Punjab, India. Materials and Methods: A total of 650 subjects reporting dentine sensitivity were included in the study comprising of 270 males and 380 females. All the subjects completed an interview and the subjects reporting dentine hypersensitivity were examined further using air syringe to put a blast of air to confirm the diagnosis of dentine hypersensitivity. Periodontal attachment loss and gingival recession of all the sensitive teeth were examined and recorded. Results: The prevalence of dentine hypersensitivity was 25% in the oral test. The subjects receiving the treatment of hypersensitivity were only 15.1%. The older group in the 50-59 years had the highest number (98%) of subjects with dentine hypersensitivity. Most commonly affected teeth were mandibular incisors. The other factors related to dentine hypersensitivity were the socioeconomic status, lower education level, and access to dental care. The periodontal factors related to hypersensitivity were gingival recession and poor oral hygiene. Conclusions: The prevalence of dentine hypersensitivity was 25% in the rural population of Punjab. PMID:23162341

  18. Fish assemblages in the Upper Esopus Creek, NY: Current status, variability, and controlling factors

    USGS Publications Warehouse

    Baldigo, Barry P.; George, Scott D.; Keller, Walter T

    2015-01-01

    The Upper Esopus Creek receives water diversions from a neighboring basin through the Shandaken Tunnel (the portal) from the Schoharie Reservoir. Although the portal is closed during floods, mean flows and turbidity of portal waters are generally greater than in Esopus Creek above their confluence. These conditions could potentially affect local fish assemblages, yet such effects have not been assessed in this highly regulated stream. We studied water quality, hydrology, temperature, and fish assemblages at 18 sites in the Upper Esopus Creek during 2009–2011 to characterize the effects of the portal input on resident-fish assemblages and to document the status of the fishery resource. In general, fish-community richness increased by 2–3 species at mainstem sites near the portal, and median density and biomass of fish communities at sites downstream of the portal were significantly lower than they were at sites upstream of the portal. Median densities of Salmo trutta (Brown Trout) and all trout species were significantly lower than at mainstem sites downstream from the portal—25.1 fish/0.1 ha and 148.9 fish/0.1 ha, respectively—than at mainstem sites upstream from the portal—68.8 fish/0.1 ha and 357.7 fish/0.1 ha, respectively—yet median biomass for Brown Trout and all trout did not differ between sites from both reaches. The median density of young-of-year Brown Trout at downstream sites (9.3 fish/0.1 ha) was significantly lower than at upstream sites (33.9 fish/0.1 ha). Waters from the portal appeared to adversely affect the density and biomass of young-of-year Brown Trout, but lower temperatures and increased flows also improved habitat quality for mature trout at downstream sites during summer. These findings, and those from companion studies, indicate that moderately turbid waters from the portal had few if any adverse impacts on trout populations and overall fish communities in the Upper Esopus Creek during this study.

  19. Regulation of the Cobalt/Nickel Efflux Operon dmeRF in Agrobacterium tumefaciens and a Link between the Iron-Sensing Regulator RirA and Cobalt/Nickel Resistance

    PubMed Central

    Dokpikul, Thanittra; Chaoprasid, Paweena; Saninjuk, Kritsakorn; Sirirakphaisarn, Sirin; Johnrod, Jaruwan; Nookabkaew, Sumontha; Mongkolsuk, Skorn

    2016-01-01

    ABSTRACT The Agrobacterium tumefaciens C58 genome harbors an operon containing the dmeR (Atu0890) and dmeF (Atu0891) genes, which encode a transcriptional regulatory protein belonging to the RcnR/CsoR family and a metal efflux protein belonging to the cation diffusion facilitator (CDF) family, respectively. The dmeRF operon is specifically induced by cobalt and nickel, with cobalt being the more potent inducer. Promoter-lacZ transcriptional fusion, an electrophoretic mobility shift assay, and DNase I footprinting assays revealed that DmeR represses dmeRF transcription through direct binding to the promoter region upstream of dmeR. A strain lacking dmeF showed increased accumulation of intracellular cobalt and nickel and exhibited hypersensitivity to these metals; however, this strain displayed full virulence, comparable to that of the wild-type strain, when infecting a Nicotiana benthamiana plant model under the tested conditions. Cobalt, but not nickel, increased the expression of many iron-responsive genes and reduced the induction of the SoxR-regulated gene sodBII. Furthermore, control of iron homeostasis via RirA is important for the ability of A. tumefaciens to cope with cobalt and nickel toxicity. IMPORTANCE The molecular mechanism of the regulation of dmeRF transcription by DmeR was demonstrated. This work provides evidence of a direct interaction of apo-DmeR with the corresponding DNA operator site in vitro. The recognition site for apo-DmeR consists of 10-bp AT-rich inverted repeats separated by six C bases (5′-ATATAGTATACCCCCCTATAGTATAT-3′). Cobalt and nickel cause DmeR to dissociate from the dmeRF promoter, which leads to expression of the metal efflux gene dmeF. This work also revealed a connection between iron homeostasis and cobalt/nickel resistance in A. tumefaciens. PMID:27235438

  20. Occurrence of emerging contaminants in water and bed material in the Missouri River, North Dakota, 2007

    USGS Publications Warehouse

    Damschen, William C.; Lundgren, Robert F.

    2009-01-01

    The U.S. Geological Survey (USGS), in cooperation with the Standing Rock Sioux Tribe, conducted a reconnaissance study to determine the occurrence of emerging contaminants in water and bed sediment within the Missouri River upstream and downstream from the cities of Bismarck and Mandan, North Dakota, and upstream from the city of Fort Yates, North Dakota, during September-October 2007. At each site, water samples were collected twice and bed-sediment samples were collected once. Samples were analyzed for more than 200 emerging contaminants grouped into four compound classes - wastewater compounds, human-health pharmaceutical compounds, hormones, and antibiotics. Only sulfamethoxazole, an antibiotic, was present at a concentration higher than minimum detection limits. It was detected in a water sample collected downstream from the cities of Bismarck and Mandan, and in bed-sediment samples collected at the two sites downstream from the cities of Bismarck and Mandan and upstream from Fort Yates. Sulfamethoxazole is an antibiotic commonly used for treating bacterial infections in humans and animals.

  1. Transcription factor AtTCP14 regulates embryonic growth potential during seed germination in Arabidopsis thaliana.

    PubMed

    Tatematsu, Kiyoshi; Nakabayashi, Kazumi; Kamiya, Yuji; Nambara, Eiji

    2008-01-01

    To understand the molecular mechanisms underlying regulation of seed germination, we searched enriched cis elements in the upstream regions of Arabidopsis genes whose transcript levels increased during seed germination. Using available published microarray data, we found that two cis elements, Up1 or Up2, which regulate outgrowth of Arabidopsis axillary shoots, were significantly over-represented. Classification of Up1- and Up2-containing genes by gene ontology revealed that protein synthesis-related genes, especially ribosomal protein genes, were highly over-represented. Expression analysis using a reporter gene driven by a synthetic promoter regulated by these elements showed that the Up1 is necessary and sufficient for germination-associated gene induction, whereas Up2 acts as an enhancer of Up1. Up1-mediated gene expression was suppressed by treatments that blocked germination. Up1 is almost identical to the site II motif, which is the predicted target of TCP transcription factors. Of 24 AtTCP genes, AtTCP14, which showed the highest transcript level just prior to germination, was functionally characterized to test its involvement in the regulation of seed germination. Transposon-tagged lines for AtTCP14 showed delayed germination. In addition, germination of attcp14 mutants exhibited hypersensitivity to exogenously applied abscisic acid and paclobutrazol, an inhibitor of gibberellin biosynthesis. AtTCP14 was predominantly expressed in the vascular tissues of the embryo, and affected gene expression in radicles in a non-cell-autonomous manner. Taken together, these results indicate that AtTCP14 regulates the activation of embryonic growth potential in Arabidopsis seeds.

  2. Non-canonical Activities of Hog1 Control Sensitivity of Candida albicans to Killer Toxins From Debaryomyces hansenii

    PubMed Central

    Morales-Menchén, Ana; Navarro-García, Federico; Guirao-Abad, José P.; Román, Elvira; Prieto, Daniel; Coman, Ioana V.; Pla, Jesús; Alonso-Monge, Rebeca

    2018-01-01

    Certain yeasts secrete peptides known as killer toxins or mycocins with a deleterious effect on sensitive yeasts or filamentous fungi, a common phenomenon in environmental species. In a recent work, different Debaryomyces hansenii (Dh) strains isolated from a wide variety of cheeses were identified as producing killer toxins active against Candida albicans and Candida tropicalis. We have analyzed the killer activity of these toxins in C. albicans mutants defective in MAPK signaling pathways and found that the lack of the MAPK Hog1 (but not Cek1 or Mkc1) renders cells hypersensitive to Dh mycocins while mutants lacking other upstream elements of the pathway behave as the wild type strain. Point mutations in the phosphorylation site (T174A-176F) or in the kinase domain (K52R) of HOG1 gene showed that both activities were relevant for the survival of C. albicans to Dh killer toxins. Moreover, Hog1 phosphorylation was also required to sense and adapt to osmotic and oxidative stress while the kinase activity was somehow dispensable. Although the addition of supernatant from the killer toxin- producing D. hansenii 242 strain (Dh-242) induced a slight intracellular increase in Reactive Oxygen Species (ROS), overexpression of cytosolic catalase did not protect C. albicans against this mycocin. This supernatant induced an increase in intracellular glycerol concentration suggesting that this toxin triggers an osmotic stress. We also provide evidence of a correlation between sensitivity to Dh-242 killer toxin and resistance to Congo red, suggesting cell wall specific alterations in sensitive strains. PMID:29774204

  3. Regulation of drought tolerance by the F-box protein MAX2 in Arabidopsis.

    PubMed

    Bu, Qingyun; Lv, Tianxiao; Shen, Hui; Luong, Phi; Wang, Jimmy; Wang, Zhenyu; Huang, Zhigang; Xiao, Langtao; Engineer, Cawas; Kim, Tae Houn; Schroeder, Julian I; Huq, Enamul

    2014-01-01

    MAX2 (for MORE AXILLARY GROWTH2) has been shown to regulate diverse biological processes, including plant architecture, photomorphogenesis, senescence, and karrikin signaling. Although karrikin is a smoke-derived abiotic signal, a role for MAX2 in abiotic stress response pathways is least investigated. Here, we show that the max2 mutant is strongly hypersensitive to drought stress compared with wild-type Arabidopsis (Arabidopsis thaliana). Stomatal closure of max2 was less sensitive to abscisic acid (ABA) than that of the wild type. Cuticle thickness of max2 was significantly thinner than that of the wild type. Both of these phenotypes of max2 mutant plants correlate with the increased water loss and drought-sensitive phenotype. Quantitative real-time reverse transcription-polymerase chain reaction analyses showed that the expression of stress-responsive genes and ABA biosynthesis, catabolism, transport, and signaling genes was impaired in max2 compared with wild-type seedlings in response to drought stress. Double mutant analysis of max2 with the ABA-insensitive mutants abi3 and abi5 indicated that MAX2 may function upstream of these genes. The expression of ABA-regulated genes was enhanced in imbibed max2 seeds. In addition, max2 mutant seedlings were hypersensitive to ABA and osmotic stress, including NaCl, mannitol, and glucose. Interestingly, ABA, osmotic stress, and drought-sensitive phenotypes were restricted to max2, and the strigolactone biosynthetic pathway mutants max1, max3, and max4 did not display any defects in these responses. Taken together, these results uncover an important role for MAX2 in plant responses to abiotic stress conditions.

  4. Hydrologic characteristics of surface-mined land reclaimed by sludge irrigation, Fulton County, Illinois

    USGS Publications Warehouse

    Patterson, G.L.; Fuentes, R.F.; Toler, L.G.

    1982-01-01

    Analyses of water samples collected at four stream-monitoring stations, in an area surface mined for coal and being reclaimed by sludge irrigation, show the principal metals are sodium, calcium, and magnesium and principal non-metals are chloride, sulfate, and bicarbonate. Comparing yearly mean chemical concentrations shows no changing trends since reclamation began, nor are there differences between stations upstream and downstream from the site. Yearly suspended-sediment loads and discharge relations upstream and downstream from the site also show no differences. Discharge hydrographs of two streams draining the site show a delayed response to precipitation due to the storage capacity of several upstream strip-mine lakes. The water-table surface generally follows the irregular topography. Monthly water-level fluctuations were dependent on the surface material (mined or unmined) and proximity to surface discharge. The largest fluctuations were in unmined land away from discharge while the smallest were in mined land near discharge. The water table is closer to the surface in unmined land. Analyses of water samples from 70 wells within or adjacent to the reclamation site showed no differences in water quality which could be attributed to sludge or supernatant application. Samples from wells in mined land, however, had higher concentrations of dissolved sulfate, calcium, magnesium, chloride, iron, zinc, and manganese than samples from wells in unmined land. (USGS)

  5. Characterization of the microbial community composition and the distribution of Fe-metabolizing bacteria in a creek contaminated by acid mine drainage.

    PubMed

    Sun, Weimin; Xiao, Enzong; Krumins, Valdis; Dong, Yiran; Xiao, Tangfu; Ning, Zengping; Chen, Haiyan; Xiao, Qingxiang

    2016-10-01

    A small watershed heavily contaminated by long-term acid mine drainage (AMD) from an upstream abandoned coal mine was selected to study the microbial community developed in such extreme system. The watershed consists of AMD-contaminated creek, adjacent contaminated soils, and a small cascade aeration unit constructed downstream, which provide an excellent contaminated site to study the microbial response in diverse extreme AMD-polluted environments. The results showed that the innate microbial communities were dominated by acidophilic bacteria, especially acidophilic Fe-metabolizing bacteria, suggesting that Fe and pH are the primary environmental factors in governing the indigenous microbial communities. The distribution of Fe-metabolizing bacteria showed distinct site-specific patterns. A pronounced shift from diverse communities in the upstream to Proteobacteria-dominated communities in the downstream was observed in the ecosystem. This location-specific trend was more apparent at genus level. In the upstream samples (sampling sites just below the coal mining adit), a number of Fe(II)-oxidizing bacteria such as Alicyclobacillus spp., Metallibacterium spp., and Acidithrix spp. were dominant, while Halomonas spp. were the major Fe(II)-oxidizing bacteria observed in downstream samples. Additionally, Acidiphilium, an Fe(III)-reducing bacterium, was enriched in the upstream samples, while Shewanella spp. were the dominant Fe(III)-reducing bacteria in downstream samples. Further investigation using linear discriminant analysis (LDA) effect size (LEfSe), principal coordinate analysis (PCoA), and unweighted pair group method with arithmetic mean (UPGMA) clustering confirmed the difference of microbial communities between upstream and downstream samples. Canonical correspondence analysis (CCA) and Spearman's rank correlation indicate that total organic carbon (TOC) content is the primary environmental parameter in structuring the indigenous microbial communities, suggesting that the microbial communities are shaped by three major environmental parameters (i.e., Fe, pH, and TOC). These findings were beneficial to a better understanding of natural attenuation of AMD.

  6. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

    PubMed Central

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

  7. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

    PubMed

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

  8. Distribution of spawning activity by anadromous fishes in an atlantic slope drainage after removal of a low-head dam

    USGS Publications Warehouse

    Burdick, S.M.; Hightower, J.E.

    2006-01-01

    In 1998, the Quaker Neck Dam was removed from the Neuse River near Goldsboro, North Carolina, restoring access to more than 120 km of potential main-stem spawning habitat and 1,488 km of potential tributary spawning habitat to anadromous fishes. We used plankton sampling and standardized electrofishing to examine the extent to which anadromous fishes utilized this restored spawning habitat in 2003 and 2004. Evidence of spawning activity was detected upstream of the former dam site for three anadromous species: American shad Alosa sapidissima, hickory shad A. mediocris, and striped bass Morone saxatilis. The percentages of eggs and larvae collected in the restored upstream habitat were greater in 2003, when spring flows were high, than in 2004. River reaches where spawning occurred were estimated from egg stage and water velocity data. Spawning of American shad and striped bass occurred primarily in main-stem river reaches that were further upstream during the year of higher spring flows. Hickory shad generally spawned in downstream reaches and in tributaries above and below the former dam site. These results demonstrate that anadromous fishes will take advantage of upper basin spawning habitat restored through dam removal as long as instream flows are adequate to facilitate upstream migration.

  9. Use of a Fish Transportation Barge for Increasing Returns of Steelhead Imprinted for Homing, Final Report.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harmon, Jerrel R.

    1989-08-01

    The objective of this 7-year National Fisheries Service study, which began is 1982, was to determine if transporting juvenile steelhead (Oncorhynchus mykiss) by truck and barge from Dworshak National Fish Hatchery (NFH), on the Clearwater River, to a release site on the Columbia River below Bonneville Dam would result in increased returns of adults to the various fisheries and to the hatchery homing site. During 1982 and 1983, over 500,000 marked juvenile steelhead were serially released as controls from the hatchery or barged as test fish to below Bonneville Dam. Recoveries of marked adults to various recovery sites are complete.more » Fish released in 1983 showed a stronger homing ability and more rapid upstream migration than test fish released in 1982. Most adults from both control and test releases in 1983 and control releases in 1982 migrated a considerable distance upstream and overwintered in the Snake and Clearwater Rivers--behavior similar to Clearwater River fish previously transported from Lower Granite Dam. In contrast, many of the adults from test releases in 1982 failed to migrate upstream during the fall, overwintered in the Columbia River, and migrated upstream the following spring. Survival of control fish released at Dworshak NFH in late April 1982 was substantially higher than survival of those released in mid-May. Survival and homing of control fish released in late April and early May 1983 were over 10 times that for fish released in late May. Return of adults from normal hatchery releases in 1982 was the highest ever observed at Dworshak NFH.« less

  10. Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

    PubMed

    Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

    2013-10-01

    Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

  11. Cardiac Iodine-123-Meta-Iodo-Benzylguanidine Uptake in Carotid Sinus Hypersensitivity.

    PubMed

    Tan, Maw Pin; Murray, Alan; Hawkins, Terry; Chadwick, Thomas J; Kerr, Simon R J; Parry, Steve W

    2015-01-01

    Carotid sinus syndrome is the association of carotid sinus hypersensitivity with syncope, unexplained falls and drop attacks in generally older people. We evaluated cardiac sympathetic innervation in this disorder in individuals with carotid sinus syndrome, asymptomatic carotid sinus hypersensitivity and controls without carotid sinus hypersensitivity. Consecutive patients diagnosed with carotid sinus syndrome at a specialist falls and syncope unit were recruited. Asymptomatic carotid sinus hypersensitivity and non-carotid sinus hypersensitivity control participants recruited from a community-dwelling cohort. Cardiac sympathetic innervation was determined using Iodine-123-metaiodobenzylguanidine (123-I-MIBG) scanning. Heart to mediastinal uptake ratio (H:M) were determined for early and late uptake on planar scintigraphy at 20 minutes and 3 hours following intravenous injection of 123-I-MIBG. Forty-two subjects: carotid sinus syndrome (n = 21), asymptomatic carotid sinus hypersensitivity (n = 12) and no carotid sinus hypersensitivity (n = 9) were included. Compared to the non- carotid sinus hypersensitivity control group, the carotid sinus syndrome group had significantly higher early H:M (estimated mean difference, B = 0.40; 95% confidence interval, CI = 0.13 to 0.67, p = 0.005) and late H:M (B = 0.32; 95%CI = 0.03 to 0.62, p = 0.032). There was, however, no significant difference in early H:M (p = 0.326) or late H:M (p = 0.351) between the asymptomatic carotid sinus hypersensitivity group and non- carotid sinus hypersensitivity controls. Cardiac sympathetic neuronal activity is increased relative to age-matched controls in individuals with carotid sinus syndrome but not those with asymptomatic carotid sinus hypersensitivity. Blood pressure and heart rate measurements alone may therefore represent an over simplification in the assessment for carotid sinus syndrome and the relative increase in cardiac sympathetic innervation provides additional clues to understanding the mechanisms behind the symptomatic presentation of carotid sinus hypersensitivity.

  12. PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

    PubMed

    Feng, Youjun; Cronan, John E

    2014-01-01

    Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  13. Self-report prevalence and associated factors to drug hypersensitivity in Mexican young adults.

    PubMed

    Bedolla-Barajas, Martín; Puente-Fernández, Cecilia; Flores-Merino, Miriam V; Morales-Romero, Jaime; Domínguez-García, Ma Victoria

    2017-07-01

    Drug hypersensitivity is defined as any unfavorable reaction that occurs after the administration of any drug. It may or may not be mediated by the involvement of the immune system. Epidemiological data related to drug hypersensitivity reactions in our country are scarce. To determine the prevalence of drug hypersensitivity in a group of young adults, as well as to identify associated factors. A structured questionnaire was applied to young people aged 18 to 25 years. The instrument was oriented to identify reactions of drug hypersensitivity, as well as the most prevalent drugs involved. In addition, a personal and family history of atopic diseases was included. Analysis for associations between variables was been done through logistic regression. The prevalence of drug hypersensitivity reactions was 12% (144 of 1,200). The antibiotics were the agents most related to hypersensitivity reactions (9.8%) followed by nonsteroidal anti-inflammatory drugs (1.6%). Factors associated with drug hypersensitivity were a personal history of asthma, odds ratio (OR) 3.15 (95% confidence interval [CI], 1.44-6.91), maternal and paternal history of drug hypersensitivity, OR 2.33 (95% CI, 1.21-4.48) and OR 3.11 (95% CI, 1.22-7.92), respectively. The results of this research show that drug hypersensitivity in young adults is a highly prevalent event and it is associated with personal history of asthma and history of drug hypersensitivity in parents.

  14. Bed Sediment Monitoring of Multiple Contiguous Small Dam Removals

    NASA Astrophysics Data System (ADS)

    Galster, J. C.; Wyrick, J. R.

    2010-12-01

    Dam removal is crucial for reconnecting river habitats, restoring passage of fish and other aquatic organisms, and restoring the free flow of water and sediment. However, removal of obsolete dams is often resisted due to concerns of releasing sediment and initiating channel instability. Two dams on the Musconetcong River in northern New Jersey have been removed as part of a watershed-wide effort to remove or breach all major obstructions to restore the river to its original free-flowing state. The two dams were consecutively situated 1 kilometer apart and their removals provided an opportunity to study the geomorphic response in the form of bed elevation changes and sediment size through pre- and post-removal monitoring. Initial geomorphic surveys of the riverbed in the vicinity of and between the two dams have shown areas of erosion and deposition. These surveys have established a set of control points along the river channel between the two dams, and confirm the downstream movement of a sediment plume and localized areas of erosion. At the upstream dam, comparisons pre- and post-dam removal surveys show greater than 100 cubic meters of sediment being both eroded and deposited within the site. Most but not all of the erosion occurred around the newly exposed sediment bar upstream of the former dam, where the thalweg has reestablished itself following the dam’s removal. Areas that were excavated during removal have experienced deposition. Most of the deposition occurred downstream and on the left-hand bank. Due to the two low flow culverts in the former dam, a mid-channel sediment bar formed but has subsequently eroded. At the downstream dam site, erosion has removed up to 1.1 m of sediment from the bed in places while depositing up to 0.5 m sediment in others. As sediment from the former impoundment migrated through the project site, areas excavated during the removal became areas of deposition following the removal, and; alternately, areas in the channel margins where sediments were placed experienced gradual erosion. Grain size analysis shows a coarsening of the riverbed over the first nine months since removal. Grain size analyses were done upstream and downstream of the dam sites as well as at two locations between the sites. Pebble counts were completed using the random walk method at each of the six sites. The largest change in grain sizes at the four sites occurred upstream of the downstream dam site, where there was a significant coarsening of the sediment from October 2008 to June 2009. This has most likely occurred from the increase in energy upstream of the dam post-removal, which has transported many of the fine-grained sediments downstream. Downstream of this dam site sediment size has not significantly changed, suggesting that the fine sediments have been transported downstream far enough to leave the site. Surveys of the channel thalweg above and below both dams also show a pulse of sediment migrating slowing from the uppermost impoundment areas. Long-term monitoring of the channel thalweg may reveal reach-level changes in channel slope.

  15. Defense responses regulated by jasmonate and delayed senescence caused by ethylene receptor mutation contribute to tolerance of petunia to Botrytis cinerea

    USDA-ARS?s Scientific Manuscript database

    The death of cells can be a programmed event that occurs when plants are attacked by pathogens. Botrytis cinerea (B. cinerea), a model necrotrophic pathogen, triggers the host cell death response because it produces toxins. A hypersensitive reaction (HR) occurs at the site of contact. In Arabidopsis...

  16. Class-Switch Recombination in the Absence of the IgH 3' Regulatory Region.

    PubMed

    Kim, Ahrom; Han, Li; Santiago, Gabriel E; Verdun, Ramiro E; Yu, Kefei

    2016-10-01

    The ∼28-kb 3' regulatory region (3'RR), which is located at the most distal 3' region of the Ig H chain locus, has multiple regulatory functions that control IgH expression, class-switch recombination (CSR), and somatic hypermutation. In this article, we report that deletion of the entire 3'RR in a mouse B cell line that is capable of robust cytokine-dependent CSR to IgA results in reduced, but not abolished, CSR. These data suggest that 3'RR is not absolutely required for CSR and, thus, is not essential for targeting activation-induced cytidine deaminase to S regions, as was suggested. Moreover, replacing 3'RR with a DNA fragment including only its four DNase I hypersensitive sites (lacking the large spacer regions) restores CSR to a level equivalent to or even higher than in wild-type cells, suggesting that the four hypersensitive sites contain most of the CSR-promoting functions of 3'RR. Stimulated cells express abundant germline transcripts, with the presence or absence of 3'RR, providing evidence that 3'RR has a role in promoting CSR that is unique from enhancing S region transcription. Copyright © 2016 by The American Association of Immunologists, Inc.

  17. Biomaterial Hypersensitivity: Is It Real? Supportive Evidence and Approach Considerations for Metal Allergic Patients following Total Knee Arthroplasty

    PubMed Central

    Mihalko, William M.; Grupp, Thomas M.; Manning, Blaine T.; Dennis, Douglas A.; Goodman, Stuart B.; Saleh, Khaled J.

    2015-01-01

    The prospect of biomaterial hypersensitivity developing in response to joint implant materials was first presented more than 30 years ago. Many studies have established probable causation between first-generation metal-on-metal hip implants and hypersensitivity reactions. In a limited patient population, implant failure may ultimately be related to metal hypersensitivity. The examination of hypersensitivity reactions in current-generation metal-on-metal knee implants is comparatively limited. The purpose of this study is to summarize all available literature regarding biomaterial hypersensitivity after total knee arthroplasty, elucidate overall trends about this topic in the current literature, and provide a foundation for clinical approach considerations when biomaterial hypersensitivity is suspected. PMID:25883940

  18. Characterization of mercury contamination in the Androscoggin River, Coos County, New Hampshire

    USGS Publications Warehouse

    Chalmers, Ann; Marvin-DiPasquale, Mark C.; Degnan, James R.; Coles, James; Agee, Jennifer L.; Luce, Darryl

    2013-01-01

    Concentrations of total mercury (THg) and MeHg in sediment, pore water, and biota in the Androscoggin River were elevated downstream from the former chloralkali facility compared with those upstream from reference sites. Sequential extraction of surface sediment showed a distinct difference in Hg speciation upstream compared with downstream from the contamination site. An upstream site was dominated by potassium hydroxide-extractable forms (for example, organic-Hg or particle-bound Hg(II)), whereas sites downstream from the point source were dominated by more chemically recalcitrant forms (largely concentrated nitric acid-extractable), indicative of elemental mercury or mercurous chloride. At all sites, only a minor fraction (less than 0.1 percent) of THg existed in chemically labile forms (for example, water extractable or weak acid extractable). All metrics indicated that a greater percentage of mercury at an upstream site was available for Hg(II)-methylation compared with sites downstream from the point source, but the absolute concentration of bioavailable Hg(II) was greater downstream from the point source. In addition, the concentration of tin-reducible inorganic reactive mercury, a surrogate measure of bioavailable Hg(II) generally increased with distance downstream from the point source. Whereas concentrations of mercury species on a sediment-dry-weight basis generally reflected the relative location of the sample to the point source, river-reach integrated mercury-species inventories and MeHg production potential (MPP) rates reflected the amount of fine-grained sediment in a given reach. THg concentrations in biota were significantly higher downstream from the point source compared with upstream reference sites for smallmouth bass, white sucker, crayfish, oligochaetes, bat fur, nestling tree swallow blood and feathers, adult tree swallow blood, and tree swallow eggs. As with tin-reducible inorganic reactive mercury, THg in smallmouth bass also increased with distance downstream from the point source. Toxicity tests and invertebrate community assessments suggested that invertebrates were not impaired at the current (2009 and 2010) levels of mercury contamination downstream from the point source. Concentrations of THg and MeHg in most water and sediment samples from the Androscoggin River were below U.S. Environmental Protection Agency (USEPA), the Canadian Council of Ministers of the Environment, and probable effects level guidelines. Surface-water and sediment samples from the Androscoggin River had similar THg concentrations but lower MeHg concentrations compared with other rivers in the region. Concentrations of THg in fish tissue were all above regional and U.S. Environmental Protection Agency guidelines. Moreover, median THg concentrations in smallmouth bass from the Androscoggin River were significantly higher than those reported in regional surveys of river and streams nationwide and in the Northeastern United States and Canada. The higher concentrations of mercury in smallmouth bass suggest conditions may be more favorable for Hg(II)-methylation and bioaccumulation in the Androscoggin River compared with many other rivers in the United States and Canada.

  19. Invasion and Colonisation of a Tropical Stream by an Exotic Loricariid Fish: Indices of Gradual Displacement of the Native Common Pleco (Hypostomus punctatus) by the Red Fin Dwarf Pleco (Parotocinclus maculicauda) over Fifteen Years

    PubMed Central

    Mazzoni, Rosana; Costa da Silva, Raquel; Pinto, Míriam Plaza

    2015-01-01

    The introduction of invasive species represents a major threat to the integrity of stream-dwelling fish populations worldwide, and this issue is receiving increasing attention from scientists, in particular because of potential impact on biodiversity. In this study, we analysed the dispersal of an exotic loricariid fish the red fin dwarf pleco (Parotocinclus maculicauda) in a stream of the Atlantic Forest biome in coastal south-eastern Brazil and evaluated the effects of this invasion on the native loricariid common pleco (Hypostomus punctatus). Specimens were collected at eight sites located along the course of the stream over a 15-year period. The distribution and density of the two species were determined by the Successive Removal Method. The introduction of P. maculicauda occurred in the medium sector of the stream, and during the course of the study, the species dispersed to new sites further upstream. By the end of the study, it was found at all points upstream from the original site. Hypostomus punctatus was registered at all sample sites both before and after the introduction of P. maculicauda, but its density decreased at all upstream sites after the arrival of the exotic species. Our analysis shows that colonisation by P. maculicauda seems to have a negative effect on H. punctatus densities. The maintenance of H. punctatus densities at the sites not colonised by P. maculicauda reinforces the conclusion that the colonisation of the stream by the exotic species had deleterious effects on the density of the resident H. punctatus populations, either by direct or indirect action. PMID:26440412

  20. Temporal trends and spatial patterns in nutrient export along the Mississippi River and its Tributaries

    NASA Astrophysics Data System (ADS)

    Stewart, B.; Li, L.

    2017-12-01

    The Mississippi River, the largest river in the U. S., exports excessive nutrients from the land to the sea, causing the problem of hypoxia in the Gulf of Mexico. In this research, we examined nutrient export along the Mississippi River and its tributaries to understand its trends and patterns and to identify the major factors contributing to these trends. We examined nutrient data from 1950 - 2017 for four sites along the Mississippi River and four tributary sites from the U. S. Geological Survey. The species included: total nitrogen, organic nitrogen, ammonia, nitrate, orthophosphate, and phosphorous. We analyzed the power law relationship of concentration and discharge, for which the export of nutrient species exhibited several trends. Both nitrogen (N) and phosphorous (P) species exhibited mostly chemodynamic behavior. This is in contrast to previous observations in smaller agricultural land where N and P export was mostly chemostatic with no significant change in concentration as discharge varies, suggesting possible scaling effects at different spatial scales. We also compared the average annual concentration over time at each site. The N concentration decreased from upstream to downstream, likely due to greater agricultural activities in the upstream Mississippi river and possible denitrification along the river. The N concentration also increased with time. The P species, however, fluctuated from site to site with no clear spatial patterns, but consistently exhibited higher concentrations at upstream sites with greater agricultural activities. The P species also fluctuated over time, likely due to patterns in discharge and agricultural activities. The results of this research can be further explored by calculating the total export of nutrients into the Gulf of Mexico to determine limits and drivers of nutrient export for better water management, thus helping prevent hypoxia and eutrophication within the Mississippi River basin.

  1. Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site.

    PubMed

    Kassotis, Christopher D; Iwanowicz, Luke R; Akob, Denise M; Cozzarelli, Isabelle M; Mumford, Adam C; Orem, William H; Nagel, Susan C

    2016-07-01

    Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

    PubMed Central

    Link, Gerhard

    1984-01-01

    A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

  3. Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

    PubMed

    Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

    2012-07-01

    The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site

    USGS Publications Warehouse

    Kassotis, Christopher D.; Iwanowicz, Luke R.; Akob, Denise M.; Cozzarelli, Isabelle M.; Mumford, Adam; Orem, William H.; Nagel, Susan C.

    2016-01-01

    Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby.

  5. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    PubMed

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

    2013-01-01

    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  6. Early H2O2 Accumulation in Mesophyll Cells Leads to Induction of Glutathione during the Hyper-Sensitive Response in the Barley-Powdery Mildew Interaction1

    PubMed Central

    Vanacker, Helene; Carver, Tim L.W.; Foyer, Christine H.

    2000-01-01

    H2O2 production and changes in glutathione, catalase, and peroxidase were followed in whole-leaf extracts from the susceptible (AlgS [Algerian/4* (F14) Man.(S)]; ml-a1 allele) and resistant (AlgR [Algerian/4* (F14) Man.(R)]; Ml-a1 allele) barley (Hordeum vulgare) isolines between 12 and 24 h after inoculation with powdery mildew (Blumeria graminis [DC]. Speer [syn. Erysiphe graminis DC] f.sp hordei Marchal). Localized papilla responses and cell death hypersensitive responses were not observed within the same cell. In hypersensitive response sites, H2O2 accumulation first occurred in the mesophyll underlying the attacked epidermal cell. Subsequently, H2O2 disappeared from the mesophyll and accumulated around attacked epidermal cells. In AlgR, transient glutathione oxidation coincided with H2O2 accumulation in the mesophyll. Subsequently, total foliar glutathione and catalase activities transiently increased in AlgR. These changes, absent from AlgS, preceded inoculation-dependent increases in peroxidase activity that were observed in both AlgR and AlgS at 18 h. An early intercellular signal precedes H2O2, and this elicits anti-oxidant responses in leaves prior to events leading to death of attacked cells. PMID:10938348

  7. Hypersensitive prostaglandin and thromboxane response to hormones in rabbit colitis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zipser, R.D.; Patterson, J.B.; Kao, H.W.

    1985-10-01

    Inflammation of the colon is associated with increased production of prostaglandins (PG) and thromboxanes (Tx), and these eicosanoids may contribute to the inflammatory, secretory, and motility dysfunctions in colitis. To evaluate the potential role of peptide hormones in the enhanced eicosanoid release, colitis was established in rabbits by a delayed-type hypersensitivity reaction to dinitrochlorobenzene and by an immune-complex-mediated reaction. PG and Tx were identified in the venous effluent of isolated perfused colons by radiochromatography after ( UC)arachidonic acid prelabeling, as well as by bioassay, and then quantitated by immunoassay. The two colitis models were morphologically similar. Basal release of PGE2,more » PGI2, and TxA2 was two- to threefold greater from colitis tissue than from control tissue. Bradykinin (BK) and angiotensin II (ANG II) increased release of UC-labeled eicosanoids, whereas several gastrointestinal hormones had no effect. In control colons, BK and ANG II increased PGE2 and PGI2 release (by about 2-fold) but did not alter TxA2. In contrast, BK and ANG II markedly exaggerated the release of eicosanoids in colitis. Since BK and possibly ANG II are increased at sites of inflammation, the hypersensitive eicosanoid response to these peptides may augment the eicosanoid-mediated manifestations of colitis.« less

  8. Glucocorticoid effects on contact hypersensitivity and on the cutaneous response to ultraviolet light in the mouse

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ross, P.M.; Walberg, J.A.; Bradlow, H.L.

    1988-03-01

    A single exposure to 254 nm ultraviolet irradiation (UV) can systemically suppress experimental sensitization to the simple allergen 2,4-dinitro, 1-chlorobenzene (DNCB) in the mouse. We show here that topical application at the site of irradiation of the 21-oic acid methyl ester derivative of the synthetic glucocorticoid triamcinolone acetonide (TAme) prevents UV suppression of sensitization. That is, mice painted with TAme at the site of UV exposure developed normal contact hypersensitivity (CH); mice exposed to UV only, like mice treated with the parent compound triamcinolone acetonide (TA), failed to be sensitized by DNCB applied to a distal site. TAme is inactivatedmore » rapidly by plasma esterases, so its effect is thought to be confined to the skin. Apparently, TAme blocked the cutaneous signal(s) for systemic suppression of CH. Histologically, irradiated skin exhibited mild inflammation and hyperproliferation, but these effects were greatly exaggerated and prolonged in the UV + TAme-treated skin, independent of sensitization at the distal site. The infiltrate consisted mostly of neutrophils and lacked the round cells characteristic of cell-mediated immunity. Apparently, normal immune suppression by UV prevented this vigorous reaction to irradiated skin. Applied together with DNCB. TAme blocked sensitization. It also prevented response to challenge by DNCB in previously sensitized animals. However, unlike the parent compound triamcinolone acetonide (TA), Budesonide or Beclomethasone diproprionate, each of which can penetrate the epidermis in active form, TAme had no effect on sensitization when applied at a distal site. Likewise, TAme did not affect plasma B (17-desoxycortisol) levels, whereas the other three compounds reduced plasma B tenfold, as expected of compounds causing adrenal-pituitary suppression.« less

  9. Nonylphenol ethoxylates and other additives in aircraft deicers, antiicers, and waters receiving airport runoff.

    PubMed

    Corsi, Steven R; Zitomer, Daniel H; Field, Jennifer A; Cancilla, Devon A

    2003-09-15

    Samples of nine different formulations of aircraft deicer and antiicer fluids (ADAF) were screened for the presence of selected surfactants. Nonylphenol ethoxylates (NPnEO) were identified in three ADAF formulations, octylphenol ethoxylates were identified in two formulations, and six formulations contained alcohol ethoxylates. A preliminary field study was conducted at General Mitchell International Airport, Milwaukee, WI, to quantify NPnEO (n = 1-15) and one of its byproducts, nonylphenol (NP), in airport runoff. Samples were collected from two airport outfalls, from the receiving stream, and from an upstream reference site during intensive ADAF application events. NPnEO was measured at concentrations up to 1190microg/L in airport outfall samples, up to 77 ug/L in samples from the receiving stream and less than 5.0 microg/L from the upstream reference. Concentrations of glycol and other ADAF-related constituents, including NPnEO, were reduced by approximately 1 order of magnitude between the outfall sites and the receiving stream site; however, concentrations of NP in the receiving stream remained similar to those from the outfalls (< 0.04 microg/L at the upstream reference, 0.98 and 7.67 microg/L at outfalls, and 3.89 microg/L in the receiving stream). The field data suggest that NP is generated through degradation of NPnEO from airport runoff.

  10. Nonylphenol ethoxylates and other additives in aircraft deicers, antiicers, and waters receiving airport runoff

    USGS Publications Warehouse

    Corsi, Steven R.; Zitomer, Daniel H.; Field, Jennifer A.; Cancilla, Devon A.

    2003-01-01

    Samples of nine different formulations of aircraft deicer and antiicer fluids (ADAF) were screened for the presence of selected surfactants. Nonylphenol ethoxylates (NPnEO) were identified in three ADAF formulations, octylphenol ethoxylates were identified in two formulations, and six formulations contained alcohol ethoxylates. A preliminary field study was conducted at General Mitchell International Airport, Milwaukee, WI, to quantify NPnEO (n = 1-15) and one of its byproducts, nonylphenol (NP), in airport runoff. Samples were collected from two airport outfalls, from the receiving stream, and from an upstream reference site during intensive ADAF application events. NPnEO was measured at concentrations up to 1190microg/L in airport outfall samples, up to 77 ug/L in samples from the receiving stream and less than 5.0 microg/L from the upstream reference. Concentrations of glycol and other ADAF-related constituents, including NPnEO, were reduced by approximately 1 order of magnitude between the outfall sites and the receiving stream site; however, concentrations of NP in the receiving stream remained similar to those from the outfalls (< 0.04 microg/L at the upstream reference, 0.98 and 7.67 microg/L at outfalls, and 3.89 microg/L in the receiving stream). The field data suggest that NP is generated through degradation of NPnEO from airport runoff.

  11. Leaf Litter Decomposition as a Functional Assessment of a Natural Stream Channel Design Project

    NASA Astrophysics Data System (ADS)

    Gentry, A.; Word, D.; Carreiro, M.; Jack, J.

    2005-05-01

    In October 2003, a 965m reach of Wilson Creek (Bernheim Research Forest, Kentucky, USA) was relocated, and meanders and riffle-pool sequences were restored, providing a unique opportunity to measure the re-establishment of post-restoration stream functions. Leaf litter bags were placed across riffles in the restored reach, in an upstream reference site and in two reference streams. Bags were collected for nine months, and mass loss, N dynamics and fungal ergosterol were measured. Daily mass loss rates in the restored and reference riffles in Wilson Creek were faster (k= -0.00759 and k= -0.00855, respectively) than those of the two reference streams (k= -0.00511 and k= -0.00308). This is equivalent to litter mean residence times of 132 days for the restored reach in Wilson, 117 days in the upstream reference site, and 196 and 325 days for the reference streams. It appears that the decay rate in the restored reach is similar to the upstream portion of Wilson Creek, indicating rapid mass loss recovery in the restored reach. We also determined that same-stream reference sites are important for evaluating the restoration of stream functions, because of high decay rate variation among nearby streams within the same watershed.

  12. Body morphology differs in wild juvenile Chinook salmon Oncorhynchus tshawytscha in the Willamette River, Oregon, USA

    USGS Publications Warehouse

    Billman, E.J.; Whitman, L.D.; Schroeder, R.K.; Sharpe, C.S.; Noakes, David L. G.; Schreck, Carl B.

    2014-01-01

    Body morphology of juvenile Chinook salmon Oncorhynchus tshawytscha in the upper Willamette River, Oregon, U.S.A., was analysed to determine if variation in body shape is correlated with migratory life-history tactics followed by juveniles. Body shape was compared between migrating juveniles that expressed different life-history tactics, i.e. autumn migrants and yearling smolts, and among parr sampled at three sites along a longitudinal river gradient. In the upper Willamette River, the expression of life-history tactics is associated with where juveniles rear in the basin with fish rearing in downstream locations generally completing ocean ward migrations earlier in life than fish rearing in upstream locations. The morphological differences that were apparent between autumn migrants and yearling smolts were similar to differences between parr rearing in downstream and upstream reaches, indicating that body morphology is correlated with life-history tactics. Autumn migrants and parr from downstream sampling sites had deeper bodies, shorter heads and deeper caudal peduncles compared with yearling smolts and parr from the upstream sampling site. This study did not distinguish between genetic and environmental effects on morphology; however, the results suggest that downstream movement of juveniles soon after emergence is associated with differentiation in morphology and with the expression of life-history variation.

  13. Seasonal variation of benthic macro invertebrates from Tons River of Garhwal Himalaya Uttarakhand.

    PubMed

    Negi, R K; Mamgain, Sheetal

    2013-11-15

    Present investigation was carried out to assess the seasonal variation of benthic macro-invertebrates from the Tons river, a tributary of Yamuna River in Garhwal Himalaya, Uttrakhand during December, 2007 to November, 2009. The seasonal benthic diversity was correlated with various physic-chemical parameters which documented that the macrobenthic diversity is mostly regulated by the dissolved oxygen in the water while temperature and free CO2 were found to be inversely correlated with the benthic fauna. Maximum diversity of benthos was reported at the upstream site ('H' 0.204) during the winter season while it was recorded minimum during the rainy season at all the sites. Maximum diversity is reported during the winter season at all the sites. The benthic fauna is represented by three phylum, 4 classes and 10 orders with Insecta emerging as the most dominant class. Maximum genera were reported from midstream site as it acts as ecotone between upstream and downstream.

  14. Antigen-specific histamine release in dogs with food hypersensitivity.

    PubMed

    Ishida, Rinei; Masuda, Kenichi; Sakaguchi, Masahiro; Kurata, Keigo; Ohno, Koichi; Tsujimoto, Hajime

    2003-03-01

    An in vitro evidence of IgE-mediated hypersensitivity to food allergens was detected by positive results of antigen-specific histamine release in dogs with food hypersensitivity. Eight dogs were diagnosed to have food hypersensitivity based on identification of offending food allergens with food elimination followed by oral food provocation. The percentages of histamine release against the stimulation of offending food allergens in the cases ranged from 2.1% to 70.9%. Six of the 8 cases showed histamine release higher than those of healthy control dogs. Four dogs showed relatively high histamine release at the percentage beyond 10% that was compatible with a positive value of histamine release in humans with food hypersensitivity. These findings would suggest that IgE-mediated hypersensitivity against food allergens could be involved in canine food hypersensitivity.

  15. Terrestrial Contributions to the Aquatic Food Web in the Middle Yangtze River

    PubMed Central

    Wang, Jianzhu; Gu, Binhe; Huang, Jianhui; Han, Xingguo; Lin, Guanghui; Zheng, Fawen; Li, Yuncong

    2014-01-01

    Understanding the carbon sources supporting aquatic consumers in large rivers is essential for the protection of ecological integrity and for wildlife management. The relative importance of terrestrial and algal carbon to the aquatic food webs is still under intensive debate. The Yangtze River is the largest river in China and the third longest river in the world. The completion of the Three Gorges Dam (TGD) in 2003 has significantly altered the hydrological regime of the middle Yangtze River, but its immediate impact on carbon sources supporting the river food web is unknown. In this study, potential production sources from riparian and the main river channel, and selected aquatic consumers (invertebrates and fish) at an upstream constricted-channel site (Luoqi), a midstream estuarine site (Huanghua) and a near dam limnetic site (Maoping) of the TGD were collected for stable isotope (δ13C and δ15N) and IsoSource analyses. Model estimates indicated that terrestrial plants were the dominant carbon sources supporting the consumer taxa at the three study sites. Algal production appeared to play a supplemental role in supporting consumer production. The contribution from C4 plants was more important than that of C3 plants at the upstream site while C3 plants were the more important carbon source to the consumers at the two impacted sites (Huanghua and Maoping), particularly at the midstream site. There was no trend of increase in the contribution of autochthonous production from the upstream to the downstream sites as the flow rate decreased dramatically along the main river channel due to the construction of TGD. Our findings, along with recent studies in rivers and lakes, are contradictory to studies that demonstrate the importance of algal carbon in the aquatic food web. Differences in system geomorphology, hydrology, habitat heterogeneity, and land use may account for these contradictory findings reported in various studies. PMID:25047656

  16. Terrestrial contributions to the aquatic food web in the middle Yangtze River.

    PubMed

    Wang, Jianzhu; Gu, Binhe; Huang, Jianhui; Han, Xingguo; Lin, Guanghui; Zheng, Fawen; Li, Yuncong

    2014-01-01

    Understanding the carbon sources supporting aquatic consumers in large rivers is essential for the protection of ecological integrity and for wildlife management. The relative importance of terrestrial and algal carbon to the aquatic food webs is still under intensive debate. The Yangtze River is the largest river in China and the third longest river in the world. The completion of the Three Gorges Dam (TGD) in 2003 has significantly altered the hydrological regime of the middle Yangtze River, but its immediate impact on carbon sources supporting the river food web is unknown. In this study, potential production sources from riparian and the main river channel, and selected aquatic consumers (invertebrates and fish) at an upstream constricted-channel site (Luoqi), a midstream estuarine site (Huanghua) and a near dam limnetic site (Maoping) of the TGD were collected for stable isotope (δ13C and δ15N) and IsoSource analyses. Model estimates indicated that terrestrial plants were the dominant carbon sources supporting the consumer taxa at the three study sites. Algal production appeared to play a supplemental role in supporting consumer production. The contribution from C4 plants was more important than that of C3 plants at the upstream site while C3 plants were the more important carbon source to the consumers at the two impacted sites (Huanghua and Maoping), particularly at the midstream site. There was no trend of increase in the contribution of autochthonous production from the upstream to the downstream sites as the flow rate decreased dramatically along the main river channel due to the construction of TGD. Our findings, along with recent studies in rivers and lakes, are contradictory to studies that demonstrate the importance of algal carbon in the aquatic food web. Differences in system geomorphology, hydrology, habitat heterogeneity, and land use may account for these contradictory findings reported in various studies.

  17. Spawning migration movements of Lost River and shortnose suckers in the Williamson and Sprague Rivers, Oregon, following the removal of Chiloquin Dam-2009 Annual Report

    USGS Publications Warehouse

    Ellsworth, Craig M.; VanderKooi, Scott P.

    2011-01-01

    The Chiloquin Dam was located at river kilometer (rkm) 1.3 on the Sprague River near the town of Chiloquin, Oregon. The dam was identified as a barrier that potentially inhibited or prevented the upstream spawning migrations and other movements of endangered Lost River suckers (Deltistes luxatus), shortnose suckers (Chasmistes brevirostris), and other fish in the Sprague River. Our research objectives in 2009 were to evaluate adult catostomid spawning migration patterns using radio telemetry to identify and describe shifts in spawning area distribution and migration behavior following the removal of Chiloquin Dam in 2008. We attached external radio transmitters to 58 Lost River suckers and 59 shortnose suckers captured at the Williamson River fish weir. A total of 17 radio-tagged Lost River suckers and one radio-tagged shortnose sucker were detected approaching the site of the former Chiloquin Dam but only two radio-tagged fish (one male Lost River sucker and one female Lost River sucker) were detected crossing upstream of the dam site. A lower proportion of radio-tagged shortnose suckers were detected migrating into the Sprague River when compared with previous years. Detections on remote passive integrated transponder (PIT) tag arrays located in the Sprague River show that although the proportion of fish coming into the Sprague River is small when compared to the number of fish crossing the Williamson River fish weir, the number of fish migrating upstream of the Chiloquin Dam site increased exponentially in the first year since its removal. These data will be used in conjunction with larval production and adult spawning distribution data to evaluate the effectiveness of dam removal in order to provide increased access to underutilized spawning habitat located further upstream in the Sprague River and to reduce the crowding of spawning fish below the dam site.

  18. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

  19. Cardiac Iodine-123-Meta-Iodo-Benzylguanidine Uptake in Carotid Sinus Hypersensitivity

    PubMed Central

    Tan, Maw Pin; Murray, Alan; Hawkins, Terry; Chadwick, Thomas J.; Kerr, Simon R. J.; Parry, Steve W.

    2015-01-01

    Background Carotid sinus syndrome is the association of carotid sinus hypersensitivity with syncope, unexplained falls and drop attacks in generally older people. We evaluated cardiac sympathetic innervation in this disorder in individuals with carotid sinus syndrome, asymptomatic carotid sinus hypersensitivity and controls without carotid sinus hypersensitivity. Methods Consecutive patients diagnosed with carotid sinus syndrome at a specialist falls and syncope unit were recruited. Asymptomatic carotid sinus hypersensitivity and non-carotid sinus hypersensitivity control participants recruited from a community-dwelling cohort. Cardiac sympathetic innervation was determined using Iodine-123-metaiodobenzylguanidine (123-I-MIBG) scanning. Heart to mediastinal uptake ratio (H:M) were determined for early and late uptake on planar scintigraphy at 20 minutes and 3 hours following intravenous injection of 123-I-MIBG. Results Forty-two subjects: carotid sinus syndrome (n = 21), asymptomatic carotid sinus hypersensitivity (n = 12) and no carotid sinus hypersensitivity (n = 9) were included. Compared to the non- carotid sinus hypersensitivity control group, the carotid sinus syndrome group had significantly higher early H:M (estimated mean difference, B = 0.40; 95% confidence interval, CI = 0.13 to 0.67, p = 0.005) and late H:M (B = 0.32; 95%CI = 0.03 to 0.62, p = 0.032). There was, however, no significant difference in early H:M (p = 0.326) or late H:M (p = 0.351) between the asymptomatic carotid sinus hypersensitivity group and non- carotid sinus hypersensitivity controls. Conclusions Cardiac sympathetic neuronal activity is increased relative to age-matched controls in individuals with carotid sinus syndrome but not those with asymptomatic carotid sinus hypersensitivity. Blood pressure and heart rate measurements alone may therefore represent an over simplification in the assessment for carotid sinus syndrome and the relative increase in cardiac sympathetic innervation provides additional clues to understanding the mechanisms behind the symptomatic presentation of carotid sinus hypersensitivity. PMID:26057525

  20. [Hypersensitivity reaction to radio contrast media: diagnosis, prevention and treatment].

    PubMed

    Mahlab-Guri, Keren; Herskovitz, Pearl; Sthoeger, Zev

    2012-07-01

    More than 70 million radiographic examinations with radio contrast media are performed worldwide each year. The incidence of adverse reactions to radio contrast media is 5-13%. Adverse reactions include hypersensitivity reactions, chemotoxic reactions and renal toxicity. Hypersensitivity reactions to radio contrast media range from mild pruritus to life-threatening emergency. The differential diagnosis between hypersensitivity reaction to radio contrast media and chemotoxic reaction is challenging. The incidence of chemotoxic reactions is mainly affected by the chemical structure of the radio contrast media and the rate of infusion. The incidence of hypersensitivity radio contrast media reaction is affected by age and by the presence of asthma and other atopic diseases. The diagnosis of hypersensitivity reaction to radio contrast media is based on clinical manifestations. The additional value of laboratory tests is limited and questionable. In case of hypersensitivity radio contrast reaction, the infusion should be stopped immediately, airways should be protected and fluids, oxygen and drugs should be given. Prophylactic treatment before its administration may prevent hypersensitivity reactions to radio contrast media.

  1. The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

    PubMed

    Jiang, Jiming

    2015-04-01

    Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Genome-wide DNase hypersensitivity, and occupancy of RUNX2 and CTCF reveal a highly dynamic gene regulome during MC3T3 pre-osteoblast differentiation.

    PubMed

    Tai, Phillip W L; Wu, Hai; van Wijnen, André J; Stein, Gary S; Stein, Janet L; Lian, Jane B

    2017-01-01

    The ability to discover regulatory sequences that control bone-related genes during development has been greatly improved by massively parallel sequencing methodologies. To expand our understanding of cis-regulatory regions critical to the control of gene expression during osteoblastogenesis, we probed the presence of open chromatin states across the osteoblast genome using global DNase hypersensitivity (DHS) mapping. Our profiling of MC3T3 mouse pre-osteoblasts during differentiation has identified more than 224,000 unique DHS sites. Approximately 65% of these sites are dynamic during temporal stages of osteoblastogenesis, and a majority of them are located within non-promoter (intergenic and intronic) regions. Nearly half of all DHS sites (both constitutive and dynamic) overlap binding events of the bone-essential RUNX2 and/or the chromatin-related CTCF transcription factors. This finding reinforces the role of these regulatory proteins as essential components of the bone gene regulome. We observe a reduction in chromatin accessibility throughout the genome between pre-osteoblast and early osteoblasts. Our analysis also defined a class of differentially expressed genes that harbor DHS peaks centered within 1 kb downstream of transcriptional end sites (TES). These DHSs at the 3'-flanks of genes exhibit dynamic changes during differentiation that may impact regulation of the osteoblast genome. Taken together, the distribution of DHS regions within non-promoter locations harboring osteoblast and chromatin related transcription factor binding motifs, reflect novel cis-regulatory requirements to support temporal gene expression in differentiating osteoblasts.

  3. Electromobility Shift Assay Reveals Evidence in Favor of Allele-Specific Binding of RUNX1 to the 5' Hypersensitive Site 4-Locus Control Region.

    PubMed

    Dehghani, Hossein; Ghobakhloo, Sepideh; Neishabury, Maryam

    2016-08-01

    In our previous studies on the Iranian β-thalassemia (β-thal) patients, we identified an association between the severity of the β-thal phenotype and the polymorphic palindromic site at the 5' hypersensitive site 4-locus control region (5'HS4-LCR) of the β-globin gene cluster. Furthermore, a linkage disequilibrium was observed between this region and XmnI-HBG2 in the patient population. Based on this data, it was suggested that the well-recognized phenotype-ameliorating role assigned to positive XmnI could be associated with its linked elements in the LCR. To investigate the functional significance of polymorphisms at the 5'HS4-LCR, we studied its influence on binding of transcription factors. Web-based predictions of transcription factor binding revealed a binding site for runt-related transcription factor 1 (RUNX1), when the allele at the center of the palindrome (TGGGG(A/G)CCCCA) was A but not when it was G. Furthermore, electromobility shift assay (EMSA) presented evidence in support of allele-specific binding of RUNX1 to 5'HS4. Considering that RUNX1 is a well-known regulator of hematopoiesis, these preliminary data suggest the importance of further studies to confirm this interaction and consequently investigate its functional and phenotypical relevance. These studies could help us to understand the molecular mechanism behind the phenotype modifying role of the 5'HS4-LCR polymorphic palindromic region (rs16912979), which has been observed in previous studies.

  4. Pyruvate Dehydrogenase Kinase-mediated Glycolytic Metabolic Shift in the Dorsal Root Ganglion Drives Painful Diabetic Neuropathy*

    PubMed Central

    Rahman, Md Habibur; Jha, Mithilesh Kumar; Kim, Jong-Heon; Nam, Youngpyo; Lee, Maan Gee; Go, Younghoon; Harris, Robert A.; Park, Dong Ho; Kook, Hyun; Lee, In-Kyu; Suk, Kyoungho

    2016-01-01

    The dorsal root ganglion (DRG) is a highly vulnerable site in diabetic neuropathy. Under diabetic conditions, the DRG is subjected to tissue ischemia or lower ambient oxygen tension that leads to aberrant metabolic functions. Metabolic dysfunctions have been documented to play a crucial role in the pathogenesis of diverse pain hypersensitivities. However, the contribution of diabetes-induced metabolic dysfunctions in the DRG to the pathogenesis of painful diabetic neuropathy remains ill-explored. In this study, we report that pyruvate dehydrogenase kinases (PDK2 and PDK4), key regulatory enzymes in glucose metabolism, mediate glycolytic metabolic shift in the DRG leading to painful diabetic neuropathy. Streptozotocin-induced diabetes substantially enhanced the expression and activity of the PDKs in the DRG, and the genetic ablation of Pdk2 and Pdk4 attenuated the hyperglycemia-induced pain hypersensitivity. Mechanistically, Pdk2/4 deficiency inhibited the diabetes-induced lactate surge, expression of pain-related ion channels, activation of satellite glial cells, and infiltration of macrophages in the DRG, in addition to reducing central sensitization and neuroinflammation hallmarks in the spinal cord, which probably accounts for the attenuated pain hypersensitivity. Pdk2/4-deficient mice were partly resistant to the diabetes-induced loss of peripheral nerve structure and function. Furthermore, in the experiments using DRG neuron cultures, lactic acid treatment enhanced the expression of the ion channels and compromised cell viability. Finally, the pharmacological inhibition of DRG PDKs or lactic acid production substantially attenuated diabetes-induced pain hypersensitivity. Taken together, PDK2/4 induction and the subsequent lactate surge induce the metabolic shift in the diabetic DRG, thereby contributing to the pathogenesis of painful diabetic neuropathy. PMID:26769971

  5. Northeastern Florida Bay estuarine creek data, water years 1996-2000

    USGS Publications Warehouse

    Hittle, Clinton D.; Zucker, Mark A.

    2004-01-01

    From October 1995 to September 2000 (water years 1996-2000), continuous 15-minute stage, water velocity, salinity, and water temperature data were collected at seven estuarine creeks that flow into northeastern Florida Bay. These creeks include West Highway Creek, Stillwater Creek, Trout Creek, Mud Creek, Taylor River, Upstream Taylor River, and McCormick Creek. Discharge was computed at 15-minute intervals using mean water velocity and the cross-sectional area of the channel. Fifteen-minute unit values are presented for comparison of the quantity, quality, timing, and distribution of flows through the creeks. Revised discharge estimation formulas are presented for three noninstrumented sites (East Highway Creek, Oregon Creek and Stillwater Creek) that utilize an improved West Highway discharge rating. Stillwater Creek and Upstream Taylor River were originally noninstrumented sites; both were fully instrumented in 1999. Discharge rating equations are presented for these sites and were developed using a simple linear regression.

  6. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

  7. Environmental effects of the Big Rapids dam remnant removal, Big Rapids, Michigan, 2000-02

    USGS Publications Warehouse

    Healy, Denis F.; Rheaume, Stephen J.; Simpson, J. Alan

    2003-01-01

    The U.S. Geological Survey (USGS), in cooperation with the city of Big Rapids, investigated the environmental effects of removal of a dam-foundation remnant and downstream cofferdam from the Muskegon River in Big Rapids, Mich. The USGS applied a multidiscipline approach, which determined the water quality, sediment character, and stream habitat before and after dam removal. Continuous water-quality data and discrete water-quality samples were collected, the movement of suspended and bed sediment were measured, changes in stream habitat were assessed, and streambed elevations were surveyed. Analyses of water upstream and downstream from the dam showed that the dam-foundation remnant did not affect water quality. Dissolved-oxygen concentrations downstream from the dam remnant were depressed for a short period (days) during the beginning of the dam removal, in part because of that removal effort. Sediment transport from July 2000 through March 2002 was 13,800 cubic yards more at the downstream site than the upstream site. This increase in sediment represents the remobilized sediment upstream from the dam, bank erosion when the impoundment was lowered, and contributions from small tributaries between the sites. Five habitat reaches were monitored before and after dam-remnant removal. The reaches consisted of a reference reach (A), upstream from the effects of the impoundment; the impoundment (B); and three sites below the impoundment where habitat changes were expected (C, D, and E, in downstream order). Stream-habitat assessment reaches varied in their responses to the dam-remnant removal. Reference reach A was not affected. In impoundment reach B, Great Lakes and Environmental Assessment Section (GLEAS) Procedure 51 ratings went from fair to excellent. For the three downstream reaches, reach C underwent slight habitat degradation, but ratings remained good; reach D underwent slight habitat degradation with ratings changing from excellent to good; and, in an area affected by a 1966 sediment release, reach E habitat rated fair in April 2000 and remained fair in September 2001. The most noticeable habitat change in the three reaches downstream from the dam site was a measurable increase in siltation and embeddedness. Bed-elevation profiles show that bed material upstream from the dam site was remobilized as suspended sediment and bedload, and was redeposited in the reaches below the cofferdam. Deposition was greater in the deep, slow-moving pools than the shallow, fast-moving riffles. For the most part, where deposition took place, deposits were less than 1 foot in thickness. In the year following the removal of the cofferdam, much of the sediment deposited below the dam was moved out of the study reach.

  8. New insights into visceral hypersensitivity —clinical implications in IBS

    PubMed Central

    Zhou, QiQi; Verne, G. Nicholas

    2012-01-01

    A subset of patients with IBS have visceral hypersensitivity and/or somatic hypersensitivity. Visceral hypersensitivity might have use as a clinical marker of IBS and could account for symptoms of urgency for bowel movements, bloating and abdominal pain. The mechanisms that lead to chronic visceral hypersensitivity in patients who have IBS are unclear. However, several working models may be considered, including: nociceptive input from the colon that leads to hypersensitivity; increased intestinal permeability that induces a visceral nociceptive drive; and alterations in the expression of microRNAs in gastrointestinal tissue that might be delivered via blood microvesicles to other target organs, such as the peripheral and/or central nervous system. As such, the chronic visceral hypersensitivity that is present in a subset of patients with IBS might be maintained by both peripheral and central phenomena. The theories underlying the development of chronic visceral hypersensitivity in patients with IBS are supported by findings from new animal models in which hypersensitivity follows transient inflammation of the colon. The presence of somatic hypersensitivity and an alteration in the neuroendocrine system in some patients who have IBS suggests that multisystemic factors are involved in the overall disorder. Thus, IBS is similar to other chronic pain disorders, such as fibromyalgia, chronic regional pain disorder and temporomandibular joint disorder, as chronic nociceptive mechanisms are activated in all of these disorders. PMID:21643039

  9. Disruption of the Fanconi anemia-BRCA pathway in cisplatin-sensitive ovarian tumors.

    PubMed

    Taniguchi, Toshiyasu; Tischkowitz, Marc; Ameziane, Najim; Hodgson, Shirley V; Mathew, Christopher G; Joenje, Hans; Mok, Samuel C; D'Andrea, Alan D

    2003-05-01

    Ovarian tumor cells are often genomically unstable and hypersensitive to cisplatin. To understand the molecular basis for this phenotype, we examined the integrity of the Fanconi anemia-BRCA (FANC-BRCA) pathway in those cells. This pathway regulates cisplatin sensitivity and is governed by the coordinate activity of six genes associated with Fanconi anemia (FANCA, FANCC, FANCD2, FANCE, FANCF and FANCG) as well as BRCA1 and BRCA2 (FANCD1). Here we show that the FANC-BRCA pathway is disrupted in a subset of ovarian tumor lines. Mono-ubiquitination of FANCD2, a measure of the function of this pathway, and cisplatin resistance were restored by functional complementation with FANCF, a gene that is upstream in this pathway. FANCF inactivation in ovarian tumors resulted from methylation of its CpG island, and acquired cisplatin resistance correlated with demethylation of FANCF. We propose a model for ovarian tumor progression in which the initial methylation of FANCF is followed by FANCF demethylation and ultimately results in cisplatin resistance.

  10. Cryptosporidium source tracking in the Potomac River watershed - MCEARD

    EPA Science Inventory

    To better characterize Cryptosporidium in the Potomac River watershed, a PCR-based genotyping tool was used to analyze 64 base-flow and 28 storm-flow samples from five sites within the watershed. These sites included two water treatment plant intakes as well as three upstream si...

  11. Effects of backpacker use, pack stock trail use, and pack stock grazing on water-quality indicators, including nutrients, E. coli, hormones, and pharmaceuticals, in Yosemite National Park, USA

    USGS Publications Warehouse

    Forrester, Harrison; Clow, David W.; Roche, James W.; Heyvaert, Alan C.; Battaglin, William A.

    2017-01-01

    We investigated how visitor-use affects water quality in wilderness in Yosemite National Park. During the summers of 2012–2014, we collected and analyzed surface-water samples for water-quality indicators, including fecal indicator bacteria Escherichia coli, nutrients (nitrogen, phosphorus, carbon), suspended sediment concentration, pharmaceuticals, and hormones. Samples were collected upstream and downstream from different types of visitor use at weekly to biweekly intervals and during summer storms. We conducted a park-wide synoptic sampling campaign during summer 2014, and sampled upstream and downstream from meadows to evaluate the mitigating effect of meadows on water quality. At pack stock stream crossings, Escherichia coli concentrations were greater downstream from crossings than upstream (median downstream increase in Escherichia coli of three colony forming units 100 mL−1), with the greatest increases occurring during storms (median downstream increase in Escherichia coli of 32 CFU 100 mL−1). At backpacker use sites, hormones, and pharmaceuticals (e.g., insect repellent) were detected at downstream sites, and Escherichia coli concentrations were greater at downstream sites (median downstream increase in Escherichia coli of 1 CFU 100 mL−1). Differences in water quality downstream vs. upstream from meadows grazed by pack stock were not detectable for most water-quality indicators, however, Escherichia coli concentrations decreased downstream, suggesting entrapment and die-off of fecal indicator bacteria in meadows. Our results indicate that under current-use levels pack stock trail use and backpacker use are associated with detectable, but relatively minor, effects on water quality, which are most pronounced during storms.

  12. Effects of Backpacker Use, Pack Stock Trail Use, and Pack Stock Grazing on Water-Quality Indicators, Including Nutrients, E. coli, Hormones, and Pharmaceuticals, in Yosemite National Park, USA

    NASA Astrophysics Data System (ADS)

    Forrester, Harrison; Clow, David; Roche, James; Heyvaert, Alan; Battaglin, William

    2017-09-01

    We investigated how visitor-use affects water quality in wilderness in Yosemite National Park. During the summers of 2012-2014, we collected and analyzed surface-water samples for water-quality indicators, including fecal indicator bacteria Escherichia coli, nutrients (nitrogen, phosphorus, carbon), suspended sediment concentration, pharmaceuticals, and hormones. Samples were collected upstream and downstream from different types of visitor use at weekly to biweekly intervals and during summer storms. We conducted a park-wide synoptic sampling campaign during summer 2014, and sampled upstream and downstream from meadows to evaluate the mitigating effect of meadows on water quality. At pack stock stream crossings, Escherichia coli concentrations were greater downstream from crossings than upstream (median downstream increase in Escherichia coli of three colony forming units 100 mL-1), with the greatest increases occurring during storms (median downstream increase in Escherichia coli of 32 CFU 100 mL-1). At backpacker use sites, hormones, and pharmaceuticals (e.g., insect repellent) were detected at downstream sites, and Escherichia coli concentrations were greater at downstream sites (median downstream increase in Escherichia coli of 1 CFU 100 mL-1). Differences in water quality downstream vs. upstream from meadows grazed by pack stock were not detectable for most water-quality indicators, however, Escherichia coli concentrations decreased downstream, suggesting entrapment and die-off of fecal indicator bacteria in meadows. Our results indicate that under current-use levels pack stock trail use and backpacker use are associated with detectable, but relatively minor, effects on water quality, which are most pronounced during storms.

  13. [Spatial distribution characteristics of the physical and chemical properties of water in the Kunes River after the supply of snowmelt during spring].

    PubMed

    Liu, Xiang; Guo, Ling-Peng; Zhang, Fei-Yun; Ma, Jie; Mu, Shu-Yong; Zhao, Xin; Li, Lan-Hai

    2015-02-01

    Eight physical and chemical indicators related to water quality were monitored from nineteen sampling sites along the Kunes River at the end of snowmelt season in spring. To investigate the spatial distribution characteristics of water physical and chemical properties, cluster analysis (CA), discriminant analysis (DA) and principal component analysis (PCA) are employed. The result of cluster analysis showed that the Kunes River could be divided into three reaches according to the similarities of water physical and chemical properties among sampling sites, representing the upstream, midstream and downstream of the river, respectively; The result of discriminant analysis demonstrated that the reliability of such a classification was high, and DO, Cl- and BOD5 were the significant indexes leading to this classification; Three principal components were extracted on the basis of the principal component analysis, in which accumulative variance contribution could reach 86.90%. The result of principal component analysis also indicated that water physical and chemical properties were mostly affected by EC, ORP, NO3(-) -N, NH4(+) -N, Cl- and BOD5. The sorted results of principal component scores in each sampling sites showed that the water quality was mainly influenced by DO in upstream, by pH in midstream, and by the rest of indicators in downstream. The order of comprehensive scores for principal components revealed that the water quality degraded from the upstream to downstream, i.e., the upstream had the best water quality, followed by the midstream, while the water quality at downstream was the worst. This result corresponded exactly to the three reaches classified using cluster analysis. Anthropogenic activity and the accumulation of pollutants along the river were probably the main reasons leading to this spatial difference.

  14. Concentrations and ratios of Sr, Ba and Ca along an estuarine river to the Gulf of Mexico - implication for sea level rise effects on trace metal distribution

    NASA Astrophysics Data System (ADS)

    He, S.; Xu, Y. J.

    2015-11-01

    Strontium and barium to calcium ratios are often used as proxies for tracking animal movement across salinity gradients. As sea level rise continues, many estuarine rivers in the world face saltwater intrusion, which may cause changes in mobility and distribution of these metals upstream. Despite intensive research on metal adsorption and desorption in marine systems, knowledge of the spatiotemporal distribution of these elements along estuarine rivers is still limited. In this study, we conducted an intensive monitoring of Sr and Ba dynamics along an 88 km long estuary, the Calcasieu River in South Louisiana, USA, which has been strongly affected by saltwater intrusion. Over the period from May 2013 to August 2015, we collected monthly water samples and performed in-situ water quality measurements at six sites from the upstream to the river mouth, with a salinity range from 0.02 to 29.50 ppt. Water samples were analyzed for Sr, Ba, and Ca concentrations. In-situ measurements were made on salinity, pH, water temperature, dissolved oxygen concentration, and specific conductance. We found that the Sr and Ca concentrations and the Sr / Ca ratio all increased significantly with increasing salinity. The average Sr concentration at the site closest to the Gulf of Mexico (site 6) was 46.21 μmol L-1, which was about 130 times higher than that of the site furthest upstream (site 1, 0.35 μmol L-1). The average Ca concentration at site 6 was 8.19 mmol L-1, which was about 60 times higher than that of site 1 (0.13 mmol L-1). The average Sr / Ca ratio at site 6 (8.41 mmol mol-1) was about 3 times the average Sr / Ca ratio at site 1 (2.89 mmol mol-1). However, the spatial variation in Ba concentration was marginal, varying from 0.36 μmol L-1 at site 6 to 0.47 at site 5. The average Ba / Ca ratio at site 1 (4.82 mmol mol-1) was about 54 times the average Ba / Ca ratio at site 6 (0.09 mmol mol-1), showing a clear negative relation between the Ba / Ca ratio and increasing salinity. All the elemental concentrations and ratios had considerable seasonal variations, with significant differences among sampling months for the Sr, Ba concentrations and the Ba / Ca ratio (p < 0.01). The results from this study suggest that concentrations of Sr and Ca in the world's estuaries will very likely increase in the future as sea level rise continues. For low-gradient estuarine rivers such as the Calcasieu River in South Louisiana, USA, water chemistry upstream would experience substantial Sr and Ca enrichment, which could affect aquatic environments and biological communities.

  15. Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

    PubMed Central

    Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

    1984-01-01

    Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

  16. Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

    NASA Astrophysics Data System (ADS)

    Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

    1994-07-01

    We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

  17. Occurrence of organic wastewater compounds in drinking water, wastewater effluent, and the Big Sioux River in or near Sioux Falls, South Dakota, 2001-2004

    USGS Publications Warehouse

    Sando, Steven K.; Furlong, Edward T.; Gray, James L.; Meyer, Michael T.

    2006-01-01

    The U.S. Geological Survey (USGS) in cooperation with the city of Sioux Falls conducted several rounds of sampling to determine the occurrence of organic wastewater compounds (OWCs) in the city of Sioux Falls drinking water and waste-water effluent, and the Big Sioux River in or near Sioux Falls during August 2001 through May 2004. Water samples were collected during both base-flow and storm-runoff conditions. Water samples were collected at 8 sites, which included 4 sites upstream from the wastewater treatment plant (WWTP) discharge, 2 sites downstream from the WWTP discharge, 1 finished drinking-water site, and 1 WWTP effluent (WWE) site. A total of 125 different OWCs were analyzed for in this study using five different analytical methods. Analyses for OWCs were performed at USGS laboratories that are developing and/or refining small-concentration (less than 1 microgram per liter (ug/L)) analytical methods. The OWCs were classified into six compound classes: human pharmaceutical compounds (HPCs); human and veterinary antibiotic compounds (HVACs); major agricultural herbicides (MAHs); household, industrial,and minor agricultural compounds (HIACs); polyaromatic hydrocarbons (PAHs); and sterol compounds (SCs). Some of the compounds in the HPC, MAH, HIAC, and PAH classes are suspected of being endocrine-disrupting compounds (EDCs). Of the 125 different OWCs analyzed for in this study, 81 OWCs had one or more detections in environmental samples reported by the laboratories, and of those 81 OWCs, 63 had acceptable analytical method performance, were detected at concentrations greater than the study reporting levels, and were included in analyses and discussion related to occurrence of OWCs in drinking water, wastewater effluent, and the Big Sioux River. OWCs in all compound classes were detected in water samples from sampling sites in the Sioux Falls area. For the five sampling periods when samples were collected from the Sioux Falls finished drinking water, only one OWC was detected at a concentration greater than the study reporting level (metolachlor; 0.0040 ug/L). During base-flow conditions, Big Sioux River sites upstream from the WWTP discharge had OWC contributions that primarily were from nonpoint animal or crop agriculture sources or had OWC concentrations that were minimal. The influence of the WWTP discharge on OWCs at downstream river sites during base-flow conditions ranged from minimal influence to substantial influence depending on the sampling period. During runoff conditions, OWCs at sites upstream from the WWTP discharge probably were primarily contributed by nonpoint animal and/or crop agriculture sources and possibly by stormwater runoff from nearby roads. OWCs at sites downstream from the WWTP discharge probably were contributed by sources other than the WWTP effluent discharge, such as stormwater runoff from urban and/or agriculture areas and/or resuspension of OWCs adsorbed to sediment deposited in the Big Sioux River. OWC loads generally were substantially smaller for upstream sites than downstream sites during both base-flow and runoff conditions.discharge had OWC contributions that primarily were from nonpoint animal or crop agriculture sources or had OWC concentrations that were minimal. The influence of the WWTP discharge on OWCs at downstream river sites during base-flow conditions ranged from minimal influence to substantial influence depending on the sampling period. During runoff conditions, OWCs at sites upstream from the WWTP discharge probably were primarily contributed by nonpoint animal and/or crop agriculture sources and possibly by stormwater runoff from nearby roads. OWCs at sites downstream from the WWTP discharge probably were contributed by sources other than the WWTP effluent discharge, such as stormwater runoff from urban and/or agriculture areas and/or resuspension of OWCs adsorbed to sediment deposited in the Big Sioux River. OWC loads generally were substantially smaller for

  18. HLA- B*5701 Allele in HIV-infected Indian Children and its Association with Abacavir Hypersensitivity.

    PubMed

    Manglani, Mamta V; Gabhale, Yashwant R; Lala, Mamatha M; Sekhar, Rohini; More, Dipti

    2018-02-15

    To determine the prevalence of HLA-B*5701 allele in HIV-infected children, and to find its association with Abacavir hypersensitivity. Children (2 to 18 y) already on, or to be initiated on Abacavir were included for PCR sequencing to detect HLA-B*5701. proportion with HLA B*5701 allele and hypersensitivity with Abacavir. Abacavir was stopped if patient tested positive for HLA-B*5701 allele. 100 children (median age 11 y) were enrolled; 10 were already on Abacavir. HLA-B*5701 positivity was observed in 11 (11%) children. Two of these 11 children developed hypersensitivity after initiation of Abacavir. Abacavir was thereafter stopped in all who tested HLA-B*5701 positive, irrespective of the development of hypersensitivity reaction. HLA-B*5701 allele was present in 11 (11%) of HIV-infected children, of which two developed Abacavir hypersensitivity. None of the patients without the allele developed hypersensitivity.

  19. Proceedings of a workshop on American Eel passage technologies

    USGS Publications Warehouse

    Haro, Alexander J.

    2013-01-01

    Recent concerns regarding a decline in recruitment of American eels (Anguilla rostrata) have prompted efforts to restore this species to historic habitats by providing passage for both upstream migrant juveniles and downstream migrant adults at riverine barriers, including low-head and hydroelectric dams (Castonguay et al. 1994, Haro et al. 2000). These efforts include development of management plans and stock assessment reviews in both the US and Canada (COSEWIC 2006, Canadian Eel Working Group 2009, DFO 2010, MacGregor et al. 2010, ASMFC 2000, ASMFC 2006, ASMFC 2008, Williams and Threader 2007), which target improvement of upstream and downstream passage for eels, as well as identification and prioritization of research needs for development of new and more effective passage technologies for American eels. Traditional upstream fish passage structures, such as fishways and fish lifts, are often ineffective passing juvenile eels, and specialized passage structures for this species are needed. Although designs for such passage structures are available and diverse (Knights and White 1998, Porcher 2002, FAO/DVWK 2002, Solomon and Beach 2004a,b, Environment Agency UK 2011), many biologists, managers, and engineers are unfamiliar with eel pass design and operation, or unaware of the technical options available for upstream eel passage, Better coordination is needed to account for eel passage requirements during restoration efforts for other diadromous fish species. Also, appropriately siting eel passes at hydropower projects is critical, and siting can be difficult and complex due to physical restrictions in access to points of natural concentrations of eels, dynamic hydraulics of tailrace areas, and presence of significant competing flows from turbine outfalls or spill. As a result, some constructed eel passes are sited poorly and may pass only a fraction of the number of eels attempting to pass the barrier. When sited and constructed appropriately, however, eel passes can effectively pass thousands of individuals in a season (Appendix D). technologies for preventing impingement and entrainment mortality and injury of downstream migrant eels at hydropower projects are not well developed. Traditional downstream fish passage mitigative techniques originally developed for salmonids and other species are frequently ineffective passing eels (Richkus and Dixon 2003, EPRI 2001, Bruijs and Durif 2009). Large hydropower projects, with high project flows or intake openings that cannot be fitted with racks or screens with openings small enough to exclude eels, pose significant passage problems for this species, and turbine impingement and entrainment mortality of eels can be as high as 100%. Spill mortality and injury may also be significant for eels, given their tendency to move during high flow events when projects typically spill large amounts of flow. Delays in migration of eels that have difficulty locating and utilizing bypass entrances can also be significant. Therefore, downstream passage technologies are at a much more nebulous state of development than upstream passage technologies, and require further evaluation and improvement before rigorous design guidelines can be established. There have been few studies conducted to evaluate effectiveness of current mitigative measures for both upstream and downstream passage of eels. Research is needed to determine eel migratory timing, behavior, and appropriate mitigation technologies for specific sites and eel life history stages. Both upstream and downstream eel passage structures can be difficult to evaluate in terms of performance, and examples of how evaluation and monitoring can be accomplished were reviewed at the workshop.

  20. Biological and chemical characterization of metal bioavailability in sediments from Lake Roosevelt, Columbia River, Washington, USA

    USGS Publications Warehouse

    Besser, J.M.; Brumbaugh, W.G.; Ivey, C.D.; Ingersoll, C.G.; Moran, P.W.

    2008-01-01

    We studied the bioavailability and toxicity of copper, zinc, arsenic, cadmium, and lead in sediments from Lake Roosevelt (LR), a reservoir on the Columbia River in Washington, USA that receives inputs of metals from an upstream smelter facility. We characterized chronic sediment toxicity, metal bioaccumulation, and metal concentrations in sediment and pore water from eight study sites: one site upstream in the Columbia River, six sites in the reservoir, and a reference site in an uncontaminated tributary. Total recoverable metal concentrations in LR sediments generally decreased from upstream to downstream in the study area, but sediments from two sites in the reservoir had metal concentrations much lower than adjacent reservoir sites and similar to the reference site, apparently due to erosion of uncontaminated bank soils. Concentrations of acid-volatile sulfide in LR sediments were too low to provide strong controls on metal bioavailability, and selective sediment extractions indicated that metals in most LR sediments were primarily associated with iron and manganese oxides. Oligochaetes (Lumbriculus variegatus) accumulated greatest concentrations of copper from the river sediment, and greatest concentrations of arsenic, cadmium, and lead from reservoir sediments. Chronic toxic effects on amphipods (Hyalella azteca; reduced survival) and midge larvae (Chironomus dilutus; reduced growth) in whole-sediment exposures were generally consistent with predictions of metal toxicity based on empirical and equilibrium partitioning-based sediment quality guidelines. Elevated metal concentrations in pore waters of some LR sediments suggested that metals released from iron and manganese oxides under anoxic conditions contributed to metal bioaccumulation and toxicity. Results of both chemical and biological assays indicate that metals in sediments from both riverine and reservoir habitats of Lake Roosevelt are available to benthic invertebrates. These findings will be used as part of an ongoing ecological risk assessment to determine remedial actions for contaminated sediments in Lake Roosevelt. ?? 2007 Springer Science+Business Media, LLC.

  1. In situ impact assessment of wastewater effluents by integrating multi-level biomarker responses in the pale chub (Zacco platypus).

    PubMed

    Kim, Woo-Keun; Jung, Jinho

    2016-06-01

    The integration of biomarker responses ranging from the molecular to the individual level is of great interest for measuring the toxic effects of hazardous chemicals or effluent mixtures on aquatic organisms. This study evaluated the effects of wastewater treatment plant (WWTP) effluents on the freshwater pale chub Zacco platypus by using multi-level biomarker responses at molecular [mRNA expression of catalase (CAT), superoxide dismutase (SOD), glutathione S-transferase (GST), and metallothionein (MT)], biochemical (enzyme activities of CAT, SOD, GST, and concentration of MT), and physiological [condition factor (CF) and liver somatic index (LSI)] levels. The mRNA expression levels of GST and MT in Z. platypus from a site downstream of a WWTP significantly increased by 2.2- and 4.5-fold (p<0.05) when compared with those from an upstream site. However, the enzyme activities of CAT, SOD, and GST in fish from the downstream site significantly decreased by 43%, 98%, and 13%, respectively (p<0.05), except for an increase in MT concentration (41%). In addition, a significant increase in LSI (46%) was observed in Z. platypus from the downstream site (p<0.05). Concentrations of Cu, Zn, Cd, and Pb in the liver of Z. platypus were higher (530%, 353%, 800%, and 2,200%, respectively) in fish from a downstream site than in fish from an upstream location, and several multi-level biomarker responses were significantly correlated with the accumulated metals in Z. platypus (p<0.05). Integrated biomarker responses at molecular, biochemical, and physiological levels (multi-level IBR) were much higher (about 4-fold) at the downstream site than at the upstream site. This study suggests that the multi-level IBR approach is very useful for quantifying in situ adverse effects of WWTP effluents. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Drosophila Insulin receptor regulates the persistence of injury-induced nociceptive sensitization

    PubMed Central

    Patel, Atit A.

    2018-01-01

    ABSTRACT Diabetes-associated nociceptive hypersensitivity affects diabetic patients with hard-to-treat chronic pain. Because multiple tissues are affected by systemic alterations in insulin signaling, the functional locus of insulin signaling in diabetes-associated hypersensitivity remains obscure. Here, we used Drosophila nociception/nociceptive sensitization assays to investigate the role of Insulin receptor (Insulin-like receptor, InR) in nociceptive hypersensitivity. InR mutant larvae exhibited mostly normal baseline thermal nociception (absence of injury) and normal acute thermal hypersensitivity following UV-induced injury. However, their acute thermal hypersensitivity persists and fails to return to baseline, unlike in controls. Remarkably, injury-induced persistent hypersensitivity is also observed in larvae that exhibit either type 1 or type 2 diabetes. Cell type-specific genetic analysis indicates that InR function is required in multidendritic sensory neurons including nociceptive class IV neurons. In these same nociceptive sensory neurons, only modest changes in dendritic morphology were observed in the InRRNAi-expressing and diabetic larvae. At the cellular level, InR-deficient nociceptive sensory neurons show elevated calcium responses after injury. Sensory neuron-specific expression of InR rescues the persistent thermal hypersensitivity of InR mutants and constitutive activation of InR in sensory neurons ameliorates the hypersensitivity observed with a type 2-like diabetic state. Our results suggest that a sensory neuron-specific function of InR regulates the persistence of injury-associated hypersensitivity. It is likely that this new system will be an informative genetically tractable model of diabetes-associated hypersensitivity. PMID:29752280

  3. Immediate changes in stream channel geomorphology, aquatic habitat, and fish assemblages following dam removal in a small upland catchment

    NASA Astrophysics Data System (ADS)

    Magilligan, F. J.; Nislow, K. H.; Kynard, B. E.; Hackman, A. M.

    2016-01-01

    Dam removal is becoming an increasingly important component of river restoration, with > 1100 dams having been removed nationwide over the past three decades. Despite this recent progression of removals, the lack of pre- to post-removal monitoring and assessment limits our understanding of the magnitude, rate, and sequence of geomorphic and/or ecological recovery to dam removal. Taking advantage of the November 2012 removal of an old ( 190 year-old) 6-m high, run-of-river industrial dam on Amethyst Brook (26 km2) in central Massachusetts, we identify the immediate eco-geomorphic responses to removal. To capture the geomorphic responses to dam removal, we collected baseline data at multiple scales, both upstream ( 300 m) and downstream (> 750 m) of the dam, including monumented cross sections, detailed channel-bed longitudinal profiles, embeddedness surveys, and channel-bed grain size measurements, which were repeated during the summer of 2013. These geomorphic assessments were combined with detailed quantitative electrofishing surveys of stream fish richness and abundance above and below the dam site and throughout the watershed and visual surveys of native anadromous sea lamprey (Petromyzon marinus) nest sites. Post-removal assessments were complicated by two events: (1) upstream knickpoint migration exhumed an older (ca. late eighteenth century) intact wooden crib dam 120 m upstream of the former stone dam, and (2) the occurrence of a 10-20 year RI flood 6 months after removal that caused further upstream incision and downstream aggradation. Now that the downstream reach has been reconnected to upstream sediment supply, the predominant geomorphic response was bed aggradation and associated fining (30-60% reduction). At dam proximal locations, aggradation ranged from 0.3 to > 1 m where a large woody debris jam enhanced aggradation. Although less pronounced, distal locations still showed aggradation with a mean depth of deposition of 0.20 m over the 750-m downstream reach. Post-removal, but pre-flood, bed surveys indicate 2 m of incision had migrated 25 m upstream of the former reservoir before encountering the exhumed dam, which now acts as the new grade control, limiting progressive headcutting. Approximately 1000 m3 of sediment was evacuated in the first year, with 67% of the volume occurring by pre-flood, process-driven (e.g., changes in base level) controls. The combination of changes in channel-bed sedimentology, the occurrence of a large magnitude flood, and the emergence of the new crib dam that is a likely barrier to fish movement was associated with major reductions in abundance and richness in sites downstream and immediately upstream adjacent to the former dam in post-removal sampling. At the same time, we documented the presence of four species of fish, including sea lamprey, which were not present above the dam prior to removal, indicating that upstream passage has been achieved; and we also documented lamprey spawning activity at sites immediately below the dam, which had previously been unsuitable owing to an excessively coarse and armored riverbed. Our results point to the importance of interactions between dam removal and flood disturbance effects, with important implications for short- and long-term monitoring and assessment of dam impacts to river systems.

  4. A systematic review of validated methods for identifying hypersensitivity reactions other than anaphylaxis (fever, rash, and lymphadenopathy), using administrative and claims data.

    PubMed

    Schneider, Gary; Kachroo, Sumesh; Jones, Natalie; Crean, Sheila; Rotella, Philip; Avetisyan, Ruzan; Reynolds, Matthew W

    2012-01-01

    The Food and Drug Administration's Mini-Sentinel pilot program aims to conduct active surveillance to refine safety signals that emerge for marketed medical products. A key facet of this surveillance is to develop and understand the validity of algorithms for identifying health outcomes of interest from administrative and claims data. This article summarizes the process and findings of the algorithm review of hypersensitivity reactions. PubMed and Iowa Drug Information Service searches were conducted to identify citations applicable to the hypersensitivity reactions of health outcomes of interest. Level 1 abstract reviews and Level 2 full-text reviews were conducted to find articles using administrative and claims data to identify hypersensitivity reactions and including validation estimates of the coding algorithms. We identified five studies that provided validated hypersensitivity-reaction algorithms. Algorithm positive predictive values (PPVs) for various definitions of hypersensitivity reactions ranged from 3% to 95%. PPVs were high (i.e. 90%-95%) when both exposures and diagnoses were very specific. PPV generally decreased when the definition of hypersensitivity was expanded, except in one study that used data mining methodology for algorithm development. The ability of coding algorithms to identify hypersensitivity reactions varied, with decreasing performance occurring with expanded outcome definitions. This examination of hypersensitivity-reaction coding algorithms provides an example of surveillance bias resulting from outcome definitions that include mild cases. Data mining may provide tools for algorithm development for hypersensitivity and other health outcomes. Research needs to be conducted on designing validation studies to test hypersensitivity-reaction algorithms and estimating their predictive power, sensitivity, and specificity. Copyright © 2012 John Wiley & Sons, Ltd.

  5. Regulation of Drought Tolerance by the F-Box Protein MAX2 in Arabidopsis1[C][W][OPEN

    PubMed Central

    Bu, Qingyun; Lv, Tianxiao; Shen, Hui; Luong, Phi; Wang, Jimmy; Wang, Zhenyu; Huang, Zhigang; Xiao, Langtao; Engineer, Cawas; Kim, Tae Houn; Schroeder, Julian I.; Huq, Enamul

    2014-01-01

    MAX2 (for MORE AXILLARY GROWTH2) has been shown to regulate diverse biological processes, including plant architecture, photomorphogenesis, senescence, and karrikin signaling. Although karrikin is a smoke-derived abiotic signal, a role for MAX2 in abiotic stress response pathways is least investigated. Here, we show that the max2 mutant is strongly hypersensitive to drought stress compared with wild-type Arabidopsis (Arabidopsis thaliana). Stomatal closure of max2 was less sensitive to abscisic acid (ABA) than that of the wild type. Cuticle thickness of max2 was significantly thinner than that of the wild type. Both of these phenotypes of max2 mutant plants correlate with the increased water loss and drought-sensitive phenotype. Quantitative real-time reverse transcription-polymerase chain reaction analyses showed that the expression of stress-responsive genes and ABA biosynthesis, catabolism, transport, and signaling genes was impaired in max2 compared with wild-type seedlings in response to drought stress. Double mutant analysis of max2 with the ABA-insensitive mutants abi3 and abi5 indicated that MAX2 may function upstream of these genes. The expression of ABA-regulated genes was enhanced in imbibed max2 seeds. In addition, max2 mutant seedlings were hypersensitive to ABA and osmotic stress, including NaCl, mannitol, and glucose. Interestingly, ABA, osmotic stress, and drought-sensitive phenotypes were restricted to max2, and the strigolactone biosynthetic pathway mutants max1, max3, and max4 did not display any defects in these responses. Taken together, these results uncover an important role for MAX2 in plant responses to abiotic stress conditions. PMID:24198318

  6. Extensive forearm deep venous thrombosis following a severe infliximab infusion reaction.

    PubMed

    Ryan, Barbara M; Romberg, Marielle; Wolters, Frank; Stockbrugger, Reinhold W

    2004-09-01

    Here we describe a patient with Crohn's disease who developed a severe infliximab infusion reaction (IIR), complicated 1 day later by severe swelling of the forearm and hand ipsilateral to the site of infliximab infusion. This proved to be extensive forearm deep venous thrombosis. The site of thrombosis and the chronological relationship with the IIR implicates a hypersensitivity to infliximab in the causation of the venous thrombosis in this case. With an increasing trend towards re-treating patients with known IIRs, clinicians should be aware of this potentially serious and previously unreported complication.

  7. The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

    PubMed

    Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

    2014-01-01

    Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

  8. Effect of hepatic venous sphincter contraction on transmission of central venous pressure to lobar and portal pressure.

    PubMed

    Lautt, W W; Legare, D J; Greenway, C V

    1987-11-01

    In dogs anesthetized with pentobarbital, central vena caval pressure (CVP), portal venous pressure (PVP), and intrahepatic lobar venous pressure (proximal to the hepatic venous sphincters) were measured. The objective was to determine some characteristics of the intrahepatic vascular resistance sites (proximal and distal to the hepatic venous sphincters) including testing predictions made using a recent mathematical model of distensible hepatic venous resistance. The stimulus used was a brief rise in CVP produced by transient occlusion of the thoracic vena cava in control state and when vascular resistance was elevated by infusions of norepinephrine or histamine, or by nerve stimulation. The percent transmission of the downstream pressure rise to upstream sites past areas of vascular resistance was elevated. Even small increments in CVP are partially transmitted upstream. The data are incompatible with the vascular waterfall phenomenon which predicts that venous pressure increments are not transmitted upstream until a critical pressure is overcome and then further increments would be 100% transmitted. The hepatic sphincters show the following characteristics. First, small rises in CVP are transmitted less than large elevations; as the CVP rises, the sphincters passively distend and allow a greater percent transmission upstream, thus a large rise in CVP is more fully transmitted than a small rise in CVP. Second, the amount of pressure transmission upstream is determined by the vascular resistance across which the pressure is transmitted. As nerves, norepinephrine, or histamine cause the hepatic sphincters to contract, the percent transmission becomes less and the distensibility of the sphincters is reduced. Similar characteristics are shown for the "presinusoidal" vascular resistance and the hepatic venous sphincter resistance.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  10. Mount St. Helens Long-Term Sediment Management Plan for Flood Risk Reduction

    DTIC Science & Technology

    2010-06-01

    one dredge would direct pump to the Wasser Winters disposal site, located along the southern bank of the Cowlitz River mouth. The average annual...dredge would pipeline pump either upstream to disposal site 20cde or downstream to the Wasser Winters site. Pumping distances would not exceed 6.0...estimates referenced the Wasser Winters upland preparation estimates and were based on the relationship between acreage and effort. Total site

  11. LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.

    PubMed

    Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna

    2012-12-01

    The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.

  12. Community and Ecosystem-Level Impacts of an Emergent Macrophyte on the Ventura River, California.

    NASA Astrophysics Data System (ADS)

    Simpson, J.; Leydecker, A.; Melack, J.

    2005-05-01

    Ludwigia hexapetala is a pervasive, emergent vascular plant on the lower Ventura River. Presence of this plant appears to facilitate growth of shade-tolerant diatoms, while indirectly inhibiting filamentous green macroalgae. Four sites on the river were monitored during 2003; three downstream of a wastewater treatment plant, where Ludwigia is present, and one upstream site where it is absent. Filamentous algae occurred at all four sites, but declined rapidly at the below-treatment plant sites as growth and cover of vascular plants increased. By late summer, percent cover at these sites was dominated by Ludwigia, while the upstream site was consistently dominated by green macroalgae. Submerged plant parts provided substrate for diatom colonization, roughly doubling benthic diatom biomass (measured as chlorophyll a) at the downstream sites. Presence of the Ludwigia population also had strong ecosystem-level effects. The wastewater effluent produced typical stream water nitrate concentrations of 100-200 uM. Nitrate uptake rates downstream of the treatment plant inputs averaged 5 kg N/km/day, and direct uptake by Ludwigia could account for 20-40% of this nitrate drawdown. Further nitrate removal from the water column may be indirectly facilitated by the presence of Ludwigia through facilitation of diatom population growth.

  13. Assessment of Surface Water Contamination from Coalbed Methane Fracturing-Derived Volatile Contaminants in Sullivan County, Indiana, USA.

    PubMed

    Meszaros, Nicholas; Subedi, Bikram; Stamets, Tristan; Shifa, Naima

    2017-09-01

    There is a growing concern over the contamination of surface water and the associated environmental and public health consequences from the recent proliferation of hydraulic fracturing in the USA. Petroleum hydrocarbon-derived contaminants of concern [benzene, toluene, ethylbenzene, and xylenes (BTEX)] and various dissolved cations and anions were spatially determined in surface waters around 15 coalbed methane fracking wells in Sullivan County, IN, USA. At least one BTEX compound was detected in 69% of sampling sites (n = 13) and 23% of sampling sites were found to be contaminated with all of the BTEX compounds. Toluene was the most common BTEX compound detected across all sampling sites, both upstream and downstream from coalbed methane fracking wells. The average concentration of toluene at a reservoir and its outlet nearby the fracking wells was ~2× higher than other downstream sites. However, one of the upstream sites was found to be contaminated with BTEX at similar concentrations as in a reservoir site nearby the fracking well. Calcium (~60 ppm) and sulfates (~175 ppm) were the dominant cations and anions, respectively, in surface water around the fracking sites. This study represents the first report of BTEX contamination in surface water from coalbed methane hydraulic fracturing wells.

  14. Streamflow and Water-Quality Characteristics for Wind Cave National Park, South Dakota, 2002-03

    USGS Publications Warehouse

    Heakin, Allen J.

    2004-01-01

    A 2-year study of streamflow and water-quality characteristics in Wind Cave National Park was performed by the U.S. Geological Survey in cooperation with the National Park Service. During this study, streamflow and water-quality data were collected for three of the park's perennial streams (Cold Spring, Beaver, and Highland Creeks) from January 2002 through November 2003. The potential influence of parking lot runoff on cave drip within Wind Cave also was investigated by collecting and analyzing several time-dependent samples from a drainage culvert downstream from the parking lot and from Upper Minnehaha Falls inside the cave following a series of simulated runoff events. The primary focus of the report is on data collected during the 2-year study from January 2002 to November 2003; however, data collected previously also are summarized. Losing reaches occur on both Beaver and Highland Creeks as these streams flow across outcrops of bedrock aquifers within the park. No streamflow losses occur along Cold Spring Creek because its confluence with Beaver Creek is located upstream from the outcrop of the Madison aquifer, where most streamflow losses occur. Physical properties, major ions, trace elements, nutrients, bacteria, benthic macroinvertebrates, organic (wastewater) compounds, bottom sediment, and suspended sediment are summarized for samples collected from 2 sites on Cold Spring Creek, 2 sites on Beaver Creek, and 1 site on Highland Creek. None of the constituent concentrations for any of the samples collected during 2002-03 exceeded any of the U.S. Environmental Protection Agency drinking-water standards, with the exception of the Secondary Maximum Contaminant Level for pH, which was exceeded in numerous samples from Beaver Creek and Highland Creek. Additionally, the pH values in several of these same samples also exceeded beneficial-use criteria for coldwater permanent fisheries and coldwater marginal fisheries. Water temperature exceeded the coldwater permanent fisheries criterion in numerous samples from all three streams. Two samples from Highland Creek also exceeded the coldwater marginal fisheries criterion for water temperature. Mean concentrations of ammonia, orthophosphate, and phosphorous were higher for the upstream site on Beaver Creek than for other water-quality sampling sites. Concentrations of E. coli, fecal coliform, and total coliform bacteria also were higher at the upstream site on Beaver Creek than for any other site. Samples for the analysis of benthic macroinvertebrates were collected from one site on each of the three streams during July 2002 and May 2003. The benthic macroinvertebrate data showed that Beaver Creek had lower species diversity and a higher percentage of tolerant species than the other two streams during 2002, but just the opposite was found during 2003. However, examination of the complete data set indicates that the quality of water at the upstream site was generally poorer than the quality of water at the downstream site. Furthermore, the quality of water at the upstream site on Beaver Creek is somewhat degraded when compared to the quality of water from Highland and Cold Spring Creeks, indicating that anthropogenic activities outside the park probably are affecting the quality of water in Beaver Creek. Samples for the analysis of wastewater compounds were collected at least twice from four of the five water-quality sampling sites. Bromoform, phenol, caffeine, and cholesterol were detected in samples from Cold Spring Creek, but only phenol was detected at concentrations greater than the minimum reporting level. Concentrations of several wastewater compounds were estimated in samples collected from sites on Beaver Creek, including phenol, para-cresol, and para-nonylphenol-total. Phenol was detected at both sites on Beaver Creek at concentrations greater than the minimum reporting level. Bromoform; para-cresol; ethanol,2-butoxy-phosphate; and cholesterol were detected

  15. Subjective Welfare, Well-Being, and Self-Reported Food Hypersensitivity in Four European Countries: Implications for European Policy

    ERIC Educational Resources Information Center

    Voordouw, Jantine; Antonides, Gerrit; Fox, Margaret; Cerecedo, Inmaculada; Zamora, Javier; de la Hoz Caballer, Belen; Rokicka, Ewa; Cornelisse-Vermaat, Judith; Jewczak, Maciej; Starosta, Pawel; Kowalska, Marek L.; Jedrzejczak-Czechowicz, Monika; Vazquez-Cortes, Sonia; Escudero, Cano; de Blok, Bertine Flokstra; Dubois, Anthony; Mugford, Miranda; Frewer, Lynn J.

    2012-01-01

    This study estimates the effects of food hypersensitivity on individuals' perceived welfare and well-being compared to non-food hypersensitive individuals. Study respondents were recruited in the Netherlands, Poland, Spain and UK. The difference in welfare between food hypersensitive respondents and those asymptomatic to foods was estimated using…

  16. Dietary hypersensitivity in cats and dogs.

    PubMed

    Mandigers, Paul; German, Alexander J

    2010-10-01

    Adverse reactions to food or dietary hypersensitivity are frequently seen problems in companion animal medicine and may be difficult to differentiate from inflammatory bowel disease (IBD). Dietary hypersensitivity can be divided into two subgroups: immunological and nonimmunological problems. Non-immunological problems can be subdivided into food intolerance, food poisoning, and dietary indiscretion. The immunological group can be subdivided into true food allergy (IgE mediated) and anaphylaxis (non-IgE mediated). This article gives an outline of what dietary hypersensitivity is, and more specifically food allergy and how to deal with patients with possible dietary hypersensitivity.

  17. 3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

    PubMed Central

    Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

    2016-01-01

    Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

  18. Beaver lodge location on the upstream Loire River.

    PubMed

    Fustec, Joëlle; Cormier, Jean-Paul; Lodé, Thierry

    2003-08-01

    In the part of the Loire River recently colonized by Eurasian beavers, we compared habitat characteristics among sites with lodges, sites with cut trees and sites without beaver. The absence of sandbank and canopy cover (by 10-15-m tall trees, by tall Salicaceae, and by bushy Salicaceae) appeared as good predictors for lodge settling. Based on this model, the number of proper lodge sites was estimated for the next downstream 36 kilometers stretch. The number of favourable sites decreases as anthropization increases.

  19. Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

    PubMed Central

    Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

    2005-01-01

    Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

  20. Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

    PubMed Central

    Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

    2000-01-01

    The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

  1. Assessment of biological conditions at selected stream sites in Johnson County, Kansas, and Cass and Jackson Counties, Missouri, 2003 and 2004

    USGS Publications Warehouse

    Poulton, Barry C.; Rasmussen, Teresa J.; Lee, Casey J.

    2007-01-01

    Macroinvertebrate samples were collected at 15 stream sites representing 11 different watersheds in Johnson County, Kansas, in 2003 and 2004 to assess biological conditions in streams and relations to environmental variables. Published data from an additional seven stream sites, one in Johnson County, Kansas, and six others in adjacent Cass and Jackson Counties in Missouri also were evaluated. Multimetric scores, which integrated a combination of measures that describe various aspects of biological community abundance and diversity, were used to evaluate and compare the biological health of streams. In addition, for 15 of 16 Johnson County stream sites, environmental data (streamflow, precipitation, and land use) and water- and sediment-quality data (primarily nutrients, indicator bacteria, and organic wastewater compounds) were used in statistical analyses to evaluate relations between macroinvertebrate metrics and variables that may affect them. The information is useful for defining current conditions, evaluating conditions relative to State aquatic-life support and total maximum daily load requirements, evaluating effects of urbanization, developing effective water-quality management plans, and documenting changes in biological condition and water quality.Biological conditions in selected Johnson County streams generally reflected a gradient in the degree of human disturbances upstream from the sites, including percentage of urban and agricultural land use as well as the presence, absence, and proximity of wastewater treatment discharges. In this report, the term gradient is used to describe a continuum in the conditions (biological, environmental, or land use) observed at the study sites. Upstream Blue River sites, downstream from primarily agricultural land use, consistently scored among the sites least impacted by human disturbance, and in some metrics these sites scored higher than the State reference site (Captain Creek). The term impact, as used in this report, refers to a negative biological response at a site associated with one or more human-induced sources of disturbance or stress. However, no sites, including the Captain Creek reference site, met Kansas Department of Health and Environment criteria for full support of aquatic life during the 2 years of sample collection. Upstream sites on Kill and Cedar Creeks also consistently scored among the least impacted. Sites less than 3 miles downstream from municipal wastewater treatment facility discharges (two Indian Creek sites) and sites with no wastewater discharge but with substantial impervious surface area within their respective watersheds (Tomahawk, Turkey, and Brush Creeks) consistently scored among the sites most impacted by human disturbance.

  2. Use of Liposomal Bupivacaine for Postoperative Analgesia in an Incisional Pain Model in Rats (Rattus norvegicus)

    PubMed Central

    Kang, Stacey C; Jampachaisri, Katechan; Seymour, Travis L; Felt, Stephen A; Pacharinsak, Cholawat

    2017-01-01

    The local anesthetic bupivacaine is valuable for perioperative analgesia, but its use in the postoperative period is limited by its short duration of action. Here, we evaluated the application of a slow-release liposomal formulation of bupivacaine for postoperative analgesia. The aim was to assess whether liposomal bupivacaine effectively attenuates postoperative mechanical and thermal hypersensitivity in a rat model of incisional pain. Rats (n = 36) were randomly assigned to 1 of 5 treatment groups: saline, 1 mL/kg SC every 12 h for 2 d; buprenorphine HCl, 0.05 mg/kg SC every 12 h for 2 d (Bup HCl); 0.5% bupivacaine, 2 mg/kg SC local infiltration once (Bupi); liposomal bupivacaine, 1 mg/kg SC local infiltration once (Exp1); and liposomal bupivacaine, 6 mg/kg SC local infiltration once (Exp6). Mechanical and thermal hypersensitivity were evaluated daily on days –1, 0, 1, 2, 3, and 4. The saline group exhibited both hypersensitivities through all 4 evaluated postoperative days. Bup HCl attenuated mechanical hypersensitivity for 2 d and thermal hypersensitivity for 1 d. Bupi attenuated only thermal hypersensitivity for 4 d. Rats in the Exp1 group showed attenuation of both mechanical and thermal hypersensitivity for 4 d, and those in the Exp6 group had attenuation of mechanical hypersensitivity on day 0 and thermal hypersensitivity for 4 d. These data suggest that a single local infiltration of liposomal bupivacaine at a dose of 1 mg/kg SC effectively attenuates postoperative mechanical and thermal hypersensitivity for 4 d in a rat model of incisional pain. PMID:28905717

  3. Use of Liposomal Bupivacaine for Postoperative Analgesia in an Incisional Pain Model in Rats (Rattus norvegicus).

    PubMed

    Kang, Stacey C; Jampachaisri, Katechan; Seymour, Travis L; Felt, Stephen A; Pacharinsak, Cholawat

    2017-01-01

    The local anesthetic bupivacaine is valuable for perioperative analgesia, but its use in the postoperative period is limited by its short duration of action. Here, we evaluated the application of a slow-release liposomal formulation of bupivacaine for postoperative analgesia. The aim was to assess whether liposomal bupivacaine effectively attenuates postoperative mechanical and thermal hypersensitivity in a rat model of incisional pain. Rats (n = 36) were randomly assigned to 1 of 5 treatment groups: saline, 1 mL/kg SC every 12 h for 2 d; buprenorphine HCl, 0.05 mg/kg SC every 12 h for 2 d (Bup HCl); 0.5% bupivacaine, 2 mg/kg SC local infiltration once (Bupi); liposomal bupivacaine, 1 mg/kg SC local infiltration once (Exp1); and liposomal bupivacaine, 6 mg/kg SC local infiltration once (Exp6). Mechanical and thermal hypersensitivity were evaluated daily on days -1, 0, 1, 2, 3, and 4. The saline group exhibited both hypersensitivities through all 4 evaluated postoperative days. Bup HCl attenuated mechanical hypersensitivity for 2 d and thermal hypersensitivity for 1 d. Bupi attenuated only thermal hypersensitivity for 4 d. Rats in the Exp1 group showed attenuation of both mechanical and thermal hypersensitivity for 4 d, and those in the Exp6 group had attenuation of mechanical hypersensitivity on day 0 and thermal hypersensitivity for 4 d. These data suggest that a single local infiltration of liposomal bupivacaine at a dose of 1 mg/kg SC effectively attenuates postoperative mechanical and thermal hypersensitivity for 4 d in a rat model of incisional pain.

  4. Histological observations on needle colonization by Cronartium ribicola in susceptible and resistant seedlings of whitebark pine and limber pine

    Treesearch

    Jeffrey Stone; Anna Schoettle; Richard Sniezko; Angelia Kegley

    2011-01-01

    Resistance to white pine blister rust based on a hypersensitive response (HR) that is conferred by a dominant gene has been identified as functioning in needles of blister rust-resistant families of sugar pine, western white pine and southwestern white pine. The typical HR response displays a characteristic local necrosis at the site of infection in the needles during...

  5. An Atypical Local Vesicular Reaction to the Yellow Fever Vaccine.

    PubMed

    Wauters, Robert H; Hernandez, Camellia L; Petersen, Maureen M

    2017-09-19

    Yellow fever vaccine is a live attenuated viral inoculation indicated for patients traveling to endemic areas. The vaccine is generally well tolerated with minimal adverse effects. Typical side effects include malaise, pain at the injection site, and, albeit rarely, immediate hypersensitivity reactions. We present a case of a rare adverse reaction to yellow fever vaccine in which a patient developed vesicular lesions resulting in bullae and circumferential hyperpigmentation.

  6. The Role of Cytokinin During Infection of Arabidopsis thaliana by the Cyst Nematode Heterodera schachtii.

    PubMed

    Shanks, Carly M; Rice, J Hollis; Zubo, Yan; Schaller, G Eric; Hewezi, Tarek; Kieber, Joseph J

    2016-01-01

    Plant-parasitic cyst nematodes induce the formation of hypermetabolic feeding sites, termed syncytia, as their sole source of nutrients. The formation of the syncytium is orchestrated by the nematode, in part, by modulation of phytohormone responses, including cytokinin. In response to infection by the nematode Heterodera schachtii, cytokinin signaling is transiently induced at the site of infection and in the developing syncytium. Arabidopsis lines with reduced cytokinin sensitivity show reduced susceptibility to nematode infection, indicating that cytokinin signaling is required for optimal nematode development. Furthermore, lines with increased cytokinin sensitivity also exhibit reduced nematode susceptibility. To ascertain why cytokinin hypersensitivity reduces nematode parasitism, we examined the transcriptomes in wild type and a cytokinin-hypersensitive type-A arr Arabidopsis mutant in response to H. schachtii infection. Genes involved in the response to biotic stress and defense response were elevated in the type-A arr mutant in the absence of nematodes and were hyperinduced following H. schachtii infection, which suggests that the Arabidopsis type-A arr mutants impede nematode development because they are primed to respond to pathogen infection. These results suggest that cytokinin signaling is required for optimal H. schachtii parasitism of Arabidopsis but that elevated cytokinin signaling triggers a heightened immune response to nematode infection.

  7. Functionality of resistance gene Hero, which controls plant root-infecting potato cyst nematodes, in leaves of tomato.

    PubMed

    Poch, H L Cabrera; López, R H Manzanilla; Kanyuka, K

    2006-07-01

    The expression of host genomes is modified locally by root endoparasitic nematode secretions to induce the development of complex cellular structures referred as feeding sites. In compatible interactions, the feeding sites provide the environment and nutrients for the completion of the nematode's life cycle, whereas in an incompatible (resistant) interaction, the host immune system triggers a plant cell death programme, often in the form of a hypersensitive reaction, which restricts nematode reproduction. These processes have been studied in great detail in organ tissues normally infected by these nematodes: the roots. Here we show that host leaves can support a similar set of programmed developmental events in the potato cyst nematode Globodera rostochiensis life cycle that are typical of the root-invading nematodes. We also show that a gene-for-gene type specific disease resistance that is effective against potato cyst nematodes (PCN) in roots also operates in leaves: the expression of the resistance (R) gene Hero and members of its gene family in leaves correlates with the elicitation of a hypersensitive response only during the incompatible interaction. These findings, and the ability to isolate RNA from relevant parasitic stages of the nematode, may have significant implications for the identification of nematode factors involved in incompatible interactions.

  8. Chromosomal position effects in chicken lysozyme gene transgenic mice are correlated with suppression of DNase I hypersensitive site formation.

    PubMed Central

    Huber, M C; Bosch, F X; Sippel, A E; Bonifer, C

    1994-01-01

    The complete chicken lysozyme gene locus is expressed copy number dependently and at a high level in macrophages of transgenic mice. Gene expression independent of genomic position can only be achieved by the concerted action of all cis regulatory elements located on the lysozyme gene domain. Position independency of expression is lost if one essential cis regulatory region is deleted. Here we compared the DNase I hypersensitive site (DHS) pattern formed on the chromatin of position independently and position dependently expressed transgenes in order to assess the influence of deletions within the gene domain on active chromatin formation. We demonstrate, that in position independently expressed transgene all DHSs are formed with the authentic relative frequency on all genes. This is not the case for position dependently expressed transgenes. Our results show that the formation of a DHS during cellular differentiation does not occur autonomously. In case essential regulatory elements of the chicken lysozyme gene domain are lacking, the efficiency of DHS formation on remaining cis regulatory elements during myeloid differentiation is reduced and influenced by the chromosomal position. Hence, no individual regulatory element on the lysozyme domain is capable of organizing the chromatin structure of the whole locus in a dominant fashion. Images PMID:7937145

  9. Comparison of the prevalence and characteristics of food hypersensitivity among adolescent and older women.

    PubMed

    Fujimori, Anri; Yamashita, Tomomi; Kubota, Masaru; Saito, Hiromi; Takamatsu, Nobue; Nambu, Mitsuhiko

    2016-12-01

    Although food hypersensitivity is a public health concern, its documentation among the elderly is limited. The current study aims to compare the prevalence and characteristics of food hypersensitivity among adolescent women between aged 18-24 with among older women >50 years of age. 660 female university students between the ages of 18 and 24 who volunteered were enrolled as adolescent subjects. 470 women >50 years old who visited the Health Care Centre of Kyoto Katsura Hospital for health check-ups were enrolled as the older subjects. A questionnaire created by ourselves asking the presence of food hypersensitivity, symptoms, causative food, personal or family history of other allergic disorders was distributed. The prevalence of food hypersensitivity was statistically similar between adolescent (8.2%) and older women (8.9%). Among them, only 24.1% of the adolescent women and 26.2% of the older women had been diagnosed by physicians as having food allergy. The main causative foods (fruits, shellfish and fish) and the manifestations relating to food hypersensitivity were almost identical between adolescent and older women. In both adolescent and older women, food hypersensitivity positive group showed significantly higher prevalence of personal or family history of allergic disorders than that in food hypersensitivity negative group. These data indicate that food hypersensitivity in older women should be given more attention because the prevalence of this condition was as common as that in adolescent women.

  10. Upregulation of Ih expressed in IB4-negative Aδ nociceptive DRG neurons contributes to mechanical hypersensitivity associated with cervical radiculopathic pain

    PubMed Central

    Liu, Da-Lu; Lu, Na; Han, Wen-Juan; Chen, Rong-Gui; Cong, Rui; Xie, Rou-Gang; Zhang, Yu-Fei; Kong, Wei-Wei; Hu, San-Jue; Luo, Ceng

    2015-01-01

    Cervical radiculopathy represents aberrant mechanical hypersensitivity. Primary sensory neuron’s ability to sense mechanical force forms mechanotransduction. However, whether this property undergoes activity-dependent plastic changes and underlies mechanical hypersensitivity associated with cervical radiculopathic pain (CRP) is not clear. Here we show a new CRP model producing stable mechanical compression of dorsal root ganglion (DRG), which induces dramatic behavioral mechanical hypersensitivity. Amongst nociceptive DRG neurons, a mechanically sensitive neuron, isolectin B4 negative Aδ-type (IB4− Aδ) DRG neuron displays spontaneous activity with hyperexcitability after chronic compression of cervical DRGs. Focal mechanical stimulation on somata of IB4- Aδ neuron induces abnormal hypersensitivity. Upregulated HCN1 and HCN3 channels and increased Ih current on this subset of primary nociceptors underlies the spontaneous activity together with neuronal mechanical hypersensitivity, which further contributes to the behavioral mechanical hypersensitivity associated with CRP. This study sheds new light on the functional plasticity of a specific subset of nociceptive DRG neurons to mechanical stimulation and reveals a novel mechanism that could underlie the mechanical hypersensitivity associated with cervical radiculopathy. PMID:26577374

  11. Evaluation of Streamflow Gain-Loss Characteristics of Hubbard Creek, in the Vicinity of a Mine-Permit Area, Delta County, Colorado, 2007

    USGS Publications Warehouse

    Ruddy, Barbara C.; Williams, Cory A.

    2007-01-01

    In 2007, the U.S. Geological Survey, in cooperation with Bowie Mining Company, initiated a study to characterize the streamflow and streamflow gain-loss in a reach of Hubbard Creek in Delta County, Colorado, in the vicinity of a mine-permit area planned for future coal mining. Premining streamflow characteristics and streamflow gain-loss variation were determined so that pre- and postmining gain-loss characteristics could be compared. This report describes the methods used in this study and the results of two streamflow-measurement sets collected during low-flow conditions. Streamflow gain-loss measurements were collected using rhodamine WT and sodium bromide tracers at four sites spanning the mine-permit area on June 26-28, 2007. Streamflows were estimated and compared between four measurement sites within three stream subreaches of the study reach. Data from two streamflow-gaging stations on Hubbard Creek upstream and downstream from the mine-permit area were evaluated. Streamflows at the stations were continuous, and flow at the upstream station nearly always exceeded the streamflow at the downstream station. Furthermore, streamflow at both stations showed similar diurnal patterns with traveltime offsets. On June 26, streamflow from the gain-loss measurements was greater at site 1 (most upstream site) than at site 4 (most downstream site); on June 27, streamflow was greater at site 4 than at site 2; and on June 27, there was no difference in streamflow between sites 2 and 3. Data from streamflow-gaging stations 09132940 and 09132960 showed diurnal variations and overall decreasing streamflow over time. The data indicate a dynamic system, and streamflow can increase or decrease depending on hydrologic conditions. The streamflow within the study reach was greater than the streamflows at either the upstream or downstream stations. A second set of gain-loss measurements was collected at sites 2 and 4 on November 8-9, 2007. On November 8, streamflow was greater at site 4 than at site 2, and on the following day, November 9, streamflow was greater at site 2 than at site 4. Data collection on November 8 occurred while the streamflow was increasing due to contributions from stream ice melting throughout different parts of the basin. Data collection on November 9 occurred earlier in the day with less stream ice melting and more steady-state conditions, so the indication that streamflow decreased between sites 2 and 4 may be more accurate. Diurnal variations in streamflow are common at both the upper and the lower streamflow-gaging stations. The upper streamflow-gaging station shows a melt-freeze influence from tributaries to Hubbard Creek during the winter season. Downstream from the study reach, observed diurnal variation is likely due to evapotranspiration associated with dense flood-plain vegetation, which consumes water from the creek during the middle of the day. Varying diurnal patterns in streamflow, combined with possible variations in tributary inflows to Hubbard Creek in the study reach, probably account for the observed variations in streamflow at the tracer measurement sites. During both sampling periods in June and November 2007, conditions were less than ideal and not steady state. The June 27 sampling indicates that the streamflow was increasing between measurement sites 2 and 4, and the November 9 sampling indicates that the streamflow was decreasing between measurement sites 2 and 4. The data collected during the diurnal and day-to-day variations in streamflow indicated that the streamflow reach is dynamic and can be gaining, losing, or constant.

  12. Determination of instream metal loads using tracer-injection and synoptic-sampling techniques in Wightman Fork, southwestern Colorado, September 1997

    USGS Publications Warehouse

    Ortiz, Roderick F.; Bencala, Kenneth E.

    2001-01-01

    Spatial determinations of the metal loads in Wightman Fork can be used to identify potential source areas to the stream. In September 1997, a chloride tracer-injection study was done concurrently with synoptic water-quality sampling in Wightman Fork near the Summitville Mine site. Discharge was determined and metal concentrations at 38 sites were used to generate mass-load profiles for dissolved aluminum, copper, iron, manganese, and zinc. The U.S. Environmental Protection Agency had previously identified these metals as contaminants of concern.Metal loads increased substantially in Wightman Fork near the Summitville Mine. A large increase occurred along a 60-meter reach that is north of the North Waste Dump and generally corresponds to a region of radial faults. Metal loading from this reach was equivalent to 50 percent or more of the dissolved aluminum, copper, iron, manganese, and zinc load upstream from the outfall of the Summitville Water Treatment Facility (SWTF). Overall, sources along the entire reach upstream from the SWTF were equivalent to 15 percent of the iron, 33 percent of the copper and manganese, 58 percent of the zinc, and 66 percent of the aluminum load leaving the mine site. The largest increases in metal loading to Wightman Fork occurred as a result of inflow from Cropsy Creek. Aluminum, iron, manganese, and zinc loads from Cropsy Creek were equivalent to about 40 percent of the specific metal load leaving the mine site. Copper, iron, and manganese loads from Cropsy Creek were nearly as large or larger than the load from sources upstream from the SWTF.

  13. Linking Anxiety and Insistence on Sameness in Autistic Children: The Role of Sensory Hypersensitivity.

    PubMed

    Black, Karen R; Stevenson, Ryan A; Segers, Magali; Ncube, Busiswe L; Sun, Sol Z; Philipp-Muller, Aviva; Bebko, James M; Barense, Morgan D; Ferber, Susanne

    2017-08-01

    Sensory hypersensitivity and insistence on sameness (I/S) are common, co-occurring features of autism, yet the relationship between them is poorly understood. This study assessed the impact of sensory hypersensitivity on the clinical symptoms of specific phobia, separation anxiety, social anxiety and I/S for autistic and typically developing (TD) children. Parents of 79 children completed questionnaires on their child's difficulties related to sensory processing, I/S, and anxiety. Results demonstrated that sensory hypersensitivity mediated 67% of the relationship between symptoms of specific phobia and I/S and 57% of the relationship between separation anxiety and I/S. No relationship was observed between sensory hypersensitivity and social anxiety. These mediation effects of sensory hypersensitivity were found only in autistic children, not in TD children.

  14. Use of the semipermeable membrane device as an in situ sampler of waterborne bioavailable PCDD and PCDF residues at sub-parts-per-quadrillion concentrations

    USGS Publications Warehouse

    Lebo, Jon A.; Gale, Robert W.; Petty, Jimmie D.; Tillitt, Donald E.; Huckins, James N.; Meadows, John C.; Orazio, Carl E.; Echols, Kathy R.; Schroeder, Dennis J.; Inmon, Lloyd E.

    1995-01-01

    Semipermeable membrane devices (SPMDs) were used to passively sample aqueous polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs) in Bayou Meto, AR. The two sites were upstream and downstream from the confluence with a tributary that delivers PCDDs and PCDFs to the Bayou. Following dialysis, cleanup, and fractionation, four replicate 17-9 SPMD samples from each site were analyzed by GUMS, and four were evaluated by H411E bioassay. Traces of only OCDD and HpCDDs were detected in samples from the upstream site. The four samples from below the tributary contained averages of 1550 ± 80 pg of 2,3,7,8-TCDD, 1640 ± 80 pg of 2,3,7,8-TCDF, and lesser quantities of other congeners. The TCDD equivalents obtained by bioassay of replicate SPMD samples agreed well with results obtained by GC/MS. The quantities of 2,3,7,8- TCDD and 2,3,7,8-TCDF sequestered by SPMDs at the downstream site were used to estimate the aqueous concentrations for both compounds as 2 pg/L.

  15. Water quality and the composition of fish and macroinvertebrate communities in the Devils and Pecos Rivers within and upstream from the Amistad National Recreation Area, Texas, 2005-7

    USGS Publications Warehouse

    Moring, J. Bruce

    2012-01-01

    The total number of fish species collected was the same in the Devils River and Pecos River, but the species found in the two rivers varied slightly. The number of fish species generally increased from the site farthest upstream to the site farthest downstream in the Devils River, and decreased between the site farthest upstream and site farthest downstream in the Pecos River. The redbreast sunfish was the most abundant species collected in the Devils River, and the blacktail shiner was the most abundant species collected in the Pecos River. Comparing the species from each river, the percentage of omnivorous fish species was larger at the more downstream sites closer to Amistad Reservoir, and the percentage of species tolerant of environmental stressors was larger in the Pecos River. The fish community, assessed on the basis of the number of shared species among the sites sampled, was more similar to the fish community at the other sites on the same river than it was to the fish community from any other site in the other river. More macroinvertebrate taxa were collected in the Devils River than in the Pecos River. The largest number of macroinvertebrate taxa were from the site second farthest downstream on the Devils River, and the smallest numbers of macroinvertebrate taxa were from the farthest downstream site on the Pecos River. Mayflies were more common in the Devils River, and caddisflies were less common than mayflies at most sites. Net-spinning caddisflies were more common at the Devils River sites. The combined percent of mayfly, caddisfly, and stonefly taxa was generally larger at the Pecos River sites. Riffle beetles were the most commonly collected beetle taxon among all sites, and water-penny beetles were only collected at the Pecos River sites. A greater number of true midge taxa were collected more than any other taxa at the genus and species taxonomic level. Non-insect macroinvertebrate taxa were more common at the Devils River sites. Corbicula sp. (presumably the introduced Asian clam) was found at sites in both rivers, and amphipods were more abundant in the Devils River. The Margalef species richness index, based on aquatic insect taxa only, was larger at the Devils River sites than at the Pecos River sites. The Hilsenhoff's biotic index was largest at the site farthest downstream in the Devils River and smallest at the site second farthest downstream in the Pecos River. Overall similarity among sites based on the number of shared macroinvertebrate taxa indicated that each site is more similar to other sites on the same river than to sites on the other river.

  16. Effects of selenium supplementation in cattle on aquatic ecosystems in northern California

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Norman, B.; Nader, G.; Oliver, M.

    1992-09-15

    The potential impact on aquatic ecosystems of supplementing the diets of beef cattle with selenium (Se) was studied on 4 northern California ranches. All study sites included an area of concentrated use by cattle that had diets supplemented with Se. In each case, a stream flowed through the site and provided a control sampling area upstream and a treated sampling area downstream. Specimens of water, sediment, algae, aquatic plants, aquatic invertebrates, and fish were analyzed fluorometrically for total Se content. Significant differences in Se concentration were not found between specimens from upstream control areas and those from downstream areas subjectedmore » to use by Se-treated cattle. Evidence was not found that Se supplementation in cattle at maximal permitted concentrations caused Se accumulation in associated aquatic ecosystems.« less

  17. Streamflow, specific-conductance, and temperature data for Bayou and Little Bayou Creeks near Paducah, Kentucky, August 15 and 16, 1989

    USGS Publications Warehouse

    Evaldi, R.D.; McClain, D.L.

    1989-01-01

    Discharge, temperature, and specific conductance measurements were made August 15 and 16, 1989, at 74 main channel sites and seven flowing tributaries on Bayou and Little Bayou Creeks, Kentucky in the vicinity of the Paducah Gaseous Diffusion Plant. These measurements were made during base flow conditions to provide data for analysis of the interaction of surface and groundwater. The discharge of Bayou Creek was 0.30 cfs at the most upstream site, and 5.8 cfs at the most downstream site. Total measured tributary inflow of Bayou Creek was 5.7 cfs. Specific conductance values in the Bayou Creek watershed ranged from 208 to 489 microsiemens/cm, and water temperature ranged from 20.0 to 32.6 C. The discharge of Little Bayou Creek was 0.65 cfs at the most upstream site, and 1.8 cfs at the most downstream site. Total measured tributary inflow of Little Bayou Creek was 0.38 cfs. Specific conductance values in the Little Bayou Creek watershed ranged from 211 to 272 microsiemens/cm, and water temperature ranged from 14.5 to 24.9 C. (USGS)

  18. Decreased fish diversity found near marble industry effluents in River Barandu, Pakistan.

    PubMed

    Mulk, Shahi; Korai, Abdul Latif; Azizullah, Azizullah; Khattak, Muhammad Nasir Khan

    2016-01-01

    In a recently published study we observed that effluents from marble industry affected physicochemical characteristics of River Barandu in District Buner, Pakistan. These changes in water quality due to marble effluents may affect fish community. The present study was therefore conducted to evaluate the impacts of marble industry effluents on fish communities in River Barandu using abundance, richness, diversity and evenness of fish species as end point criteria. The fish samples were collected by local fishermen on monthly basis from three selected sites (upstream, effluents/industrial, and downstream sites). During the study period, a total of 18 fish species were found belonging to 4 orders, 5 families and 11 genera. The Cyprinidae was observed to be the dominant family at all the three selected sites. Lower abundance and species diversity was observed at the industrial (22%) and downstream sites (33%) as compared to the upstream site (45%). Effluents of marble industry were associated with lower abundance of species in River Barandu. It is recommended that industries should be shifted away from the vicinity of river and their effluents must be treated before discharging to prevent further loss of fish abundance and diversity in the River.

  19. Effects of wastewater effluent discharge and treatment facility upgrades on environmental and biological conditions of the upper Blue River, Johnson County, Kansas and Jackson County, Missouri, January 2003 through March 2009

    USGS Publications Warehouse

    Graham, Jennifer L.; Stone, Mandy L.; Rasmussen, Teresa J.; Poulton, Barry C.

    2010-01-01

    The Johnson County Blue River Main Wastewater Treatment Facility discharges into the upper Blue River near the border between Johnson County, Kansas and Jackson County, Missouri. During 2005 through 2007 the wastewater treatment facility underwent upgrades to increase capacity and include biological nutrient removal. The effects of wastewater effluent on environmental and biological conditions of the upper Blue River were assessed by comparing an upstream site to two sites located downstream from the wastewater treatment facility. Environmental conditions were evaluated using previously and newly collected discrete and continuous data, and were compared with an assessment of biological community composition and ecosystem function along the upstream-downstream gradient. This evaluation is useful for understanding the potential effects of wastewater effluent on water quality, biological community structure, and ecosystem function. In addition, this information can be used to help achieve National Pollution Discharge Elimination System (NPDES) wastewater effluent permit requirements after additional studies are conducted. The effects of wastewater effluent on the water-quality conditions of the upper Blue River were most evident during below-normal and normal streamflows (about 75 percent of the time), when wastewater effluent contributed more than 20 percent to total streamflow. The largest difference in water-quality conditions between the upstream and downstream sites was in nutrient concentrations. Total and inorganic nutrient concentrations at the downstream sites during below-normal and normal streamflows were 4 to 15 times larger than at the upstream site, even after upgrades to the wastewater treatment facility were completed. However, total nitrogen concentrations decreased in wastewater effluent and at the downstream site following wastewater treatment facility upgrades. Similar decreases in total phosphorus were not observed, likely because the biological phosphorus removal process was not optimized until after the study was completed. Total nitrogen and phosphorus from the wastewater treatment facility contributed a relatively small percentage (14 to 15 percent) to the annual nutrient load in the upper Blue River, but contributed substantially (as much as 75 percent) to monthly loads during seasonal low-flows in winter and summer. During 2007 and 2008, annual discharge from the wastewater treatment facility was about one-half maximum capacity, and estimated potential maximum annual loads were 1.6 to 2.4 times greater than annual loads before capacity upgrades. Even when target nutrient concentrations are met, annual nutrient loads will increase when the wastewater treatment facility is operated at full capacity. Regardless of changes in annual nutrient loads, the reduction of nutrient concentrations in the Blue River Main wastewater effluent will help prevent further degradation of the upper Blue River. The Blue River Main Wastewater Treatment Facility wastewater effluent caused changes in concentrations of several water-quality constituents that may affect biological community structure and function including larger concentrations of bioavailable nutrients (nitrate and orthophosphorus) and smaller turbidities. Streambed-sediment conditions were similar along the upstream-downstream gradient and measured constituents did not exceed probable effect concentrations. Habitat conditions declined along the upstream-downstream gradient, largely because of decreased canopy cover and riparian buffer width and increased riffle-substrate fouling. Algal biomass, primary production, and the abundance of nutrient-tolerant diatoms substantially increased downstream from the wastewater treatment facility. Likewise, the abundance of intolerant macroinvertebrate taxa and Kansas Department of Health and Environment aquatic-life-support scores, derived from macroinvertebrate data, significantly decreased downstream from the wastewater

  20. Interstitial Lung Disease in India. Results of a Prospective Registry.

    PubMed

    Singh, Sheetu; Collins, Bridget F; Sharma, Bharat B; Joshi, Jyotsna M; Talwar, Deepak; Katiyar, Sandeep; Singh, Nishtha; Ho, Lawrence; Samaria, Jai Kumar; Bhattacharya, Parthasarathi; Gupta, Rakesh; Chaudhari, Sudhir; Singh, Tejraj; Moond, Vijay; Pipavath, Sudhakar; Ahuja, Jitesh; Chetambath, Ravindran; Ghoshal, Aloke G; Jain, Nirmal K; Devi, H J Gayathri; Kant, Surya; Koul, Parvaiz; Dhar, Raja; Swarnakar, Rajesh; Sharma, Surendra K; Roy, Dhrubajyoti J; Sarmah, Kripesh R; Jankharia, Bhavin; Schmidt, Rodney; Katiyar, Santosh K; Jindal, Arpita; Mangal, Daya K; Singh, Virendra; Raghu, Ganesh

    2017-03-15

    Interstitial lung disease (ILD) is a heterogeneous group of acute and chronic inflammatory and fibrotic lung diseases. Existing ILD registries have had variable findings. Little is known about the clinical profile of ILDs in India. To characterize new-onset ILDs in India by creating a prospective ILD using multidisciplinary discussion (MDD) to validate diagnoses. Adult patients of Indian origin living in India with new-onset ILD (27 centers, 19 Indian cities, March 2012-June 2015) without malignancy or infection were included. All had connective tissue disease (CTD) serologies, spirometry, and high-resolution computed tomography chest. ILD pattern was defined by high-resolution computed tomography images. Three groups independently made diagnoses after review of clinical data including that from prompted case report forms: local site investigators, ILD experts at the National Data Coordinating Center (NDCC; Jaipur, India) with MDD, and experienced ILD experts at the Center for ILD (CILD; Seattle, WA) with MDD. Cohen's κ was used to assess reliability of interobserver agreement. A total of 1,084 patients were recruited. Final diagnosis: hypersensitivity pneumonitis in 47.3% (n = 513; exposure, 48.1% air coolers), CTD-ILD in 13.9%, and idiopathic pulmonary fibrosis in 13.7%. Cohen's κ: 0.351 site investigator/CILD, 0.519 site investigator/NDCC, and 0.618 NDCC/CILD. Hypersensitivity pneumonitis was the most common new-onset ILD in India, followed by CTD-ILD and idiopathic pulmonary fibrosis; diagnoses varied between site investigators and CILD experts, emphasizing the value of MDD in ILD diagnosis. Prompted case report forms including environmental exposures in prospective registries will likely provide further insight into the etiology and management of ILD worldwide.

  1. Differences in components at delayed-type hypersensitivity reaction sites in mice immunized with either a protective or a nonprotective immunogen of Cryptococcus neoformans.

    PubMed

    Nichols, Kasie L; Bauman, Sean K; Schafer, Fredda B; Murphy, Juneann W

    2002-02-01

    Cell-mediated immunity is the major protective mechanism against Cryptococcus neoformans. Delayed swelling reactions, i.e., delayed-type hypersensitivity (DTH), in response to an intradermal injection of specific antigen are used as a means of detecting a cell-mediated immune (CMI) response to the antigen. We have found previously that the presence of an anticryptococcal DTH response in mice is not always indicative of protection against a cryptococcal infection. Using one immunogen that induces a protective anticryptococcal CMI response and one that induces a nonprotective response, we have shown that mice immunized with the protective immunogen undergo a classical DTH response characterized by mononuclear cell and neutrophil infiltrates and the presence of gamma interferon and NO. In contrast, immunization with the nonprotective immunogen results in an influx of primarily neutrophils and production of tumor necrosis factor alpha (TNF-alpha) at the DTH reaction site. Even when the anticryptococcal DTH response was augmented by blocking the down-regulator, CTLA-4 (CD152), on T cells in the mice given the nonprotective immunogen, the main leukocyte population infiltrating the DTH reaction site is the neutrophil. Although TNF-alpha is increased at the DTH reaction site in mice immunized with the nonprotective immunogen, it is unlikely that TNF-alpha activates the neutrophils, because the density of TNF receptors on the neutrophils is reduced below control levels. Uncoupling of DTH reactivity and protection has been demonstrated in other infectious-disease models; however, the mechanisms differ from our model. These findings stress the importance of defining the cascade of events occurring in response to various immunogens and establishing the relationships between protection and DTH reactions.

  2. Assessing inundation hazards to nuclear powerplant sites using geologically extended histories of riverine floods, tsunamis, and storm surges

    USGS Publications Warehouse

    O'Connor, Jim; Atwater, Brian F.; Cohn, Timothy A.; Cronin, Thomas M.; Keith, Mackenzie K.; Smith, Christopher G.; Mason, Jr., Robert R.

    2014-01-01

    A screening of the 104 nuclear powerplants in the United States licensed by the Nuclear Regulatory Commission (at 64 sites) indicates several sites for which paleoflood studies likely would provide additional flood-frequency information. Two sites—Duane Arnold, Iowa, on the Cedar River; and David-Besse, Ohio, on the Toussaint River—have geologic conditions suitable for creating and preserving stratigraphic records of flooding and few upstream dams that may complicate flood-frequency analysis. One site—Crystal River, Florida1, on the Withlacoochee River and only 4 kilometers from the coast—has high potential as a candidate for assessing riverine and marine inundation hazards. Several sites on the Mississippi River have high geologic potential, but upstream dams almost certainly now regulate peak flows. Nevertheless, studies on the Mississippi River to evaluate long-term flood frequency may provide results applicable to a wide spectrum of regional hazard issues. Several sites in the southeastern United States have high geologic potential, and studies at these sites also may be helpful in evaluating hazards from outburst floods from landslide dams (river blockages formed by mass movements), which may be a regional hazard. For all these sites, closer investigation and field reconnaissance would be needed to confirm suitable deposits and settings for a complete paleoflood analysis. Similar screenings may help identify high-potential sites for geologic investigations of tsunami and storm-surge hazards.

  3. Hypersensitivity Events, Including Potentially Hypersensitivity-Related Skin Events, with Dapagliflozin in Patients with Type 2 Diabetes Mellitus: A Pooled Analysis.

    PubMed

    Mellander, Annika; Billger, Martin; Johnsson, Eva; Träff, Anna Karin; Yoshida, Shigeru; Johnsson, Kristina

    2016-11-01

    In patients with type 2 diabetes mellitus (T2DM), dapagliflozin improves glycemic control and has a safety profile typically related to its mechanism of action. Hypersensitivity adverse events (AEs) have been reported in some patients with sodium-glucose cotransporter 2 (SGLT2) inhibitors, including a recent report of dermatological AEs in Japan. We investigated the frequency and characteristics of hypersensitivity AEs, including potentially hypersensitivity-related skin AEs, across 21 phase IIb/III trials of dapagliflozin (N = 5936) versus active or placebo comparators (N = 3403), including the subpopulation of Asian patients (N = 1563). Overall, AEs and serious AEs (SAEs) of hypersensitivity were infrequent and were reported in a similar proportion of patients with dapagliflozin versus active or placebo comparators (AEs: 4.5 vs. 4.3 %; SAEs: 0.2 vs. 0.1 %, respectively). The most common events affected the skin or subcutaneous tissue: rash (dapagliflozin: 1.1 %, comparator: 1.1 %), eczema (0.6, 0.8 %), dermatitis (0.5, 0.4 %), and urticaria (0.5, 0.2 %). Few patients discontinued as a result of hypersensitivity AEs (≤0.2 %). In patients of Asian descent, a lower frequency of hypersensitivity AEs was observed with dapagliflozin versus comparators (2.0 vs. 4.5 %). In the subset of placebo-controlled trials, hypersensitivity AEs were slightly more frequent with dapagliflozin than with placebo across the overall population (4.7 vs. 3.8 %), and less frequent with dapagliflozin in Asian patients (1.5 vs. 5.0 %). The findings of this post hoc analysis indicate that dapagliflozin does not lead to an increased risk of serious hypersensitivity reactions or potentially hypersensitivity-related skin events among patients with T2DM, including Asian patients. Long-term outcome studies and postmarketing surveillance will provide further information on hypersensitivity reactions with SGLT2 inhibitors. CLINICALTRIALS. NCT01042977, NCT01031680, NCT00855166, NCT00984867, NCT01294423, NCT00673231, NCT00972244, NCT00680745, NCT00660907, NCT01095653, NCT00831779, NCT00976495, NCT00859898, NCT00736879, NCT00683878, NCT00663260, NCT00643851, NCT00528879, NCT00528372, NCT00357370, NCT00263276.

  4. Incidence of hypersensitivity and anaphylaxis with sugammadex.

    PubMed

    Min, K Chris; Woo, Tiffany; Assaid, Christopher; McCrea, Jacqueline; Gurner, Deborah M; Sisk, Christine McCrary; Adkinson, Franklin; Herring, W Joseph

    2018-06-01

    To evaluate the incidence of hypersensitivity and anaphylaxis after administration of sugammadex. Retrospective analysis. Sugammadex clinical development program and post-marketing experience. Surgical patients and healthy volunteers who received sugammadex or placebo/comparator with anesthesia and/or neuromuscular blockade (NMB). Sugammadex administered as 2.0 mg/kg at reappearance of the second twitch, 4.0 mg/kg at 1-2 post-tetanic count, or 16.0 mg/kg at 3 min after rocuronium 1.2 mg/kg. Three analytical methods were used: 1) automated MedDRA queries; 2) searches of adverse events (AEs) consistent with treatment-related hypersensitivity reactions as diagnosed by the investigator; and 3) a retrospective adjudication of AEs suggestive of hypersensitivity by a blinded, independent adjudication committee (AC). In addition, a search of all post-marketing reports of events of hypersensitivity was performed, and events were retrospectively adjudicated by an independent AC. Anaphylaxis was determined according to Sampson Criterion 1. The pooled dataset included 3519 unique subjects who received sugammadex and 544 who received placebo. The automated MedDRA query method showed no apparent increase in hypersensitivity or anaphylaxis with sugammadex as compared to placebo or neostigmine. Similarly, there was a low overall incidence of AEs of treatment-related hypersensitivity (<1%), with no differences between sugammadex and placebo or neostigmine. Finally, the retrospective adjudication of AEs suggestive of hypersensitivity showed a low incidence of hypersensitivity (0.56% and 0.21% for sugammadex 2 mg/kg and 4 mg/kg, respectively), with an incidence similar to subjects who received placebo (0.55%). There were no confirmed cases of anaphylaxis in the pooled studies. During post-marketing use, spontaneous reports of anaphylaxis occurred with approximately 0.01% of sugammadex doses. Subjects who received sugammadex with general anesthesia and/or NMB had a low overall incidence of hypersensitivity, with no apparent increase in hypersensitivity or anaphylaxis with sugammadex as compared to placebo or neostigmine. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

    NASA Astrophysics Data System (ADS)

    Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

    2004-12-01

    Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

  6. Effects of stock use and backpackers on water quality in wilderness in Sequoia and Kings Canyon National Parks, USA.

    PubMed

    Clow, David W; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O; Ryu, Hodon; Domingo, Jorge Santo

    2013-12-01

    During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli concentrations. The synoptic survey sites were categorized as minimal use, backpacker-use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E. coli) than those categorized as minimal-use (P ≤ 0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E. coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas (P ≤ 0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E. coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

  7. Effects of Stock Use and Backpackers on Water Quality in Wilderness in Sequoia and Kings Canyon National Parks, USA

    NASA Astrophysics Data System (ADS)

    Clow, David W.; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O.; Ryu, Hodon; Domingo, Jorge Santo

    2013-12-01

    During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli concentrations. The synoptic survey sites were categorized as minimal use, backpacker-use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E. coli) than those categorized as minimal-use ( P ≤ 0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E. coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas ( P ≤ 0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E. coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

  8. Effects of stock use and backpackers on water quality in wilderness in Sequoia and Kings Canyon National Parks, USA

    USGS Publications Warehouse

    Clow, David W.; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O.; Ryu, Hodon; Santo Domingo, Jorge

    2013-01-01

    During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water-quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water-quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli (E. coli) concentrations. The synoptic survey sites were categorized as minimal use, backpacker use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E.coli) than those categorized as minimal-use (p≤0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E.coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas (p≤0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E.coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

  9. Risk Factors of Hypersensitivity to Carboplatin in Patients with Gynecologic Malignancies

    PubMed Central

    Tai, Yu-Hsiao; Tai, Yi-Jou; Hsu, Heng-Cheng; Lee, Shu-Ping; Chen, Yun-Yuan; Chiang, Ying-Cheng; Chen, Yu-Li; Chen, Chi-An; Cheng, Wen-Fang

    2017-01-01

    We evaluated the prevalence of and risk factors for hypersensitivity reactions related to carboplatin, which is commonly used to treat gynecological malignancies. All women with pathologically documented ovarian, fallopian tube, or primary peritoneal cancer treated with carboplatin alone or a carboplatin-based combination chemotherapy regimen at a single hospital between January 2006 and December 2013 were retrospectively recruited. We analyzed the incidence, characteristics, risk factors, management, and outcomes of carboplatin-related hypersensitivity reactions among these patients. Among 735 eligible women, 75 (10.2%) experienced a total of 215 carboplatin-related hypersensitivity reaction events. The annual incidence of carboplatin-related hypersensitivity reactions gradually increased from 0.88% in 2006 to 5.42% in 2013. The incidence of carboplatin-related hypersensitivity was higher in patients with advanced stage disease (P < 0.001, Kruskal-Wallis test), serous and mixed histological types (P = 0.003, Kruskal-Wallis test), malignant ascites (P = 0.009, chi-square test), and history of other drug allergy (P < 0.001, chi-square test). Compared to women without hypersensitivity reactions, women who experienced hypersensitivity reactions had a significantly greater median cycle number (12 vs. 6, P < 0.001, independent sample t-test) and dose (6,816 vs. 3,844 mg, P < 0.001, independent sample t-test). The cumulative incidence of carboplatin-related hypersensitivity reactions dramatically increased with >8 cycles or dose >3,500 mg. Therefore, disease severity, histological type, malignant ascites, past drug allergies, and cumulative carboplatin dose are risk factors for carboplatin-related hypersensitivity reactions. Such reactions could potentially be reduced or prevented by slowing the infusion rate and using a desensitization protocol involving anti-allergy medications. PMID:29163180

  10. Risk Factors of Hypersensitivity to Carboplatin in Patients with Gynecologic Malignancies.

    PubMed

    Tai, Yu-Hsiao; Tai, Yi-Jou; Hsu, Heng-Cheng; Lee, Shu-Ping; Chen, Yun-Yuan; Chiang, Ying-Cheng; Chen, Yu-Li; Chen, Chi-An; Cheng, Wen-Fang

    2017-01-01

    We evaluated the prevalence of and risk factors for hypersensitivity reactions related to carboplatin, which is commonly used to treat gynecological malignancies. All women with pathologically documented ovarian, fallopian tube, or primary peritoneal cancer treated with carboplatin alone or a carboplatin-based combination chemotherapy regimen at a single hospital between January 2006 and December 2013 were retrospectively recruited. We analyzed the incidence, characteristics, risk factors, management, and outcomes of carboplatin-related hypersensitivity reactions among these patients. Among 735 eligible women, 75 (10.2%) experienced a total of 215 carboplatin-related hypersensitivity reaction events. The annual incidence of carboplatin-related hypersensitivity reactions gradually increased from 0.88% in 2006 to 5.42% in 2013. The incidence of carboplatin-related hypersensitivity was higher in patients with advanced stage disease ( P < 0.001, Kruskal-Wallis test), serous and mixed histological types ( P = 0.003, Kruskal-Wallis test), malignant ascites ( P = 0.009, chi-square test), and history of other drug allergy ( P < 0.001, chi-square test). Compared to women without hypersensitivity reactions, women who experienced hypersensitivity reactions had a significantly greater median cycle number (12 vs. 6, P < 0.001, independent sample t -test) and dose (6,816 vs. 3,844 mg, P < 0.001, independent sample t -test). The cumulative incidence of carboplatin-related hypersensitivity reactions dramatically increased with >8 cycles or dose >3,500 mg. Therefore, disease severity, histological type, malignant ascites, past drug allergies, and cumulative carboplatin dose are risk factors for carboplatin-related hypersensitivity reactions. Such reactions could potentially be reduced or prevented by slowing the infusion rate and using a desensitization protocol involving anti-allergy medications.

  11. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    PubMed

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  12. Managing hypersensitivity to asparaginase in pediatrics, adolescents, and young adults.

    PubMed

    Shinnick, Sara E; Browning, Mary L; Koontz, Susannah E

    2013-01-01

    Hypersensitivity reactions to chemotherapeutic drugs have been documented for numerous cancer therapies. Clinical hypersensitivity to Escherichia coli asparaginase has been reported to range from 0% to 75%. Throughout the United States, nurses assume frontline responsibility for the assessment of asparaginase-related hypersensitivity reactions. It is essential that nurses educate themselves on the signs and symptoms of asparaginase-related hypersensitivity reactions as well as current supportive care approaches. The purpose of this review is to summarize acute lymphoblastic leukemia and the role of asparaginase and the pathology of allergic reactions. We will also update nurses on the differences in asparaginase preparations including dosing, half-life, rates of hypersensitivity, and routes of administration. A summary of current management and supportive care strategies will be provided as will a discussion of the relationship between allergy, antibodies, and asparaginase activity.

  13. The relation between the cell-mediated immunological response and the induction of circulating antibodies to collagen in guinea-pigs.

    PubMed Central

    Gentner, G J; Adelmann, B C

    1976-01-01

    Cutaneous delayed hypersensitivity reactions to collagen in guinea-pigs were partially but specifically suppressed if the animals had been pretreated with collagen and Freund's incomplete adjuvant. Such animals responded normally to skin-reactive factor prepared with ovalbumin. Lymphoid cells from animals with normal delayed hypersensitivity to collagen functioned normally in animals with suppressed skin reactivity. Cells from animals with suppressed delayed hypersensitivity were specifically, functionally impaired since they transferred delayed hypersensitivity into neutral recipients efficiently for PPD but not for collagen. Suppression could be induced in Cy-treated animals, and it persisted for at least 143 days. It is concluded that guinea-pigs with depressed delayed hypersensitivity to collagen are functionally impaired with respect to those T cells normally generated by induction of delayed hypersensitivity. PMID:1088420

  14. Streamflow losses along the Balcones Fault Zone, Nueces River basin, Texas

    USGS Publications Warehouse

    Land, L.F.; Boning, C.W.; Harmsen, Lynn; Reeves, R.D.

    1983-01-01

    Statistical evaluations of historical daily flow records for the streams that have gaging stations upstream and downstream from the recharge zone provided mathematical relationships that expressed downstream flow in terms of other significant parameters. For each stream, flow entering the recharge zone is most significant in defining downstream flow; for some streams, antecedent flows at the upstream site and ground-water levels are also significantly related to downstream flow. The analyses also determined the discharges required upstream from the recharge zone to sustain flow downstream from that zone. These discharges ranged from 355 cubic feet per second for the combined Frio and Dry Frio Rivers to 33 cubic feet per second for the Nueces River. The entire flows of lesser magnitude are generally lost to recharge to the aquifer.

  15. Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

    PubMed Central

    Graveley, Brenton R.

    2008-01-01

    Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

  16. Distribution and speciation of metals (Cu, Zn, Cd, and Pb) in agricultural and non-agricultural soils near a stream upriver from the Pearl River, China.

    PubMed

    Yang, Silin; Zhou, Dequn; Yu, Huayong; Wei, Rong; Pan, Bo

    2013-06-01

    The distribution and chemical speciation of typical metals (Cu, Zn, Cd and Pb) in agricultural and non-agricultural soils were investigated in the area of Nanpan River, upstream of the Pearl River. The investigated four metals showed higher concentrations in agricultural soils than in non-agricultural soils, and the site located in factory district contained metals much higher than the other sampling sites. These observations suggested that human activities, such as water irrigation, fertilizer and pesticide applications might have a major impact on the distribution of metals. Metal speciation analysis presented that Cu, Zn and Cd were dominated by the residual fraction, while Pb was dominated by the reducible fraction. Because of the low mobility of the metals in the investigated area, no remarkable difference could be observed between upstream and downstream separated by the factory site. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Nevirapine patch testing in Thai human immunodeficiency virus infected patients with nevirapine drug hypersensitivity.

    PubMed

    Prasertvit, Piyatida; Chareonyingwattana, Angkana; Wattanakrai, Penpun

    2017-12-01

    Antiretroviral drug hypersensitivity in HIV patients is common. Publications have shown that Abacavir (ABC) patch testing is useful in confirming ABC hypersensitivity in 24-50% of cases with a 100% sensitivity of HLA-B*5701 in patch test positive cases. However, Nevirapine (NVP) patch testing has not been reported. (1) To evaluate the usefulness and safety of NVP patch testing in Thai HIV patients with NVP hypersensitivity. (2) To assess the correlation of positive patch tests with HLA-B*3505. Patients were classified into two groups: (1) study group of 20 HIV NVP hypersensitivity patients and (2) control group of 15 volunteers without NVP hypersensitivity. Both groups were patch tested with purified and commercialized form of NVP in various vehicles. Two HIV patients with NVP hypersensitivity were patch test positive. All controls tested negative. Three HIV patients were positive for HLA-B*3505 and the two patients with positive patch testing were both HLA-B*3505 positive. NVP patch testing in Thai HIV patients is safe and can be used to help confirm the association between NVP and hypersensitivity skin reactions. NVP patch test results significantly correlated with HLA-B*3505. The sensitivity of HLA-B*3505 for positive patch test was 100%. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Assessment of De Facto Wastewater Reuse across the US: trends between 1980 and 2008.

    PubMed

    Rice, Jacelyn; Wutich, Amber; Westerhoff, Paul

    2013-10-01

    De facto wastewater reuse is the incidental presence of treated wastewater in a water supply source. In 1980 the EPA identified drinking water treatment plants (DWTPs) impacted by upstream wastewater treatment plant (WWTP) discharges and found the top 25 most impacted DWTPs contained between 2% and 16% wastewater discharges from upstream locations (i.e., de facto reuse) under average streamflow conditions. This study is the first to provide an update to the 1980 EPA analysis. An ArcGIS model of DWTPs and WWTPs across the U.S. was created to quantify de facto reuse for the top 25 cities in the 1980 EPA study. From 1980 to 2008, de facto reuse increased for 17 of the 25 DWTPs, as municipal flows upstream of the sites increased by 68%. Under low streamflow conditions, de facto reuse in DWTP supplies ranged from 7% to 100%, illustrating the importance of wastewater in sustainable water supplies. Case studies were performed on four cities to analyze the reasons for changes in de facto reuse over time. Three of the four sites have greater than 20% treated wastewater effluent within their drinking water source for streamflow less than the 25th percentile historic flow.

  19. An Updated Review of the Molecular Mechanisms in Drug Hypersensitivity

    PubMed Central

    Abe, Riichiro; Pan, Ren-You; Wang, Chuang-Wei

    2018-01-01

    Drug hypersensitivity may manifest ranging from milder skin reactions (e.g., maculopapular exanthema and urticaria) to severe systemic reactions, such as anaphylaxis, drug reactions with eosinophilia and systemic symptoms (DRESS)/drug-induced hypersensitivity syndrome (DIHS), or Stevens–Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN). Current pharmacogenomic studies have made important strides in the prevention of some drug hypersensitivity through the identification of relevant genetic variants, particularly for genes encoding drug-metabolizing enzymes and human leukocyte antigens (HLAs). The associations identified by these studies are usually drug, phenotype, and ethnic specific. The drug presentation models that explain how small drug antigens might interact with HLA and T cell receptor (TCR) molecules in drug hypersensitivity include the hapten theory, the p-i concept, the altered peptide repertoire model, and the altered TCR repertoire model. The broad spectrum of clinical manifestations of drug hypersensitivity involving different drugs, as well as the various pathomechanisms involved, makes the diagnosis and management of it more challenging. This review highlights recent advances in our understanding of the predisposing factors, immune mechanisms, pathogenesis, diagnostic tools, and therapeutic approaches for drug hypersensitivity. PMID:29651444

  20. Chronic hypersensitivity pneumonitis: important considerations in the work-up of this fibrotic lung disease.

    PubMed

    Glazer, Craig S

    2015-03-01

    Chronic hypersensitivity pneumonitis is increasingly recognized as an important mimic of other fibrotic lung diseases. This review will summarize recent data regarding the importance and difficulty of determining causative exposures both for accurate diagnosis and prognosis, and describe the expanded pathologic spectrum of the disease, the effects of fibrosis on prognosis and challenges in the diagnostic evaluation. Several recent publications show the potential pathologic patterns induced by chronic hypersensitivity pneumonitis are broader than the classic triad of bronchiolitis, interstitial infiltrates and granulomas. Other pathologic patterns include nonspecific interstitial pneumonia, usual interstitial pneumonia, organizing pneumonia, bronchiolitis and airway centric fibrosis. Detecting a causative antigen in fibrotic hypersensitivity pneumonitis is challenging but critically important both for accurate diagnosis and improved prognosis. The prognosis in hypersensitivity pneumonitis worsens in the presence of fibrosis, but it remains significantly better than idiopathic pulmonary fibrosis. Hypersensitivity pneumonitis is increasingly recognized as an important cause of fibrotic interstitial lung disease. Hypersensitivity pneumonitis demonstrates a remarkable tendency to mimic other idiopathic interstitial pneumonias. A detailed exposure history remains a cornerstone of diagnosis and management.

  1. Food hypersensitivity in patients over 14 years of age suffering from atopic dermatitis.

    PubMed

    Celakovská, Jarmila; Ettler, K; Ettlerová, K; Vaněčková, J

    2014-05-01

    Patients suffering from atopic dermatitis often describe food hypersensitivity. Rising prevalence of food hypersensitivity and severe allergic reactions to foods have been reported, but the data are scarce. Evaluation of food hypersensitivity reactions in patients suffering from atopic dermatitis. The dermatological examination was performed in patients of age 14 years and above and the detailed history was taken concerning the food hypersensitivity. A total of 228 patients were examined-72 men, 156 women, average age 26.2 (SD 9.5) years. The food hypersensitivity reactions were recorded in 196 patients from 228 (86%), no reactions were recorded in 32 patients (24%). Foods with the most often recorded reactions are: Nuts (in 35% of patients), tomatoes (in 20%), and kiwi (in 17, 5%), apples and spices (in 16%), tangerines and oranges (in 15%), capsicum (in 13%), fishes (in 12%), celery (in 9%), and chocolate (in 7%). Food hypersensitivity reactions are recorded in 86% of patients suffering from atopic dermatitis. Nuts, tomatoes, and pollen-associated foods play a role in the majority of patients suffering from atopic dermatitis.

  2. Evaluation of water-quality characteristics and sampling design for streams in North Dakota, 1970–2008

    USGS Publications Warehouse

    Galloway, Joel M.; Vecchia, Aldo V.; Vining, Kevin C.; Densmore, Brenda K.; Lundgren, Robert F.

    2012-01-01

    In response to the need to examine the large amount of historic water-quality data comprehensively across North Dakota and evaluate the efficiency of the State-wide sampling programs, a study was done by the U.S. Geological Survey in cooperation with the North Dakota State Water Commission and the North Dakota Department of Health to describe the water-quality data collected for the various programs and determine an efficient State-wide sampling design for monitoring future water-quality conditions. Although data collected for the North Dakota State Water Commission High-Low Sampling Program, the North Dakota Department of Health Ambient Water-Quality Network, and other projects and programs provide valuable information on the quality of water in streams in North Dakota, the objectives vary among the programs, some of the programs overlap spatially and temporally, and the various sampling designs may not be the most efficient or relevant to the objectives of the individual programs as they have changed through time. One objective of a State-wide sampling program was to evaluate ways to describe the spatial variability of water-quality conditions across the State in the most efficient manner. Weighted least-squares regression analysis was used to relate the average absolute difference between paired downstream and upstream concentrations, expressed as a percent of the average downstream concentration, to the average absolute difference in daily flow between the downstream and upstream pairs, expressed as a percent of the average downstream flow. The analysis showed that a reasonable spatial network would consist of including the most downstream sites in large basins first, followed by the next upstream site(s) that roughly bisect the downstream flows at the first sites, followed by the next upstream site(s) that roughly bisect flows for the second sites. Sampling sites to be included in a potential State-wide network were prioritized into 3 design levels: level 1 (highest priority), level 2 (second priority), and level 3 (third priority). Given the spatial distribution and priority designation (levels 1–3) of sites in the potential spatial network, the next consideration was to determine the appropriate temporal sampling frequency to use for monitoring future water-quality conditions. The time-series model used to detect concentration trends for this report also was used to evaluate sampling designs to monitor future water-quality trends. Sampling designs were evaluated with regard to their sensitivity to detect seasonal trends that occurred during three 4-month seasons—March through June, July through October, and November through February. For the 34 level-1 sites, samples would be collected for major ions, trace metals, nutrients, bacteria, and sediment eight times per year, with samples in January, April (2 samples),May, June, July, August, and October. For the 21 level-2 sites, samples would be collected for major ions, trace metals, and nutrients six times per year (January, April, May, June, August, and October), and for the 26 level-3 sites, samples would be collected for these constituents four times per year (April, June, August, and October).

  3. Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

    PubMed Central

    Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

    2013-01-01

    Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

  4. 75 FR 65509 - Notice of Lodging of Consent Decree Under the Comprehensive Environmental Response, Compensation...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-25

    ... is hereby given that on October 14, 2010 a proposed Consent Decree with Georgia-Pacific Consumer... Green Bay Superfund Site in northeastern Wisconsin (the ``Site''). The proposed Consent Decree would... from a line across the River slightly upstream of the company's paper mill in the City of Green Bay...

  5. Different immune cells mediate mechanical pain hypersensitivity in male and female mice

    PubMed Central

    Sorge, Robert E.; Mapplebeck, Josiane C.S.; Rosen, Sarah; Beggs, Simon; Taves, Sarah; Alexander, Jessica K.; Martin, Loren J.; Austin, Jean-Sebastien; Sotocinal, Susana G.; Chen, Di; Yang, Mu; Shi, Xiang Qun; Huang, Hao; Pillon, Nicolas J.; Bilan, Philip J.; Tu, Yu Shan; Klip, Amira; Ji, Ru-Rong; Zhang, Ji; Salter, Michael W.; Mogil, Jeffrey S.

    2016-01-01

    A large and rapidly increasing body of evidence indicates that microglia-neuron signaling is essential for chronic pain hypersensitivity. Here we show using multiple approaches that microglia are not required for mechanical pain hypersensitivity in female mice; female mice achieve similar levels of pain hypersensitivity using adaptive immune cells, likely T-lymphocytes. This sexual dimorphism suggests that male mice cannot be used as proxies for females in pain research. PMID:26120961

  6. Acute hypersensitivity to mannitol: a case report

    NASA Astrophysics Data System (ADS)

    Siahaan, A. M.; Fithrie, A.

    2018-03-01

    Mannitol is an osmotic diuretic agent that has been considered a main therapeutic option in cerebral edema for the past several decades. The most common adverse effect reported is acute kidney injury and electrolyte imbalance. Hypersensitivity associated with mannitol is not a usual finding. Here we describe a case of a traumatic brain injury patient who had a hypersensitivity reaction to mannitol. It is the first reported case report about hypersensitivity to Mannitol in Indonesia.

  7. Hypersensitivity reactions to etoposide.

    PubMed

    Hoetelmans, R M; Schornagel, J H; ten Bokkel Huinink, W W; Beijnen, J H

    1996-04-01

    To report a hypersensitivity reaction to etoposide occurring in a patient after 2 months of drug therapy. A 20-year-old man with a diagnosis of testicular carcinoma was treated with bleomycin, etoposide, and cisplatin (BEP regimen). After dose 20 of etoposide, an exanthema was noted, which was attributed to etoposide. The patient had received 19 doses of etoposide during the previous 2 months without any sign of an allergic reaction. Rechallenging the patient with etoposide from another batch resulted in recurrence of the exanthema. Both etoposide and its excipient (polysorbate 80) are suspected of causing hypersensitivity reactions. Although the exact mechanism of the hypersensitivity reaction is not known, it is believed to be of nonimmunogenic origin. With a lower rate of infusion of etoposide and/or by premedication with antihistamines and/or corticosteroids, hypersensitivity reactions to etoposide might be prevented in patients with a history of hypersensitivity to this drug.

  8. Management of trichomonas vaginalis in women with suspected metronidazole hypersensitivity.

    PubMed

    Helms, Donna J; Mosure, Debra J; Secor, W Evan; Workowski, Kimberly A

    2008-04-01

    Standard treatment for Trichomonas vaginalis is metronidazole or tinidazole. Hypersensitivity to these drugs has been documented but is poorly understood. Desensitization is an option described in limited reports of women with hypersensitivity to nitroimidazoles. The purpose of this analysis is to improve documentation of management for trichomonas infections among women with metronidazole hypersensitivity. Clinicians who consulted Centers for Disease Control and Prevention concerning patients with suspected hypersensitivity to metronidazole were provided with treatment options and asked to report outcomes. From September 2003-September 2006, complete information was obtained for 59 women. The most common reactions were urticaria (47%) and facial edema (11%). Fifteen of these women (25.4%) were treated with metronidazole desensitization and all had eradication of their infection. Seventeen women (28.8%) were treated with alternative intravaginal drugs, which were less successful; 5 of 17 infections (29.4%) were eradicated. Metronidazole desensitization was effective in the management of women with nitroimidazole hypersensitivity.

  9. Reflux Hypersensitivity: A New Functional Esophageal Disorder.

    PubMed

    Yamasaki, Takahisa; Fass, Ronnie

    2017-10-30

    Reflux hypersensitivity, recently introduced by Rome IV as a new functional esophageal disorder, is currently considered as the presence of typical heartburn symptoms in patients with normal upper endoscopy and esophageal biopsies, normal esophageal pH test and with evidence of a close correlation between patients' heartburn and reflux events. Reflux hypersensitivity is very common and together with functional heartburn accounts for more than 90% of the heartburn patients who failed treatment with proton pump inhibitor twice daily. In addition, reflux hypersensitivity affects primarily young to middle aged women, commonly overlaps with another functional gastrointestinal disorders, and is often associated with some type of psychological comorbidity. Diagnosis is made by using endoscopy with esophageal biopsies, pH-impedance, and high-resolution esophageal manometry. Reflux hypersensitivity is primarily treated with esophageal neuromodulators, such as tricyclic anti-depressants and selective serotonin reuptake inhibitors among others. Surgical anti-reflux management may also play an important role in the treatment of reflux hypersensitivity.

  10. Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny

    PubMed Central

    Orengo, Dorcas J.; Aguadé, Montserrat

    2017-01-01

    The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426

  11. Freshwater mussel shells as environmental chronicles: Geochemical and taphonomic signatures of mercury-related extirpations in the North Fork Holston River, Virginia

    USGS Publications Warehouse

    Brown, M.E.; Kowalewski, M.; Neves, R.J.; Cherry, D.S.; Schreiber, M.E.

    2005-01-01

    This study utilized freshwater mussel shells to assess mercury (Hg) contamination in the North Fork Holston River that extirpated (caused local extinctions of) a diverse mussel fauna. Shells (n = 366) were collected from five sites situated upstream (two sites), just below (one site), and downstream (two sites) of the town of Saltville, Virginia, where Hg was used to produce chlorine and caustic soda from 1950 to 1972. Shell samples were used to test the (1) utility of geochemical signatures of shells for assessing the spatial variation in Hg levels in the river relative to the contamination source and (2) value of taphonomy (postmortem shell alteration) for distinguishing sites that differ in extirpation histories. Geochemical signatures of 40 shells, analyzed using atomic absorption spectroscopy, indicated a strong longitudinal pattern. All shells from the two upstream sites had low Hg concentrations (<5-31 ??g/kg), shells directly below Saltville had variable, but dramatically higher concentrations (23-4637 ??g/kg), and shells from the two downstream sites displayed intermediate Hg levels (<5-115 ??g/kg) that declined with distance from Saltville. Two pre-industrial shells, collected at Saltville in 1917, yielded very low Hg estimates (5-6 ??g/kg). Hg signatures were consistent among mussel species, suggesting that Hg concentrations were invariant to species type; most likely, highly variable Hg levels, both across sites and through time, overwhelmed any interspecific differences in Hg acquisition. Also, a notable postmortem incorporation of Hg in mussel shells seemed unlikely, as the Hg content was not correlated with shell taphonomy (r = 0.18; p = 0.28). The taphonomic analysis (n = 366) showed that the degree of shell alteration reliably distinguished sites with different extirpation histories. At Saltville, where live mussels have been absent for at least 30 years, shells were most heavily altered and fragmented. Conversely, fresh-looking shells abounded upstream, where reproducing mussel populations are still present. In summary, relic shells offered valuable spatiotemporal data on Hg concentrations in a polluted ecosystem, and shell taphonomic signatures discriminated sites with different extirpation histories. The shell-based strategies exemplified here do not require sampling live specimens and may augment more standard strategies applied to environmental monitoring. The approach should prove especially useful in areas with unknown extirpation and pollution histories. ?? 2005 American Chemical Society.

  12. Corticosterone stress response in tree swallows nesting near polychlorinated biphenyl- and dioxin-contaminated rivers

    USGS Publications Warehouse

    Franceschini, M.D.; Custer, Christine M.; Custer, T.W.; Reed, J.M.; Romero, L.M.

    2008-01-01

    We assayed baseline and stress-induced corticosterone concentrations from adult female and nestling tree swallows, Tachycineta bicolor, from New England, USA, sites with different levels of contamination with polychlorinated biphenyls (PCBs) and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Corticosterone was compared over 2 years from a highly contaminated PCB site along the Housatonic River (Berkshire County, MA, USA), a midrange contaminated site upstream, and a reference site. Adult females (n = 29), sampled only in 2003, showed an inverted-U association with PCBs, with higher stress-induced corticosterone with midrange contamination than at the high-contamination site. In nestlings, stress-induced corticosterone was highest for the highly contaminated site compared with the other sites in 2003 (n = 53, 29 nests), with no difference among sites in 2004 (n = 93, 27 nests). In 2004, we began testing mechanisms underlying these changes in nestlings at the high- and low-PCB sites. Corticosterone response to dexamethasone injection (used to test negative feedback) was not different between sites, but stress-induced corticosterone was reduced at the contaminated site after adrenocorticotropin hormone injection (used to test adrenal responsiveness), suggesting an inhibited ability to mount a stress response. We also compared nestlings from a stretch of the Woonasquatucket River, Rhode Island, USA, heavily contaminated with TCDD (n = 80, 43 nests) with nestlings from an upstream site that had lower levels of TCDD and the Berkshire County reference site. Although there were no stress-induced differences, baseline corticosterone was lower at the higher TCDD site than at the reference site. Altogether these findings suggest that tree swallows chronically exposed to high PCB and TCDD levels exhibit altered baseline and stress-induced corticosterone responses, but the patterns of alteration might not be predictable. ?? 2008 SETAC.

  13. Coupling GIS and multivariate approaches to reference site selection for wadeable stream monitoring.

    PubMed

    Collier, Kevin J; Haigh, Andy; Kelly, Johlene

    2007-04-01

    Geographic Information System (GIS) was used to identify potential reference sites for wadeable stream monitoring, and multivariate analyses were applied to test whether invertebrate communities reflected a priori spatial and stream type classifications. We identified potential reference sites in segments with unmodified vegetation cover adjacent to the stream and in >85% of the upstream catchment. We then used various landcover, amenity and environmental impact databases to eliminate sites that had potential anthropogenic influences upstream and that fell into a range of access classes. Each site identified by this process was coded by four dominant stream classes and seven zones, and 119 candidate sites were randomly selected for follow-up assessment. This process yielded 16 sites conforming to reference site criteria using a conditional-probabilistic design, and these were augmented by an additional 14 existing or special interest reference sites. Non-metric multidimensional scaling (NMS) analysis of percent abundance invertebrate data indicated significant differences in community composition among some of the zones and stream classes identified a priori providing qualified support for this framework in reference site selection. NMS analysis of a range standardised condition and diversity metrics derived from the invertebrate data indicated a core set of 26 closely related sites, and four outliers that were considered atypical of reference site conditions and subsequently dropped from the network. Use of GIS linked to stream typology, available spatial databases and aerial photography greatly enhanced the objectivity and efficiency of reference site selection. The multi-metric ordination approach reduced variability among stream types and bias associated with non-random site selection, and provided an effective way to identify representative reference sites.

  14. Blockage of High-Affinity Choline Transporter Increases Visceral Hypersensitivity in Rats with Chronic Stress

    PubMed Central

    2018-01-01

    Background Visceral hypersensitivity is a common feature of irritable bowel syndrome. Cholinergic system involves in the development of visceral hypersensitivity, and high-affinity choline transporter (CHT1) is of crucial importance in choline uptake system. However, involvement of CHT1 in visceral hypersensitivity remains unknown. The research aimed to study the CHT1 expression in dorsal root ganglions (DRGs) and the role of CHT1 in visceral hypersensitivity. Methods Repetitive water avoidance stress (WAS) was used to induce visceral hypersensitivity in rats. Colorectal distension (CRD) was determined, and the abdominal withdrawal reflex (AWR) and threshold intensity data were recorded to measure the visceral sensitivity. After intraperitoneal injection of hemicholinium-3 (HC-3), the specific inhibitor of CHT1, CRD data were also recorded. The CHT1 expression of DRGs was investigated by Western blotting, immunohistochemistry, and quantitative RT-PCR. Acetylcholine levels in the DRGs were detected by the assay kit. Results Repetitive WAS increased the AWR score of CRD at high distension pressure and decreased the mean threshold of rats. The CHT1 expression and acetylcholine concentration of DRG were significantly increased in WAS rats. After the administration of HC-3, the AWR score in WAS group was significantly increased at higher distension pressure while the threshold intensity was significantly reduced compared to the normal saline group. Acetylcholine concentration was significantly lower than the normal saline rats. Conclusion Our research firstly reports that CHT1 is overexpressed in noninflammatory visceral hypersensitivity, and blockage of CHT1 can enhance the visceral hypersensitivity. CHT1 may play an inhibitory role in visceral hypersensitivity. PMID:29849603

  15. Successful desensitization protocol for hypersensitivity reaction probably caused by dabrafenib in a patient with metastatic melanoma.

    PubMed

    Bar-Sela, Gil; Abu-Amna, Mahmoud; Hadad, Salim; Haim, Nissim; Shahar, Eduardo

    2015-09-01

    Vemurafenib and dabrafenib are both orally bioavailable small molecule agents that block mitogen activated protein kinase signalling in patients with melanoma and BRAF(V600E) mutation. Generalized hypersensitivity reactions to vemurafenib or dabrafenib have not been described. Continuing vemurafenib or dabrafenib therapy despite hypersensitivity reaction is especially important in patients with melanoma and BRAF(V600E) mutation, in whom this mutation plays a critical role in tumour growth. Desensitization protocols to overcome hypersensitivity reactions by gradual reintroduction of small amounts of the offending drug up to full therapeutic doses are available for many anti-cancer agents, including vemurafenib but, to the best of our knowledge, have not been reported for dabrafenib. We describe a patient with metastatic melanoma who developed Type I hypersensitivity reaction to vemurafenib and to subsequent treatment with dabrafenib, and who was successfully treated by drug desensitization which allowed safe prolonged continuation of dabrafenib. The development of hypersensitivity reactions for both dabrafenib and vemurafinib in the current case could be because these drugs have a similar chemical structure and cause a cross-reactivity. However, hypersensitivity reaction to a non-medicinal ingredient shared by the two drugs is also possible. Oral desensitization appears to be an option for patients with hypersensitivity Type I to dabrafenib. This approach may permit clinicians to safely administer dabrafenib to patients who experience hypersensitivity reactions to this life-prolonging medication. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Perceived food hypersensitivity relates to poor asthma control and quality of life in young non-atopic asthmatics.

    PubMed

    Johnson, Jennifer; Borres, Magnus P; Nordvall, Lennart; Lidholm, Jonas; Janson, Christer; Alving, Kjell; Malinovschi, Andrei

    2015-01-01

    The relationship between perceived food hypersensitivity in asthmatics, food allergen sensitization, asthma control and asthma-related quality of life has not been studied. Our aim was to study the prevalence of perceived food hypersensitivity in a cohort of young asthmatics, its relation to food allergen sensitization, and any correlation to asthma control and asthma-related quality of life. Perceived food hypersensitivity, as well as IgE sensitization to common food allergens, levels of exhaled nitric oxide (FeNO), and blood eosinophil counts (B-Eos) were assessed in 408 subjects (211 women) with asthma, aged (mean ± SEM) 20.4 ± 0.3 years. Subjects filled out the Asthma Control Test (ACT) and the Mini Asthma Quality of Life Questionnaire (Mini-AQLQ). Inflammation was assessed by means of FeNO and B-Eos. Fifty-three per cent of subjects reported food hypersensitivity. A corresponding food allergen sensitization was found in 68% of these subjects. Non-atopic subjects with perceived food hypersensitivity (n = 31) had lower ACT (19 (15 - 22) vs. 21 (20 - 23), p < 0.001) and Mini-AQLQ -scores (5.3 (4.3 - 6.1) vs. 6.1 (5.5 - 6.5), p < 0.001) than subjects with no food hypersensitivity (n = 190), despite lower levels of FeNO and B-Eos (p < 0.05). Food hypersensitivity was commonly reported among young asthmatics. In a majority of cases, a corresponding food allergen sensitization was found. A novel and clinically important finding was that non-atopic subjects with perceived food hypersensitivity were characterized by poorer asthma control and asthma-related quality of life.

  17. Comparison of two different forms of varnishes in the treatment of dentine hypersensitivity: a subject-blind randomised clinical study.

    PubMed

    Sethna, Gulnar Dara; Prabhuji, M L V; Karthikeyan, B V

    2011-01-01

    Dentine hypersensitivity is one of the most frequently recorded complaints of dental discomfort. Current evidence implicates patent dentinal tubules in hypersensitive dentine, and it follows that one effective way to reduce dentine sensitivity is to occlude the dentinal tubules. The purpose of this study was to compare the efficacy of two different desensitising agents, Cervitec varnish and Gluma varnish. Two hundred fifty patients self-reporting dentine hypersensitivity completed the paired split mouth randomised, subject-blind study. Each participant had a minimum of two sensitive teeth in at least two different quadrants and displaying a response of ≥3 cm to an evaporative stimulus. The hypersensitivity levels were measured with a tactile stimulus (scratchometer), thermal stimulus (cold water test), and an evaporative stimulus (air blast test) using a visual analogue scale. The teeth were evaluated immediately after treatment, and at 4 and 12 weeks after application of the chlorhexidine-containing varnish Cervitec and the glutaraldehyde-containing varnish, Gluma Desensitizer. Statistical analysis indicated that both the desensitising varnishes were effective in alleviating dentine hypersensitivity at all time intervals compared to baseline. There was a highly statistically significantly greater reduction in dentine hypersensitivity to evaporative stimulus, cold stimulus, and tactile stimulus after application of Cervitec than after Gluma Desensitizer (P < 0.001). Both the varnishes have a therapeutic potential to alleviate dentine hypersensitivity at all time intervals compared to baseline. However, Cervitec varnish is more efficacious in reducing dentine hypersensitivity than Gluma varnish at both 4 weeks and 12 weeks post-treatment.

  18. The glucocorticoid receptor regulates the binding of C/EPBbeta on the alpha-1-acid glycoprotein promoter in vivo.

    PubMed

    Savoldi, G; Fenaroli, A; Ferrari, F; Rigaud, G; Albertini, A; Di Lorenzo, D

    1997-12-01

    A complex interaction between the Glucocorticoid Receptor (GR), C/EBPbeta, and other transcription factors activate the Alpha-1 Acid Glycoprotein (AGP) promoter in HTC(JZ-1) rat hepatoma culture cells. This effect is mediated by the so-called Steroid Responsive Unit (SRU) of the AGP promoter that contains several binding sites for C/EBP transcription factors, some of which overlap with the Glucocorticoid Responsive Element (GRE). Our in vivo footprinting experiments revealed that the GRE- and the C/EBP-binding sites were already occupied glucocorticoid dependently in HTC(JZ-1) cells 10 min after dexamethasone administration (10(-6) M). Furthermore, local changes in the chromatine structure shown by the appearance of DNAse I hypersensitive sites (HS sites) also took place. These changes were probably dependent on a tissue-specific organization of the chromatine at the SRU because they were not detectable in a different glucocorticoid-responsive cell line (PC12) that did not express AGP. Here, we have also shown that withdrawal of dexamethasone or addition of the anti-glucocorticoid RU486 were able to revert the pattern induced by dexamethasone in vivo. The disappearance of the protected region and the hypersensitive sites, typical of the hormone activated promoter, confirmed the necessity of the GR to be bound by the agonist and the inability of the GR-antagonist complex to bind the DNA. By functional assays, we showed that the occupancy of the SRU by these transcriptional proteins in vivo correlated with the activation of the AGP gene transcription. With these results, we have shown that one of the functions of the GR to activate transcription of the AGP gene is to recruit C/EBPbeta and to maintain it bound at its target DNA sequences (SRU). This process was not accomplished by RU486.

  19. Parthenium dermatitis manifesting clinically as polymorphic light eruption and prurigo nodularis- like lesions with vasculitis-like picture on histopathology

    PubMed Central

    Lakshmi, Chembolli; Srinivas, C. R.; Pillai, Suma B.; Shanthakumari, S.

    2011-01-01

    Parthenium dermatitis is a widespread and distressing dermatoses in rural and urban India caused by the air borne allergen of the Compositae weed Parthenium hysterophorus. Parthenium dermatitis has been thought to be mediated solely by type IV hypersensitivity, but recently a combined immediate (type I) and delayed (type IV) hypersensitivity mechanism has been postulated in the initiation and perpetuation of parthenium dermatitis, especially in sensitized subjects with an atopic diathesis. Initially, the exposed sites of the body are involved. Later in the course of the disease, unexposed sites may get involved. Various clinical presentations have been described in parthenium dermatitis. Typically, it presents as an air borne contact dermatitis (ABCD) involving the eyelids and nasolabial folds Other presentations include a photodermatitis (essentially a pseudo photodermatitis), atopic dermatitis, seborrheic dermatitis, exfoliative dermatitis, hand dermatitis. Photosensitive lichenoid dermatitis and prurigo nodularis are rarer presentations. Uncommon presentations have been described in parthenium dermatitis. They include prurigo nodularis-like lesions and photosensitive lichenoid eruption. Three cases are presented, two of whom presented as polymorphic-like lesions and one as prurigo nodularis. All three patch tested positive to parthenium on Day 2. Prick testing was positive in two of the three patients. Parthenium dermatitis mimicking polymorphic light eruption has not been reported. Histopathology revealed vasculitis in the lesional skin in two of the patients. Although leukocytoclastic vasculitis has been reported earlier from the prick-tested site, this is the first report demonstrating the presence of vasculitis in lesional skin of parthenium dermatitis. PMID:23130236

  20. Euchromatin islands in large heterochromatin domains are enriched for CTCF binding and differentially DNA-methylated regions

    PubMed Central

    2012-01-01

    Background The organization of higher order chromatin is an emerging epigenetic mechanism for understanding development and disease. We and others have previously observed dynamic changes during differentiation and oncogenesis in large heterochromatin domains such as Large Organized Chromatin K (lysine) modifications (LOCKs), of histone H3 lysine-9 dimethylation (H3K9me2) or other repressive histone posttranslational modifications. The microstructure of these regions has not previously been explored. Results We analyzed the genome-wide distribution of H3K9me2 in two human pluripotent stem cell lines and three differentiated cells lines. We identified > 2,500 small regions with very low H3K9me2 signals in the body of LOCKs, which were termed as euchromatin islands (EIs). EIs are 6.5-fold enriched for DNase I Hypersensitive Sites and 8-fold enriched for the binding of CTCF, the major organizer of higher-order chromatin. Furthermore, EIs are 2–6 fold enriched for differentially DNA-methylated regions associated with tissue types (T-DMRs), reprogramming (R-DMRs) and cancer (C-DMRs). Gene ontology (GO) analysis suggests that EI-associated genes are functionally related to organ system development, cell adhesion and cell differentiation. Conclusions We identify the existence of EIs as a finer layer of epigenomic architecture within large heterochromatin domains. Their enrichment for CTCF sites and DNAse hypersensitive sites, as well as association with DMRs, suggest that EIs play an important role in normal epigenomic architecture and its disruption in disease. PMID:23102236

  1. LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub

    PubMed Central

    Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna

    2012-01-01

    The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246

  2. Characterization of the cutaneous mycobiota in healthy and allergic cats using next generation sequencing.

    PubMed

    Meason-Smith, Courtney; Diesel, Alison; Patterson, Adam P; Older, Caitlin E; Johnson, Timothy J; Mansell, Joanne M; Suchodolski, Jan S; Rodrigues Hoffmann, Aline

    2017-02-01

    Next generation sequencing (NGS) studies have demonstrated a diverse skin-associated microbiota and microbial dysbiosis associated with atopic dermatitis in people and in dogs. The skin of cats has yet to be investigated using NGS techniques. We hypothesized that the fungal microbiota of healthy feline skin would be similar to that of dogs, with a predominance of environmental fungi, and that fungal dysbiosis would be present on the skin of allergic cats. Eleven healthy cats and nine cats diagnosed with one or more cutaneous hypersensitivity disorders, including flea bite, food-induced and nonflea nonfood-induced hypersensitivity. Healthy cats were sampled at twelve body sites and allergic cats at six sites. DNA was isolated and Illumina sequencing was performed targeting the internal transcribed spacer region of fungi. Sequences were processed using the bioinformatics software QIIME. The most abundant fungal sequences from the skin of all cats were classified as Cladosporium and Alternaria. The mucosal sites, including nostril, conjunctiva and reproductive tracts, had the fewest number of fungi, whereas the pre-aural space had the most. Allergic feline skin had significantly greater amounts of Agaricomycetes and Sordariomycetes, and significantly less Epicoccum compared to healthy feline skin. The skin of healthy cats appears to have a more diverse fungal microbiota compared to previous studies, and a fungal dysbiosis is noted in the skin of allergic cats. Future studies assessing the temporal stability of the skin microbiota in cats will be useful in determining whether the microbiota sequenced using NGS are colonizers or transient microbes. © 2016 ESVD and ACVD.

  3. Water Quality of the Snake River and Five Eastern Tributaries in the Upper Snake River Basin, Grand Teton National Park, Wyoming, 1998-2002

    USGS Publications Warehouse

    Clark, Melanie L.; Sadler, Wilfrid J.; O'Ney, Susan E.

    2004-01-01

    To address water-resource management objectives of the National Park Service in Grand Teton National Park, the U.S. Geological Survey in cooperation with the National Park Service has conducted water-quality sampling in the upper Snake River Basin. Routine sampling of the Snake River was conducted during water years 1998-2002 to monitor the water quality of the Snake River through time. A synoptic study during 2002 was conducted to supplement the routine Snake River sampling and establish baseline water-quality conditions of five of its eastern tributaries?Pilgrim Creek, Pacific Creek, Buffalo Fork, Spread Creek, and Ditch Creek. Samples from the Snake River and the five tributaries were collected at 12 sites and analyzed for field measurements, major ions and dissolved solids, nutrients, selected trace metals, pesticides, and suspended sediment. In addition, the eastern tributaries were sampled for fecal-indicator bacteria by the National Park Service during the synoptic study. Major-ion chemistry of the Snake River varies between an upstream site above Jackson Lake near the northern boundary of Grand Teton National Park and a downstream site near the southern boundary of the Park, in part owing to the inputs from the eastern tributaries. Water type of the Snake River changes from sodium bicarbonate at the upstream site to calcium bicarbonate at the downstream site. The water type of the five eastern tributaries is calcium bicarbonate. Dissolved solids in samples collected from the Snake River were significantly higher at the upstream site (p-value<0.001), where concentrations in 43 samples ranged from 62 to 240 milligrams per liter, compared to the downstream site where concentrations in 33 samples ranged from 77 to 141 milligrams per liter. Major-ion chemistry of Pilgrim Creek, Pacific Creek, Buffalo Fork, Spread Creek, and Ditch Creek generally did not change substantially between the upstream sites near the National Park Service boundary with the National Forest and the downstream sites near the Snake River; however, variations in the major ions and dissolved solids existed between basins. Variations probably result from differences in geology between the tributary basins. Concentrations of dissolved ammonia, nitrite, and nitrate in all samples collected from the Snake River and the five eastern tributaries were less than water-quality criteria for surface waters in Wyoming. Concentrations of total nitrogen and total phosphorus in samples from the Snake River and the tributaries generally were less than median concentrations determined for undeveloped streams in the United States; however, concentrations in some samples did exceed ambient total-nitrogen and total-phosphorus criteria for forested mountain streams in the Middle Rockies ecoregion recommended by the U.S. Environmental Protection Agency to address cultural eutrophication. Sources for the excess nitrogen and phosphorus probably are natural because these basins have little development and cultivation. Concentrations of trace metals and pesticides were low and less than water-quality criteria for surface waters in Wyoming in samples collected from the Snake River and the five eastern tributaries. Atrazine, dieldrin, EPTC, or tebuthiuron were detected in estimated concentrations of 0.003 microgram per liter or less in 5 of 27 samples collected from the Snake River. An estimated concentration of 0.008 microgram per liter of metolachlor was detected in one sample from the Buffalo Fork. The estimated concentrations were less than the reporting levels for the pesticide analytical method. Suspended-sediment concentrations in 43 samples from the upstream site on the Snake River ranged from 1 to 604 milligrams per liter and were similar to suspended-sediment concentrations in 33 samples from the downstream site, which ranged from 1 to 648 milligrams per liter. Suspended-sediment concentrations in 38 samples collected from the tributary streams ranged from 1 t

  4. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  5. Environmental signatures and effects of an oil and gas wastewater spill in the Williston Basin, North Dakota.

    PubMed

    Cozzarelli, I M; Skalak, K J; Kent, D B; Engle, M A; Benthem, A; Mumford, A C; Haase, K; Farag, A; Harper, D; Nagel, S C; Iwanowicz, L R; Orem, W H; Akob, D M; Jaeschke, J B; Galloway, J; Kohler, M; Stoliker, D L; Jolly, G D

    2017-02-01

    Wastewaters from oil and gas development pose largely unknown risks to environmental resources. In January 2015, 11.4ML (million liters) of wastewater (300g/L TDS) from oil production in the Williston Basin was reported to have leaked from a pipeline, spilling into Blacktail Creek, North Dakota. Geochemical and biological samples were collected in February and June 2015 to identify geochemical signatures of spilled wastewaters as well as biological responses along a 44-km river reach. February water samples had elevated chloride (1030mg/L) and bromide (7.8mg/L) downstream from the spill, compared to upstream levels (11mg/L and <0.4mg/L, respectively). Lithium (0.25mg/L), boron (1.75mg/L) and strontium (7.1mg/L) were present downstream at 5-10 times upstream concentrations. Light hydrocarbon measurements indicated a persistent thermogenic source of methane in the stream. Semi-volatile hydrocarbons indicative of oil were not detected in filtered samples but low levels, including tetramethylbenzenes and di-methylnaphthalenes, were detected in unfiltered water samples downstream from the spill. Labile sediment-bound barium and strontium concentrations (June 2015) were higher downstream from the Spill Site. Radium activities in sediment downstream from the Spill Site were up to 15 times the upstream activities and, combined with Sr isotope ratios, suggest contributions from the pipeline fluid and support the conclusion that elevated concentrations in Blacktail Creek water are from the leaking pipeline. Results from June 2015 demonstrate the persistence of wastewater effects in Blacktail Creek several months after remediation efforts started. Aquatic health effects were observed in June 2015; fish bioassays showed only 2.5% survival at 7.1km downstream from the spill compared to 89% at the upstream reference site. Additional potential biological impacts were indicated by estrogenic inhibition in downstream waters. Our findings demonstrate that environmental signatures from wastewater spills are persistent and create the potential for long-term environmental health effects. Published by Elsevier B.V.

  6. Spatial and temporal patterns of micropollutants in streams and effluent of 24 WWTPs across Switzerland

    NASA Astrophysics Data System (ADS)

    Schönenberger, Urs; Spycher, Barbara; Kistler, David; Burdon, Frank; Reyes, Marta; Eggen, Rik; Joss, Adriano; Singer, Heinz; Stamm, Christian

    2016-04-01

    Treated municipal wastewater is an important source of micropollutants entering the environment. Micropollutants are a diverse range of chemicals of which concentrations vary strongly in space and time. To better quantitatively understand the spatio-temporal patterns of micropollutants in streams, we compared upstream and downstream locations at 24 wastewater treatment plants (WWTPs) across the Swiss Plateau and Jura regions. Each site represents the most upstream treatment plant in the corresponding catchment. In 2013, a broad analytical screening was applied to samples collected at 12 sites during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 at 12 additional sites were analysed for a group of approximately 60 selected organic micropollutants. The screening results demonstrate that generally, pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest share of the organic micropollutants in wastewater. Pesticides including biocides and plant protection products are also regularly found, but at lower concentrations. The opposite holds true for the concentration variability: pesticides vary the most across time and space, while pharmaceuticals exhibit more stable concentrations. Heavy metals fluctuate to a similar degree as pharmaceuticals. Principal component analyses suggest that pesticide and pharmaceutical levels at both upstream locations and in the wastewater vary independently of each other. At the upstream locations, the pesticide levels increased with the proportion of arable land in the watershed, whilst decreasing with greater cover of pasture and forest. Interestingly, the same patterns hold true for the composition of wastewater when considering land use in the catchments of the WWTPs. This suggests that pesticide-intensive agricultural crops not only impact surface water quality via diffuse pollution but also increase levels of pesticides in wastewater discharged to the streams. As a consequence, catchment land uses and effluent composition appear to be inextricably bound.

  7. Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

    PubMed Central

    González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina

    2018-01-01

    Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs from environmental hotspots such as discharge sites of pharmaceutical effluents. PMID:29387045

  8. Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

    PubMed Central

    Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

    1993-01-01

    The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

  9. Identification of American shad spawning sites and habitat use in the Pee Dee River, North Carolina and South Carolina

    USGS Publications Warehouse

    Harris, Julianne E.; Hightower, Joseph E.

    2011-01-01

    We examined spawning site selection and habitat use by American shad Alosa sapidissima in the Pee Dee River, North Carolina and South Carolina, to inform future management in this flow-regulated river. American shad eggs were collected in plankton tows, and the origin (spawning site) of each egg was estimated; relocations of radio-tagged adults on spawning grounds illustrated habitat use and movement in relation to changes in water discharge rates. Most spawning was estimated to occur in the Piedmont physiographic region within a 25-river-kilometer (rkm) section just below the lowermost dam in the system; however, some spawning also occurred downstream in the Coastal Plain. The Piedmont region has a higher gradient and is predicted to have slightly higher current velocities and shallower depths, on average, than the Coastal Plain. The Piedmont region is dominated by large substrates (e.g., boulders and gravel), whereas the Coastal Plain is dominated by sand. Sampling at night (the primary spawning period) resulted in the collection of young eggs (≤1.5 h old) that more precisely identified the spawning sites. In the Piedmont region, most radio-tagged American shad remained in discrete areas (average linear range = 3.6 rkm) during the spawning season and generally occupied water velocities between 0.20 and 0.69 m/s, depths between 1.0 and 2.9 m, and substrates dominated by boulder or bedrock and gravel. Tagged adults made only small-scale movements with changes in water discharge rates. Our results demonstrate that the upstream extent of migration and an area of concentrated spawning occur just below the lowermost dam. If upstream areas have similar habitat, facilitating upstream access for American shad could increase the spawning habitat available and increase the population's size.

  10. Bedload entrainment in low-gradient paraglacial coastal rivers of Maine, U.S.A.: Implications for habitat restoration

    NASA Astrophysics Data System (ADS)

    Snyder, Noah P.; Castele, Michael R.; Wright, Jed R.

    2009-02-01

    The rivers of coastal Maine flow through mainstem lakes and long low-gradient reaches that break the continuum of bedload transport expected in nonparaglacial landscapes. Stream erosion of glacial deposits supplies coarse sediment to these systems. The land use history includes intensive timber harvest and associated dam construction, which may have altered the frequency of substrate-mobilizing events. These watersheds are vital habitat for the last remaining wild anadromous Atlantic salmon in the United States. Future adjustments in channel morphology and habitat quality (via natural stream processes or restoration projects) depend on erosion, transport, and deposition of coarse sediment. These factors motivate our study of competence at four sites in the Sheepscot and Narraguagus watersheds. Three of the four sites behaved roughly similarly, with particle entrainment during intervals that include winter ice and spring flood conditions, and relatively minor bed mobilization during moderate floods in the summer and fall (with a recurrence interval of 2-3 years). The fourth site, on the Sheepscot River mainstem, exhibits more vigorous entrainment of marked particles and more complex three-dimensional channel morphology. This contrast is partially due to local geomorphic conditions that favor high shear stresses (particularly relatively steep gradient), but also likely to nourishment of the bedload saltation system by recruitment from an eroding glacial deposit upstream. Our results suggest that the frequency and magnitude of bedload transport are reach specific, depending on factors including local channel geometry, upstream sediment supply and transport, and formation of anchor ice. This presents a challenge for stream practitioners in this region: different reaches may require contrasting management strategies. Our results underscore the importance of understanding channel processes at a given site and assessing conditions upstream and downstream as a prerequisite for conducting habitat restoration projects.

  11. Bioavailability of Pb and Zn from mine tailings as indicated by erythrocyte aminolevulinic acid dehydratase (ALA-D) activity in suckers (Pisces: catostomidae)

    USGS Publications Warehouse

    Schmitt, Christopher J.; Dwyer, F. James; Finger, Susan E.

    1984-01-01

    The activity of the erythrocyte enzyme δ-aminolevulinic acid dehydratase (ALA-D) was measured in 35 catostomids (black redhorse, Moxostoma duquesnei; golden redhorse, M. erythrurum; northern hogsucker, Hypentelium nigricans) collected from three sites on a stream contaminated with Pb-, Cd-, and Zn-rich mine tailings and from an uncontaminated site upstream. Enzyme activity was expressed in terms of hemoglobin (Hb), DNA, and protein concentrations; these variables can be determined in the laboratory on once-frozen blood samples. Concentrations of Pb and Zn in blood and of Pb in edible tissues were significantly higher, and ALA-D activity was significantly lower, at all three contaminated sites than upstream. At the most contaminated site, ALA-D activity was 62–67% lower than upstream. Lead concentrations in the edible tissues and in blood were positively correlated (r = 0.80), whereas ALA-D activity was negatively correlated with Pb in blood (r = −0.70) and in edible tissues (r = −0.59). Five statistically significant relations between Pb and Zn in blood and ALA-D activity were determined. The two models that explained the highest percentage (> 74%) of the total variance also included factors related to Hb concentration. All five significant models included negative coefficients for variables that represented Pb in blood and positive coefficients for Zn in blood. The ALA-D assay with results standardized to Hb concentration represents an expedient alternative to the more traditional hematocrit standardization, and the measurement of ALA-D activity by this method can be used to document exposure of fish to environmental Pb.

  12. Pharmacovigilance of drug allergy and hypersensitivity using the ENDA-DAHD database and the GALEN platform. The Galenda project.

    PubMed

    Bousquet, P-J; Demoly, P; Romano, A; Aberer, W; Bircher, A; Blanca, M; Brockow, K; Pichler, W; Torres, M J; Terreehorst, I; Arnoux, B; Atanaskovic-Markovic, M; Barbaud, A; Bijl, A; Bonadonna, P; Burney, P G; Caimmi, S; Canonica, G W; Cernadas, J; Dahlen, B; Daures, J-P; Fernandez, J; Gomes, E; Gueant, J-L; Kowalski, M L; Kvedariene, V; Mertes, P-M; Martins, P; Nizankowska-Mogilnicka, E; Papadopoulos, N; Ponvert, C; Pirmohamed, M; Ring, J; Salapatas, M; Sanz, M L; Szczeklik, A; Van Ganse, E; De Weck, A L; Zuberbier, T; Merk, H F; Sachs, B; Sidoroff, A

    2009-02-01

    Nonallergic hypersensitivity and allergic reactions are part of the many different types of adverse drug reactions (ADRs). Databases exist for the collection of ADRs. Spontaneous reporting makes up the core data-generating system of pharmacovigilance, but there is a large under-estimation of allergy/hypersensitivity drug reactions. A specific database is therefore required for drug allergy and hypersensitivity using standard operating procedures (SOPs), as the diagnosis of drug allergy/hypersensitivity is difficult and current pharmacovigilance algorithms are insufficient. Although difficult, the diagnosis of drug allergy/hypersensitivity has been standardized by the European Network for Drug Allergy (ENDA) under the aegis of the European Academy of Allergology and Clinical Immunology and SOPs have been published. Based on ENDA and Global Allergy and Asthma European Network (GA(2)LEN, EU Framework Programme 6) SOPs, a Drug Allergy and Hypersensitivity Database (DAHD((R))) has been established under FileMaker((R)) Pro 9. It is already available online in many different languages and can be accessed using a personal login. GA(2)LEN is a European network of 27 partners (16 countries) and 59 collaborating centres (26 countries), which can coordinate and implement the DAHD across Europe. The GA(2)LEN-ENDA-DAHD platform interacting with a pharmacovigilance network appears to be of great interest for the reporting of allergy/hypersensitivity ADRs in conjunction with other pharmacovigilance instruments.

  13. Desensitizing Agent Reduces Dentin Hypersensitivity During Ultrasonic Scaling: A Pilot Study

    PubMed Central

    Suda, Tomonari; Akiyama, Toshiharu; Takano, Takuya; Gokyu, Misa; Sudo, Takeaki; Khemwong, Thatawee; Izumi, Yuichi

    2015-01-01

    Background Dentin hypersensitivity can interfere with optimal periodontal care by dentists and patients. The pain associated with dentin hypersensitivity during ultrasonic scaling is intolerable for patient and interferes with the procedure, particularly during supportive periodontal therapy (SPT) for patients with gingival recession. Aim This study proposed to evaluate the desensitizing effect of the oxalic acid agent on pain caused by dentin hypersensitivity during ultrasonic scaling. Materials and Methods This study involved 12 patients who were incorporated in SPT program and complained of dentin hypersensitivity during ultrasonic scaling. We examined the availability of the oxalic acid agent to compare the degree of pain during ultrasonic scaling with or without the application of the dentin hypersensitivity agent. Evaluation of effects on dentin hypersensitivity was determined by a questionnaire and visual analog scale (VAS) pain scores after ultrasonic scaling. The statistical analysis was performed using the paired Student t-test and Spearman rank correlation coefficient. Results The desensitizing agent reduced the mean VAS pain score from 69.33 ± 16.02 at baseline to 26.08 ± 27.99 after application. The questionnaire revealed that >80% patients were satisfied and requested the application of the desensitizing agent for future ultrasonic scaling sessions. Conclusion This study shows that the application of the oxalic acid agent considerably reduces pain associated with dentin hypersensitivity experienced during ultrasonic scaling. This pain control treatment may improve patient participation and treatment efficiency. PMID:26501012

  14. The scientific rationale and development of an optimized dentifrice for the treatment of dentin hypersensitivity.

    PubMed

    Tavss, Edward A; Fisher, Steven W; Campbell, Shannon; Bonta, Yolanda; Darcy-Siegel, Joann; Blackwell, Bernie L; Volpe, Anthony R; Miller, Steven E

    2004-02-01

    To describe the development of a new dentin hypersensitivity treatment, Colgate Sensitive Maximum Strength dentifrice, containing 5% potassium nitrate as the anti-hypersensitivity active agent. The objective was to develop a home-use hypersensitivity dentifrice that would be superior to the market leader, improving on what is available, which also contains 5% potassium nitrate as the anti-hypersensitivity active agent. In vivo (clinicals, taste evaluation and rat caries), in vitro (potassium flux) and analytical (rheology, dispensed volume, scanning electron microscopy, electron scanning chemical analysis and radioactive dentin abrasion) methods were performed. The objective was accomplished with the development of a new activated silica technology that resulted in enhanced potassium ion activity. In vitro documentation, supported by clinical studies, demonstrated that the resulting formula is more effective than the market leader for relief of hypersensitivity pain. Fast pain relief in less than 2 weeks and long-lasting protection against pain with regular use have also been clinically documented. Furthermore, FDA-required in vivo and in vitro studies indicate that this formula, which contains 0.45% stannous fluoride (1100 ppm fluoride) as the anti-caries active agent, is effective against caries. Good taste, acceptable rheology, acceptable abrasivity, and cosmetic and chemical stability have all been engineered into this unique dentin hypersensitivity treatment. In summary, a highly efficacious consumer friendly treatment for dentin hypersensitivity has been developed.

  15. Desensitizing Agent Reduces Dentin Hypersensitivity During Ultrasonic Scaling: A Pilot Study.

    PubMed

    Suda, Tomonari; Kobayashi, Hiroaki; Akiyama, Toshiharu; Takano, Takuya; Gokyu, Misa; Sudo, Takeaki; Khemwong, Thatawee; Izumi, Yuichi

    2015-09-01

    Dentin hypersensitivity can interfere with optimal periodontal care by dentists and patients. The pain associated with dentin hypersensitivity during ultrasonic scaling is intolerable for patient and interferes with the procedure, particularly during supportive periodontal therapy (SPT) for patients with gingival recession. This study proposed to evaluate the desensitizing effect of the oxalic acid agent on pain caused by dentin hypersensitivity during ultrasonic scaling. This study involved 12 patients who were incorporated in SPT program and complained of dentin hypersensitivity during ultrasonic scaling. We examined the availability of the oxalic acid agent to compare the degree of pain during ultrasonic scaling with or without the application of the dentin hypersensitivity agent. Evaluation of effects on dentin hypersensitivity was determined by a questionnaire and visual analog scale (VAS) pain scores after ultrasonic scaling. The statistical analysis was performed using the paired Student t-test and Spearman rank correlation coefficient. The desensitizing agent reduced the mean VAS pain score from 69.33 ± 16.02 at baseline to 26.08 ± 27.99 after application. The questionnaire revealed that >80% patients were satisfied and requested the application of the desensitizing agent for future ultrasonic scaling sessions. This study shows that the application of the oxalic acid agent considerably reduces pain associated with dentin hypersensitivity experienced during ultrasonic scaling. This pain control treatment may improve patient participation and treatment efficiency.

  16. Hypersensitivity reactions to penicillins: studies in a group of patients with negative benzylpenicillin G skin test.

    PubMed

    Qiao, H-L; Li, Z; Yang, J; Tian, X; Gao, N; Jia, L-J

    2009-06-01

    Although skin tests are usually employed to evaluate current penicillin allergy status, a negative result does not exclude hypersensitivity. There is a need for accurate in vitro tests to exclude hypersensitivity. A radioallergosorbent test (RAST) is a potentially good supplementary approach, but there is little information on the suitability of this method to diagnose penicillin hypersensitivity in subjects with a negative skin test to benzylpenicillin. A total of 133 patients with a negative skin test to benzylpenicillin G (PG) and all of whom developed allergic reactions to PG were studied. RAST was used to detect eight kinds of specific IgE antibodies to penicillins in serum, which included four kinds of major and minor antigenic determinants to four penicillin drugs. The combination sites for the specific IgE antibodies were studied by RAST inhibition test. The rate of positive reactions for the specific IgE antibodies was 59.40% (79/133). Of the eight kinds of antigenic determinants, the positive rates for specific IgE against the major and minor determinants were 39.10% (52) and 42.86% (57) respectively. Of the four drugs, positive cases only to PG were 10 (7.5%), were significantly fewer than the cross-reacting positive cases (36) to PG (P < 0.01). In the RAST inhibition studies all drugs exhibited good inhibitory potencies, and in some instances the side-chain of the penicillins could induce specific responses with a variable degree of cross-reactivity among the different penicillins. Radioallergosorbent test is a good complementary test in persons who are skin-test negative with PG, and the sensitivity of RAST increases with increasing specificity of IgE antibodies to be detected. 6-APA and the groups, making part of the different side-chains on penicillins, all contributed to the cross-reactivity.

  17. Low Dose Ionizing Radiation Modulates Immune Function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nelson, Gregory A.

    In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokinemore » secretion patterns characteristic of a “Th2 polarized” immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in the dose range of 5 to 50 cGy.« less

  18. 21 CFR 866.5500 - Hypersensitivity pneumonitis immunological test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5500 Hypersensitivity pneumonitis immunological test system. (a) Identification. A... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Hypersensitivity pneumonitis immunological test...

  19. Cervical dentin hypersensitivity: a cross-sectional investigation in Athens, Greece.

    PubMed

    Rahiotis, C; Polychronopoulou, A; Tsiklakis, K; Kakaboura, A

    2013-12-01

    The purpose of this study was to identify the prevalence of cervical dentin hypersensitivity in a cross-sectional investigation of Greek adults. Seven hundred and sixty-seven subjects were examined. Participants were patients processed for first examination in the Clinic of Oral Diagnosis and Radiology at the Faculty of Dentistry, University of Athens. The evaluation of hypersensitivity was performed using two methods: for each tooth, the response to a) tactile stimulus and b) air-blast stimulus was measured. Additional factors such as smoking habits, oral health behaviour, consumption of acidic foods, type of toothbrush, daily use of fluoride solution and of desensitising toothpaste, gingival recession and non-carious cervical lesions were recorded and evaluated as causative factors. Descriptive statistics on the demographics of the study sample, of oral health behaviour characteristics and of oral examination findings were performed. Comparisons of these characteristics in the presence or absence of hypersensitivity were conducted with the chi-square test. Data were further analysed using multiple logistic regression modelling. Among study participants, 21·3% had at least one cervical dentin hypersensitivity reaction to the tactile stimulus, and 38·6%, to the air-blast stimulus. Multivariate analysis detected association of the hypersensitivity in tactile or air-blast stimulus with the non-carious lesions and with the gingival recessions. Additionally, a relation between hypersensitivity and air-blast stimulus with gender (female) was found. There was no association between the hypersensitivity in both of the stimuli and the level of education, smoking, consumption of acidic foods, type of toothbrush and daily use of fluoride solution or desensitising toothpaste. The overall prevalence of cervical dentin hypersensitivity in the adult population in Athens ranged from 21·3% to 38·6% depending on the type of stimuli. Cervical non-carious lesions and gingival recessions were determined as significant predictors of dentin hypersensitivity. © 2013 John Wiley & Sons Ltd.

  20. Survival, transport, and sources of fecal bacteria in streams and survival in land-applied poultry litter in the upper Shoal Creek basin, southwestern Missouri, 2001-2002

    USGS Publications Warehouse

    Schumacher, John G.

    2003-01-01

    Densities of fecal coliform bacteria along a 5.7-mi (mile) reach of Shoal Creek extending upstream from State Highway 97 (site 3) to State Highway W (site 2) and in two tributaries along this reach exceeded the Missouri Department of Natural Resources (MDNR) standard of 200 col/100 mL (colonies per 100 milliliters) for whole-body contact recreation. A combination of techniques was used in this report to provide information on the source, transport, and survival of fecal bacteria along this reach of Shoal Creek. Results of water-quality samples collected during dye-trace and seepage studies indicated that at summer low base-flow conditions, pastured cattle likely were a substantial source of fecal bacteria in Shoal Creek at the MDNR monitoring site (site 3) at State Highway 97. Using repeat element Polymerase Chain Reaction (rep-PCR), cattle were the presumptive source of about 50 percent of the Escherichia coli (E. coli) isolates in water samples from site 3. Cattle, horses, and humans were the most common presumptive source of E. coli isolates at sites further upstream. Poultry was identified by rep-PCR as a major source of E. coli in Pogue Creek, a tributary in the upper part of the study area. Results of the rep-PCR were in general agreement with the detection and distribution of trace concentrations of organic compounds commonly associated with human wastewater, such as caffeine, the antimicrobial agent triclosan, and the pharmaceutical compounds acetaminophen and thiabendazole (a common cattle anthelmintic). Significant inputs of fecal bacteria to Shoal Creek occurred along a 1.6-mi reach of Shoal Creek immediately upstream from site 3. During a 36-hour period in July 2001, average densities of fecal coliform and E. coli bacteria increased from less than or equal to 500 col/100 mL upstream from this stream reach (sample site 2c) to 2,100 and 1,400 col/100 mL, respectively, at the MDNR sampling site. Fecal bacteria densities exhibited diurnal variability at all five sampling sites along the 5.7-mi study reach of Shoal Creek, but the trends at successive downstream sites were out of phase and could not be explained by simple advection and dispersion. At base-flow conditions, the travel time of bacteria in Shoal Creek along the 5.7-mi reach between State Highway W (site 2) and the MDNR sampling site (site 3) was about 26 hours. Substantial dispersion and dilution occurs along the upper 4.1 mi of this reach because of inflows from a number of springs and tributaries and the presence of several long pools and channel meanders. Minimal dispersion and dilution occurs along the 1.6-mi reach immediately upstream from the MDNR sampling site. Measurements of fecal bacteria decay in Shoal Creek during July 2001 indicated that about 8 percent of fecal coliform and E. coli bacteria decay each hour with an average first-order decay constant of 0.084 h-1 (per hour). Results of field test plots indicated that substantial numbers of fecal bacteria present in poul try litter can survive in fields for as much as 8 weeks after the application of the litter to the land surface. Median densities of fecal coliform and E. coli in slurry-water samples collected from fields increased from less than 60 col/100 mL before the application of turkey and broiler litter, to as large as 420,000 and 290,000 col/100 mL after the application of litter. Bacteria densities in the test plots generally decreased in a exponential manner over time with decay rates ranging from 0.085 to 0.185 d-1 (per day) for fecal coliform to between 0.100 and 0.250 d-1 for E. coli. The apparent survival of significant numbers of fecal bacteria on fields where poultry litter has been applied indicates that runoff from these fields is a potential source of fecal bacteria to vicinity streams for many weeks following litter application.

  1. Desensitization for Drug Hypersensitivity to Chemotherapy and Monoclonal Antibodies.

    PubMed

    Bonamichi-Santos, Rafael; Castells, Mariana

    2016-01-01

    Chemotherapies drugs and monoclonal antibodies are key components of the treatment of cancer patients and patients with chronic inflammatory conditions to provide increase in life expectancy and quality of life. Their increased use has lead to an increase in drugs hypersensitivity reactions (DHR) worldwide. DHR to those agents prevented their use and promoted the use of second line therapies to protect patients' hypersensitive reactions and anaphylaxis. Second line medications may not fully address the patients' medical condition and it is desirable to keep patients on first line therapy. Drug hypersensitivity symptoms can range from mild cutaneous reactions to life-threatening anaphylaxis. Rapid drug desensitization (RDD) is a novel approach to the management of drug hypersensitivity reactions which are IgE and non-IgE mediated. Through the diferent desensitization protocols patients can receive the full dose of the medications that they have presented a hypersensitive reaction and been protected against anaphylaxis. This review looks at the current literature on hypersensitivity reactions (HSR) to chemotherapy drugs and monoclonal antibodies and the potential use of RDD for their management. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  3. Skin Response to Delayed Hypersensitivity Testing in Persons With Unilateral Stroke-related Paresis: Implications for People With Spinal Cord Injury

    PubMed Central

    Trautner, Barbara W; Zimmermann, Kuno P; Squyres, Sara A; Darouiche, Rabih O

    2007-01-01

    Background: Vaccination rates among individuals with spinal cord injury (SCI) could be improved if it can be shown that vaccination performed on insensate areas is effective. This would eliminate the the risk of discomfort and soreness at the injection site. Objective: To determine whether immune responsiveness varies between areas with intact and impaired innervation in patients with stroke-related paresis. Design: Prospective trial in which each subject served as his or her own control. Setting: Rehabilitation wards and long-term care units at a Veterans Affairs Medical Center. Patients: Individuals with a history of cerebrovascular accident (CVA) affecting 1 side of the body. Methods: The Multitest cell-mediated immunity (CMI) and purified protein derivative (PPD) of tuberculin were administered intradermally to each arm of each subject. Main Outcome Measures: Total millimeters of induration in response to either test and positive vs negative responses to either test were compared between the 2 arms of each subject. Results: Response to delayed hypersensitivity testing did not differ between the arms affected and unaffected by CVA in each subject, and the time since CVA also did not affect the magnitude of the skin response. Conclusions: Skin testing for delayed hypersensitivity can be effectively administered in the paretic arms of persons who have experienced CVA. Although this study was performed in patients with stroke-related impairment, it has implications for vaccine administration in individuals with SCI-related neurologic deficits. PMID:17853658

  4. Disruption of δ-opioid receptor phosphorylation at threonine 161 attenuates morphine tolerance in rats with CFA-induced inflammatory hypersensitivity.

    PubMed

    Chen, Hai-Jing; Xie, Wei-Yan; Hu, Fang; Zhang, Ying; Wang, Jun; Wang, Yun

    2012-04-01

    Our previous study identified Threonine 161 (Thr-161), located in the second intracellular loop of the δ-opioid receptor (DOR), as the only consensus phosphorylation site for cyclin-dependent kinase 5 (Cdk5). The aim of this study was to assess the function of DOR phosphorylation by Cdk5 in complete Freund's adjuvant (CFA)-induced inflammatory pain and morphine tolerance. Dorsal root ganglion (DRG) neurons of rats with CFA-induced inflammatory pain were acutely dissociated and the biotinylation method was used to explore the membrane localization of phosphorylated DOR at Thr-161 (pThr-161-DOR), and paw withdrawal latency was measured after intrathecal delivery of drugs or Tat-peptide, using a radiant heat stimulator in rats with CFA-induced inflammatory pain. Both the total amount and the surface localization of pThr-161-DOR were significantly enhanced in the ipsilateral DRG following CFA injection. Intrathecal delivery of the engineered Tat fusion-interefering peptide corresponding to the second intracellular loop of DOR (Tat-DOR-2L) increased inflammatory hypersensitivity, and inhibited DOR- but not µ-opioid receptor-mediated spinal analgesia in CFA-treated rats. However, intrathecal delivery of Tat-DOR-2L postponed morphine antinociceptive tolerance in rats with CFA-induced inflammatory pain. Phosphorylation of DOR at Thr-161 by Cdk5 attenuates hypersensitivity and potentiates morphine tolerance in rats with CFA-induced inflammatory pain, while disruption of the phosphorylation of DOR at Thr-161 attenuates morphine tolerance.

  5. Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

    PubMed

    Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

    2003-04-01

    Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

  6. The possible influence of upstream upper-level baroclinic processes on the development of the QE II storm

    NASA Technical Reports Server (NTRS)

    Uccellini, L. W.

    1986-01-01

    An analysis of the QE II storm of September 9-11, 1978 presents evidence for the existence of upper-level baroclinic processes upstream of the rapidly developing cyclone. The analysis shows that a deepening shortwave trough was located 400 to 500 km upstream of the site of the storm 12 h prior to rapid cyclogenesis. The trough was associated with: (1) a polar jet marked by 65 m/s winds in its core and significant vertical and horizontal wind shear, (2) positive vorticity advection and divergence at the 300 mb level, and (3) an intense frontal zone that extended from 300 mb down to the surface. It also appears that a tropopause fold likely extruded stratospheric air down to the 700-800 mb level, 400-500 km upstream of the surface low and 12 h prior to the explosive development phase of the cyclone. These findings raise questions about Gyakum's (1983) assertion that the QE II storm developed in an area in which the baroclinic support was confined to the lower troposphere and the related assertion by Anthes et al. (1983) that upper-level forcing upstream of the area of rapid cyclogenesis was weak and apparently not important in this case.

  7. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  8. Natural history of perceived food hypersensitivity and IgE sensitisation to food allergens in a cohort of adults.

    PubMed

    Patelis, Antonios; Gunnbjörnsdottir, Maria; Borres, Magnus P; Burney, Peter; Gislason, Thorarinn; Torén, Kjell; Forsberg, Bertil; Alving, Kjell; Malinovschi, Andrei; Janson, Christer

    2014-01-01

    No longitudinal studies exist on the natural history of food hypersensitivity and IgE sensitisation to food allergens in adults. To examine the natural history of food hypersensitivity, the natural history of IgE sensitisation to food allergens and to investigate the risk factors for new onset food hypersensitivity. Food hypersensitivity was questionnaire-assessed in 2307 individuals (aged 20-45 years) from Iceland and Sweden during the European Community Respiratory Health Survey both at baseline and follow-up 9 years later. IgE food and aeroallergen sensitisation were assessed in a subgroup of these individuals (n = 807). Values of 0.35 kU/L and above were regarded as positive sensitisation. Food hypersensitivity was reported by 21% of the subjects and this proportion remained unchanged at follow-up (p = 0.58). Fruits, nuts and vegetables were the three most common causes of food hypersensitivity, with a similar prevalence at baseline and follow-up. The prevalence IgE sensitisation to food allergens decreased in general by 56% (p<0.001) and IgE sensitisation to peanut decreased in particular by 67% (p = 0.003). The prevalence of timothy grass IgE sensitisation decreased by 15% (p = 0.003) while cat, mite and birch IgE sensitisation did not decrease significantly. Female sex, rhinitis, eczema and presence of IgE sensitisation to aeroallergens were independently associated with new onset food hypersensitivity. The prevalence of food hypersensitivity remained unchanged while the prevalence of IgE sensitisation to food allergens decreased in adults over a 9-year follow-up period. The decrease in prevalence of IgE sensitisation to food allergens was considerably larger than the change in prevalence of IgE sensitisation to aeroallergens.

  9. Perceived Food Hypersensitivity Relates to Poor Asthma Control and Quality of Life in Young Non-Atopic Asthmatics

    PubMed Central

    Johnson, Jennifer; Borres, Magnus P.; Nordvall, Lennart; Lidholm, Jonas; Janson, Christer; Alving, Kjell; Malinovschi, Andrei

    2015-01-01

    Background The relationship between perceived food hypersensitivity in asthmatics, food allergen sensitization, asthma control and asthma-related quality of life has not been studied. Objective Our aim was to study the prevalence of perceived food hypersensitivity in a cohort of young asthmatics, its relation to food allergen sensitization, and any correlation to asthma control and asthma-related quality of life. Methods Perceived food hypersensitivity, as well as IgE sensitization to common food allergens, levels of exhaled nitric oxide (FeNO), and blood eosinophil counts (B-Eos) were assessed in 408 subjects (211 women) with asthma, aged (mean ± SEM) 20.4 ± 0.3 years. Subjects filled out the Asthma Control Test (ACT) and the Mini Asthma Quality of Life Questionnaire (Mini-AQLQ). Inflammation was assessed by means of FeNO and B-Eos. Results Fifty-three per cent of subjects reported food hypersensitivity. A corresponding food allergen sensitization was found in 68% of these subjects. Non-atopic subjects with perceived food hypersensitivity (n = 31) had lower ACT (19 (15 - 22) vs. 21 (20 - 23), p < 0.001) and Mini-AQLQ -scores (5.3 (4.3 - 6.1) vs. 6.1 (5.5 - 6.5), p < 0.001) than subjects with no food hypersensitivity (n = 190), despite lower levels of FeNO and B-Eos (p < 0.05). Conclusions and Clinical Relevance Food hypersensitivity was commonly reported among young asthmatics. In a majority of cases, a corresponding food allergen sensitization was found. A novel and clinically important finding was that non-atopic subjects with perceived food hypersensitivity were characterized by poorer asthma control and asthma-related quality of life. PMID:25923451

  10. Cost-effectiveness analysis of HLA B*5701 genotyping in preventing abacavir hypersensitivity.

    PubMed

    Hughes, Dyfrig A; Vilar, F Javier; Ward, Charlotte C; Alfirevic, Ana; Park, B Kevin; Pirmohamed, Munir

    2004-06-01

    Abacavir, a human immunodeficiency virus-1 (HIV-1) nucleoside-analogue reverse transcriptase inhibitor, causes severe hypersensitivity in 4-8% of patients. HLA B*5701 is a known genetic risk factor for abacavir hypersensitivity in Caucasians. Our aim was to confirm the presence of this genetic factor in our patients, and to determine whether genotyping for HLA B*5701 would be a cost-effective use of healthcare resources. Patients with and without abacavir hypersensitivity were identified from a UK HIV clinic. Patients were genotyped for HLA B*5701, and pooled data used for calculation of test characteristics. The cost-effectiveness analysis incorporated the cost of testing, cost of treating abacavir hypersensitivity, and the cost and selection of alternative antiretroviral regimens. A probabilistic decision analytic model (comparing testing versus no testing) was formulated and Monte Carlo simulations performed. Of the abacavir hypersensitive patients, six (46%) were HLA B*5701 positive, compared to five (10%) of the non-hypersensitive patients (odds ratio 7.9 [95% confidence intervals 1.5-41.4], P = 0.006). Pooling of our data on HLA B*5701 with published data resulted in a pooled odds ratio of 29 (95% CI 6.4-132.3; P < 0.0001). The cost-effectiveness model demonstrated that depending on the choice of comparator, routine testing for HLA B*5701 ranged from being a dominant strategy (less expensive and more beneficial than not testing) to an incremental cost-effectiveness ratio (versus no testing) of Euro 22,811 per hypersensitivity reaction avoided. Abacavir hypersensitivity is associated with HLA B*5701, and pre-prescription pharmacogenetic testing for this appears to be a cost-effective use of healthcare resources.

  11. Natural History of Perceived Food Hypersensitivity and IgE Sensitisation to Food Allergens in a Cohort of Adults

    PubMed Central

    Patelis, Antonios; Gunnbjörnsdottir, Maria; Borres, Magnus P.; Burney, Peter; Gislason, Thorarinn; Torén, Kjell; Forsberg, Bertil; Alving, Kjell

    2014-01-01

    Background No longitudinal studies exist on the natural history of food hypersensitivity and IgE sensitisation to food allergens in adults. Objective To examine the natural history of food hypersensitivity, the natural history of IgE sensitisation to food allergens and to investigate the risk factors for new onset food hypersensitivity. Methods Food hypersensitivity was questionnaire-assessed in 2307 individuals (aged 20–45 years) from Iceland and Sweden during the European Community Respiratory Health Survey both at baseline and follow-up 9 years later. IgE food and aeroallergen sensitisation were assessed in a subgroup of these individuals (n = 807). Values of 0.35 kU/L and above were regarded as positive sensitisation. Results Food hypersensitivity was reported by 21% of the subjects and this proportion remained unchanged at follow-up (p = 0.58). Fruits, nuts and vegetables were the three most common causes of food hypersensitivity, with a similar prevalence at baseline and follow-up. The prevalence IgE sensitisation to food allergens decreased in general by 56% (p<0.001) and IgE sensitisation to peanut decreased in particular by 67% (p = 0.003). The prevalence of timothy grass IgE sensitisation decreased by 15% (p = 0.003) while cat, mite and birch IgE sensitisation did not decrease significantly. Female sex, rhinitis, eczema and presence of IgE sensitisation to aeroallergens were independently associated with new onset food hypersensitivity. Conclusion The prevalence of food hypersensitivity remained unchanged while the prevalence of IgE sensitisation to food allergens decreased in adults over a 9-year follow-up period. The decrease in prevalence of IgE sensitisation to food allergens was considerably larger than the change in prevalence of IgE sensitisation to aeroallergens. PMID:24427301

  12. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    PubMed Central

    2010-01-01

    Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

  13. Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

    PubMed

    Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

    2010-07-04

    Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  14. Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

    USDA-ARS?s Scientific Manuscript database

    The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

  15. Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

    NASA Technical Reports Server (NTRS)

    Nordheim, A.; Rich, A.

    1983-01-01

    Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

  16. The 5S RNA gene minichromosome of Euplotes.

    PubMed Central

    Roberson, A E; Wolffe, A P; Hauser, L J; Olins, D E

    1989-01-01

    The macronucleus of the ciliated protozoan Euplotes eurystomus contains about 10(6) copies of a single type of 5S ribosomal RNA gene. This 5S gene DNA is only 930 bp long, is flanked by telomeres, and contains a single coding region of 120 bp which serves as a template for transcription in vivo and in vitro. The 5S gene minichromatin possesses four positioned nucleosomes and hypersensitive cleavage sites in the telomeric regions. Images PMID:2501759

  17. [Light protection for xeroderma pigmentosum].

    PubMed

    Ettinger, M; Berneburg, M

    2017-05-01

    Xeroderma pigmentosum is a rare autosomal recessive disorder which is caused by germinal mutations responsible for the repair of ultraviolet (UV) radiation-induced DNA lesions. It is characterized by hypersensitivity to UV radiation, poikiloderma, ocular surface disease, and in some patients pronounced sunburn and neurological disease. Patients have a very high risk of developing ocular and skin cancer on exposed body sites. No cure is available for these patients except complete protection from all types of UV radiation.

  18. DFR1-Mediated Inhibition of Proline Degradation Pathway Regulates Drought and Freezing Tolerance in Arabidopsis.

    PubMed

    Ren, Yongbing; Miao, Min; Meng, Yun; Cao, Jiasheng; Fan, Tingting; Yue, Junyang; Xiao, Fangming; Liu, Yongsheng; Cao, Shuqing

    2018-06-26

    Proline accumulation is one of the most important adaptation mechanisms for plants to cope with environmental stresses, such as drought and freezing. However, the molecular mechanism of proline homeostasis under these stresses is largely unknown. Here, we identified a mitochondrial protein, DFR1, involved in the inhibition of proline degradation in Arabidopsis. DFR1 was strongly induced by drought and cold stresses. The dfr1 knockdown mutants showed hypersensitivity to drought and freezing stresses, whereas the DFR1 overexpression plants exhibited enhanced tolerance, which was positively correlated with proline levels. DFR1 interacts with proline degradation enzymes PDH1/2 and P5CDH and compromises their activities. Genetic analysis showed that DFR1 acts upstream of PDH1/2 and P5CDH to positively regulate proline accumulation. Our results demonstrate a regulatory mechanism by which, under drought and freezing stresses, DFR1 interacts with PDH1/2 and P5CDH to abrogate their activities to maintain proline homeostasis, thereby conferring drought and freezing tolerance. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Pten Cell Autonomously Modulates the Hematopoietic Stem Cell Response to Inflammatory Cytokines.

    PubMed

    Porter, Shaina N; Cluster, Andrew S; Signer, Robert A J; Voigtmann, Jenna; Monlish, Darlene A; Schuettpelz, Laura G; Magee, Jeffrey A

    2016-06-14

    Pten negatively regulates the phosphatidylinositol 3-kinase (PI3K) pathway and is required to maintain quiescent adult hematopoietic stem cells (HSCs). Pten has been proposed to regulate HSCs cell autonomously and non-cell autonomously, but the relative importance of each mechanism has not been directly tested. Furthermore, the cytokines that activate the PI3K pathway upstream of Pten are not well defined. We sought to clarify whether Pten cell autonomously or non-cell autonomously regulates HSC mobilization. We also tested whether Pten deficiency affects the HSC response to granulocyte colony-stimulating factor (G-CSF) and interferon-α (IFNα) since these cytokines induce HSC mobilization or proliferation, respectively. We show that Pten regulates HSC mobilization and expansion in the spleen primarily via cell-autonomous mechanisms. Pten-deficient HSCs do not require G-CSF to mobilize, although they are hyper-sensitized to even low doses of exogenous G-CSF. Pten-deficient HSCs are similarly sensitized to IFNα. Pten therefore modulates the HSC response to inflammatory cytokines. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Control of seed dormancy and germination by DOG1-AHG1 PP2C phosphatase complex via binding to heme.

    PubMed

    Nishimura, Noriyuki; Tsuchiya, Wataru; Moresco, James J; Hayashi, Yuki; Satoh, Kouji; Kaiwa, Nahomi; Irisa, Tomoko; Kinoshita, Toshinori; Schroeder, Julian I; Yates, John R; Hirayama, Takashi; Yamazaki, Toshimasa

    2018-06-06

    Abscisic acid (ABA) regulates abiotic stress and developmental responses including regulation of seed dormancy to prevent seeds from germinating under unfavorable environmental conditions. ABA HYPERSENSITIVE GERMINATION1 (AHG1) encoding a type 2C protein phosphatase (PP2C) is a central negative regulator of ABA response in germination; however, the molecular function and regulation of AHG1 remain elusive. Here we report that AHG1 interacts with DELAY OF GERMINATION1 (DOG1), which is a pivotal positive regulator in seed dormancy. DOG1 acts upstream of AHG1 and impairs the PP2C activity of AHG1 in vitro. Furthermore, DOG1 has the ability to bind heme. Binding of DOG1 to AHG1 and heme are independent processes, but both are essential for DOG1 function in vivo. Our study demonstrates that AHG1 and DOG1 constitute an important regulatory system for seed dormancy and germination by integrating multiple environmental signals, in parallel with the PYL/RCAR ABA receptor-mediated regulatory system.

  1. Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

    PubMed

    Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

    2018-04-01

    In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

    PubMed

    Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

    2016-03-18

    Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

  3. Spatial and temporal trends in PCBs in sediment along the lower Rhone River, France

    USGS Publications Warehouse

    Desmet, Marc; Mourier, Brice; Mahler, Barbara J.; Van Metre, Peter C.; Roux, Gwenaelle; Persat, Henri; Lefevre, Irene; Peretti, Annie; Chapron, Emmanuel; Anaelle, Simonneau; Miege, Cecile; Babut, Marc

    2012-01-01

    Despite increasingly strict control of polychlorinated biphenyl (PCB) releases in France since the mid-1970s, PCB contamination of fish recently has emerged as a major concern in the lower Rhone River basin. We measured PCB concentrations in Rhone sediment to evaluate the effects of PCB releases from major urban and industrial areas, sediment redistribution by large floods, and regulatory controls on PCB trends from 1970 to present. Profiles of PCBs (the sum of seven indicator PCB congeners) were reconstructed from sediment cores collected from an off-river rural reference site and from three depositional areas along the Rhone upstream and downstream from the city of Lyon, France. Core chronology was determined from radionuclide profiles and flood deposits. PCB concentrations increased progressively in the downstream direction, and reached a maximum concentration in 1991 of 281 μg/kg at the most downstream site. At the rural reference site and at the upstream Rhone site, PCB concentrations peaked in the 1970s (maximum concentration of 13 and 78 μg/kg, respectively) and have decreased exponentially since then. PCB concentrations in the middle and downstream cores were elevated into the early 1990s, decreased very rapidly until 2000, and since then have remained relatively stable. Congener profiles for three time windows (1965–80, 1986–93, and 2000–08) were similar in the three sediment cores from the Rhone and different from those at the rural reference site. The results indicate that permitted discharges from a hazardous-waste treatment facility upstream from Lyon might have contributed to high concentrations into the 1980-90s, but that industrial discharges from the greater Lyon area and tributaries to the Rhone near Lyon have had a greater contribution since the 1990s. There is little indication that PCB concentration in sediments downstream from Lyon will decrease over at least the short term.

  4. Pre-clinical methods for detecting the hypersensitivity potential of pharmaceuticals: regulatory considerations.

    PubMed

    Hastings, K L

    2001-02-02

    Immune-based systemic hypersensitivities account for a significant number of adverse drug reactions. There appear to be no adequate nonclinical models to predict systemic hypersensitivity to small molecular weight drugs. Although there are very good methods for detecting drugs that can induce contact sensitization, these have not been successfully adapted for prediction of systemic hypersensitivity. Several factors have made the development of adequate models difficult. The term systemic hypersensitivity encompases many discrete immunopathologies. Each type of immunopathology presumably is the result of a specific cluster of immunologic and biochemical phenomena. Certainly other factors, such as genetic predisposition, metabolic idiosyncrasies, and concomitant diseases, further complicate the problem. Therefore, it may be difficult to find common mechanisms upon which to construct adequate models to predict specific types of systemic hypersensitivity reactions. There is some reason to hope, however, that adequate methods could be developed for at least identifying drugs that have the potential to produce signs indicative of a general hazard for immune-based reactions.

  5. Reflux Hypersensitivity: A New Functional Esophageal Disorder

    PubMed Central

    Yamasaki, Takahisa; Fass, Ronnie

    2017-01-01

    Reflux hypersensitivity, recently introduced by Rome IV as a new functional esophageal disorder, is currently considered as the presence of typical heartburn symptoms in patients with normal upper endoscopy and esophageal biopsies, normal esophageal pH test and with evidence of a close correlation between patients’ heartburn and reflux events. Reflux hypersensitivity is very common and together with functional heartburn accounts for more than 90% of the heartburn patients who failed treatment with proton pump inhibitor twice daily. In addition, reflux hypersensitivity affects primarily young to middle aged women, commonly overlaps with another functional gastrointestinal disorders, and is often associated with some type of psychological comorbidity. Diagnosis is made by using endoscopy with esophageal biopsies, pH-impedance, and high-resolution esophageal manometry. Reflux hypersensitivity is primarily treated with esophageal neuromodulators, such as tricyclic anti-depressants and selective serotonin reuptake inhibitors among others. Surgical anti-reflux management may also play an important role in the treatment of reflux hypersensitivity. PMID:28992673

  6. A diagnostic model for chronic hypersensitivity pneumonitis

    PubMed Central

    Johannson, Kerri A; Elicker, Brett M; Vittinghoff, Eric; Assayag, Deborah; de Boer, Kaïssa; Golden, Jeffrey A; Jones, Kirk D; King, Talmadge E; Koth, Laura L; Lee, Joyce S; Ley, Brett; Wolters, Paul J; Collard, Harold R

    2017-01-01

    The objective of this study was to develop a diagnostic model that allows for a highly specific diagnosis of chronic hypersensitivity pneumonitis using clinical and radiological variables alone. Chronic hypersensitivity pneumonitis and other interstitial lung disease cases were retrospectively identified from a longitudinal database. High-resolution CT scans were blindly scored for radiographic features (eg, ground-glass opacity, mosaic perfusion) as well as the radiologist’s diagnostic impression. Candidate models were developed then evaluated using clinical and radiographic variables and assessed by the cross-validated C-statistic. Forty-four chronic hypersensitivity pneumonitis and eighty other interstitial lung disease cases were identified. Two models were selected based on their statistical performance, clinical applicability and face validity. Key model variables included age, down feather and/or bird exposure, radiographic presence of ground-glass opacity and mosaic perfusion and moderate or high confidence in the radiographic impression of chronic hypersensitivity pneumonitis. Models were internally validated with good performance, and cut-off values were established that resulted in high specificity for a diagnosis of chronic hypersensitivity pneumonitis. PMID:27245779

  7. In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

    PubMed

    Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

    1996-03-01

    In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

  8. A comparison of dentifrices for clinical relief from dentin hypersensitivity using the Jay Sensitivity Sensor Probe.

    PubMed

    Hegde, Shashikanth; Rao, B H Sripathi; Kakar, Ravish Chander; Kakar, Ashish

    2013-05-01

    To evaluate the clinical relief from dentin hypersensitivity among subjects provided with a dentifrice formulated with 8% arginine, calcium carbonate and 1,000 ppm fluoride [sodium monofluorophosphate (MFP)] in comparison to those issued a commercially available dentifrice containing 1,000 ppm fluoride [as sodium monofluorophosphate (MFP)]. Clinical evaluations for hypersensitivity were performed with a novel tactile hypersensitivity measuring instrument--the Jay Sensitivity Sensor (Jay) Probe--in conjunction with evaporative triggers by air blast (Schiff scale) and Visual Analog Scores (VAS). Qualified adults from the Mangalore, India area who presented two teeth with dentin hypersensitivity were enrolled for this double-blind, randomized, parallel, controlled clinical trial conducted in an outpatient clinical setting. At baseline, dentin hypersensitivity was evaluated by the Jay Probe (tactile), air blast and VAS methods. Subjects were randomly issued a study dentifrice and instructed to brush their teeth for 1 minute twice daily with the provided dentifrice. Clinical evaluations for hypersensitivity were repeated after 2, 4 and 8 weeks of product use. 86 subjects (35 males and 51 females) complied with the study protocol and completed the entire study. At each recall visit, both treatment groups demonstrated significant reductions in dentin hypersensitivity from their corresponding baselines (P < 0.05). Subjects assigned the 8% arginine, calcium carbonate and 1,000 ppm fluoride dentifrice demonstrated statistically significant reductions in responses to tactile stimuli, air blast, and VAS responses in comparison to those using the dentifrice containing 1,000 ppm fluoride after 2, 4, and 8 weeks, respectively.

  9. Hypersensitivity reactions in patients receiving hemodialysis.

    PubMed

    Butani, Lavjay; Calogiuri, Gianfranco

    2017-06-01

    To describe hypersensitivity reactions in patients receiving maintenance hemodialysis. PubMed search of articles published during the past 30 years with an emphasis on publications in the past decade. Case reports and review articles describing hypersensitivity reactions in the context of hemodialysis. Pharmacologic agents are the most common identifiable cause of hypersensitivity reactions in patients receiving hemodialysis. These include iron, erythropoietin, and heparin, which can cause anaphylactic or pseudoallergic reactions, and topical antibiotics and anesthetics, which lead to delayed-type hypersensitivity reactions. Many hypersensitivity reactions are triggered by complement activation and increased bradykinin resulting from contact system activation, especially in the context of angiotensin-converting enzyme inhibitor use. Several alternative pharmacologic preparations and dialyzer membranes are available, such that once an etiology for the reaction is established, recurrences can be prevented without affecting the quality of care provided to patients. Although hypersensitivity reactions are uncommon in patients receiving hemodialysis, they can be life-threatening. Moreover, considering the large prevalence of the end-stage renal disease population, the implications of such reactions are enormous. Most reactions are pseudoallergic and not mediated by immunoglobulin E. The multiplicity of potential exposures and the complexity of the environment to which patients on dialysis are exposed make it challenging to identify the precise cause of these reactions. Great diligence is needed to investigate hypersensitivity reactions to avoid recurrence in this high-risk population. Copyright © 2017 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  10. Analysis of ambient conditions and simulation of hydrodynamics and water-quality characteristics in Beaver Lake, Arkansas, 2001 through 2003

    USGS Publications Warehouse

    Galloway, Joel M.; Green, W. Reed

    2006-01-01

    Beaver Lake is a large, deep-storage reservoir located in the upper White River Basin in northwestern Arkansas. The purpose of this report is to describe the ambient hydrologic and water-quality conditions in Beaver Lake and its inflows and describe a two-dimensional model developed to simulate the hydrodynamics and water quality of Beaver Lake from 2001 through 2003. Water-quality samples were collected at the three main inflows to Beaver Lake; the White River near Fayetteville, Richland Creek at Goshen, and War Eagle Creek near Hindsville. Nutrient concentrations varied among the tributaries because of land use and contributions of nutrients from point sources. The median concentrations of total ammonia plus organic nitrogen were greater for the White River than Richland and War Eagle Creeks. The greatest concentrations of nitrite plus nitrate and total nitrogen, however, were observed at War Eagle Creek. Phosphorus concentrations were relatively low, with orthophosphorus and dissolved phosphorus concentrations mostly below the laboratory reporting limit at the three sites. War Eagle Creek had significantly greater median orthophosphorus and total phosphorus concentrations than the White River and Richland Creek. Dissolved organic-carbon concentrations were significantly greater at the White River than at War Eagle and Richland Creeks. The White River also had significantly greater turbidity than War Eagle Creek and Richland Creek. The temperature distribution in Beaver Lake exhibits the typical seasonal cycle of lakes and reservoirs located within similar latitudes. Beaver Lake is a monomictic system, in which thermal stratification occurs annually during the summer and fall and complete mixing occurs in the winter. Isothermal conditions exist throughout the winter and early spring. Nitrogen concentrations varied temporally, longitudinally, and vertically in Beaver Lake for 2001 through 2003. Nitrite plus nitrate concentrations generally decreased from the upstream portion of Beaver Lake to the downstream portion and generally were greater in the hypolimnion. Total ammonia plus organic nitrogen concentrations also decreased from the upstream end of Beaver Lake to the downstream end and were substantially greater in the hypolimnion of Beaver Lake. Phosphorus concentrations mostly were near or below laboratory detection limits in the epilimnion and metalimnion in Beaver Lake and were substantially greater in the hypolimnion in the upstream and middle parts of the reservoir. Measured total and dissolved organic carbon in Beaver Lake was relatively uniform spatially, longitudinally, and vertically in the reservoir from January 2001 through December 2003. Chlorophyll a concentrations measured at sites in the upstream portion of the lake were significantly greater than at the other sites in the downstream portion of Beaver Lake. During the study period, water clarity in Beaver Lake was significantly greater at the downstream end of the reservoir than at the upstream end. The greatest Secchi depths at the downstream end of the reservoir generally were observed in 2001 compared to 2002 and 2003, but did not have a seasonal pattern as observed at sites in the middle and upstream portion of the reservoir. Similar to Secchi depth results, turbidity results indicated greater water clarity in the downstream portion of Beaver Lake compared to the upstream portion. Turbidity also was greater in the hypolimnion than in the epilimnion in the reservoir during the stratification season. A two-dimensional, laterally averaged, hydrodynamic, and water-quality model using CE-QUAL-W2 Version 3.1 was developed for Beaver Lake and calibrated based on vertical profiles of temperature and dissolved oxygen, and water-quality constituent concentrations collected at various depths at four sites in the reservoir from April 2001 to April 2003. Simulated temperatures and dissolved-oxygen concentrations compared reasonably well with measured t

  11. 21 CFR 866.5500 - Hypersensitivity pneumonitis immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... system. 866.5500 Section 866.5500 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... Systems § 866.5500 Hypersensitivity pneumonitis immunological test system. (a) Identification. A hypersensitivity pneumonitis immunological test system is a device that consists of the reagents used to measure by...

  12. 21 CFR 866.5500 - Hypersensitivity pneumonitis immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... system. 866.5500 Section 866.5500 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... Systems § 866.5500 Hypersensitivity pneumonitis immunological test system. (a) Identification. A hypersensitivity pneumonitis immunological test system is a device that consists of the reagents used to measure by...

  13. 21 CFR 866.5500 - Hypersensitivity pneumonitis immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... system. 866.5500 Section 866.5500 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... Systems § 866.5500 Hypersensitivity pneumonitis immunological test system. (a) Identification. A hypersensitivity pneumonitis immunological test system is a device that consists of the reagents used to measure by...

  14. 21 CFR 866.5500 - Hypersensitivity pneumonitis immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... system. 866.5500 Section 866.5500 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... Systems § 866.5500 Hypersensitivity pneumonitis immunological test system. (a) Identification. A hypersensitivity pneumonitis immunological test system is a device that consists of the reagents used to measure by...

  15. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  16. Numerical simulation of vertical ground-water flux of the Rio Grande from ground-water temperature profiles, central New Mexico

    USGS Publications Warehouse

    Bartolino, James R.; Niswonger, Richard G.

    1999-01-01

    An important gap in the understanding of the hydrology of the Middle Rio Grande Basin, central New Mexico, is the rate at which water from the Rio Grande recharges the Santa Fe Group aquifer system. Several methodologies-including use of the Glover-Balmer equation, flood pulses, and channel permeameters- have been applied to this problem in the Middle Rio Grande Basin. In the work presented here, ground-water temperature profiles and ground-water levels beneath the Rio Grande were measured and numerically simulated at four sites. The direction and rate of vertical ground-water flux between the river and underlying aquifer was simulated and the effective vertical hydraulic conductivity of the sediments underlying the river was estimated through model calibration. Seven sets of nested piezometers were installed during July and August 1996 at four sites along the Rio Grande in the Albuquerque area, though only four of the piezometer nests were simulated. In downstream order, these four sites are (1) the Bernalillo site, upstream from the New Mexico State Highway 44 bridge in Bernalillo (piezometer nest BRN02); (2) the Corrales site, upstream from the Rio Rancho sewage treatment plant in Rio Rancho (COR01); (3) the Paseo del Norte site, upstream from the Paseo del Norte bridge in Albuquerque (PDN01); and (4) the Rio Bravo site, upstream from the Rio Bravo bridge in Albuquerque (RBR01). All piezometers were completed in the inner-valley alluvium of the Santa Fe Group aquifer system. Ground-water levels and temperatures were measured in the four piezometer nests a total of seven times in the 24-month period from September 1996 through August 1998. The flux between the surface- and ground-water systems at each of the field sites was quantified by one-dimensional numerical simulation of the water and heat exchange in the subsurface using the heat and water transport model VS2DH. Model calibration was aided by the use of PEST, a model-independent computer program that uses nonlinear parameter estimation. Mean vertical hydraulic conductivities were estimated by model calibration and range from 1.5x10-5 to 5.8x10-6 meters per second (m/s). Mean simulated vertical ground-water flux for the BRN02 piezometer nest is 3.30x10-7 m/s; for the COR01 piezometer nest is 3.58x10-7 m/s; for the PDN01 piezometer nest is 4.22x10- 7 m/s; and for the RBR01 piezometer nest is 2.05x10-7 m/s. Comparison of the simulated vertical fluxes and vertical hydraulic conductivities derived from this study with values from other studies in the Middle Rio Grande Basin indicate agreement between 1 and 3.5 orders of magnitude for hydraulic conductivity and within 1 order of magnitude for vertical flux.

  17. The impact of on-site wastewater from high density cluster developments on groundwater quality

    NASA Astrophysics Data System (ADS)

    Morrissey, P. J.; Johnston, P. M.; Gill, L. W.

    2015-11-01

    The net impact on groundwater quality from high density clusters of unsewered housing across a range of hydro(geo)logical settings has been assessed. Four separate cluster development sites were selected, each representative of different aquifer vulnerability categories. Groundwater samples were collected on a monthly basis over a two year period for chemical and microbiological analysis from nested multi-horizon sampling boreholes upstream and downstream of the study sites. The field results showed no statistically significant difference between upstream and downstream water quality at any of the study areas, although there were higher breakthroughs in contaminants in the High and Extreme vulnerability sites linked to high intensity rainfall events; these however, could not be directly attributed to on-site effluent. Linked numerical models were then built for each site using HYDRUS 2D to simulate the attenuation of contaminants through the unsaturated zone from which the resulting hydraulic and contaminant fluxes at the water table were used as inputs into MODFLOW MT3D models to simulate the groundwater flows. The results of the simulations confirmed the field observations at each site, indicating that the existing clustered on-site wastewater discharges would only cause limited and very localised impacts on groundwater quality, with contaminant loads being quickly dispersed and diluted downstream due to the relatively high groundwater flow rates. Further simulations were then carried out using the calibrated models to assess the impact of increasing cluster densities revealing little impact at any of the study locations up to a density of 6 units/ha with the exception of the Extreme vulnerability site.

  18. Occurrence of pharmaceuticals, hormones, and organic wastewater compounds in Pennsylvania waters, 2006-09

    USGS Publications Warehouse

    Reif, Andrew G.; Crawford, J. Kent; Loper, Connie A.; Proctor, Arianne; Manning, Rhonda; Titler, Robert

    2012-01-01

    Concern over the presence of contaminants of emerging concern, such as pharmaceutical compounds, hormones, and organic wastewater compounds (OWCs), in waters of the United States and elsewhere is growing. Laboratory techniques developed within the last decade or new techniques currently under development within the U.S. Geological Survey now allow these compounds to be measured at concentrations in nanograms per liter. These new laboratory techniques were used in a reconnaissance study conducted by the U.S. Geological Survey, in cooperation with the Pennsylvania Department of Environmental Protection, to determine the occurrence of contaminants of emerging concern in streams, streambed sediment, and groundwater of Pennsylvania. Compounds analyzed for in the study are pharmaceuticals (human and veterinary drugs), hormones (natural and synthetic), and OWCs (detergents, fragrances, pesticides, industrial compounds, disinfectants, polycyclic aromatic hydrocarbons, fire retardants and plasticizers). Reconnaissance sampling was conducted from 2006 to 2009 to identify contaminants of emerging concern in (1) groundwater from wells used to supply livestock, (2) streamwater upstream and downstream from animal feeding operations, (3) streamwater upstream from and streamwater and streambed sediment downstream from municipal wastewater effluent discharges, (4) streamwater from sites within 5 miles of drinking-water intakes, and (5) streamwater and streambed sediment where fish health assessments were conducted. Of the 44 pharmaceutical compounds analyzed in groundwater samples collected in 2006 from six wells used to supply livestock, only cotinine (a nicotine metabolite) and the antibiotics tylosin and sulfamethoxazole were detected. The maximum concentration of any contaminant of emerging concern was 24 nanograms per liter (ng/L) for cotinine, and was detected in a groundwater sample from a Lebanon County, Pa., well. Seven pharmaceutical compounds including acetaminophen, caffeine, carbamazepine, and the four antibiotics tylosin, sulfadimethoxine, sulfamethoxazole, and oxytetracycline were detected in streamwater samples collected in 2006 from six paired stream sampling sites located upstream and downstream from animal-feeding operations. The highest reported concentration of these seven compounds was for the antibiotic sulfamethoxazole (157 ng/L), in a sample from the downstream site on Snitz Creek in Lancaster County, Pa. Twenty-one pharmaceutical compounds were detected in streamwater samples collected in 2006 from five paired stream sampling sites located upstream or downstream from a municipal wastewater-effluent-discharge site. The most commonly detected compounds and maximum concentrations were the anticonvulsant carbamazepine, 276 ng/L; the antihistamine diphenhydramine, 135 ng/L; and the antibiotics ofloxacin, 329 ng/L; sulfamethoxazole, 1,340 ng/L; and trimethoprim, 256 ng/L. A total of 51 different contaminants of emerging concern were detected in streamwater samples collected from 2007 through 2009 at 13 stream sampling sites located downstream from a wastewater-effluent-discharge site. The concentrations and numbers of compounds detected were higher in stream sites downstream from a wastewater-effluent-discharge site than in stream sites upstream from a wastewater-effluent-discharge site. This finding indicates that wastewater-effluent discharges are a source of contaminants of emerging concern; these contaminants were present more frequently in the streambed-sediment samples than in streamwater samples. Antibiotic compounds were often present in both the streamwater and streambed-sediment samples, but many OWCs were present exclusively in the streambed-sediment samples. Compounds with endocrine disrupting potential including detergent metabolites, pesticides, and flame retardants, were present in the streamwater and streambed-sediment samples. Killinger Creek, a stream where wastewater-effluent discharges contribute a large percentage of the total flow, stands out as a stream with particularly high numbers of compounds detected and detected at the highest concentrations measured in the reconnaissance sampling. Nineteen contaminants of emerging concern were detected in streamwater samples collected quarterly from 2007 through 2009 at 27 stream sites within 5 miles of a drinking-water intake. The number of contaminants and the concentrations detected at the stream sites within 5 miles of drinking-water intakes were generally very low (concentrations less than 50 ng/L), much lower than those at sites downstream from a wastewater-effluent discharge. The most commonly detected compounds and maximum concentrations were caffeine, 517 ng/L; carbamazepine, 95 ng/L; sulfamethoxazole, 146 ng/L; and estrone, 3.15 ng/L. The concentrations and frequencies of detection of some of the contaminants of emerging concern appear to vary by season, which could be explained by compound use, flow regime, or differences in degradation rates. Concentrations of some contaminants were associated with lower flows as a result of decreased in-stream dilution of wastewater effluents or other contamination sources. Twenty-two contaminants of emerging concern were detected once each in streamwater samples collected in 2007 and 2008 from 16 fish-health stream sites located statewide. The highest concentrations were for the OWCs, including flame retardants tri(2-butoxyethyl)phosphate (604 ng/L) and tri(2-chloroethyl)phosphate (272 ng/L) and the fragrance isoquinoline (330 ng/L). Far fewer numbers of contaminants of emerging concern were detected at the fish-health sites than at the wastewater-effluent-discharge sites. Most of the fish-health sites were not located directly downstream from a wastewater-effluent discharge, but there were multiple wastewater-effluent discharges in the drainage basins upstream from the sampling sites. No distinct pattern of contaminant occurrence could be discerned for the fish-health stream sites

  19. Quality of water and time of travel in Little Copiah Creek near Crystal Springs, Mississippi

    USGS Publications Warehouse

    Kalkhoff, S.J.

    1981-01-01

    An intensive quality of water study was conducted on Little Copiah Creek in the vicinity of Crystal Springs, Miss., from August 19 to August 21, 1980. The quality of water in Little Copiah Creek improved 7 miles downstream of a source of wastewater inflow. The mean total nitrogen concentration decreased from 17 to 1.1 milligrams per liter and the mean total phosphorus concentrations decreased from 5.8 to 0.39 milligrams per liter. The maximum five-day biochemical oxygen demand decreased from 14 to 1.4 milligrams per liter while the dissolved-oxygen concentration increased from 2.0 to 6.9 milligrams per liter. The maximum fecal coliform and fecal streptococcus densities at the upstream sampling site were 2,200 and 6,700 colonies per 100 milliliter, respectively, and were observed to decrease downstream to 160 and 1,500 colonies per 100 milliliters. The mean stream temperatures decreased downstream only slightly from 26.5 to 25.0 Celsius and the pH of the water ranged from 7.2 to 7.4 units upstream and 6.5 to 7.0 units at the downstream site. The average rate of dye travel through the upstream 2.3 mile reach was 0.08 miles per hour during the study. (USGS)

  20. 40 CFR 1054.625 - What requirements apply under the Transition Program for Equipment Manufacturers?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... number to contact for further information, or a Web site that includes this contact information. (5) The... configuration. Use good engineering judgment for these measurements, which may involve sampling exhaust upstream...

  1. Factors affecting food chain transfer of mercury in the vicinity of the Nyanza site, Sudbury River, Massachusetts

    USGS Publications Warehouse

    Haines, T.A.; May, T.W.; Finlayson, R.T.; Mierzykowski, S.E.

    2003-01-01

    The influence of the Nyanza Chemical Waste Dump Superfund Site on the Sudbury River, Massachusetts, was assessed by analysis of sediment, fish prey organisms, and predator fish from four locations in the river system. Whitehall Reservoir is an impoundment upstream of the site, and Reservoir #2 is an impoundment downstream of the site. Cedar Street is a flowing reach upstream of the site, and Sherman Bridge is a flowing reach downstream of the site. Collections of material for analysis were made three times, in May, July, and October. Sediment was analyzed for acid-volatile sulfide (AVS), simultaneously-extracted (SEM) metals (As, Cd, Cr, Hg, Pb, Sb, Zn), and total recoverable Hg. The dominant predatory fish species collected at all sites, largemouth bass (Micropterus salmoides), was analyzed for the same suite of metals as sediment. Analysis of stomach contents of bass identified small fish (yellow perch Perca flavescens, bluegill Lepomis macrochirus, and pumpkinseed Lepomis gibbosus), crayfish, and dragonfly larvae as the dominant prey organisms. Samples of the prey were collected from the same locations and at the same times as predator fish, and were analyzed for total and methyl mercury. Results of AVS and SEM analyses indicated that sediments were not toxic to aquatic invertebrates at any site. The SEM concentrations of As, Cd, and Cr were significantly higher at Reservoir #2 than at the reference sites, and SEM As and Cd were significantly higher at Sherman Bridge than at Cedar St. Sediment total Hg was elevated only at Reservoir #2. Hg was higher at site-influenced locations in all fish species except brown bullhead (Ameiurus nebulosus). Cd was higher in bluegill, black crappie (Pomoxis nigromaculatus), and brown bullhead, and Cr was higher in largemouth bass fillet samples but not in whole-body samples. There were no seasonal differences in sediment or prey organism metals, but some metals in some fish species did vary over time in an inconsistent manner. Predator fish Hg concentration was significantly linearly related to weighted prey organism methyl Hg concentration. Largemouth bass Hg was significantly lower at Reservoir #2 in our study than in previous investigations in 1989 and 1990. High concentrations of inorganic Hg remain in river sediment as a result of operation of the Nyanza site, and fish Hg concentrations in river reaches downstream of the site are elevated compared to upstream reference sites. However, the differences are relatively small and Hg concentrations in largemouth bass from the site-influenced locations are no higher than those from some other, nearby uncontaminated sites. We hypothesize that this results from burial of contaminated sediment with cleaner material, which reduces bioavailability of contaminants and possibly reduces methylation of mercury.

  2. Mechanism of Promoter Melting by the Xeroderma Pigmentosum Complementation Group B Helicase of Transcription Factor IIH Revealed by Protein-DNA Photo-Cross-Linking

    PubMed Central

    Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit

    2000-01-01

    The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286

  3. Uncertainty analysis of diffuse-gray radiation enclosure problems: A hypersensitive case study

    NASA Technical Reports Server (NTRS)

    Taylor, Robert P.; Luck, Rogelio; Hodge, B. K.; Steele, W. Glenn

    1993-01-01

    An uncertainty analysis of diffuse-gray enclosure problems is presented. The genesis was a diffuse-gray enclosure problem which proved to be hypersensitive to the specification of view factors. This genesis is discussed in some detail. The uncertainty analysis is presented for the general diffuse-gray enclosure problem and applied to the hypersensitive case study. It was found that the hypersensitivity could be greatly reduced by enforcing both closure and reciprocity for the view factors. The effects of uncertainties in the surface emissivities and temperatures are also investigated.

  4. An unexpected cause of an acute hypersensitivity reaction during recovery from anaesthesia.

    PubMed

    Thong, C L; Lambros, M; Stewart, M G; Kam, P C A

    2005-08-01

    Acute hypersensitivity reactions to chlorhexidine in the operating room are probably more likely to occur during the early phases of anaesthesia because chlorhexidine is often used for cleaning the surgical field or during placement of indwelling catheters. We report a case of an acute hypersensitivity reaction that occurred in the post anaesthetic care unit. Subsequent skin testing suggested sensitivity to chlorhexidine, which had been applied over the vaginal mucosa at the end of surgery. Relevant issues in the investigation of acute hypersensitivity reactions in the post anaesthetic period are discussed.

  5. Sympathoinhibition and hypotension in carotid sinus hypersensitivity

    NASA Technical Reports Server (NTRS)

    Smith, M. L.; Ellenbogen, K. A.; Eckberg, D. L.

    1992-01-01

    Carotid sinus reflex hypersensitivity is a known cause of syncope in humans. The condition is characterized by cardioinhibition and vasodepression, each to varying degrees. The extent and importance of sympathoinhibition has not been determined in patients with carotid sinus hypersensitivity. This study reports on the extent of sympathoinhibition measured directly directly during carotid massage with and without atrioventricular sequential pacing, in a patient with symptomatic carotid sinus reflex hypersensitivity. Carotid massage elicited asystole, hypotension and complete inhibition of muscle sympathetic nerve activity. Carotid massage during atrioventricular pacing produced similar sympathoinhibition, but with minimal hypotension. Therefore, sympathoinhibition did not contribute importantly to the hypotension during carotid massage in the supine position in this patient. Further investigations are required to elucidate the relation of sympathoinhibition to hypotension in patients with carotid sinus hypersensitivity in the upright position.

  6. Instant dentin hypersensitivity relief of a single topical application of an in-office desensitizing paste containing 8% arginine and calcium carbonate: a split-mouth, randomized-controlled study.

    PubMed

    Kapferer, Ines; Pflug, Claudia; Kisielewsky, Irene; Giesinger, Johannes; Beier, Ulrike S; Dumfahrt, Herbert

    2013-01-01

    The aim of this study was to evaluate the clinical efficacy of an in-office desensitizing paste containing 8% arginine and calcium carbonate relative to calcium carbonate alone in the reduction of dentin hypersensitivity in a randomized, double-blind, split-mouth clinical trial. Sixty teeth (30 subjects) with an air blast hypersensitivity score of 2 or 3 (Schiff Cold Air Sensitivity Scale) were randomly assigned to one of two treatment groups: (1) test paste containing 8% arginine and calcium carbonate (elmex sensitive professional desensitizing paste) and (2) control paste: paris white (calcium carbonate). Tactile and air blast dentin hypersensitivity examinations were performed at baseline, immediately after paste application and 4 and 12 weeks later. A statistically significant difference in air blast (p = 0.001) and tactile (p = 0.047) hypersensitivity reduction over time was observed between the two therapy modes. After 12-weeks, statistically significant differences were indicated between the test and control group with respect to baseline-adjusted mean tactile (41.94%; p = 0.038) and air blast hypersensitivity scores (46.5%; p = 0.017). The tested in-office desensitizing paste containing 8.0% arginine and calcium carbonate provides significantly greater hypersensitivity relief compared to calcium carbonate alone.

  7. Data on surface-water quality and quantity, lower Edgewood Creek basin, Douglas County, Nevada, 1984-85

    USGS Publications Warehouse

    La Camera, R. J.; Browning, S.B.

    1988-01-01

    Selected hydrologic data were collected from August 1984 through July 1985 at three sites on the lower part of Edgewood Creek, and at a recently constructed sediment-catchment basin that captures and retains runoff from developed areas in the lower Edgewood Creek drainage. The data were collected to quantify the discharge of selected constituents downstream from recent and planned watershed restoration projects, and to Lake Tahoe. Contained in this report are the results of quantitative analyses of 39 water samples for: total and dissolved ammonium, organic nitrogen, nitrite, nitrate, phosphorus, and orthophosphorus; suspended sediment; total iron, manganese, and zinc; and dissolved temperature, specific conductance, pH, and dissolved oxygen; summary statistics (means and standard deviations), and computations of instantaneous loads. On the basis of mean values, about 80% of the total nitrogen load at each of the three Edgewood Creek sites is in the form of organic nitrogen, 12% is in the form of nitrate nitrogen, 7% is in the form of ammonium nitrogen, and 1% is in the form of nitrite nitrogen. The percentage of total phosphorus load in the form of orthophosphorus at the three stream sites varies somewhat with time, but is generally greater at the two downstream sites than at the upstream site. In addition, the percentage of the total phosphorus load that is present in the dissolved state generally is greater at the two downstream sites than at the upstream site. (Lantz-PTT)

  8. Sweet Syndrome: A Review and Update.

    PubMed

    Villarreal-Villarreal, C D; Ocampo-Candiani, J; Villarreal-Martínez, A

    2016-06-01

    Sweet syndrome is the most representative entity of febrile neutrophilic dermatoses. It typically presents in patients with pirexya, neutrophilia, painful tender erytomatous papules, nodules and plaques often distributed asymmetrically. Frequent sites include the face, neck and upper extremities. Affected sites show a characteristical neutrophilic infiltrate in the upper dermis. Its etiology remains elucidated, but it seems that can be mediated by a hypersensitivity reaction in which cytokines, followed by infiltration of neutrophils, may be involved. Systemic corticosteroids are the first-line of treatment in most cases. We present a concise review of the pathogenesis, classification, diagnosis and treatment update of this entity. Copyright © 2015 AEDV. Published by Elsevier España, S.L.U. All rights reserved.

  9. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  10. Seasonal and diel movements of white sturgeon in the lower columbia river

    USGS Publications Warehouse

    Parsley, M.J.; Popoff, N.D.; Van Der Leeuw, B. K.; Wright, C.D.

    2008-01-01

    Continuous monitoring of the movements and depths used by white sturgeon Acipenser transmontanus with acoustic telemetry technologies in the lower Columbia River provided information on diel and seasonal migrations, local movements, and site fidelity. White sturgeon moved to shallower water at night and showed greater activity, inferred from rates of movement, than during daytime. The extent of local movement within a season was variable among fish; some fish readily moved among habitats while the movements of others were more constrained. White sturgeon were absent from the study area (river kilometers 45-52) during winter and returned from upstream during the spring, confirming an upstream seasonal migration in the fall and downstream migration in spring. The return of individual fish and reoccupation of areas previously inhabited showed that some white sturgeon exhibit site fidelity. This work shows that studies seeking to characterize habitat for white sturgeon need to be cognizant of diel migrations and site fidelity. We urge caution in the use of limited fish location data to describe habitats if diel activities and fine-scale movements are not known.

  11. Summary of Environmental Monitoring and Assessment Program (EMAP) activities in South Dakota, 2000-2004

    USGS Publications Warehouse

    Heakin, Allen J.; Neitzert, Kathleen M.; Shearer, Jeffrey S.

    2006-01-01

    The U.S. Environmental Protection Agency (USEPA) initiated data-collection activities for the Environmental Monitoring and Assessment Program-West (EMAP-West) in South Dakota during 2000. The objectives of the study were to develop the monitoring tools necessary to produce unbiased estimates of the ecological condition of surface waters across a large geographic area of the western United States, and to demonstrate the effectiveness of those tools in a large-scale assessment. In 2001, the U.S. Geological Survey (USGS) and the South Dakota Department of Game, Fish and Parks (GF&P) established a cooperative agreement and assumed responsibility for completing the remaining assessments for the perennial, wadable streams of the EMAP-West in the State. Stream assessment sites were divided into two broad categories-the first category of sites was randomly selected and assigned by the USEPA for South Dakota. The second category consisted of sites that were specifically selected because they appeared to have reasonable potential for representing the best available physical, chemical, and biological conditions in the State. These sites comprise the second category of assessment sites and were called 'reference' sites and were selected following a detailed evaluation process. Candidate reference site data will serve as a standard or benchmark for assessing the overall ecological condition of the randomly selected sites. During 2000, the USEPA completed 22 statewide stream assessments in South Dakota. During 2001-2003, the USGS and GF&P completed another 42 stream assessments bringing the total of randomly selected stream assessments within South Dakota to 64. In addition, 18 repeat assessments designed to meet established quality-assurance/quality-control requirements were completed at 12 of these 64 sites. During 2002-2004, the USGS in cooperation with GF&P completed stream assessments at 45 candidate reference sites. Thus, 109 sites had stream assessments completed in South Dakota for EMAP-West (2000-2004). Relatively early in the EMAP-West stream-assessment process, it became apparent that for some streams in south-central South Dakota, in-stream conditions varied considerably over relatively short distances of only a few miles. These changes appeared to be a result of geomorphic changes associated with changes in the underlying geology. For these streams, moving stream assessment sites short distances upstream or downstream had the potential to provide substantially different bioassessment data. In order to obtain a better understanding of how geology influences stream conditions, two streams located in south-central South Dakota were chosen for multiple stream sampling at sites located along their longitudinal profile at points where notable changes in geomorphology were observed. Subsequently, three sites on Bear-in-the-Lodge Creek and three sites on Black Pipe Creek were selected for multiple stream sampling using EMAP-West protocols so that more could be learned about geologic influences on stream conditions. Values for dissolved oxygen and specific conductance generally increased from upstream to downstream locations on Bear-in-the-Lodge Creek. Values for pH and water temperature generally decreased from upstream to downstream locations. Decreasing water temperature could be indicative of ground-water inflows. Values for dissolved oxygen, pH, and water temperature generally increased from upstream to downstream locations on Black Pipe Creek. The increase in temperature at the lower sites is a result of less dense riparian cover, and the warmer water also could account for the lower concentrations of dissolved oxygen found in the lower reaches of Black Pipe Creek. Values for specific conductance were more than three times greater at the lower site (1,342 microsiemens per centimeter (?S/cm)) than at the upper site (434 ?S/cm). The increase probably occurs when the stream transitions from contacting the underlying Ar

  12. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  13. A comparison of results from a hydrologic transport model (HSPF) with distributions of sulfate and mercury in a mine-impacted watershed in northeastern Minnesota.

    PubMed

    Berndt, Michael E; Rutelonis, Wes; Regan, Charles P

    2016-10-01

    The St. Louis River watershed in northeast Minnesota hosts a major iron mining district that has operated continuously since the 1890s. Concern exists that chemical reduction of sulfate that is released from mines enhances the methylation of mercury in the watershed, leading to increased mercury concentrations in St. Louis River fish. This study tests this idea by simulating the behavior of chemical tracers using a hydrologic flow model (Hydrologic Simulation Program FORTRAN; HSPF) and comparing the results with measured chemistry from several key sites located both upstream and downstream from the mining region. It was found that peaks in measured methylmercury (MeHg), total mercury (THg), dissolved organic carbon (DOC), and dissolved iron (Fe) concentrations correspond to periods in time when modeled recharge was dominated by active groundwater throughout the watershed. This helps explain why the timing and size of the MeHg peaks was nearly the same at sites located just upstream and downstream from the mining region. Both the modeled percentages of mine water and the measured sulfate concentrations were low and computed transit times were short for sites downstream from the mining region at times when measured MeHg reached its peak. Taken together, the data and flow model imply that MeHg is released into groundwater that recharges the river through riparian sediments following periods of elevated summer rainfall. The measured sulfate concentrations at the upstream site reached minimum concentrations of approximately 1 mg/L just as MeHg reached its peak, suggesting that reduction of sulfate from non-point sources exerts an important influence on MeHg concentrations at this site. While mines are the dominant source of sulfate to sites downstream from them, it appears that the background sulfate which is present at only 1-6 mg/L, has the largest influence on MeHg concentrations. This is because point sourced sulfate is transported generally under oxidized conditions and is not flushed through riparian sediments in a gaining stream watershed system. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Streamflow gain/loss in the Republican River basin, Nebraska, March 1989

    USGS Publications Warehouse

    Johnson, Michaela R.; Stanton, Jennifer S.; Cornwall, James F.; Landon, Matthew K.

    2002-01-01

    This arc and point data set contains streamflow measurement sites and reaches indicating streamflow gain or loss under base-flow conditions along the Republican River and tributaries in Nebraska during March 21 to 22, 1989 (Boohar and others, 1990). These measurements were made to obtain data on ground-water/surface-water interaction. Flow was visually observed to be zero, was measured, or was estimated at 136 sites. The measurements were made on the main stem of the Republican River and all flowing tributaries that enter the Republican River above Swanson Reservoir and parts of the Frenchman, Red Willow, and Medicine Creek drainages in the Nebraska part of the Republican River Basin. Tributaries were followed upstream until the first road crossing where zero flow was encountered. For selected streams, points of zero flow upstream of the first zero flow site were also checked. Streamflow gain or loss for each stream reach was calculated by subtracting the streamflow values measured at the upstream end of the reach and values for contributing tributaries from the downstream value. The data obtained reflected base-flow conditions suitable for estimating streamflow gains and losses for stream reaches between sites. This digital data set was created by manually plotting locations of streamflow measurements. These points were used to designate stream-reach segments to calculate gain/loss per river mile. Reach segments were created by manually splitting the lines from a 1:250,000 hydrography data set (Soenksen and others, 1999) at every location where the streams were measured. Each stream-reach segment between streamflow-measurement sites was assigned a unique reach number. All other lines in the hydrography data set without reach numbers were omitted. This data set was created to archive the calculated streamflow gains and losses of selected streams in part of the Republican River Basin, Nebraska in March 1989, and make the data available for use with geographic information systems (GIS). If measurement sites are used separately from reaches, the maximum scale of 1:100,000 should not be exceeded. When used in conjunction with the reach segments, the maximum scale should not exceed 1:250,000.

  15. Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

    PubMed

    Lee, Sooncheol; Kang, Changwon

    2011-05-06

    The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

  16. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    PubMed

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  17. Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

    PubMed

    Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

    2017-11-01

    We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

  18. Outcome of pediatric patients with acute lymphoblastic leukemia/lymphoblastic lymphoma with hypersensitivity to pegaspargase treated with PEGylated Erwinia asparaginase, pegcrisantaspase: A report from the Children's Oncology Group

    PubMed Central

    Rau, Rachel E.; Dreyer, ZoAnn; Choi, Mi Rim; Liang, Wei; Skowronski, Roman; Allamneni, Krishna P.; Devidas, Meenakshi; Raetz, Elizabeth A.; Adamson, Peter C.; Blaney, Susan M.; Loh, Mignon L; Hunger, Stephen P.

    2018-01-01

    Background Erwinia asparaginase is a Food and Drug Administration approved agent for the treatment of acute lymphoblastic leukemia (ALL) for patients who develop hypersensitivity to Escherichia coli derived asparaginases. Erwinia asparaginase is efficacious, but has a short half-life, requiring six doses to replace one dose of the most commonly used first-line asparaginase, pegaspargase, a polyethylene glycol (PEG) conjugated E. coli asparaginase. Pegcristantaspase, a recombinant PEGylated Erwinia asparaginase with improved pharmacokinetics, was developed for patients with hypersensitivity to pegaspargase. Here, we report a series of patients treated on a pediatric phase 2 trial of pegcrisantaspase. Procedure Pediatric patients with ALL or lymphoblastic lymphoma and hypersensitivity to pegaspargase enrolled on Children's Oncology Group trial AALL1421 (Jazz 13-011) and received intravenous pegcrisantaspase. Serum asparaginase activity (SAA) was monitored before and after dosing; immunogenicity assays were performed for antiasparaginase and anti-PEG antibodies and complement activation was evaluated. Results Three of the four treated patients experienced hypersensitivity to pegcrisantaspase manifested as clinical hypersensitivity reactions or rapid clearance of SAA. Immunogenicity assays demonstrated the presence of anti-PEG immunoglobulin G antibodies in all three hypersensitive patients, indicating a PEG-mediated immune response. Conclusions This small series of patients, nonetheless, provides data, suggesting preexisting immunogenicity against the PEG moiety of pegaspargase and poses the question as to whether PEGylation may be an effective strategy to optimize Erwinia asparaginase administration. Further study of larger cohorts is needed to determine the incidence of preexisting antibodies against PEG-mediated hypersensitivity to pegaspargase. PMID:29090524

  19. Dissociation between the relief of skeletal pain behaviors and skin hypersensitivity in a model of bone cancer pain.

    PubMed

    Guedon, Jean-Marc G; Longo, Geraldine; Majuta, Lisa A; Thomspon, Michelle L; Fealk, Michelle N; Mantyh, Patrick W

    2016-06-01

    Recent studies have suggested that in humans and animals with significant skeletal pain, changes in the mechanical hypersensitivity of the skin can be detected. However, whether measuring changes in skin hypersensitivity can be a reliable surrogate for measuring skeletal pain itself remains unclear. To explore this question, we generated skeletal pain by injecting and confining GFP-transfected NCTC 2472 osteosarcoma cells unilaterally to the femur of C3H male mice. Beginning at day 7 post-tumor injection, animals were administered vehicle, an antibody to the P2X3 receptor (anti-P2X3) or anti-NGF antibody. Pain and analgesic efficacy were then measured on days 21, 28, and 35 post-tumor injection using a battery of skeletal pain-related behaviors and von Frey assessment of mechanical hypersensitivity on the plantar surface of the hind paw. Animals with bone cancer pain treated with anti-P2X3 showed a reduction in skin hypersensitivity but no attenuation of skeletal pain behaviors, whereas animals with bone cancer pain treated with anti-NGF showed a reduction in both skin hypersensitivity and skeletal pain behaviors. These results suggest that although bone cancer can induce significant skeletal pain-related behaviors and hypersensitivity of the skin, relief of hypersensitivity of the skin is not always accompanied by attenuation of skeletal pain. Understanding the relationship between skeletal and skin pain may provide insight into how pain is processed and integrated and help define the preclinical measures of skeletal pain that are predictive end points for clinical trials.

  20. Efficacy of desensitizing products containing 8% arginine and calcium carbonate for hypersensitivity relief in MIH-affected molars: an 8-week clinical study.

    PubMed

    Bekes, Katrin; Heinzelmann, Karolin; Lettner, Stefan; Schaller, Hans-Günter

    2017-09-01

    The objective of this study was to compare the efficacy in reducing hypersensitivity in molar incisor hypomineralization (MIH)-affected molars immediately and over 8 weeks combining a single in-office application and a homed-based program with desensitizing products containing 8% arginine and calcium carbonate. Nineteen children with at least one MIH-affected molar with hypersensitivity were included. Hypersensitivity was assessed with an evaporative (air) stimulus and a tactile stimulus. Each child received a single in-office treatment with a desensitizing paste containing 8% arginine and calcium carbonate (elmex Sensitive Professional desensitizing paste), followed by 8 weeks of brushing twice daily with a desensitizing toothpaste containing 8% arginine, calcium carbonate with 1450 ppm fluoride (elmex Sensitive Professional toothpaste), using the elmex Sensitive Professional toothbrush. Additionally, the corresponding mouthwash (elmex Sensitive Professional mouthwash) was used. Clinical assessments were made at baseline, immediately after the in-office treatment and after 1, 2, 4 and 8 weeks of brushing twice daily. Fifty-six molars with an air blast hypersensitivity score of 2 or 3 (Schiff Cold Air Sensitivity Scale) were included. Application of the desensitizing paste decreased hypersensitivity significantly immediately and throughout the 8 weeks recalls (p < 0.001). In conclusion, 8% arginine and calcium carbonate were able to reduce hypersensitivity successfully during this 8-week trial. Hypersensitivity is a major complaint in patients with MIH. This is the first study evaluating the desensitizing effect of a desensitizing paste containing 8% arginine and calcium carbonate in patients with MIH.

  1. Dissociation between the relief of skeletal pain behaviors and skin hypersensitivity in a model of bone cancer pain

    PubMed Central

    Guedon, Jean-Marc G.; Longo, Geraldine; Majuta, Lisa A.; Thomspon, Michelle L.; Fealk, Michelle N.; Mantyh, Patrick W.

    2016-01-01

    Recent studies have suggested that in humans and animals with significant skeletal pain, changes in the mechanical hypersensitivity of the skin can be detected. However, whether measuring changes in skin hypersensitivity can be a reliable surrogate for measuring skeletal pain itself remains unclear. To explore this question we generated skeletal pain by injecting and confining GFP-transfected NCTC 2472 osteosarcoma cells unilaterally to the femur of C3H male mice. Beginning at day 7 post-tumor injection, animals were administered vehicle, an antibody to the P2X3 receptor (anti-P2X3) or anti-NGF antibody. Pain and analgesic efficacy was then measured on days 21, 28 and 35 post-tumor injection using a battery of skeletal pain-related behaviors and von Frey assessment of mechanical hypersensitivity on the plantar surface of the hindpaw. Animals with bone cancer pain treated with anti-P2X3 showed a reduction in skin hypersensitivity but no attenuation of skeletal pain behaviors. Whereas animals with bone cancer pain treated with anti-NGF showed a reduction in both skin hypersensitivity and skeletal pain behaviors. These results suggest that while bone cancer can induce significant skeletal pain-related behaviors and hypersensitivity of the skin, relief of hypersensitivity of the skin is not always accompanied by attenuation of skeletal pain. Understanding the relationship between skeletal and skin pain may provide insight into how pain is processed and integrated and help define the preclinical measures of skeletal pain that are predictive endpoints for clinical trials. PMID:27186713

  2. From the Children’s Oncology Group: Evidence-based recommendations for PEG-asparaginase nurse monitoring, hypersensitivity reaction management, and patient/family education

    PubMed Central

    Woods, Deborah; Winchester, Kari; Towerman, Alison; Gettinger, Katie; Carey, Christina; Timmermann, Karen; Langley, Rachel; Browne, Emily

    2017-01-01

    PEG-aspariginase is a backbone chemotherapy agent in pediatric acute lymphoblastic leukemia and in some non-Hodgkin lymphoma therapies. Nurses lack standardized guidelines for monitoring patients receiving PEG-asparaginase and for educating patients/families about hypersensitivity reaction risks. An electronic search of six databases using publication years 2000–2015 and multiple professional organizations and clinical resources was conducted. Evidence sources were reviewed for topic applicability. Each of the final 23 sources was appraised by two team members. The GRADE system was used to assign a quality and strength rating for each recommendation. Multiple recommendations were developed: four relating to nurse monitoring of patients during and after drug administration, eight guiding hypersensitivity reaction management, and four concerning patient/family educational content. These strong recommendations were based on moderate, low, or very-low quality evidence. Several recommendations relied upon generalized drug hypersensitivity guidelines. Additional research is needed to safely guide PEG-asparaginase monitoring, hypersensitivity reaction management and patient/family education. Nurses administering PEG-asparaginase play a critical role in the early identification and management of hypersensitivity reactions. PMID:28602129

  3. Practical Management of Patients with a History of Immediate Hypersensitivity to Common non-Beta-Lactam Drugs.

    PubMed

    Macy, Eric

    2016-01-01

    Immediate hypersensitivity reactions to medications are among the most feared adverse drug reactions, because of their close association with anaphylaxis. This review discusses a practical management approach for patients with a history of an immediate hypersensitivity to a non-beta-lactam medication, where reexposure to the implicated, or similar, medication is clinically necessary. Mechanisms associated with severe immediate hypersensitivity reactions include IgE-mediated mast cell activation, complement-mediated mast cell activation, and direct mast cell activation. Immediate hypersensitivity reactions may also be mediated by vasodilators, other pharmacologic mechanisms, or be secondary to underlying patient-specific biochemical abnormalities such as endocrine tumors or chronic spontaneous urticaria. The key features in the reaction history and the biochemistry of the implicated medication are discussed. Most individuals with a history of immediate hypersensitivity to a medication, who require reuse of that drug, can be safely retreated with a therapeutic course of the implicated drug after a full-dose challenge, graded challenge, or desensitization, with or without premedication and/or any preliminary diagnostic testing, depending on the specific situation.

  4. Diagnostic accuracy of HLA-B*57:01 screening for the prediction of abacavir hypersensitivity and clinical utility of the test: a meta-analytic review.

    PubMed

    Cargnin, Sarah; Jommi, Claudio; Canonico, Pier Luigi; Genazzani, Armando A; Terrazzino, Salvatore

    2014-05-01

    To determine diagnostic accuracy of HLA-B*57:01 testing for prediction of abacavir-induced hypersensitivity and to quantify the clinical benefit of pretreatment screening through a meta-analytic review of published studies. A comprehensive search was performed up to June 2013. The methodological quality of relevant studies was assessed by the QUADAS-2 tool. The pooled diagnostic estimates were calculated using a random effect model. Despite the presence of heterogeneity in sensitivity or specificity estimates, the pooled diagnostic odds ratio to detect abacavir-induced hypersensitivity on the basis of clinical criteria was 33.07 (95% CI: 22.33-48.97, I(2): 13.9%), while diagnostic odds ratio for detection of immunologically confirmed abacavir hypersensitivity was 1141 (95% CI: 409-3181, I(2): 0%). Pooled analysis of risk ratio showed that prospective HLA-B*57:01 testing significantly reduced the incidence of abacavir-induced hypersensitivity. This meta-analysis demonstrates an excellent diagnostic accuracy of HLA-B*57:01 testing to detect immunologically confirmed abacavir hypersensitivity and corroborates existing recommendations.

  5. HEAVY METALS STRUCTURE BENTHIC COMUNITIES IN COLORADO MOUNTAIN STREAMS

    EPA Science Inventory

    The development of field sampling designs that employ multiple reference and polluted sites has been proposed as an alternative to the traditional upstream vs. downstream approach used in most biomonitoring studies. Spatially extensive monitoring programs can characterize ecologi...

  6. Level II scour analysis for Bridge 41 (ANDOVT00110041) on State Route 11, crossing the Middle Branch Williams River, Andover, Vermont

    USGS Publications Warehouse

    Wild, Emily C.; Hammond, Robert E.

    1997-01-01

    This report provides the results of a detailed Level II analysis of scour potential at structure ANDOVT00110041 on State Route 11 crossing the Middle Branch Williams River, Andover, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the Green Mountain section of the New England physiographic province in southeastern Vermont. The 12.1-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is grass on the upstream right overbank while the immediate banks have dense woody vegetation. The upstream left overbank and downstream right overbank are brushland. The downstream left overbank is forested. In the study area, the Middle Branch Williams River has an incised, sinuous channel with a slope of approximately 0.018 ft/ft, an average channel top width of 71 ft and an average bank height of 4 ft. The channel bed material ranges from gravel to boulders with a median grain size (D50) of 85.0 mm (0.279 ft). The geomorphic assessment at the time of the Level I and Level II site visit on September 10, 1996, indicated that the reach was laterally unstable due to a cut-bank present on the upstream right bank and a wide channel bar with vegetation in the upstream reach. The State Route 11 crossing of the Middle Branch Williams River is a 46-ft-long, two-lane bridge consisting of a concrete 44-foot tee-beam span (Vermont Agency of Transportation, written communication, March 29, 1995). The opening length of the structure parallel to the bridge face is 42 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 35 degrees to the opening while the opening-skew-toroadway is zero degrees. A scour hole 0.8 ft deeper than the mean thalweg depth was observed along the downstream end of the left abutment and downstream left wingwall during the Level I assessment. Type- 2 stone fill (less than 36 inches diameter) protects the upstream end of the upstream left wingwall, the downstream ends of the downstream left and right wingwalls and the downstream right road embankment. Type-3 stone fill protects the upstream end of the upstream right wingwall and the upstream right bank. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). In addition, the incipient roadway-overtopping discharge was determined and analyzed as another potential worst-case scour scenario. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 2.1 ft. The worst-case contraction scour occurred at the 500-year discharge. Abutment scour ranged from 11.1 to 18.7 ft. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

  7. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

    PubMed

    Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

    2011-09-26

    HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

  8. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

    PubMed Central

    2011-01-01

    Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

  9. Hypersensitivity reactions to vaccine constituents: a case series and review of the literature.

    PubMed

    Leventhal, Jonathan S; Berger, Emily M; Brauer, Jeremy A; Cohen, David E

    2012-01-01

    Vaccines are composed of immunogens, preservatives, adjuvants, antibiotics, and manufacturing by-products. Components of vaccines may rarely elicit adverse reactions in susceptible individuals, thus raising concerns regarding vaccine safety. In this report, we add to the medical literature 3 cases of cutaneous delayed-type hypersensitivity to the vaccine preservative aluminum. We provide a review of major constituents in vaccines that have elicited immediate-type or delayed-type hypersensitivity reactions and describe their clinical manifestations. We include a table of the Food and Drug Administration-approved vaccines, which lists the quantities of major components including ovalbumin (egg protein), gelatin, aluminum, neomycin, 2-phenoxyethanol, thimerosal, and formaldehyde. Our goals were to inform physicians on the variety of hypersensitivity reactions to common vaccines and to provide information on the choice of vaccines in patients with suspected hypersensitivity.

  10. Water quality in the Little Sac River basin near Springfield, Missouri, 1999-2001

    USGS Publications Warehouse

    Smith, Brenda J.

    2002-01-01

    The Little Sac River, north of Springfield, Missouri, flows through mainly agricultural and forest land. However, the quality of the river water is a concern because the river flows into Stockton Lake, which is a supplemental drinking water source for Springfield. Large bacterial densities and nutrient concentrations are primary concerns to the water quality of the river.A 29-river mile reach of the Little Sac River is on the 1998 list of waters of Missouri designated under section 303(d) of the Federal Clean Water Act because of fecal coliform densities larger than the Missouri Department of Natural Resources standard (hereinafter referred to as Missouri standard) of 200 colonies per 100 milliliters for whole-body contact recreation. During an investigation of the water quality in the Little Sac River by the U.S. Geological Survey, in cooperation with the Watershed Committee of the Ozarks, fecal coliform bacteria densities exceeded the Missouri standard (the standard applies from April 1 through October 31) in one sample from a site near Walnut Grove. At other sites on the Little Sac River, the Missouri standard was exceeded in two samples and equalled in one sample upstream from the Northwest Wastewater Treatment Plant (NW WTP) and in one sample immediately downstream from the NW WTP.Effluent from the NW WTP flows into the Little Sac River. Annually from April 1 through October 31, the effluent is disinfected to meet the Missouri standard for whole-body contact recreation. Fecal coliform bacteria densities in samples collected during this period generally were less than 100 colonies per 100 milliliters. For the rest of the year when the effluent was not disinfected, the bacteria densities in samples ranged from 50 (sample collected on November 1, 2000) to 10,100 colonies per 100 milliliters (both counts were non-ideal). When the effluent was disinfected and the fecal coliform bacteria density was small, samples from sites upstream and downstream from the NW WTP had a bacteria density larger than the density in the effluent. Other sources of bacteria are likely to be present in the study area in addition to the NW WTP. These potential sources include effluent from domestic septic systems and animal wastes.Nutrient concentrations in the Little Sac River immediately downstream from the NW WTP were affected by effluent from the NW WTP and possibly other sources. At two sites upstream from the NW WTP, median nitrite plus nitrate concentrations were 1.1 and 1.4 milligrams per liter. The median nitrite plus nitrate concentration for the effluent from the NW WTP was 6.4 milligrams per liter, and the median concentration decreased downstream in the Little Sac River to 2.2, 1.2, and 0.56 milligrams per liter.The effects of the effluent from the NW WTP on the water quality of the Little Sac River downstream from the NW WTP were reflected in an increase in discharge (effluent from the NW WTP can be as much as 50 percent of the flow at the site about 1.5 river miles downstream from the NW WTP), an increase in specific conductance values, an increase in several inorganic constituent concentrations, including calcium, magnesium, and sulfate, and a large increase in sodium and chloride concentrations. The effluent from the NW WTP seemed to have no effect on the pH value, temperature, and dissolved oxygen concentrations in the Little Sac River.Results of repetitive element polymerase chain reaction (rep-PCR) pattern analysis indicated that most Escherichia coli (E. coli) bacteria in water samples probably were from nonhuman sources, such as horses and cattle. The rep-PCR pattern analysis indicated that horses were an important source of E. coli downstream from the NW WTP, which was consistent with horses pastured adjacent to the sampling site. Fecal coliform bacteria loads increased upstream from the NW WTP from the most upstream site to the site immediately upstream from the NW WTP. Loads in the effluent from the NW WTP and also tho

  11. A novel protein factor is required for use of distal alternative 5' splice sites in vitro.

    PubMed Central

    Harper, J E; Manley, J L

    1991-01-01

    Adenovirus E1A pre-mRNA was used as a model to examine alternative 5' splice site selection during in vitro splicing reactions. Strong preference for the downstream 13S 5' splice site over the upstream 12S or 9S 5' splice sites was observed. However, the 12S 5' splice site was used efficiently when a mutant pre-mRNA lacking the 13S 5' splice site was processed, and 12S splicing from this substrate was not reduced by 13S splicing from a separate pre-mRNA, demonstrating that 13S splicing reduced 12S 5' splice site selection through a bona fide cis-competition. DEAE-cellulose chromatography of nuclear extract yielded two fractions with different splicing activities. The bound fraction contained all components required for efficient splicing of simple substrates but was unable to utilize alternative 5' splice sites. In contrast, the flow-through fraction, which by itself was inactive, contained an activity required for alternative splicing and was shown to stimulate 12S and 9S splicing, while reducing 13S splicing, when added to reactions carried out by the bound fraction. Furthermore, the activity, which we have called distal splicing factor (DSF), enhanced utilization of an upstream 5' splice site on a simian virus 40 early pre-mRNA, suggesting that the factor acts in a position-dependent, substrate-independent fashion. Several lines of evidence are presented suggesting that DSF is a non-small nuclear ribonucleoprotein protein. Finally, we describe a functional interaction between DSF and ASF, a protein that enhances use of downstream 5' splice sites. Images PMID:1658620

  12. Regulation of Dpp activity by tissue-specific cleavage of an upstream site within the prodomain

    PubMed Central

    Sopory, Shailaja; Kwon, Sunjong; Wehrli, Marcel; Christian, Jan L.

    2010-01-01

    BMP4 is synthesized as an inactive precursor that is cleaved at two sites during maturation: initially at a site (S1) adjacent to the ligand domain, and then at an upstream site (S2) within the prodomain. Cleavage at the second site regulates the stability of mature BMP4 and this in turn influences its signaling intensity and range of action. The Drosophila ortholog of BMP4, Dpp, functions as a long- or short-range signaling molecule in the wing disc or embryonic midgut, respectively but mechanisms that differentially regulate its bioactivity in these tissues have not been explored. In the current studies we demonstrate, by dpp mutant rescue, that cleavage at the S2 site of proDpp is required for development of the wing and leg imaginal discs, whereas cleavage at the S1 site is sufficient to rescue Dpp function in the midgut. Both the S1 and S2 site of proDpp are cleaved in the wing disc, and S2-cleavage is essential to generate sufficient ligand to exceed the threshold for pMAD activation at both short- and long-range in most cells. By contrast, proDpp is cleaved at the S1 site alone in the embryonic mesoderm and this generates sufficient ligand to activate physiological target genes in neighboring cells. These studies provide the first biochemical and genetic evidence that that selective cleavage of the S2 site of proDPP provides a tissue-specific mechanism for regulating Dpp activity, and that differential cleavage can contribute to, but is not an absolute determinant of signaling range. PMID:20659445

  13. Immediate hypersensitivity reactions following monovalent 2009 pandemic influenza A (H1N1) vaccines: reports to VAERS.

    PubMed

    Halsey, Neal A; Griffioen, Mari; Dreskin, Stephen C; Dekker, Cornelia L; Wood, Robert; Sharma, Devindra; Jones, James F; LaRussa, Philip S; Garner, Jenny; Berger, Melvin; Proveaux, Tina; Vellozzi, Claudia; Broder, Karen; Setse, Rosanna; Pahud, Barbara; Hrncir, David; Choi, Howard; Sparks, Robert; Williams, Sarah Elizabeth; Engler, Renata J; Gidudu, Jane; Baxter, Roger; Klein, Nicola; Edwards, Kathryn; Cano, Maria; Kelso, John M

    2013-12-09

    Hypersensitivity disorders following vaccinations are a cause for concern. To determine the type and rate by age, gender, and vaccine received for reported hypersensitivity reactions following monovalent 2009 pandemic influenza A (H1N1) vaccines. A systematic review of reports to the Vaccine Adverse Event Reporting System (VAERS) following monovalent 2009 pandemic influenza A (H1N1) vaccines. US Civilian reports following vaccine received from October 1, 2009 through May 31, 2010. Age, gender, vaccines received, diagnoses, clinical signs, and treatment were reviewed by nurses and physicians with expertise in vaccine adverse events. A panel of experts, including seven allergists reviewed complex illnesses and those with conflicting evidence for classification of the event. Of 1984 reports, 1286 were consistent with immediate hypersensitivity disorders and 698 were attributed to anxiety reactions, syncope, or other illnesses. The female-to-male ratio was ≥4:1 for persons 20-to-59 years of age, but approximately equal for children under 10. One hundred eleven reports met Brighton Collaboration criteria for anaphylaxis; only one-half received epinephrine for initial therapy. The overall rate of reported hypersensitivity reactions was 10.7 per million vaccine doses distributed, with a 2-fold higher rate for live vaccine. Underreporting, especially of mild events, would result in an underestimate of the true rate of immediate hypersensitivity reactions. Selective reporting of events in adult females could have resulted in higher rates than reported for males. Adult females may be at higher risk of hypersensitivity reactions after influenza vaccination than men. Although the risk of hypersensitivity reactions following 2009 pandemic influenza A (H1N1) vaccines was low, all clinics administering vaccines should be familiar with treatment guidelines for these adverse events, including the use of intramuscular epinephrine early in the course of serious hypersensitivity reactions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Using Soluble Reactive Phosphorus and Ammonia to Identify Point Source Discharge from Large Livestock Facilities

    NASA Astrophysics Data System (ADS)

    Borrello, M. C.; Scribner, M.; Chessin, K.

    2013-12-01

    A growing body of research draws attention to the negative environmental impacts on surface water from large livestock facilities. These impacts are mostly in the form of excessive nutrient loading resulting in significantly decreased oxygen levels. Over-application of animal waste on fields as well as direct discharge into surface water from facilities themselves has been identified as the main contributor to the development of hypoxic zones in Lake Erie, Chesapeake Bay and the Gulf of Mexico. Some regulators claim enforcement of water quality laws is problematic because of the nature and pervasiveness of non-point source impacts. Any direct discharge by a facility is a violation of permits governed by the Clean Water Act, unless the facility has special dispensation for discharge. Previous research by the principal author and others has shown runoff and underdrain transport are the main mechanisms by which nutrients enter surface water. This study utilized previous work to determine if the effects of non-point source discharge can be distinguished from direct (point-source) discharge using simple nutrient analysis and dissolved oxygen (DO) parameters. Nutrient and DO parameters were measured from three sites: 1. A stream adjacent to a field receiving manure, upstream of a large livestock facility with a history of direct discharge, 2. The same stream downstream of the facility and 3. A stream in an area relatively unimpacted by large-scale agriculture (control site). Results show that calculating a simple Pearson correlation coefficient (r) of soluble reactive phosphorus (SRP) and ammonia over time as well as temperature and DO, distinguishes non-point source from point source discharge into surface water. The r value for SRP and ammonia for the upstream site was 0.01 while the r value for the downstream site was 0.92. The control site had an r value of 0.20. Likewise, r values were calculated on temperature and DO for each site. High negative correlations between temperature and DO are indicative of a relatively unimpacted stream. Results from this study are commensurate with nutrient correlations and are: r = -0.97 for the upstream site, r = -0.21 for the downstream site and r = -0.89 for the control site. Results from every site tested were statistically significant (p ≤ 0.05). These results support previous studies and demonstrate that the simple analytical techniques mentioned provide an effective means for regulatory agencies and community groups to monitor and identify point source discharge from large livestock facilities.

  15. Water quality and benthic macroinvertebrate bioassessment of Gallinas Creek, San Miguel County, New Mexico, 1987-90

    USGS Publications Warehouse

    Garn, H.S.; Jacobi, G.Z.

    1996-01-01

    Upper Gallinas Creek in north-central New Mexico serves as the public water supply for the City of Las Vegas. The majority of this 84-square-mile watershed is within national forest lands managed by the U.S. Forest Service. In 1985, the Forest Service planned to conduct timber harvesting in the headwaters of Gallinas Creek. The City of Las Vegas was concerned about possible effects from logging on water quality and on water-supply treatment costs. The U.S. Geological Survey began a cooperative study in 1987 to (1) assess the baseline water-quality characteristics of Gallinas Creek upstream from the Las Vegas water-supply diversion, (2) relate water quality to State water- quality standards, and (3) determine possible causes for spatial differences in quality. During 1987-90, water-quality constituents and aquatic benthic macroinvertebrates were collected and analyzed at five sampling sites in the watershed. Specific conductance, pH, total hardness, total alkalinity, and calcium concentrations increased in a downstream direction, probably in response to differences in geology in the watershed. The water-quality standard for temperature was exceeded at the two most downstream sites probably due to a lack of riparian vegetation and low streamflow conditions. The standards for pH and turbidity were exceeded at all sites except the most upstream one. Concentrations of nitrogen species and phosphorus generally were small at all sites. The maximum total nitrogen concentration of 2.1 milligrams per liter was at the mouth of Porvenir Canyon; only one sample at this site exceeded the water-quality standard for total inorganic nitrogen. At each of the sites, 10 to 15 percent of the samples exceeded the total phosphorus standard of less than 0.1 milligram per liter. Except for aluminum and iron, almost all samples tested for trace elements contained concentrations less than the laboratory detection limit. No trace-element concentrations exceeded the State standard for domestic water supplies. Suspended-sediment concentrations appeared to increase with distance downstream; suspended sediment increased significantly from the uppermost site to the second site near the national forest boundary, most probably caused by runoff from the unpaved forest road adjacent to Gallinas Creek. The aquatic macroinvertebrate assessment indicated that the three upstream sites had good biological conditions and were nonimpaired, whereas the two downstream sites had lowered biological conditions and were slightly impaired. The water- quality and biological assessments provided similar results.

  16. Cross-protection against Salmonella enteritidis infection in mice. III. Delayed hypersensitivity reaction and clearance of the challenge organism.

    PubMed

    Padmanaban, V D; Mittal, K R

    1979-01-01

    Mice were immunized with live vaccines and with live vaccines with complete adjuvant incorporating Salmonella enteritidis, Salmonella typhi-murium, Salmonella gallinarum or Salmonella pullorum. On the 21st day after vacination, the hypersensitivity reactions elicited by the mice to extracts of the challenge organism (S. enteritidis 5694 SMR) were assessed. The degree of delayed hypersensitivity reaction was compared with the level of protection induced by the vaccine. The role in protection of delayed hypersensitivity is discussed. Clearance of the challenge organism from the liver of previously vaccinated and unvaccinated mice was assessed quantitatively.

  17. The MNK–eIF4E Signaling Axis Contributes to Injury-Induced Nociceptive Plasticity and the Development of Chronic Pain

    PubMed Central

    Asiedu, Marina N.; Megat, Salim; Burton, Michael D.; Burgos-Vega, Carolina C.; Melemedjian, Ohannes K.; Boitano, Scott; Vagner, Josef; Pancrazio, Joseph J.; Mogil, Jeffrey S.; Dussor, Gregory

    2017-01-01

    Injury-induced sensitization of nociceptors contributes to pain states and the development of chronic pain. Inhibiting activity-dependent mRNA translation through mechanistic target of rapamycin and mitogen-activated protein kinase (MAPK) pathways blocks the development of nociceptor sensitization. These pathways convergently signal to the eukaryotic translation initiation factor (eIF) 4F complex to regulate the sensitization of nociceptors, but the details of this process are ill defined. Here we investigated the hypothesis that phosphorylation of the 5′ cap-binding protein eIF4E by its specific kinase MAPK interacting kinases (MNKs) 1/2 is a key factor in nociceptor sensitization and the development of chronic pain. Phosphorylation of ser209 on eIF4E regulates the translation of a subset of mRNAs. We show that pronociceptive and inflammatory factors, such as nerve growth factor (NGF), interleukin-6 (IL-6), and carrageenan, produce decreased mechanical and thermal hypersensitivity, decreased affective pain behaviors, and strongly reduced hyperalgesic priming in mice lacking eIF4E phosphorylation (eIF4ES209A). Tests were done in both sexes, and no sex differences were found. Moreover, in patch-clamp electrophysiology and Ca2+ imaging experiments on dorsal root ganglion neurons, NGF- and IL-6-induced increases in excitability were attenuated in neurons from eIF4ES209A mice. These effects were recapitulated in Mnk1/2−/− mice and with the MNK1/2 inhibitor cercosporamide. We also find that cold hypersensitivity induced by peripheral nerve injury is reduced in eIF4ES209A and Mnk1/2−/− mice and following cercosporamide treatment. Our findings demonstrate that the MNK1/2–eIF4E signaling axis is an important contributing factor to mechanisms of nociceptor plasticity and the development of chronic pain. SIGNIFICANCE STATEMENT Chronic pain is a debilitating disease affecting approximately one in three Americans. Chronic pain is thought to be driven by changes in the excitability of peripheral nociceptive neurons, but the precise mechanisms controlling these changes are not elucidated. Emerging evidence demonstrates that mRNA translation regulation pathways are key factors in changes in nociceptor excitability. Our work demonstrates that a single phosphorylation site on the 5′ cap-binding protein eIF4E is a critical mechanism for changes in nociceptor excitability that drive the development of chronic pain. We reveal a new mechanistic target for the development of a chronic pain state and propose that targeting the upstream kinase, MAPK interacting kinase 1/2, could be used as a therapeutic approach for chronic pain. PMID:28674170

  18. [Residue Concentration and Distribution Characteristics of Perfluorinated Compounds in Surface Water from Qiantang River in Hangzhou Section].

    PubMed

    Zhang, Ming; Tang, Fang-liang; Yu, Ya-yun; Xu, Jian-fen; Li, Hua; Wu, Min-hua; Zhang, Wei; Pan, Jian-yang

    2015-12-01

    This study studied the pollution characteristics of perfluorinated compounds (PFCs) in Qiantang River in Hangzhou section (QR). Surface water samples, collected in July 2014 and January 2015 from 14 sites in QR were analyzed for 16 PFCs. All samples were prepared by solid-phase extraction with Oasis WAX cartridges and analyzed using the ultra performance liquid chromatography interfaced to tandem mass spectrometry ( UPLC-MS/MS). The results showed that 8 medium-and short-chain PFCs including C₄ and C₈ perfluorinated sulfonates (PFSAs) and C₄-C₉ perfluorinated carboxylic acids (PFCAs) were detected in the surface waters. The total concentrations of PFCs ranged from 0.98 to 609 ng · L⁻¹, while perfluorooctanoic acid (PFOA) dominated, with range of 0.59-538 ng L⁻¹, and perfluorooctane sulfonate (PFOS) was detected at lower levels, ranging from 0 to 2.48 ng · L⁻¹. The spatial distribution of PFCs varied, and the pollutant concentrations at the sampling sites located in upstream of the river such as Lanjiangkou and Jiangjunyan were relatively high, PFCs concentration showed a decreasing trend from the upstream to the downstream. According to the ratio of feature components, PFCs in surface water of QR originated largely from the input of direct sewage emissions. Taken together, the PFCs pollution was highly correlated with the upstream of Qiantang River valley's industry distribution, and most of the mass load in the investigated river was attributed to upstream running water with a minor influence from the wastewater discharges along the river basin. Overall, the results presented here indicated that greater attention should be given to the contamination of PFCs, especially for PFOA in water body of QR.

  19. Contact sheet recording with a self-acting negative air bearing

    NASA Technical Reports Server (NTRS)

    Muftu , Sinan (Inventor); Hinteregger, Hans F (Inventor)

    2000-01-01

    A flat head and a tape transport arrangement impart a wrap angle to the tape at the upstream corner of the head. The wrap angle, corner sharpness and tape stiffness are sufficient to cause a moving tape to form a hollow bump at the upstream corner, thereby creating a hollow into which entrained air can expand, causing a subambient pressure within and downstream of the bump. This pressure keeps the tape in contact with the head. It is created without the need for a groove or complex pressure relief slot(s). No contact pressure arises at the signal exchange site due to media wrap. The highest contact pressures are developed at a wrapped upstream corner. For a tape drive, traveling in both forward and reverse, the wrap can be at both the upstream and downstream (which is the reverse upstream) corners. Heads that are not flat can also be used, if the wrap angle relative to a main surface is sufficient and not too large. The wrapped head can also be used with rotating media, such as disks (floppy and hard) and rotating heads, such as helical wound heads for video recording. Multiple flat tape bearing surfaces can be separated by grooves and/or angles. Each flat can carry heads along one or more gap lines. Multiple adjacent narrow tracks can thus be written for extreme high track density recording.

  20. Desensitization in delayed drug hypersensitivity reactions -- an EAACI position paper of the Drug Allergy Interest Group.

    PubMed

    Scherer, K; Brockow, K; Aberer, W; Gooi, J H C; Demoly, P; Romano, A; Schnyder, B; Whitaker, P; Cernadas, J S R; Bircher, A J

    2013-07-01

    Drug hypersensitivity may deprive patients of drug therapy, and occasionally no effective alternative treatment is available. Successful desensitization has been well documented in delayed drug hypersensitivity reactions. In certain situations, such as sulfonamide hypersensitivity in HIV-positive patients or hypersensitivity to antibiotics in patients with cystic fibrosis, published success rates reach 80%, and this procedure appears helpful for the patient management. A state of clinical tolerance may be achieved by the administration of increasing doses of the previously offending drug. However, in most cases, a pre-existent sensitization has not been proven by positive skin tests. Successful re-administration may have occurred in nonsensitized patients. A better understanding of the underlying mechanisms of desensitization is needed. Currently, desensitization in delayed hypersensitivity reactions is restricted to mild, uncomplicated exanthems and fixed drug eruptions. The published success rates vary depending on clinical manifestations, drugs, and applied protocols. Slower protocols tend to be more effective than rush protocols; however, underreporting of unsuccessful procedures is very probable. The decision to desensitize a patient must always be made on an individual basis, balancing risks and benefits. This paper reviews the literature and presents the expert experience of the Drug Hypersensitivity Interest Group of the European Academy of Allergy and Clinical Immunology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Classification and pathophysiology of radiocontrast media hypersensitivity.

    PubMed

    Brockow, Knut; Ring, Johannes

    2010-01-01

    Hypersensitivity reactions to radiocontrast media (RCM) are unpredictable and are a concern for radiologists and cardiologists. Immediate hypersensitivity reactions manifest as anaphylaxis, and an allergic IgE-mediated mechanism has been continuously discussed for decades. Non-immediate reactions clinically are exanthemas resembling other drug-induced non-immediate hypersensitivities. During the past years, evidence is increasing that some of these reactions may be immunological. Repeated reactions after re-exposure, positive skin tests, and presence of specific IgE antibodies as well as positive basophil activation tests in some cases, and positive lymphocyte transformation or lymphocyte activation tests in others, indicate that a subgroup of both immediate and non-immediate reactions are of an allergic origin, although many questions remain unanswered. Recently reported cases highlight that pharmacological premedication is not safe to prevent RCM hypersensitivity in patients with previous severe reactions. These insights may have important consequences. A large multicenter study on the value of skin tests in RCM hypersensitivity concluded that skin testing is a useful tool for diagnosis of RCM allergy. It may have a role for the selection of a safe product in previous reactors, although confirmatory validation data is still scarce. In vitro tests to search for RCM-specific cell activation still are in development. In conclusion, recent data indicate that RCM hypersensitivity may have an allergic mechanism and that allergological testing is useful and may indicate tolerability. Copyright 2010 S. Karger AG, Basel.

  2. PERSISTENT SUPPRESSION OF CONTACT HYPERSENSITIVITY, AND ALTERED T-CELL PARAMETERS IN F344 RATS EXPOSED PERINATALLY TO 2,3,7,8-TETRACHLORODIBENZO-P-DIOXIN (TCDD)

    EPA Science Inventory

    Abstract
    The outcome of perinatal low-level TCDD exposure on the T cell-mediated contact hypersensitivity response (CHS) in adult F344 rats was investigated. Suppression of the 2,4- dinitrofluorobenzene (DNFB)-specific contact hypersensitivity reponse occurred in mature off...

  3. Linking Anxiety and Insistence on Sameness in Autistic Children: The Role of Sensory Hypersensitivity

    ERIC Educational Resources Information Center

    Black, Karen R.; Stevenson, Ryan A.; Segers, Magali; Ncube, Busiswe L.; Sun, Sol Z.; Philipp-Muller, Aviva; Bebko, James M.; Barense, Morgan D.; Ferber, Susanne

    2017-01-01

    Sensory hypersensitivity and insistence on sameness (I/S) are common, co-occurring features of autism, yet the relationship between them is poorly understood. This study assessed the impact of sensory hypersensitivity on the clinical symptoms of specific phobia, separation anxiety, social anxiety and I/S for autistic and typically developing (TD)…

  4. Water Quality, Fish Tissue, and Bed Sediment Monitoring in Waterbodies of Fort Chaffee Maneuver Training Center, Arkansas, 2002-2004

    USGS Publications Warehouse

    Justus, B.G.; Stanton, Gregory P.

    2005-01-01

    The Fort Chaffee Maneuver Training Center is a facility used to train as many as 50,000 Arkansas National Guardsmen each year. Due to the nature of ongoing training and also to a poor understanding of environmental procedures that were practiced in the World War II era, areas within Fort Chaffee have the potential to be sources of a large number of contaminants. Because some streams flow on to Fort Chaffee, there is also the potential for sources that are off post to affect environmental conditions on post. This study evaluates constituent concentrations in water, fish tissue, and bed sediment collected from waterbodies on Fort Chaffee between September 2002 and July 2004. Constituent concentrations detected in the three media and measured at nine stream sites and four lake sites were compared to national and regional criteria when available. Two of the larger streams, Big and Vache Grasse Creeks, were sampled at multiple sites. All three sampled media were analyzed for insecticides, PCBs, explosives, and trace elements. Additionally, water samples were analyzed for nutrients and herbicides. The different constituents detected in the three sample media (water, fish tissue, and bed sediment) indicate that land-use activities both on and off post are influencing environmental conditions. Contaminants such as explosives that were sometimes detected in water samples have an obvious relation to military training; however, the occurrence and locations of some nutrients, insecticides, and trace elements suggest that land use both on and off post also could be influencing environmental conditions to some degree. Constituent concentrations at sites on Vache Grasse Creek, and particularly the most upstream site, which was located immediately downstream from an off-post wastewater-treatment facility, indicate that environmental conditions were being influenced by an off-post source. The most upstream site on Vache Grasse Creek had both the highest number of detections and the highest concentrations detected of all sites sampled. Event-mean storm concentrations and storm loads calculated from storm-flow samples at two sites each for Big and Vache Grasse Creeks indicate that storm loads were highest at the two Vache Grasse Creek sites for 24 of the 25 constituents detected. Further evaluation by normalizing storm loads at Big Creek to storm loads at Vache Grasse Creek by stream flow indicate that event loads at Vache Grasse Creek were about two or more times higher than those on Big Creek for 15 of the 25 constituents measured. Low concentrations of arsenic and lead were detected in water samples, but all detections for the two trace elements occurred in samples collected at the upstream site on Vache Grasse Creek. The nickel concentration in fish livers collected from the upstream site on Vache Grasse Creek was 45 percent higher than the median of a national study of 145 sites. Mercury concentrations in edible fish tissue, which are a widespread concern in the United States, exceeded an USEPA criterion for methylmercury of 300 ?g/kg in four of nine samples; however, concentrations are typical of mercury concentrations in fish tissues for the State of Arkansas. Constituent concentrations at some sites indicate that environmental conditions are being influenced by on-post activities. Of the 55 (excluding total organic carbon) organic constituents analyzed in water samples, only 10 were detected above the minimum detection limit but four of those were explosives. Bed-sediment samples from one site located on Grayson Creek, and nearest the administrative and residential (cantonment) area, had detections for arsenic, copper, lead, manganese, nickel, and zinc that were above background concentrations, and concentrations for arsenic and nickel at this site exceeded lowest effect level criteria established by the U.S. Environmental Protection Agency. The site on Grayson Creek also had the only detections of DDT metabolites in bed sedi

  5. Clinical evaluation of the efficacy of an in-office desensitizing paste containing 8% arginine and calcium carbonate in providing instant and lasting relief of dentin hypersensitivity.

    PubMed

    Schiff, Thomas; Delgado, Evaristo; Zhang, Yun Po; Cummins, Diane; DeVizio, William; Mateo, Luis R

    2009-03-01

    To determine the efficacy of an in-office desensitizing paste containing 8% arginine and calcium carbonate relative to that of a commercially-available pumice prophylaxis paste in reducing dentin hypersensitivity instantly after a single application following a dental scaling procedure and to establish the duration of sensitivity relief over a period of 4 weeks and 12 weeks. This was a single-center, parallel group, double-blind, stratified clinical study conducted in San Francisco, California, USA. Qualifying adult male and female subjects who presented two hypersensitive teeth with a tactile hypersensitivity score (Yeaple Probe) between 10-50 grams of force and an air blast hypersensitivity score of 2 or 3 (Schiff Cold Air Sensitivity Scale) were stratified according to their baseline hypersensitivity scores and randomly assigned within strata to one of two treatment groups: (1) A Test Paste, a desensitizing paste containing 8% arginine and calcium carbonate (Colgate-Palmolive Co); and (2) A Control Paste, Nupro pumice prophylaxis paste (Dentsply Professional). Subjects received a professionally-administered scaling procedure, after which they were re-examined for tactile and air blast dentin hypersensitivity (Post-Scaling Examinations). The assigned pastes were then applied as the final step to the professional dental cleaning procedure. Tactile and air blast dentin hypersensitivity examinations were again performed immediately after paste application. Subjects were provided with a commercially-available non-desensitizing dentifrice containing 0.243% sodium fluoride (Crest Cavity Protection, Procter & Gamble Co.) and an adult soft-bristled toothbrush and were instructed to brush their teeth for 1 minute, twice daily at home using only the toothbrush and dentifrice provided, for the next 12 weeks. Subjects returned to the testing facility 4 and 12 weeks after the single application of Test or Control paste, having refrained from all oral hygiene procedures and chewing gum for 8 hours and from eating and drinking for 4 hours, prior to each follow-up visit. Assessments of tactile and air blast hypersensitivity, and examinations of oral soft and hard tissue were repeated at these 4- and 12-week examinations. 68 subjects completed the 12-week study. No statistically significant differences from baseline scores were indicated at the Post-Scaling Examinations for either the Test Paste or Control Paste groups. Immediately following product application and 4 weeks after product application, subjects assigned to the Test Paste group exhibited statistically significant improvements from baseline with respect to baseline-adjusted mean air blast (44.1% and 45.9% respectively) and mean tactile hypersensitivity scores (156.2% and 170.3% respectively). At the same time points, subjects assigned to the Control Paste group exhibited statistically significant improvements from baseline with respect to baseline-adjusted mean air blast (15.1% and 8.9% respectively) and mean tactile hypersensitivity scores (43.1% and 8.3% respectively). Immediately following application of the assigned paste and 4 weeks later, the Test Paste group demonstrated statistically significant reductions in dentin hypersensitivity with respect to baseline-adjusted mean air blast (34.1% and 40.6% respectively) and mean tactile hypersensitivity scores (79.0% and 149.6% respectively), compared to the Control Paste group. No statistically significant differences were exhibited between paste groups at the Post-Scaling and 12-week examinations with respect to mean tactile and baseline-adjusted mean air blast hypersensitivity scores.

  6. Randomized clinical trial on the effect of a multispecies probiotic on visceroperception in hypersensitive IBS patients.

    PubMed

    Ludidi, S; Jonkers, D M; Koning, C J; Kruimel, J W; Mulder, L; van der Vaart, I B; Conchillo, J M; Masclee, A A M

    2014-05-01

    Irritable bowel syndrome (IBS) is characterized by heterogeneous pathophysiology and low response to treatment. Up to 60% of IBS patients suffers from visceral hypersensitivity, which is associated with symptom severity and underlying pathophysiological mechanisms. Recently, positive effects of probiotics in IBS have been reported, but overall the response was modest. We performed a study in IBS patients, characterized by visceral hypersensitivity measured with the rectal barostat, aiming to assess the effect of 6 weeks of multispecies probiotic mix on visceral pain perception. We conducted a randomized, placebo-controlled, double-blind trial in forty Rome III IBS patients with visceral hypersensitivity. Prior to intake, patients kept a 2-week symptom diary and underwent a rectal barostat measurement. When hypersensitivity was confirmed, participation was allowed and patients received a multispecies probiotic with in vitro proven potential beneficial effects on mechanisms contributing to visceral hypersensitivity (six different probiotic strains; 10(9)  cfu/g), or a placebo product of one sachet (5 g) per day for 6 weeks. At the end of the intervention period, visceroperception and symptoms were reassessed. Thirty-five patients completed the trial. The percentage of patients with visceral hypersensitivity decreased significantly in the probiotic and placebo group (76.5% and 71.4%, respectively; N.S. between groups). Improvement in pain scores and mean symptom score did not differ between the probiotic and placebo group. In this placebo-controlled trial in IBS patients with visceral hypersensitivity, no significant effect of a multispecies probiotic on viscerperception was observed. The study has been registered in the US National Library of Medicine (http://www.clinicaltrials.gov, NCT00702026). © 2014 John Wiley & Sons Ltd.

  7. Impact of Prophylactic Conversion to an Extended Infusion Schedule to Prevent Hypersensitivity Reactions in Ovarian Cancer Patients during Carboplatin Retreatment

    PubMed Central

    O’Cearbhaill, Roisin; Zhou, Qin; Iasonos, Alexia; Hensley, Martee L.; Tew, William P.; Aghajanian, Carol; Spriggs, David R.; Lichtman, Stuart M.; Sabbatini, Paul J.

    2015-01-01

    Objective Repeated exposure to carboplatin can lead to hypersensitivity reactions during retreatment with carboplatin. This may prevent its further use in platinum-sensitive ovarian cancer patients. At our institution, an increasing proportion of patients are prophylactically converted to an extended schedule of infusion after 8 cycles of carboplatin. We sought to determine whether an incrementally increasing, extended 3-hour infusion of carboplatin was associated with a lower rate of hypersensitivity reactions compared to the standard 30-minute schedule in sequentially treated patients. Methods We performed a retrospective electronic medical record review of patients with recurrent ovarian cancer retreated with carboplatin at our institution from 01/98–12/08. Results Seven hundred seventy-seven patients with relapsed ovarian, fallopian tube, or primary peritoneal cancer were retreated with carboplatin and met study inclusion criteria. Of these, 117 (17%) developed hypersensitivity reactions during second-line or greater carboplatin-based treatment for recurrent disease. Only 6 (3.4%) of the 174 patients who received the extended schedule developed hypersensitivity reactions (0% grade 4; 1.7% grade 3) compared to 111 (21%) of 533 patients in the standard schedule group (12% grade 4; 77% grade 3). The first hypersensitivity episode occurred after a median of 16 platinum (carboplatin and cisplatin) treatments in the extended group compared to 9 in the standard group. Using the Fisher-exact test, there was an association with a reduced incidence of hypersensitivity reactions with the extended infusion schedule (P<0.001). Conclusion Our data suggest appropriate premedication and prophylactic conversion to an extended infusion during carboplatin retreatment may reduce hypersensitivity reactions. PMID:19944454

  8. Development and pharmacological characterization of a model of sleep disruption-induced hypersensitivity in the rat.

    PubMed

    Wodarski, R; Schuh-Hofer, S; Yurek, D A; Wafford, K A; Gilmour, G; Treede, R-D; Kennedy, J D

    2015-04-01

    Sleep disturbance is a commonly reported co-morbidity in chronic pain patients, and conversely, disruption of sleep can cause acute and long-lasting hypersensitivity to painful stimuli. The underlying mechanisms of sleep disruption-induced pain hypersensitivity are poorly understood. Confounding factors of previous studies have been the sleep disruption protocols, such as the 'pedestal over water' or 'inverted flower pot' methods, that can cause large stress responses and therefore may significantly affect pain outcome measures. Sleep disruption was induced by placing rats for 8 h in a slowly rotating cylindrical cage causing arousal via the righting reflex. Mechanical (Von Frey filaments) and thermal (Hargreaves) nociceptive thresholds were assessed, and plasma corticosterone levels were measured (mass spectroscopy). Sleep disruption-induced hypersensitivity was pharmacologically characterized with drugs relevant for pain treatment, including gabapentin (30 mg/kg and 50 mg/kg), Ica-6p (Kv7.2/7.3 potassium channel opener; 10 mg/kg), ibuprofen (30 mg/kg and 100 mg/kg) and amitriptyline (10 mg/kg). Eight hours of sleep disruption caused robust mechanical and heat hypersensitivity in the absence of a measurable change in plasma corticosterone levels. Gabapentin had no effect on reduced nociceptive thresholds. Ibuprofen attenuated mechanical thresholds, while Ica-6p and amitriptyline attenuated only reduced thermal nociceptive thresholds. These results show that acute and low-stress sleep disruption causes mechanical and heat hypersensitivity in rats. Mechanical and heat hypersensitivity exhibited differential sensitivity to pharmacological agents, thus suggesting dissociable mechanisms for those two modalities. Ultimately, this model could help identify underlying mechanisms linking sleep disruption and hypersensitivity. © 2014 European Pain Federation - EFIC®

  9. Glycerol Hypersensitivity in a Drosophila Model for Glycerol Kinase Deficiency Is Affected by Mutations in Eye Pigmentation Genes

    PubMed Central

    Wightman, Patrick J.; Jackson, George R.; Dipple, Katrina M.

    2012-01-01

    Glycerol kinase plays a critical role in metabolism by converting glycerol to glycerol 3-phosphate in an ATP dependent reaction. In humans, glycerol kinase deficiency results in a wide range of phenotypic variability; patients can have severe metabolic and CNS abnormalities, while others possess hyperglycerolemia and glyceroluria with no other apparent phenotype. In an effort to help understand the pathogenic mechanisms underlying the phenotypic variation, we have created a Drosophila model for glycerol kinase deficiency by RNAi targeting of dGyk (CG18374) and dGK (CG7995). As expected, RNAi flies have reduced glycerol kinase RNA expression, reduced phosphorylation activity and elevated glycerol levels. Further investigation revealed these flies to be hypersensitive to fly food supplemented with glycerol. Due to the hygroscopic nature of glycerol, we predict glycerol hypersensitivity is a result of greater susceptibility to desiccation, suggesting glycerol kinase to play an important role in desiccation resistance in insects. To evaluate a role for genetic modifier loci in determining severity of the glycerol hypersensitivity observed in knockdown flies, we performed a preliminary screen of lethal transposon insertion mutant flies using a glycerol hypersensitive survivorship assay. We demonstrate that this type of screen can identify both enhancer and suppressor genetic loci of glycerol hypersensitivity. Furthermore, we found that the glycerol hypersensitivity phenotype can be enhanced or suppressed by null mutations in eye pigmentation genes. Taken together, our data suggest proteins encoded by eye pigmentation genes play an important role in desiccation resistance and that eye pigmentation genes are strong modifiers of the glycerol hypersensitive phenotype identified in our Drosophila model for glycerol kinase deficiency. PMID:22427807

  10. Polymorphism in glutamate cysteine ligase catalytic subunit (GCLC) is associated with sulfamethoxazole-induced hypersensitivity in HIV/AIDS patients

    PubMed Central

    2012-01-01

    Background Sulfamethoxazole (SMX) is a commonly used antibiotic for prevention of infectious diseases associated with HIV/AIDS and immune-compromised states. SMX-induced hypersensitivity is an idiosyncratic cutaneous drug reaction with genetic components. Here, we tested association of candidate genes involved in SMX bioactivation and antioxidant defense with SMX-induced hypersensitivity. Results Seventy seven single nucleotide polymorphisms (SNPs) from 14 candidate genes were genotyped and assessed for association with SMX-induced hypersensitivity, in a cohort of 171 HIV/AIDS patients. SNP rs761142 T > G, in glutamate cysteine ligase catalytic subunit (GCLC), was significantly associated with SMX-induced hypersensitivity, with an adjusted p value of 0.045. This result was replicated in a second cohort of 249 patients (p = 0.025). In the combined cohort, heterozygous and homozygous carriers of the minor G allele were at increased risk of developing hypersensitivity (GT vs TT, odds ratio = 2.2, 95% CL 1.4-3.7, p = 0.0014; GG vs TT, odds ratio = 3.3, 95% CL 1.6 – 6.8, p = 0.0010). Each minor allele copy increased risk of developing hypersensitivity 1.9 fold (95% CL 1.4 – 2.6, p = 0.00012). Moreover, in 91 human livers and 84 B-lymphocytes samples, SNP rs761142 homozygous G allele carriers expressed significantly less GCLC mRNA than homozygous TT carriers (p < 0.05). Conclusions rs761142 in GCLC was found to be associated with reduced GCLC mRNA expression and with SMX-induced hypersensitivity in HIV/AIDS patients. Catalyzing a critical step in glutathione biosynthesis, GCLC may play a broad role in idiosyncratic drug reactions. PMID:22824134

  11. Self-reported prevalence of hypersensitivity reactions against drugs among medical students: does awareness cause any difference?

    PubMed

    Bavbek, Sevim; Erkekol, Ferda Öner; Celik, Gülfem Elif; Gönüllü, Ipek; Misirligil, Zeynep

    2011-02-01

    True epidemiologic data on hypersensitivity reactions to drugs are scarce. More accurate data may be obtained in more specific clinical settings. Considering their educational background, medical students may be an appropriate target audience for evaluating prevalence of drug hypersensitivity. This study is designed to determine the prevalence of self-reported drug hypersensitivity alongside related factors among young adults. A structured questionnaire was administered to the students. A total of 1267 students (mean age: 21.71+1.90 years, F/M: 648/619) from all grades responded to the survey. The mean prevalence of self-reported drug hypersensitivity was 4.7% (60/1267). The most frequently involved drugs were beta-lactam antibiotics (55%) followed by non-steroidal anti-inflammatory drugs (28%). The most commonly reported clinical presentations were cutaneous (43.3%), followed by systemic (36.8%), cardiovascular (8.3%) and respiratory (8.3%) symptoms. Factors related with reported reactions were higher grades (p=0.015, OR: 2.09), female gender (p=0.006, OR: 2.13), personal history of allergic diseases (p=0.001, OR: 2.64), and family history of drug hypersensitivity (p<0.001, OR: 5.78). Half of the students sought medical help during the acute stage of their reaction. Only 3.2% of the cases have been referred to an allergist for further evaluation. This study, the first of its kind in Turkey, with medical students showed that self-reported hypersensitivity reactions to drugs is highly prevalent and its prevalence seems to be affected by awareness of the individuals in addition to previously reported risk factors. The education of both patients and physicians on the management of drug hypersensitivity seems to be necessary. Copyright © 2010 John Wiley & Sons, Ltd.

  12. Field Evaluation of Detection-Control System

    DOT National Transportation Integrated Search

    2015-04-01

    In this research, a field evaluation of the Detection-Control System (D-CS) was conducted at eight sites located in four States. D-CS is similar to a traditional advance detector system in that it uses information from detectors located upstream of t...

  13. Sulfite hypersensitivity. A critical review

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gunnison, A.F.; Jacobsen, D.W.

    Sulfiting agents (sulfur dioxide and the sodium and potassium salts of bisulfite, sulfite, and metabisulfite) are widely used as preservatives in foods, beverages, and pharmaceuticals. Within the past 5 years, there have been numerous reports of adverse reactions to sulfiting agents. This review presents a comprehensive compilation and discussion of reports describing reactions to ingested, inhaled, and parenterally administered sulfite. Sulfite hypersensitivity is usually, but not exclusively, found within the chronic asthmatic population. Although there is some disagreement on its prevalence, a number of studies have indicated that 5 to 10% of all chronic asthmatics are sulfite hypersensitive. This reviewmore » also describes respiratory sulfur dioxide sensitivity which essentially all asthmatics experience. Possible mechanisms of sulfite hypersensitivity and sulfur dioxide sensitivity are discussed in detail. Sulfite metabolism and the role of sulfite oxidase in the detoxification of exogenous sulfite are reviewed in relationship to the etiology of sulfite hypersensitivity. 147 references.« less

  14. Aspirin Allergy Desensitization in Cerebrovascular Disease

    PubMed Central

    Zuckerman, Scott L; Seder, David B; Tsujiura, Crystiana; Cushing, Deborah; Gallup, Holly; Mocco, J; Hanel, Richard A; Ecker, Robert D

    2014-01-01

    Summary Aspirin (ASA) is the mainstay of treatment in cerebrovascular and systemic vascular disease. ASA hypersensitivity can pose a challenge to achieving optimum medical management prior to and after neurointerventional treatment. Desensitization to ASA is well described in the allergy and cardiovascular literature, but there are no similar discussions specific to neurointervention. The purpose of our study was to describe our experience with ASA hypersensitivity management and review the relevant literature. Two cases of patients with symptomatic cerebrovascular disease requiring neurointervention who were successfully desensitized to their ASA hypersensitivity prior to treatment are described. The subsequent literature is reviewed. Several ASA desensitization protocols exist and have been proven to successfully treat ASA hypersensitivity and allow for ASA therapy to be safely initiated. We describe several previously published protocols. ASA desensitization is a safe and simple way to manage ASA hypersensitivity. We provide comprehensive management guidelines for the neurointerventionalist engaging in ASA desensitization. PMID:24556294

  15. [Food hypersensitivity dermatitis in the dog: diagnostic possibilities].

    PubMed

    Wilhelm, S; Favrot, C

    2005-04-01

    Dogs with food hypersensitivity usually develop chronic pruritic dermatoses virtually indistinguishable from atopic dermatitis. These reactions are often called food allergy but the pathogenesis is poorly characterized. Several studies have addressed the incidence of canine adverse reactions to food but the outcomes were conflicting. The gold standard for the diagnosis of such a condition is the restricted dietary trial and the subsequent provocation challenge. Some attempts have been made to develop serological tests but none of these tests accurately predicted canine food sensitivity. The aim of the present study was to determine the incidence of food hypersensitivity dermatitis and to evaluate a newly developed serological test for the diagnosis of food allergy in dogs. Only 9% of 55 dogs with dermatological signs compatible with food hypersensitivity or atopic dermatitis have been diagnosed as food hypersensitive dogs. The repeatability of the serological test has shown to be insufficient.

  16. Pharmaceuticals and other organic chemicals in selected north-central and northwestern Arkansas streams

    USGS Publications Warehouse

    Haggard, B.E.; Galloway, J.M.; Green, W.R.; Meyer, M.T.

    2006-01-01

    Recently, our attention has focused on the low level detection of many antibiotics, pharmaceuticals, and other organic chemicals in water resources. The limited studies available suggest that urban or rural streams receiving wastewater effluent are more susceptible to contamination. The purpose of this study was to evaluate the occurrence of antibiotics, pharmaceuticals, and other organic chemicals at 18 sites on seven selected streams in Arkansas, USA, during March, April, and August 2004. Water samples were collected upstream and downstream from the influence of effluent discharges in northwestern Arkansas and at one site on a relatively undeveloped stream in north-central Arkansas. At least one antibiotic, pharmaceutical, or other organic chemical was detected at all sites, except at Spavinaw Creek near Mayesville, Arkansas. The greatest number of detections was observed at Mud Creek downstream from an effluent discharge, including 31 pharmaceuticals and other organic chemicals. The detection of these chemicals occurred in higher frequency at sites downstream from effluent discharges compared to those sites upstream from effluent discharges; total chemical concentration was also greater downstream. Wastewater effluent discharge increased the concentrations of detergent metabolites, fire retardants, fragrances and flavors, and steroids in these streams. Antibiotics and associated degradation products were only found at two streams downstream from effluent discharges. Overall, 42 of the 108 chemicals targeted in this study were found in water samples from at least one site, and the most frequently detected organic chemicals included caffeine, phenol, para-cresol, and acetyl hexamethyl tetrahydro naphthalene (AHTN). ?? ASA, CSSA, SSSA.

  17. Stream channel responses and soil loss at off-highway vehicle stream crossings in the Ouachita National Forest

    Treesearch

    Daniel A. Marion; Jonathan D. Phillips; Chad Yocum; Stephanie H. Mehlhope

    2014-01-01

    This study investigates the geomorphic effects of ford-type stream crossings in an off-highway vehicle (OHV) trail complex in the Ouachita National Forest, Arkansas. At a total of 15 crossing sites, we used a disturbed vs. undisturbed study design to assess soil truncation and an upstream vs. downstream design to assess in-channel effects. The 15 sites ranged from OHV...

  18. Migration Patterns, Densities, and Growth of Neritina punctulata Snails in Rio Espiritu Santo and Rio Mameyes, Northeastern Puerto Rico.

    Treesearch

    MARK PYRON; ALAN P. COVICH

    2003-01-01

    Snail size-frequency distributions in Rios Espiritu Santo and Mameyes, which drain the Luquillo Experimental Forest, Puerto Rico, showed that Neritina punctulata with shell lengths greater than 30 mm were the most abundant size class at upstream sites. The highest densities for all size classes were at the downstream sites. Growth rates were 0.015 mm/day for a large...

  19. Prioritizing conservation activities using reserve site selection methods and population viability analysis.

    PubMed

    Newbold, Stephen C; Siikamäki, Juha

    2009-10-01

    In recent years a large literature on reserve site selection (RSS) has developed at the interface between ecology, operations research, and environmental economics. Reserve site selection models use numerical optimization techniques to select sites for a network of nature reserves for protecting biodiversity. In this paper, we develop a population viability analysis (PVA) model for salmon and incorporate it into an RSS framework for prioritizing conservation activities in upstream watersheds. We use spawner return data for three closely related salmon stocks in the upper Columbia River basin and estimates of the economic costs of watershed protection from NOAA to illustrate the framework. We compare the relative cost-effectiveness of five alternative watershed prioritization methods, based on various combinations of biological and economic information. Prioritization based on biological benefit-economic cost comparisons and accounting for spatial interdependencies among watersheds substantially outperforms other more heuristic methods. When using this best-performing prioritization method, spending 10% of the cost of protecting all upstream watersheds yields 79% of the biological benefits (increase in stock persistence) from protecting all watersheds, compared to between 20% and 64% for the alternative methods. We also find that prioritization based on either costs or benefits alone can lead to severe reductions in cost-effectiveness.

  20. A new sampler design for measuring sedimentation in streams

    USGS Publications Warehouse

    Hedrick, Lara B.; Welsh, S.A.; Hedrick, J.D.

    2005-01-01

    Sedimentation alters aquatic habitats and negatively affects fish and invertebrate communities but is difficult to quantify. To monitor bed load sedimentation, we designed a sampler with a 10.16-cm polyvinyl chloride coupling and removable sediment trap. We conducted a trial study of our samplers in riffle and pool habitats upstream and downstream of highway construction on a first-order Appalachian stream. Sediment samples were collected over three 6-week intervals, dried, and separated into five size-classes by means of nested sieves (U.S. standard sieve numbers 4, 8, 14, and 20). Downstream sediment accumulated in size-classes 1 and 2, and the total amount accumulated was significantly greater during all three sampling periods. Size-classes 3 and 4 had significantly greater amounts of sediment for the first two sampling periods at the downstream site. Differences between upstream and downstream sites narrowed during the 5-month sampling period. This probably reflects changes in site conditions, including the addition of more effective sediment control measures after the first 6-week period of the study. The sediment sampler design allowed for long-term placement of traps without continual disturbance of the streambed and was successful at providing repeat measures of sediment at paired sites. ?? Copyright by the American Fisheries Society 2005.

  1. Lateral movement and stability of channel banks near four highway crossings in southwestern Mississippi

    USGS Publications Warehouse

    Turnipseed, D. Phil

    1994-01-01

    Channel meandering in alluvial streams has caused localized channel instability that has resulted in bridge failure and loss of human life in Mississippi. The U.S. Geological Survey, in coopera- tion with the Mississippi Department of Transpor- tation, conducted a study to develop a better methodology for defining and estimating channel meandering. For this report, river reaches near four bridge sites with current lateral movement of channel banks were selected for study. The lateral movement of channel banks was studied by mapping meanders from aerial photographs taken at various times, evaluating available discharge measurements, and measuring existing channel geometry and soil strength properties at these sites. Rapid, unre- stricted meander cuts and sandy banks are charac- teristic of the sites. Lateral movement was signi- ficant upstream from all four sites, and only one bridge site did not have significant lateral channel-bank movement during the study period. The development of cutbanks and localized channel-bank erosion have caused unstable conditions at three of the sites. Maps of tops of channel indicate significant lateral movement of channel banks upstream and downstream of all four sites and near the bridges at three of four sites. No significant movement occurred at the U.S. Highway 98 crossing of the Bogue Chitto near Tylertown from 1941 to 1991 despite large floods in 1983 and 1990. Slope stability analyses indicated this site to be marginally stable. The maximum lateral movement indicated from maps of tops of channel banks was 680 feet of northward movement of the right (north) bank of the Homochitto River near the State Highway 33 crossing at Rosetta from 1941 to 1983.

  2. Asymmetric connectivity of spawning aggregations of a commercially important marine fish using a multidisciplinary approach

    PubMed Central

    Jackson, Alexis; Marinone, Silvio Guido; Erisman, Brad; Moreno-Baez, Marcia; Girón-Nava, Alfredo; Pfister, Tad; Aburto-Oropeza, Octavio; Torre, Jorge

    2014-01-01

    Understanding patterns of larval dispersal is key in determining whether no-take marine reserves are self-sustaining, what will be protected inside reserves and where the benefits of reserves will be observed. We followed a multidisciplinary approach that merged detailed descriptions of fishing zones and spawning time at 17 sites distributed in the Midriff Island region of the Gulf of California with a biophysical oceanographic model that simulated larval transport at Pelagic Larval Duration (PLD) 14, 21 and 28 days for the most common and targeted predatory reef fish, (leopard grouper Mycteroperca rosacea). We tested the hypothesis that source–sink larval metapopulation dynamics describing the direction and frequency of larval dispersal according to an oceanographic model can help to explain empirical genetic data. We described modeled metapopulation dynamics using graph theory and employed empirical sequence data from a subset of 11 sites at two mitochondrial genes to verify the model predictions based on patterns of genetic diversity within sites and genetic structure between sites. We employed a population graph describing a network of genetic relationships among sites and contrasted it against modeled networks. While our results failed to explain genetic diversity within sites, they confirmed that ocean models summarized via graph and adjacency distances over modeled networks can explain seemingly chaotic patterns of genetic structure between sites. Empirical and modeled networks showed significant similarities in the clustering coefficients of each site and adjacency matrices between sites. Most of the connectivity patterns observed towards downstream sites (Sonora coast) were strictly asymmetric, while those between upstream sites (Baja and the Midriffs) were symmetric. The best-supported gene flow model and analyses of modularity of the modeled networks confirmed a pulse of larvae from the Baja Peninsula, across the Midriff Island region and towards the Sonoran coastline that acts like a larval sink, in agreement with the cyclonic gyre (anti-clockwise) present at the peak of spawning (May–June). Our approach provided a mechanistic explanation of the location of fishing zones: most of the largest areas where fishing takes place seem to be sustained simultaneously by high levels of local retention, contribution of larvae from upstream sites and oceanographic patterns that concentrate larval density from all over the region. The general asymmetry in marine connectivity observed highlights that benefits from reserves are biased towards particular directions, that no-take areas need to be located upstream of targeted fishing zones, and that some fishing localities might not directly benefit from avoiding fishing within reserves located adjacent to their communities. We discuss the implications of marine connectivity for the current network of marine protected areas and no-take zones, and identify ways of improving it. PMID:25165626

  3. Environmental signatures and effects of an oil and gas wastewater spill in the Williston Basin, North Dakota

    USGS Publications Warehouse

    Cozzarelli, Isabelle M.; Skalak, Katherine; Kent, D.B.; Engle, Mark A.; Benthem, Adam J.; Mumford, Adam; Haase, Karl B.; Farag, Aïda M.; Harper, David; Nagel, S. C.; Iwanowicz, Luke R.; Orem, William H.; Akob, Denise M.; Jaeschke, Jeanne B.; Galloway, Joel M.; Kohler, Matthias; Stoliker, Deborah L.; Jolly, Glenn D.

    2017-01-01

    Wastewaters from oil and gas development pose largely unknown risks to environmental resources. In January 2015, 11.4 M L (million liters) of wastewater (300 g/L TDS) from oil production in the Williston Basin was reported to have leaked from a pipeline, spilling into Blacktail Creek, North Dakota. Geochemical and biological samples were collected in February and June 2015 to identify geochemical signatures of spilled wastewaters as well as biological responses along a 44-km river reach. February water samples had elevated chloride (1030 mg/L) and bromide (7.8 mg/L) downstream from the spill, compared to upstream levels (11 mg/L and < 0.4 mg/L, respectively). Lithium (0.25 mg/L), boron (1.75 mg/L) and strontium (7.1 mg/L) were present downstream at 5–10 times upstream concentrations. Light hydrocarbon measurements indicated a persistent thermogenic source of methane in the stream. Semi-volatile hydrocarbons indicative of oil were not detected in filtered samples but low levels, including tetramethylbenzenes and di-methylnaphthalenes, were detected in unfiltered water samples downstream from the spill. Labile sediment-bound barium and strontium concentrations (June 2015) were higher downstream from the Spill Site. Radium activities in sediment downstream from the Spill Site were up to 15 times the upstream activities and, combined with Sr isotope ratios, suggest contributions from the pipeline fluid and support the conclusion that elevated concentrations in Blacktail Creek water are from the leaking pipeline. Results from June 2015 demonstrate the persistence of wastewater effects in Blacktail Creek several months after remediation efforts started. Aquatic health effects were observed in June 2015; fish bioassays showed only 2.5% survival at 7.1 km downstream from the spill compared to 89% at the upstream reference site. Additional potential biological impacts were indicated by estrogenic inhibition in downstream waters. Our findings demonstrate that environmental signatures from wastewater spills are persistent and create the potential for long-term environmental health effects.

  4. Hypersensitivity to contrast media and dyes.

    PubMed

    Brockow, Knut; Sánchez-Borges, Mario

    2014-08-01

    This article updates current knowledge on hypersensitivity reactions to diagnostic contrast media and dyes. After application of a single iodinated radiocontrast medium (RCM), gadolinium-based contrast medium, fluorescein, or a blue dye, a hypersensitivity reaction is not a common finding; however, because of the high and still increasing frequency of those procedures, patients who have experienced severe reactions are nevertheless frequently encountered in allergy departments. Evidence on allergologic testing and management is best for iodinated RCM, limited for blue dyes, and insufficient for fluorescein. Skin tests can be helpful in the diagnosis of patients with hypersensitivity reactions to these compounds. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Outpatient desensitization in selected patients with platinum hypersensitivity reactions.

    PubMed

    O'Malley, David M; Vetter, Monica Hagan; Cohn, David E; Khan, Ambar; Hays, John L

    2017-06-01

    Platinum-based chemotherapies are a standard treatment for both initial and recurrent gynecologic cancers. Given this widespread use, it is important to be aware of the features of platinum hypersensitivity reactions and the subsequent treatment of these reactions. There is also increasing interest in the development of desensitization protocols to allow patients with a history of platinum hypersensitivity to receive further platinum based therapy. In this review, we describe the management of platinum hypersensitivity reactions and the desensitization protocols utilized at our institution. We also describe the clinical categorizations utilized to triage patients to appropriate desensitization protocols. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Hypothesis on how to measure electromagnetic hypersensitivity.

    PubMed

    Tuengler, Andreas; von Klitzing, Lebrecht

    2013-09-01

    Electromagnetic hypersensitivity (EHS) is an ill-defined term to describe the fact that people who experience health symptoms in the vicinity of electromagnetic fields (EMFs) regard them as causal for their complaints. Up to now most scientists assume a psychological cause for the suffering of electromagnetic hypersensitive individuals. This paper addresses reasons why most provocation studies could not find any association between EMF exposure and EHS and presents a hypothesis on diagnosis and differentiation of this condition. Simultaneous recordings of heart rate variability, microcirculation and electric skin potentials are used for classification of EHS. Thus, it could be possible to distinguish "genuine" electromagnetic hypersensitive individuals from those who suffer from other conditions.

  7. Protein electrophoresis in cranes with presumed insect bite.

    PubMed

    Hartup, Barry K; Schroeder, Carrie A

    2006-06-01

    Serum protein electrophoresis (SPE) has emerged as a potentially valuable diagnostic tool in avian medicine; yet, there is limited information regarding SPE in cranes. Since 2000, 20 cases of unilateral periocular or facial soft tissue swelling, blepharitis, feather loss, and ocular or nasal discharge attributed to insect bite hypersensitivity were observed in cranes from a captive breeding center. SPE may be useful for evaluating these lesions. The aim of this study was to characterize the inflammatory response in cranes with hypersensitivity reactions using SPE. Serum samples from 7 cranes diagnosed with hypersensitivity reactions were submitted to a diagnostic laboratory for agarose gel electrophoresis. Results were compared to those in control serum samples obtained from the same cranes during routine physical examination, when they were clinically healthy. Total protein and a- and g-globulin concentrations were significantly increased and albumin/globulin ratios were significantly decreased in serum samples from cranes with hypersensitivity lesions compared with control samples. Using SPE, we documented changes in protein fraction concentrations in cranes with clinical signs of hypersensitivity. The increase in alpha- and gamma-globulin concentrations suggested inflammation and antigenic stimulation, consistent with a Type I hypersensitivity reaction.

  8. A diagnostic model for chronic hypersensitivity pneumonitis.

    PubMed

    Johannson, Kerri A; Elicker, Brett M; Vittinghoff, Eric; Assayag, Deborah; de Boer, Kaïssa; Golden, Jeffrey A; Jones, Kirk D; King, Talmadge E; Koth, Laura L; Lee, Joyce S; Ley, Brett; Wolters, Paul J; Collard, Harold R

    2016-10-01

    The objective of this study was to develop a diagnostic model that allows for a highly specific diagnosis of chronic hypersensitivity pneumonitis using clinical and radiological variables alone. Chronic hypersensitivity pneumonitis and other interstitial lung disease cases were retrospectively identified from a longitudinal database. High-resolution CT scans were blindly scored for radiographic features (eg, ground-glass opacity, mosaic perfusion) as well as the radiologist's diagnostic impression. Candidate models were developed then evaluated using clinical and radiographic variables and assessed by the cross-validated C-statistic. Forty-four chronic hypersensitivity pneumonitis and eighty other interstitial lung disease cases were identified. Two models were selected based on their statistical performance, clinical applicability and face validity. Key model variables included age, down feather and/or bird exposure, radiographic presence of ground-glass opacity and mosaic perfusion and moderate or high confidence in the radiographic impression of chronic hypersensitivity pneumonitis. Models were internally validated with good performance, and cut-off values were established that resulted in high specificity for a diagnosis of chronic hypersensitivity pneumonitis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  9. HLA-A*31:01 and HLA-B*15:02 as genetic markers for carbamazepine hypersensitivity in children

    PubMed Central

    Amstutz, Ursula; Ross, Colin J.D.; Castro-Pastrana, Lucila I.; Rieder, Michael J.; Shear, Neil H.; Hayden, Michael R.; Carleton, Bruce C.

    2013-01-01

    The occurrence of hypersensitivity reactions including rare but life-threatening Stevens-Johnson syndrome (SJS) and drug-induced hypersensitivity syndrome (HSS) limits the use of the anticonvulsant carbamazepine (CBZ). HLA-B*15:02 and HLA-A*31:01 have been identified as predictive genetic markers for CBZ hypersensitivity in Asian and European patients. To replicate these genetic associations in pediatric patients from North America with a diverse ethnic background, we investigated HLA-A*31:01 and HLA-B*15:02 in 42 children with CBZ hypersensitivity, and 91 CBZ-tolerant children from across Canada. HLA-A*31:01 was significantly associated with CBZ-HSS (odds ratio (OR): 26.4, p=0.0025) and maculopapular exanthems (OR: 8.6, p=0.0037), but not with CBZ-SJS. Conversely, HLA-B*15:02 was associated with CBZ-SJS (OR: 38.6, p=0.002), but not HSS and maculopapular exanthems. This study is the first to demonstrate the association of HLA-A*31:01 with CBZ hypersensitivity in children, providing important replication of this association and highlighting the importance of HLA-A*31:01 as a predictive biomarker across various ancestries. PMID:23588310

  10. Drug metabolism and hypersensitivity reactions to drugs.

    PubMed

    Agúndez, José A G; Mayorga, Cristobalina; García-Martin, Elena

    2015-08-01

    The aim of the present review was to discuss recent advances supporting a role of drug metabolism, and particularly of the generation of reactive metabolites, in hypersensitivity reactions to drugs. The development of novel mass-spectrometry procedures has allowed the identification of reactive metabolites from drugs known to be involved in hypersensitivity reactions, including amoxicillin and nonsteroidal antiinflammatory drugs such as aspirin, diclofenac or metamizole. Recent studies demonstrated that reactive metabolites may efficiently bind plasma proteins, thus suggesting that drug metabolites, rather than - or in addition to - parent drugs, may elicit an immune response. As drug metabolic profiles are often determined by variability in the genes coding for drug-metabolizing enzymes, it is conceivable that an altered drug metabolism may predispose to the generation of reactive drug metabolites and hence to hypersensitivity reactions. These findings support the potential for the use of pharmacogenomics tests in hypersensitivity (type B) adverse reactions, in addition to the well known utility of these tests in type A adverse reactions. Growing evidence supports a link between genetically determined drug metabolism, altered metabolic profiles, generation of highly reactive metabolites and haptenization. Additional research is required to developing robust biomarkers for drug-induced hypersensitivity reactions.

  11. Cinnamic aldehyde: a survey of consumer patch-test sensitization.

    PubMed

    Danneman, P J; Booman, K A; Dorsky, J; Kohrman, K A; Rothenstein, A S; Sedlak, R I; Steltenkamp, R J; Thompson, G R

    1983-12-01

    The potential for cinnamic aldehyde, an important fragrance and flavour ingredient, to induce or to elicit delayed contact hypersensitivity reactions in man was evaluated by analysing patch-test data. Results of studies involving a total of 4117 patch tests on various consumer products and fragrance blends containing cinnamic aldehyde and on the material itself were collected from fragrance and formulator companies. The data indicate that cinnamic aldehyde contained in consumer products and fragrance blends at concentrations up to 6 X 10(-1)%, and patch-tested at concentrations up to 8 X 10(-3)%, has no detectable potential to induce hypersensitivity. Cinnamic aldehyde when tested alone induced a dose-related hypersensitivity response. According to published reports, cinnamic aldehyde elicited positive delayed hypersensitivity responses in dermatitic patients. However, results of the current survey show that when cinnamic aldehyde was tested alone or as part of a mixture in subjects in the general population, no pre-existing hypersensitivity reactions to the fragrance material were observed in any of the 4117 patch tests which constituted the survey. Cinnamic aldehyde at the concentrations contained in consumer products and fragrances, has a very low potential to induce hypersensitivity ('induced' reactions) or to elicit sensitization reactions ('elicited' reactions) in the general population.

  12. Dentin hypersensitivity: from diagnosis to a breakthrough therapy for everyday sensitivity relief.

    PubMed

    Cummins, Diane

    2009-01-01

    This paper provides an overview of the current knowledge of diagnosis, epidemiology, etiology, and clinical management of dentin hypersensitivity. It summarizes technical approaches to relieve sensitivity in professional and home-use products, with emphasis on the clinical evidence for the efficacy of desensitizing toothpaste, and introduces a new innovative dentifrice technology containing 8% arginine, calcium carbonate, and 1450 ppm fluoride. Dentin hypersensitivity is characterized by short, sharp pain arising from exposed dentin in response to external stimuli which cannot be ascribed to any other form of dental defect or disease. The hydrodynamic theory proposes that pain-producing stimuli cause a change in dentin fluid flow that activates intra-dental nerve fibers, via a mechanoreceptor response, to cause pain. To be hypersensitive, dentin must be exposed and dentin tubules must be open to external stimuli and patent at the pulp. Gingival recession is the primary cause of dentin exposure, and a major predisposing factor for dentin hypersensitivity. Dentin hypersensitivity is a prevalent condition. It has been reported to afflict 15-20% of the adult population, typically 20 to 50-year-olds, with peak incidence between 30 and 39 years. Some studies have reported higher prevalence levels of up to 57%. The incidence of dentin hypersensitivity is expected to rise with changing diets, and as caries and periodontal disease prevention result in improved oral health status, and retention and functionality of the dentition. Treatments to relieve dentin hypersensitivity are based on interruption of the neural response to pain stimuli or occlusion of open tubules to block the hydrodynamic mechanism. Effective and robust dentin occlusion offers the greatest prospect for instant and lasting relief of dentin hypersensitivity. In particular, materials which can coat exposed dentin surfaces, in addition to plugging and sealing open dentin tubules, offer the intriguing prospect of strengthening dentin and rendering it less susceptible to predisposing factors, while concurrently reducing dentin hypersensitivity. Clinical studies have shown that a new toothpaste containing 8% arginine, calcium carbonate, and 1450 ppm fluoride as sodium monofluorophosphate offers significantly increased efficacy in reducing sensitivity, compared to a market-leading toothpaste containing 2% potassium ion. Mechanism of action studies have shown that this technology physically seals dentin tubules with a plug that contains arginine, calcium carbonate, and phosphate. This plug, which is resistant to normal pulpal pressures and to acid challenge, effectively reduces dentin fluid flow and, thereby, reduces sensitivity.

  13. Level II scour analysis for Bridge 4 (DANVTH00010004) on Town Highway 1, crossing Joes Brook, Danville, Vermont

    USGS Publications Warehouse

    Flynn, Robert H.; Boehmler, Erick M.

    1997-01-01

    This report provides the results of a detailed Level II analysis of scour potential at structure DANVTH00010004 on Town Highway 1 crossing Joes Brook, Danville, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the New England Upland section of the New England physiographic province in northeastern Vermont. The 42.5-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is pasture along the upstream and downstream left banks with trees and brush along the immediate banks. The upstream and downstream right banks are forested. In the study area, Joes Brook has an incised, sinuous channel with a slope of approximately 0.02 ft/ft, an average channel top width of 68 ft and an average bank height of 5 ft. The channel bed material ranges from gravel to bedrock with a median grain size (D50) of 80.1 mm (0.263 ft). The geomorphic assessment at the time of the Level I and Level II site visit on August 22, 1995, indicated that the reach was stable. The Town Highway 1 crossing of Joes Brook is a 49-ft-long, two-lane bridge consisting of one 45-foot steel-beam span (Vermont Agency of Transportation, written communication, March 17, 1995). The opening length of the structure parallel to the bridge face is 45 ft.The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 15 degrees to the opening and the computed opening-skew-to-roadway is 15 degrees. A scour hole 1.0 ft deeper than the mean thalweg depth was observed along the right abutment during the Level I assessment. The scour hole also extends upstream and downstream of the bridge, along the right side of the channel. The scour protection measures at the site include type-2 stone fill (less than 36 inches diameter) at the upstream end of the upstream left wingwall and along the entire base length of the downstream right wingwall. Type-3 stone fill (less than 48 inches diameter) is along the entire base length of the upstream right wingwall and type-5 protection (stone block wall) is along the upstream right bank. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995) for the 100- and 500-year discharges. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows was computed to be zero ft. Abutment scour ranged from 11.7 to 13.0 ft along the right abutment and from 6.6 to 9.4 ft along the left abutment. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich and Hire equations (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

  14. Regulation of Nucleotide Excision Repair by UV-DDB: Prioritization of Damage Recognition to Internucleosomal DNA

    PubMed Central

    Luch, Andreas; Glas, Andreas; Carell, Thomas; Naegeli, Hanspeter

    2011-01-01

    How tightly packed chromatin is thoroughly inspected for DNA damage is one of the fundamental unanswered questions in biology. In particular, the effective excision of carcinogenic lesions caused by the ultraviolet (UV) radiation of sunlight depends on UV-damaged DNA-binding protein (UV-DDB), but the mechanism by which this DDB1-DDB2 heterodimer stimulates DNA repair remained enigmatic. We hypothesized that a distinctive function of this unique sensor is to coordinate damage recognition in the nucleosome repeat landscape of chromatin. Therefore, the nucleosomes of human cells have been dissected by micrococcal nuclease, thus revealing, to our knowledge for the first time, that UV-DDB associates preferentially with lesions in hypersensitive, hence, highly accessible internucleosomal sites joining the core particles. Surprisingly, the accompanying CUL4A ubiquitin ligase activity is necessary to retain the xeroderma pigmentosum group C (XPC) partner at such internucleosomal repair hotspots that undergo very fast excision kinetics. This CUL4A complex thereby counteracts an unexpected affinity of XPC for core particles that are less permissive than hypersensitive sites to downstream repair subunits. That UV-DDB also adopts a ubiquitin-independent function is evidenced by domain mapping and in situ protein dynamics studies, revealing direct but transient interactions that promote a thermodynamically unfavorable β-hairpin insertion of XPC into substrate DNA. We conclude that the evolutionary advent of UV-DDB correlates with the need for a spatiotemporal organizer of XPC positioning in higher eukaryotic chromatin. PMID:22039351

  15. Why borrow from Peter when Paul can afford it? Reverse homodigital artery flap for fingertip reconstruction

    PubMed Central

    Sundaramurthy, Narayanamurthy; Venkata Mahipathy, Surya Rao Rao; Durairaj, Alagar Raja

    2017-01-01

    Background: Fingertip injuries that are complicated by pulp loss, bone or tendon exposure will need a flap cover. Cross finger flap is commonly used to cover such defects. However, patients are apprehensive about injuring the uninjured finger as a donor site. Reverse homodigital artery flap (RHAF) can provide reliable vascularised cover to such defects. Aims: This study aims to assess the functional and aesthetic outcomes along with the patient satisfaction of RHAFs done for fingertip defects. Materials and Methods: RHAFs done in 18 patients operated between August 2015 and October 2016 were retrospectively analysed on flap survival, sensory recovery, range of movements, hypersensitivity, cold intolerance, flexion contracture and donor site morbidity. Results: Seventeen of the 18 flaps done survived completely. One flap had partial necrosis of 3 mm that healed conservatively. Middle finger of the right hand was the most commonly injured finger. Touch, pain and pressure sensations recovered in 8–12 weeks. Two-point discrimination was 4.5 mm at 6 months. The deficit of 5° s was present at distal interphalangeal joint during active flexion at 6 months. Cold intolerance and flexion contracture were not seen and 2 instances of hypersensitivity at 2 months got cured conservatively after 4 months. Overall satisfaction of patients was 8/10. Conclusion: RHAF provides single staged well-vascularised cover for fingertip injuries with good sensory recovery without damaging the adjacent uninjured finger. Hence, it can be a reliable flap for fingertip reconstruction in selected cases. PMID:29343895

  16. iDHS-EL: identifying DNase I hypersensitive sites by fusing three different modes of pseudo nucleotide composition into an ensemble learning framework.

    PubMed

    Liu, Bin; Long, Ren; Chou, Kuo-Chen

    2016-08-15

    Regulatory DNA elements are associated with DNase I hypersensitive sites (DHSs). Accordingly, identification of DHSs will provide useful insights for in-depth investigation into the function of noncoding genomic regions. In this study, using the strategy of ensemble learning framework, we proposed a new predictor called iDHS-EL for identifying the location of DHS in human genome. It was formed by fusing three individual Random Forest (RF) classifiers into an ensemble predictor. The three RF operators were respectively based on the three special modes of the general pseudo nucleotide composition (PseKNC): (i) kmer, (ii) reverse complement kmer and (iii) pseudo dinucleotide composition. It has been demonstrated that the new predictor remarkably outperforms the relevant state-of-the-art methods in both accuracy and stability. For the convenience of most experimental scientists, a web server for iDHS-EL is established at http://bioinformatics.hitsz.edu.cn/iDHS-EL, which is the first web-server predictor ever established for identifying DHSs, and by which users can easily get their desired results without the need to go through the mathematical details. We anticipate that IDHS-EL: will become a very useful high throughput tool for genome analysis. bliu@gordonlifescience.org or bliu@insun.hit.edu.cn Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Mouse mammary tumor virus chromatin in human breast cancer cells is constitutively hypersensitive and exhibits steroid hormone-independent loading of transcription factors in vivo.

    PubMed Central

    Mymryk, J S; Berard, D; Hager, G L; Archer, T K

    1995-01-01

    We have stably introduced a reporter gene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat (LTR) into human T47D breast cancer cells to study the action of the progesterone receptor (PR) on transcription from a chromatin template. Unexpectedly, the chromatin organization of the MMTV LTR in these human breast cancer cells differed markedly from what we have observed previously. The region adjacent to the transcription start site (-221 to -75) was found to be constitutively hypersensitive to restriction enzyme cleavage in the absence of hormone. This region is normally encompassed within the second nucleosome of a phased array of six nucleosomes that is assembled when the MMTV LTR is stably maintained in mouse cells. Characteristically, in these rodent cells, the identical DNA sequences show increased restriction enzyme cleavage only in the presence of glucocorticoid. The increased access of restriction enzymes observed in the human PR+ cells was not observed in adjacent nucleosomes and was unaffected by treatment with the progesterone antagonist RU486. In addition, exonuclease III-dependent stops corresponding to the binding sites for nuclear factor 1 and the PR were observed before and after hormone treatment. These results indicate that MMTV chromatin replicated in these cells is organized into a constitutively open architecture and that this open chromatin state is accompanied by hormone-independent loading of a transcription factor complex that is normally excluded from uninduced chromatin. PMID:7799933

  18. Mouse mammary tumor virus chromatin in human breast cancer cells is constitutively hypersensitive and exhibits steroid hormone-independent loading of transcription factors in vivo.

    PubMed

    Mymryk, J S; Berard, D; Hager, G L; Archer, T K

    1995-01-01

    We have stably introduced a reporter gene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat (LTR) into human T47D breast cancer cells to study the action of the progesterone receptor (PR) on transcription from a chromatin template. Unexpectedly, the chromatin organization of the MMTV LTR in these human breast cancer cells differed markedly from what we have observed previously. The region adjacent to the transcription start site (-221 to -75) was found to be constitutively hypersensitive to restriction enzyme cleavage in the absence of hormone. This region is normally encompassed within the second nucleosome of a phased array of six nucleosomes that is assembled when the MMTV LTR is stably maintained in mouse cells. Characteristically, in these rodent cells, the identical DNA sequences show increased restriction enzyme cleavage only in the presence of glucocorticoid. The increased access of restriction enzymes observed in the human PR+ cells was not observed in adjacent nucleosomes and was unaffected by treatment with the progesterone antagonist RU486. In addition, exonuclease III-dependent stops corresponding to the binding sites for nuclear factor 1 and the PR were observed before and after hormone treatment. These results indicate that MMTV chromatin replicated in these cells is organized into a constitutively open architecture and that this open chromatin state is accompanied by hormone-independent loading of a transcription factor complex that is normally excluded from uninduced chromatin.

  19. Streambed scour evaluations and conditions at selected bridge sites in Alaska, 2012

    USGS Publications Warehouse

    Beebee, Robin A.; Schauer, Paul V.

    2015-11-19

    Vertical contraction and pressure flow occurred during 1 percent or smaller annual exceedance probability floods at five sites, including three aggradation sites. Contraction scour exceeded 5 feet at two sites, and total scour at piers (pier scour plus contraction scour) exceeded 5 feet at two sites. Debris accumulation increased calculated pier scour at six sites by an average of 1.2 feet. Total scour at abutments including contraction scour exceeded 5 feet at seven sites. Scour estimates seemed excessive at aggradation sites where upstream sediment supply controls scour and deposition processes, at cohesive soil sites where conservative assumptions were made for soil strength and flood duration, and for abutment scour at sites where failure of the embankment and attendant channel widening would reduce scour.

  20. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.)

    PubMed Central

    2012-01-01

    Background Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication. PMID:23241244

  1. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

    PubMed

    Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

    2012-12-15

    Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication.

  2. Hydrologic, water-quality, and meteorologic data from selected sites in the Upper Catawba River Basin, North Carolina, January 1993 through March 1994

    USGS Publications Warehouse

    Jaynes, M.L.

    1994-01-01

    Hydrologic, water-quality, and meteorologic data were collected from January 1993 through March 1994 as part of a water-quality investigation of the Upper Catawba River Basin, North Carolina. Specific objectives of the investigation were to characterize the water quality of Rhodhiss Lake, Lake Hickory, and three tributary streams, and to calibrate hydrodynamic water-quality models for the two reservoirs. Sampling locations included 11 sites in Rhodhiss Lake, 14 sites in Lake Hickory, and 3 tributary sites. Tributary sites were located at Lower Creek upstream from Rhodhiss Lake and at Upper Little River and Middle Little River upstream from Lake Hickory. During 21 sampling visits, specific conductance, pH, water temperature, dissolved-oxygen concentration, and water transparency were measured at all sampling locations. Water samples were collected for analysis of biochemical oxygen demand, fecal coliform bacteria, hardness, alkalinity, total and volatile suspended solids, suspended sediment, nutrients, total organic carbon, chlorophyll, iron, calcium, and magnesium from three sites in each reservoir and from the three tributary sites. Chemical and particle-size analyses of bottom material from Rhodhiss Lake and Lake Hickory were performed once during the study. At selected locations, automated instruments recorded water level, streamflow, water temperature, solar radiation, and air temperature at 15-minute intervals throughout the study. Hydrologic data presented in the report include monthly water-level statistics and daily mean values of discharge. Diagrams, tables, and statistical summaries of water-quality data are provided. Meteorologic data in the report include monthly precipitation, and daily mean values of solar radiation and air temperature.

  3. Effects of grade control structures on the macroinvertebrate assemblage of an agriculturally impacted stream

    USGS Publications Warehouse

    Litvan, M.E.; Stewart, T.W.; Pierce, C.L.; Larson, C.J.

    2008-01-01

    Nearly 400 rock rip-rap grade control structures (hereafter GCS) were recently placed in streams of western Iowa, USA to reduce streambank erosion and protect bridge infrastructure and farmland. In this region, streams are characterized by channelized reaches, highly incised banks and silt and sand substrates that normally support low macroinvertebrate abundance and diversity. Therefore, GCS composed of rip-rap provide the majority of coarse substrate habitat for benthic macroinvertebrates in these streams. We sampled 20 sites on Walnut Creek, Montgomery County, Iowa to quantify macroinvertebrate assemblage characteristics (1) on GCS rip-rap and at sites located (2) 5-50 m upstream of GCS, (3) 5-50 m downstream of GCS and (4) at least 1 km from any GCS (five sites each). Macroinvertebrate biomass, numerical densities and diversity were greatest at sites with coarse substrates, including GCS sites and one natural riffle site and relatively low at remaining sites with soft substrates. Densities of macroinvertebrates in the orders Ephemeroptera, Trichoptera, Diptera, Coleoptera and Acariformes were abundant on GCS rip-rap. Increases in macroinvertebrate biomass, density and diversity at GCS may improve local efficiency of breakdown of organic matter and nutrient and energy flow, and provide enhanced food resources for aquatic vertebrates. However, lack of positive macroinvertebrate responses immediately upstream and downstream of GCS suggest that positive effects might be restricted to the small areas of streambed covered by GCS. Improved understanding of GCS effects at both local and ecosystem scales is essential for stream management when these structures are present. Copyright ?? 2007 John Wiley & Sons, Ltd.

  4. Characterization of organic composition in snow and surface waters in the Athabasca Oil Sands Region, using ultrahigh resolution Fourier transform mass spectrometry.

    PubMed

    Yi, Y; Birks, S J; Cho, S; Gibson, J J

    2015-06-15

    This study was conducted to characterize the composition of dissolved organic compounds present in snow and surface waters in the Athabasca Oil Sands Region (AOSR) with the goal of identifying whether atmospherically-derived organic compounds present in snow are a significant contributor to the compounds detected in surface waters (i.e., rivers and lakes). We used electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry (ESI-FTICR MS) to characterize the dissolved organic compound compositions of snow and surface water samples. The organic profiles obtained for the snow samples show compositional differences between samples from near-field sites (<5 km from oil sands activities) and those from more distant locations (i.e., far-field sites). There are also significant compositional differences between samples collected in near-field sites and surface water samples in the AOSR. The composition of dissolved organic compounds at the upstream Athabasca River site (i.e., Athabasca River at Athabasca) is found to be different from samples obtained from downstream sites in the vicinity of oil sands operations (i.e., Athabasca River at Fort McMurray and Athabasca River at Firebag confluence). The upstream Athabasca River sites tended to share some compositional similarities with far-field snow deposition, while the downstream Athabasca River sites are more similar to local lakes and tributaries. This contrast likely indicates the relative role of regional snowmelt contributions to the Athabasca River vs inputs from local catchments in the reach downstream of Fort McMurray. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Fish assemblages in a western Iowa stream modified by grade control structures

    USGS Publications Warehouse

    Litvan, M.E.; Pierce, C.L.; Stewart, T.W.; Larson, C.J.

    2008-01-01

    Over 400 riprap grade control structures (GCSs) have been built in streams of western Iowa to reduce erosion and protect bridges, roads, and farmland. In conjunction with a companion study evaluating fish passage over GCSs in Turkey Creek, we evaluated the differences in fish assemblage and habitat characteristics in reaches immediately downstream from GCSs (GCS sites) and reaches at least 1 km from any GCS (non-GCS sites). The GCS sites were characterized by greater proportions of pool habitat, maximum depths, fish biomass, and abundance of juvenile largemouth bass Micropterus salmoides than were non-GCS sites. Index of biotic integrity (IBI) scores were poor or fair (<43 on a 0-100 scale) and not significantly different between the GCS and non-GCS sites. Additionally, we investigated both the longitudinal changes in fish assemblages in this GCS-fragmented stream and the changes in fish assemblages after slope modifications of three GCSs to facilitate fish passage. Thirteen fish species were present throughout the study area, whereas another 15 species exhibited truncated distributions not extending to the most upstream sampling location. After modification of the GCSs, IBI scores increased at seven of nine sites (mean increase =4.6 points). Also, channel catfish Ictalurus punctatus were detected 7.3 km upstream at sites where, 2 years before GCS modification, they had been absent from collections. Given the number and distribution of GCSs in western Iowa streams, understanding the effects of these structures is vital to the conservation and management of fish assemblages in this and other regions where GCSs or similar structures are used. ?? Copyright by the American Fisheries Society 2008.

  6. Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

    PubMed

    Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

    2004-09-01

    Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

  7. FcγRIIa ligation induces platelet hypersensitivity to thrombotic stimuli.

    PubMed

    Berlacher, Mark D; Vieth, Joshua A; Heflin, Brittany C; Gay, Steven R; Antczak, Adam J; Tasma, Brian E; Boardman, Holly J; Singh, Navinderjit; Montel, Angela H; Kahaleh, M Bashar; Worth, Randall G

    2013-01-01

    Platelets are known for their important role in hemostasis, however their significance in other functions, including inflammation and infection, are becoming more apparent. Patients with systemic lupus erythematosus (SLE) are known to have circulating IgG complexes in their blood and are highly susceptible to thrombotic events. Because platelets express a single receptor for IgG, we tested the hypothesis that ligation of this receptor (FcγRIIa) induces platelet hypersensitivity to thrombotic stimuli. Platelets from SLE patients were considerably more sensitive to thrombin compared to healthy volunteers, and this correlated with elevated levels of surface IgG on SLE platelets. To test whether FcγRIIa ligation stimulated thrombin hypersensitivity, platelets from healthy volunteers were incubated with buffer or heat-aggregated IgG, then stimulated with increasing concentrations of thrombin. Interestingly, heat-aggregated IgG-stimulated platelets, but not buffer-treated platelets, were hypersensitive to thrombin, and hypersensitivity was blocked by an anti-FcγRIIa monoclonal antibody (mAb). Thrombin hypersensitivity was not due to changes in thrombin receptor expression (GPIbα or PAR1) but is dependent on activation of shared signaling molecules. These observations suggest that ligation of platelet FcγRIIa by IgG complexes induces a hypersensitive state whereby small changes in thrombotic stimuli may result in platelet activation and subsequent vascular complications such as transient ischemic attacks or stroke. Copyright © 2013 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  8. Potential Danger of Pre-Pump Clamping on Negative Pressure-Associated Gaseous Microemboli Generation During Extracorporeal Life Support--An In Vitro Study.

    PubMed

    Wang, Shigang; Chin, Brian J; Gentile, Frank; Kunselman, Allen R; Palanzo, David; Ündar, Akif

    2016-01-01

    The objectives of this study were to investigate the relationship between revolution speed of a conventional centrifugal pump and negative pressure at the inlet of the pump by clamping the tubing upstream of the pump, and to verify whether negative pressure leads to gaseous microemboli (GME) production in a simulated adult extracorporeal life support (ECLS) system. The experimental circuit, including a Maquet Rotaflow centrifugal pump and a Medos Hilite 7000 LT polymethyl-pentene membrane oxygenator, was primed with packed red blood cells (hematocrit 35%). Negative pressure was created in the circuit by clamping the tubing upstream of the pump for 10 s, and then releasing the clamp. An emboli detection and classification quantifier was used to record GME volume and count at pre-oxygenator and post-oxygenator sites, and pressure and flow rate data were collected using a custom-based data acquisition system. All trials were conducted at 36°C at revolution speeds of 2000-4000 rpm (500 rpm increment). The flow rates were 1092.5-4708.4 mL/min at the revolution speeds of 2000-4000 rpm. Higher revolution speed generated higher negative pressure at the pre-pump site when clamping the tubing upstream of the pump (-108.3 ± 0.1 to -462.0 ± 0.5 mm Hg at 2000-4000 rpm). Moreover, higher negative pressure was associated with a larger number and volume of GME at pre-oxygenator site after de-clamp (GME count 10,573 ± 271 at pre-oxygenator site at 4000 rpm). The results showed that there was a potential danger of delivering GME to the patient when clamping pre-pump tubing during ECLS using a centrifugal pump. Our results warrant further clinical studies to investigate this phenomenon. Copyright © 2015 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

  9. Freshwater mussels in an urban watershed: Impacts of anthropogenic inputs and habitat alterations on populations.

    PubMed

    Gillis, Patricia L; McInnis, Rodney; Salerno, Joseph; de Solla, Shane R; Servos, Mark R; Leonard, Erin M

    2017-01-01

    The substantial increase in urbanization worldwide has resulted in higher emissions of wastewater to riverine systems near urban centers, which often impairs aquatic populations and communities. This study examined the effect of urbanization on freshwater mussel populations, including Species at Risk in two rivers receiving wastewater. The influence of anthropogenic activities was assessed in a watershed in the Laurentian Great Lakes basin, one that historically supported one of the most diverse mussel faunas in Canada. In the Grand River (ON), four sites along a 60km reach spanning from an upstream reference site to an urban-impacted downstream area were examined. In the Speed River, mussel populations at six sites along a 10km reach, selected to bracket specific anthropogenic inputs and structures were assessed. A semi-quantitative visual search method revealed that catch per unit effort in the Grand River declined by >60% from the upstream reference site to the area downstream of an urban center. The size (length) frequency distribution of the most abundant species, Lasmigona costata, was significantly (p≤0.008) different upstream of the majority of urban inputs (45-130mm) compared to downstream of the cities (85-115mm). In the Speed River, impoundments and wastewater treatment plants (WWTP) reduced both the diversity and catch per effort. Most striking were 84 and 95% changes in the number of mussels found on either side of two impoundments, and a 98% drop in mussels immediately downstream of a WWTP outfall. These population level effects of decreased abundance and underrepresentation of smaller mussels downstream of the urban area correspond to previously documented impacts at the biochemical and whole organism level of biological organization in wild mussels at this location. Our results demonstrate that poor water quality and physical barriers in urban environments continue to impair susceptible populations and communities of aquatic animals. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  10. High cancer-specific expression of mesothelin (MSLN) is attributable to an upstream enhancer containing a transcription enhancer factor dependent MCAT motif.

    PubMed

    Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E

    2007-10-01

    Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.

  11. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J

    1998-01-01

    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

  12. Effects of wastewater effluent discharge and treatment facility upgrades on environmental and biological conditions of Indian Creek, Johnson County, Kansas, June 2004 through June 2013

    USGS Publications Warehouse

    Graham, Jennifer L.; Stone, Mandy L.; Rasmussen, Teresa J.; Foster, Guy M.; Poulton, Barry C.; Paxson, Chelsea R.; Harris, Theodore D.

    2014-01-01

    Indian Creek is one of the most urban drainage basins in Johnson County, Kansas, and environmental and biological conditions of the creek are affected by contaminants from point and other urban sources. The Johnson County Douglas L. Smith Middle Basin (hereafter referred to as the “Middle Basin”) and Tomahawk Creek Wastewater Treatment Facilities (WWTFs) discharge to Indian Creek. In summer 2010, upgrades were completed to increase capacity and include biological nutrient removal at the Middle Basin facility. There have been no recent infrastructure changes at the Tomahawk Creek facility; however, during 2009, chemically enhanced primary treatment was added to the treatment process for better process settling before disinfection and discharge with the added effect of enhanced phosphorus removal. The U.S. Geological Survey, in cooperation with Johnson County Wastewater, assessed the effects of wastewater effluent on environmental and biological conditions of Indian Creek by comparing two upstream sites to four sites located downstream from the WWTFs using data collected during June 2004 through June 2013. Environmental conditions were evaluated using previously and newly collected discrete and continuous data and were compared with an assessment of biological community composition and ecosystem function along the upstream-downstream gradient. This study improves the understanding of the effects of wastewater effluent on stream-water and streambed sediment quality, biological community composition, and ecosystem function in urban areas. After the addition of biological nutrient removal to the Middle Basin WWTF in 2010, annual mean total nitrogen concentrations in effluent decreased by 46 percent, but still exceeded the National Pollutant Discharge Elimination System (NPDES) wastewater effluent permit concentration goal of 8.0 milligrams per liter (mg/L); however, the NPDES wastewater effluent permit total phosphorus concentration goal of 1.5 mg/L or less was achieved at the Middle Basin WWTF. At the Tomahawk Creek WWTF, after the addition of chemically enhanced primary treatment in 2009, effluent discharges also had total phosphorus concentrations below 1.5 mg/L. After the addition of biological nutrient removal, annual total nitrogen and phosphorus loads from the Middle Basin WWTF decreased by 42 and 54 percent, respectively, even though effluent volume increased by 11 percent. Annual total phosphorus loads from the Tomahawk Creek WWTF after the addition of chemically enhanced primary treatment decreased by 54 percent despite a 33-percent increase in effluent volume. Total nitrogen and phosphorus from the WWTFs contributed between 30 and nearly 100 percent to annual nutrient loads in Indian Creek depending on streamflow conditions. In-stream total nitrogen primarily came from wastewater effluent except during years with the highest streamflows. Most of the in-stream total phosphorus typically came from effluent during dry years and from other urban sources during wet years. During 2010 through 2013, annual mean discharge from the Middle Basin WWTF was about 75 percent of permitted design capacity. Annual nutrient loads likely will increase when the facility is operated at permitted design capacity; however, estimated maximum annual nutrient loads from the Middle Basin WWTF were 27 to 38 percent lower than before capacity upgrades and the addition of biological nutrient removal to treatment processes. Thus, the addition of biological nutrient removal to the Middle Basin wastewater treatment process should reduce overall nutrient loads from the facility even when the facility is operated at permitted design capacity. The effects of wastewater effluent on the water quality of Indian Creek were most evident during below-normal and normal streamflows (about 75 percent of the time) when wastewater effluent represented about 24 percent or more of total streamflow. Wastewater effluent had the most substantial effect on nutrient concentrations in Indian Creek. Total and inorganic nutrient concentrations at the downstream sites during below-normal and normal streamflows were 10 to 100 times higher than at the upstream sites, even after changes in treatment practices at the WWTFs. Median total phosphorus concentrations during below-normal and normal streamflows at a downstream site were 43 percent lower following improvements in wastewater treatment processes. Similar decreases in total nitrogen were not observed, likely because total nitrogen concentrations only decreased in Middle Basin effluent and wastewater contributed a higher percentage to streamflows when nutrient samples were collected during the after-upgrade period. The wastewater effluent discharges to Indian Creek caused changes in stream-water quality that may affect biological community structure and ecosystem processes, including higher concentrations of bioavailable nutrients (nitrate and orthophosphorus) and warmer water temperatures during winter months. Other urban sources of contaminants also caused changes in stream-water quality that may affect biological community structure and ecosystem processes, including higher turbidities downstream from construction areas and higher specific conductance and chloride concentrations during winter months. Chloride concentrations exceeded acute and chronic exposure criteria at all Indian Creek study sites, regardless of wastewater influence, for weeks or months during winter. Streambed sediment chemistry was affected by wastewater (elevated nutrient and organic wastewater-indicator compound concentrations) and other contaminants from urban sources (elevated polyaromatic hydrocarbon concentrations). Overall habitat conditions were suboptimal or marginal at all sites; general decline in habitat conditions along the upstream-downstream gradient likely was caused by the cumulative effects of urbanization with increasing drainage basin size. Wastewater effluent likely affected algal periphyton biomass and community composition, primary production, and community respiration in Indian Creek. Functional stream health, evaluated using a preliminary framework based on primary production and community respiration, was mildly or severely impaired at most downstream sites relative to an urban upstream Indian Creek site. The mechanistic cause of the changes in these biological variables are unclear, though elevated nutrient concentrations were positively correlated with algal biomass, primary production, and community respiration. Macroinvertebrate communities indicated impairment at all sites, and Kansas Department of Health and Environment aquatic life support scores indicated conditions nonsupporting of aquatic life, regardless of wastewater influences. Urban influences, other than wastewater effluent discharge, likely control macroinvertebrate community structure in Indian Creek. Changes in treatment processes at the Middle Basin and Tomahawk Creek WWTFs improved wastewater effluent quality and decreased nutrient loads, but wastewater effluent discharges still had negative effects on the environmental and biological conditions at downstream Indian Creek sites. Wastewater effluent discharge into Indian Creek likely contributed to changes in measures of ecosystem structure (streamflow, water and streambed-sediment chemistry, algal biomass, and algal periphyton community composition) and function (primary production and community respiration) along the upstream-downstream gradient. Wastewater effluent discharges maintained streamflows and increased nutrient concentrations, algal biomass, primary production, and community respiration at the downstream sites. Functional stream health was severely impaired downstream from the Middle Basin WWTF and mildly impaired downstream from the Tomahawk WWTF relative to the urban upstream site. As distance from the Middle Basin WWTF increased, nutrient concentrations, algal biomass, primary production, and community respiration decreased, and functional stream health was no longer impaired 9.5 kilometers downstream from the discharge relative to the urban upstream site. Therefore, although wastewater effluent caused persistent changes in environmental and biological conditions and functional stream health at sites located immediately downstream from WWTF effluent discharges, some recovery to conditions more similar to the urban upstream site occurred within a relatively short distance.

  13. Study on impact of habitat degradation on proximate composition and amino acid profile of Indian major carps from different habitats.

    PubMed

    Hussain, Bilal; Sultana, Tayyaba; Sultana, Salma; Ahmed, Z; Mahboob, Shahid

    2018-05-01

    This investigation is aimed to study an impact of habitat degradation on proximate composition and amino acid (AAs) profile of Catla catla, Labeo rohita and Cirrhinus mrigala collected from polluted, non-polluted area (upstream) and a commercial fish farm. The amino acid profile was estimated by the amino acid analyzer. C. catla collected from the polluted environment had highest lipid, protein and ash contents (12.04 ± 0.01, 13.45 ± 0.01 and 0.93 ± 0.03%, respectively). The high protein content (14.73 ± 0.01 and 14.12 ± 0. 01%) was recorded in C. catla procured from non-polluted (upstream) wild habitat of River Chenab and controlled commercial fish farm. Farmed fish species showed comparatively higher moisture contents followed by upstream and polluted area fishes. C. mrigala showed significant differences in amino acid and proximate composition collected from a polluted site of the river Chenab. C. catla collected from non-polluted site of the river showed an excellent nutrient profile, followed by L. rohita (wild and farmed) and C. mrigala (polluted area), respectively. All fishes from the polluted areas of the River Chenab indicated a significant decrease in the concentration of some AAs when compared to farmed and wild (upstream) major carps. Omitting of some important AAs was also observed in the meat of fish harvested from polluted habitat of this river. C. mrigala and L. rohita exhibited a significant increase in the concentration of some of non-essential amino acids such as cysteine in their meat. The results indicated that wild fish (upstream) and farmed fish species had highest protein contents and amino acid profile and hence appeared to be the best for human consumption. The proximate composition and AAs profiles of fish harvested from the polluted area of the river clearly indicated that efforts shall be made for the restoration of habitat to continue the requirement of high quality fish meat at a low cost to the human population.

  14. Novel mechanism of conjoined gene formation in the human genome.

    PubMed

    Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

    2012-03-01

    Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

  15. Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

    PubMed Central

    2009-01-01

    Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

  16. Assessing distribution of migratory fishes and connectivity following complete and partial dam removals in a North Carolina River

    USGS Publications Warehouse

    Raabe, Joshua K.; Hightower, Joseph E.

    2014-01-01

    Fish, especially migratory species, are assumed to benefit from dam removals that restore connectivity and access to upstream habitat, but few studies have evaluated this assumption. Therefore, we assessed the movement of migratory fishes in the springs of 2008 through 2010 and surveyed available habitat in the Little River, North Carolina, a tributary to the Neuse River, after three complete dam removals and one partial (notched) dam removal. We tagged migratory fishes with PIT tags at a resistance-board weir located at a dam removal site (river kilometer [rkm] 3.7) and followed their movements with an array of PIT antennas. The river-wide distribution of fish following removals varied by species. For example, 24–31% of anadromous American Shad Alosa sapidissima, 45–49% of resident Gizzard Shad Dorosoma cepedianum, and 4–11% of nonnative Flathead CatfishPylodictis olivaris passed the dam removal site at rkm 56 in 2009 and 2010. No preremoval data were available for comparison, but reach connectivity appeared to increase as tagged individuals passed former dam sites and certain individuals moved extensively both upstream and downstream. However, 17–28% did not pass the partially removed dam at rkm 7.9, while 20–39% of those that passed remained downstream for more than a day before migrating upstream. Gizzard Shad required the deepest water to pass this notched structure, followed by American Shad then Flathead Catfish. Fish that passed the notched dam accessed more complex habitat (e.g., available substrate size-classes) in the middle and upper reaches. The results provide strong support for efforts to restore currently inaccessible habitat through complete removal of derelict dams.

  17. Organochlorine chemical residues in bluegills and common carp from the irrigated San Joaquin Valley floor, California

    USGS Publications Warehouse

    Saiki, Michael K.; Schmitt, Christopher J.

    1986-01-01

    Samples of bluegills (Lepomis macrochirus) and common carp (Cyprinus carpio) collected from the San Joaquin River and two tributaries (Merced River and Salt Slough) in California were analyzed for 21 organochlorine chemical residues by gas chromatography to determine if pesticide contamination was confined to downstream sites exposed to irrigated agriculture, or if nonirrigated upstream sites were also contaminated. Residues ofp,p′-DDE were detected in all samples of both species. Six other contaminants were also present in both species at one or more of the collection sites: chlordane (cis-chlordane +trans-nonachlor);p,p′-DDD;o,p′-DDT;p,p′-DDT; DCPA (dimethyl tetrachloroterephthalate); and dieldrin. Concentrations of most of these residues were generally higher in carp than in bluegills; residues of other compounds were found only in carp: α-BHC (α-benzenehexachloride), Aroclor® 1260, and toxaphene. Concentrations of most organochlorines in fish increased from upstream to downstream. Water quality variables that are influenced by irrigation return flows (e.g., conductivity, turbidity, and total alkalinity) also increased from upstream to downstream and were significantly correlated (P < 0.05) with organochlorine residue levels in the fish. In carp, concentrations of two residues-⌆DDT (p,p′-DDD +p,p′-DDE + +p,p′-DDT; 1.43 to 2.21 mg/kg wet weight) and toxaphene (3.12 mg/kg wet weight)-approached the highest levels reported by the National Pesticide Monitoring Program for fish from other intensively farmed watersheds of the United States in 1980 to 1981, and surpassed criteria for whole-body residue concentrations recomended by the National Academy of Sciences and National Academy of Engineers for the protection of piscivorous wildlife.

  18. Habitat and movement of lake sturgeon in the upper Mississippi River system, USA

    USGS Publications Warehouse

    Knights, Brent C.; Vallazza, Jonathon M.; Zigler, Steven J.; Dewey, Michael R.

    2002-01-01

    Lake sturgeon Acipenser fluvescens, which are now protected from harvest, are considered rare in the upper Mississippi River and little information is available on the remaining populations. Transmitters were implanted into 31 lake sturgeon from two sites in the upper Mississippi River to describe their habitats and movement. The areas surrounding the tagging sites were core areas for both groups of lake sturgeon based on the high use (about 50% of locations by group) and frequent return to these areas by many of the tagged fish. Core areas contained sites with unique hydraulic characteristics, such that depositional substrates were common yet flow was present; these areas probably provide important feeding habitat for lake sturgeon. Minimal geographical overlap in range occurred between groups, suggesting that river reaches and associated core areas were unique to groups or substocks of fish. Lake sturgeon exhibited complex movement behaviors and had ranges of 3-198 km (median, 56 km) during the study. Tagged fish moved both downstream and upstream through upper Mississippi River navigation dams. However, dams appeared to be intermittent barriers to upstream passage because upstream passage events (10 fish, 19 passages) were fewer than downstream events (13 fish, 35 passages). Extensive use of the Wisconsin River by one group of lake sturgeon tagged in the upper Mississippi River has implications regarding management of a threatened population that transcends regulatory boundaries. Our study indicates that lake sturgeon In the upper Mississippi River system share many movement and habitat use characteristics with populations in other systems. However, significant data gaps preclude development of cogent management strategies, including information on population numbers and dynamics, identification of spawning areas, relations between groups, and assessment of the effects of commercial navigation.

  19. Influence of remediation in a mine-impacted river: Metal trends over large spatial and temporal scales

    USGS Publications Warehouse

    Hornberger, Michelle I.; Luoma, S.N.; Johnson, M.L.; Holyoak, M.

    2009-01-01

    The effectiveness of mine-waste remediation at the Clark Fork River Superfund site in western Montana, USA, was examined by monitoring metal concentrations in resident biota (caddisfly, Hydropsyche spp.) and bed sediment over a 19-year period. Remediation activities began in 1990 and are ongoing. In the upper 45 km, reduced Cu and Cd concentrations at some sites were coincident with remediation events. However, for a period of three years, the decline in Cu and Cd directly below the treatment ponds was offset by high arsenic concentrations, suggesting that remediation for cations (e.g., Cu and Cd) mobilized anions such as arsenic. The impact of remediation in the middle and lower reaches was confounded by a significant positive relationship between metal bioaccumulation and stream discharge. High flows did not dilute metals but redistributed contaminants throughout the river. The majority of clean-up efforts were focused on reducing metal-rich sediments in the most contaminated upstream reach, implicitly assuming that improvements upstream will positively impact the downstream stations. We tested this assumption by correlating temporal metal trends in sediment between and among stations. The strength of that association (r value) was our indicator of spatial connectivity. Connectivity for both Cu and Cd was strong at small spatial scales. Large-scale connectivity was strongest with Cu since similar temporal reductions were observed at most monitoring stations. The most upstream station, closest to remediation, had the lowest connectivity, but the next three downstream sites were strongly correlated to trends downstream. Targeted remediation in this reach would be an effective approach to positively influencing the downstream stations. ?? 2009 by the Ecological Society ot America.

  20. [Questionnaire about the intake of and hypersensitivity to fruits, vegetables and nuts including birch pollen related foods].

    PubMed

    Yamamoto, Tetsuo; Asakura, Kohji; Shirasaki, Hideaki; Himi, Tetsuo

    2013-07-01

    In Hokkaido and Scandinavia, birch pollen allergic persons are common and they often report oral and pharyngeal hypersensitivity to fruits and vegetables (oral allergy syndrome, OAS), because of immunological cross-reactivity. In Scandinavia, nuts as well as Rosaceae fruits such as apples were the foods most often reported to elicit symptoms. On the other hand, nuts are minor foods causing hypersensitivity in Japan. Even in Japan, regional differences of foods causing hypersensitivity have been reported, which may be related to the regional differences of elementary habit and pollen dispersion. In the present study, we evaluated the intake history of the foods and the frequency of food hypersensitivity in adults from the general population. Three hundreds and thirty nine subjects (20-67 years old) took part in the study. With a questionnaire survey, we asked them about their intake history and hypersensitive symptoms for 33 kinds of fruit, vegetables, and nuts. 30% of subjects had eaten Brazil nuts, 80% had eaten pomegranates, and 81% had eaten hazelnuts. And over 95% of subjects had eaten the other 30 foods. Those who had lived in Hokkaido for more than 20 years had a higher frequency of plum consumption than the others. Those who had lived in Hokkaido for more than 20 years had a lower frequency of loquat, fig and pomegranate consumption than the others. Food hypersensitivity was found in 52 subjects (15.3%). The most common symptom was OAS (46 subjects, 13.6%), and foods most frequently causing OAS were peach (21 subjects, 6.2%), cherry (19 subjects, 5.6%) and apple (17 subjects, 5.0%). 26 subjects (7.7%) reported OAS to Rosaceae fruits. The ratio of having OAS to consuming Rosaceae fruits was 11.0% in the group who had lived in Hokkaido for more than 20 years, which was higher than the group who has lived in Hokkaido for less than 20 years. The intake history of hazelnuts and Brazil nuts was very low, with a correspondingly low frequency of food hypersensitivity associated with these nuts. The frequency of intake and hypersensitivity of some foods differ among different regions.

  1. Toll-Like Receptor 4 in Paraventricular Nucleus Mediates Visceral Hypersensitivity Induced by Maternal Separation

    PubMed Central

    Tang, Hui-Li; Zhang, Gongliang; Ji, Ning-Ning; Du, Lei; Chen, Bin-Bin; Hua, Rong; Zhang, Yong-Mei

    2017-01-01

    Neonatal maternal separation (MS) is a major early life stress that increases the risk of emotional disorders, visceral pain perception and other brain dysfunction. Elevation of toll-like receptor 4 (TLR4) signaling in the paraventricular nucleus (PVN) precipitates early life colorectal distension (CRD)-induced visceral hypersensitivity and pain in adulthood. The present study aimed to investigate the role of TLR4 signaling in the pathogenesis of postnatal MS-induced visceral hypersensitivity and pain during adulthood. The TLR4 gene was selectively knocked out in C57BL/10ScSn mice (Tlr4-/-). MS was developed by housing the offspring alone for 6 h daily from postnatal day 2 to day 15. Visceral hypersensitivity and pain were assessed in adulthood. Tlr4+/+, but not Tlr4-/-, mice that had experienced neonatal MS showed chronic visceral hypersensitivity and pain. TLR4 immunoreactivity was observed predominately in microglia in the PVN, and MS was associated with an increase in the expression of protein and/or mRNA levels of TLR4, corticotropin-releasing factor (CRF), CRF receptor 1 (CRFR1), tumor necrosis factor-α, and interleukin-1β in Tlr4+/+ mice. These alterations were not observed in Tlr4-/- mice. Local administration of lipopolysaccharide, a TLR4 agonist, into the lateral cerebral ventricle elicited visceral hypersensitivity and TLR4 mRNA expression in the PVN, which could be prevented by NBI-35965, an antagonist to CRFR1. The present results indicate that neonatal MS induces a sensitization and upregulation of microglial TLR4 signaling activity, which facilitates the neighboring CRF neuronal activity and, eventually, precipitates visceral hypersensitivity in adulthood. Highlights (1)Neonatal MS does not induce chronic visceral hypersensitivity and pain in Tlr4-/- mice.(2)Neonatal MS increases the expression of TLR4 mRNA, CRF protein and mRNA, CRFR1 protein, TNF-α protein, and IL-1β protein in Tlr4+/+ mice.(3)TLR4 agonist LPS (i.c.v.) elicits visceral hypersensitivity and TLR4 mRNA expression in the PVN. PMID:28611665

  2. Association of HLA genotypes with phenobarbital hypersensitivity in children.

    PubMed

    Manuyakorn, Wiparat; Mahasirimongkol, Surakameth; Likkasittipan, Plernpit; Kamchaisatian, Wasu; Wattanapokayakit, Sukanya; Inunchot, Wimala; Visudtibhan, Anannit; Wichukchinda, Nuanjun; Benjaponpitak, Suwat

    2016-10-01

    Phenobarbital hypersensitivity is one of the common drug hypersensitivity syndromes in children. Clinical symptoms of phenobarbital hypersensitivity vary from maculopapular rashes (MPs) to severe cutaneous adverse drug reactions (SCARs) including drug reactions with eosinophilia and systemic symptoms (DRESS), Stevens-Johnson syndrome (SJS), and toxic epidermal necrolysis (TEN). Drug hypersensitivity has been demonstrated to be associated with variations in the HLA genotypes. This study was to investigate the association between the variations of HLA genotypes and phenobarbital hypersensitivity in Thai children. The cases were Thai children, between 0 and 18 years of age, who were diagnosed with phenobarbital hypersensitivity, which included SCARs and MPs. The control patients were Thai children of a corresponding age who had taken phenobarbital for at least 12 weeks without any hypersensitivity reaction. Blood samples were collected for HLA genotyping by using a reverse-sequence-specific oligonucleotide (SSO) probes method. The carrier rates of HLA alleles were compared between 47 cases (27 SCARs and 20 MPs) and 54 controls. The carrier rates of HLA-A*01:01 and HLA-B*13:01 were significantly higher in the phenobarbital-induced SCARs than in the tolerant controls (18.5% vs. 1.85%, p = 0.01, odds ratio [OR] 11.66, 95% confidence interval [CI] 1.21-578.19; 37.04% vs. 11.11%, p = 0.009, OR 4.60, 95%CI 1.29-17.98). There was a trend of a higher carrier rate of HLA-C*06:02 in the phenobarbital-induced SCARs when compared with those in the tolerant controls (29.63% vs. 11.11%, p = 0.059, OR 3.31, 95% CI 0.88-13.31). In contrast to the phenobarbital-induced SCARs, only the HLA-A*01:01 carrier rate in the phenobarbital-induced MPs was significantly higher than those in the tolerant controls (20% vs. 1.85%, p = 0.017, OR 12.69, 95% CI 1.15-661.62). An association between phenobarbital hypersensitivity and HLA-A*01:01 and HLA-B*13:01 has been demonstrated in Thai children. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  3. Effect of Benralizumab in Atopic Dermatitis

    ClinicalTrials.gov

    2018-06-22

    Dermatitis, Atopic; Dermatitis; Eczema; Skin Diseases; Skin Diseases, Genetic; Genetic Diseases, Inborn; Skin Diseases, Eczematous; Hypersensitivity; Hypersensitivity, Immediate; Immune System Diseases

  4. Level II scour analysis for Bridge 39 (ANDOVT00110039) on State Route 11, crossing the Middle Branch Williams River, Andover, Vermont

    USGS Publications Warehouse

    Burns, Ronda L.; Wild, Emily C.

    1997-01-01

    This report provides the results of a detailed Level II analysis of scour potential at structure ANDOVT00110039 on State Route 11 crossing the Middle Branch Williams River, Andover, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the Green Mountain section of the New England physiographic province in southern Vermont. The 5.75-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is forest on the upstream left bank and downstream right bank. The surface cover on the upstream right and downstream left banks is brush. In the study area, the Middle Branch Williams River has an incised, sinuous channel with a slope of approximately 0.01 ft/ft, an average channel top width of 58 ft and an average bank height of 8 ft. The channel bed material ranges from sand to boulder with a median grain size (D50) of 96.8 mm (0.317 ft). The geomorphic assessment at the time of the Level I and Level II site visit on September 9, 1996, indicated that the reach was laterally unstable. The State Route 11 crossing of the Middle Branch Williams River is a 43-ft-long, two-lane bridge consisting of one 41-foot concrete-beam span and two additional steel beams on the upstream face (Vermont Agency of Transportation, written communication, March 29, 1995). The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 45 degrees to the opening while the opening-skew-to-roadway is 45 degrees. The only scour protection measures at the site was type-2 stone fill (less than 36 inches diameter) at the upstream end of the upstream right wingwall and type-3 stone fill (less than 48 inches diameter) along the entire base length of the upstream left wingwall. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 0.8 ft. The worst-case contraction scour occurred at the 500-year discharge. Abutment scour ranged from 8.9 to 11.2 ft. The worst-case abutment scour occurred at the incipient-overtopping discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

  5. Occurrence and partitioning of antibiotic compounds found in the water column and bottom sediments from a stream receiving two wastewater treatment plant effluents in northern New Jersey, 2008.

    PubMed

    Gibs, Jacob; Heckathorn, Heather A; Meyer, Michael T; Klapinski, Frank R; Alebus, Marzooq; Lippincott, Robert L

    2013-08-01

    An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and ofloxacin. Generally, there was good agreement between the decreasing order of the pseudo-partition coefficients in this study and the order reported in the literature. Published by Elsevier B.V.

  6. Evaluating the effectiveness of restoring longitudinal connectivity for stream fish communities: towards a more holistic approach.

    PubMed

    Tummers, Jeroen S; Hudson, Steve; Lucas, Martyn C

    2016-11-01

    A more holistic approach towards testing longitudinal connectivity restoration is needed in order to establish that intended ecological functions of such restoration are achieved. We illustrate the use of a multi-method scheme to evaluate the effectiveness of 'nature-like' connectivity restoration for stream fish communities in the River Deerness, NE England. Electric-fishing, capture-mark-recapture, PIT telemetry and radio-telemetry were used to measure fish community composition, dispersal, fishway efficiency and upstream migration respectively. For measuring passage and dispersal, our rationale was to evaluate a wide size range of strong swimmers (exemplified by brown trout Salmo trutta) and weak swimmers (exemplified by bullhead Cottus perifretum) in situ in the stream ecosystem. Radio-tracking of adult trout during the spawning migration showed that passage efficiency at each of five connectivity-restored sites was 81.3-100%. Unaltered (experimental control) structures on the migration route had a bottle-neck effect on upstream migration, especially during low flows. However, even during low flows, displaced PIT tagged juvenile trout (total n=153) exhibited a passage efficiency of 70.1-93.1% at two nature-like passes. In mark-recapture experiments juvenile brown trout and bullhead tagged (total n=5303) succeeded in dispersing upstream more often at most structures following obstacle modification, but not at the two control sites, based on a Laplace kernel modelling approach of observed dispersal distance and barrier traverses. Medium-term post-restoration data (2-3years) showed that the fish assemblage remained similar at five of six connectivity-restored sites and two control sites, but at one connectivity-restored headwater site previously inhabited by trout only, three native non-salmonid species colonized. We conclude that stream habitat reconnection should support free movement of a wide range of species and life stages, wherever retention of such obstacles is not needed to manage non-native invasive species. Evaluation of the effectiveness of fish community restoration in degraded streams benefits from a similarly holistic approach. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Occurence of antibiotic compounds found in the water column and bottom sediments from a stream receiving two waste water treatment plant effluents in northern New Jersey, 2008

    USGS Publications Warehouse

    Gibs, Jacob; Heckathorn, Heather A.; Meyer, Michael T.; Klapinski, Frank R.; Alebus, Marzooq; Lippincott, Robert

    2013-01-01

    An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and ofloxacin. Generally, there was good agreement between the decreasing order of the pseudo-partition coefficients in this study and the order reported in the literature.

  8. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Multiple splicing defects in an intronic false exon.

    PubMed

    Sun, H; Chasin, L A

    2000-09-01

    Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

  10. Estimating the effects of land use at different scales on high ecological status in Irish rivers.

    PubMed

    Roberts, William M; Fealy, Reamonn M; Doody, Donnacha G; Jordan, Phil; Daly, Karen

    2016-12-01

    High ecological status at river sites is an indicator of minimal disturbance from anthropogenic activities and the presence of ecologically important species and communities. However, a lack of clarity on what factors cause sites to lose high ecological status is limiting the ability to maintain the quality of these sites. Examination of ecological status records at 508 high status river sites throughout the Republic of Ireland revealed that 337 had fallen below high status at some point between 2001 and 2012 due to changes in invertebrate communities. A geographical information system was used to characterise land use and environmental variables in the catchment, riparian and reach areas upstream of the sites. The relationships between these variables at the three spatial scales and whether or not river sites had maintained high ecological status were then estimated by multiple logistic regression and propensity modelling. The results indicated that grassland at either catchment or riparian scales had a greater negative impact on high ecological status than at the reach scale. This effect appeared to be strongest for upland, steeply sloping rivers that are subject to high rainfall, possibly due to the presence of sensitive biota and/or a greater potential for erosion. These results highlighted the need for better management of grassland upstream of the high status sites, with a focus on river alterations and critical source areas of nutrients, sediments and pesticides that are hydrologically connected to the river. Sustainable management practices and land use planning in those areas will need to be considered carefully if the aim of maintaining high ecological status at river sites is to be achieved. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. In Vivo Imaging of MDR1A Gene Expression

    DTIC Science & Technology

    2004-12-01

    Engineer PGK-neo and Renilla luciferase cassettes, already available, with appropriate loxP sites, into mdrla locus. Repeat for HSV-tk reporter. The...of the gene-targeting vector. under the control of the PGK promoter. Luc: Renilla luciferase fused in- frame with the translated sequences of exon 2...between the two loxP sites, upstream of the Neo cassette. A cloning strategy was then devised to fuse Renilla luciferase in-frame with the translated

  12. Reactive Oxygen Species in Planarian Regeneration: An Upstream Necessity for Correct Patterning and Brain Formation

    PubMed Central

    Pirotte, Nicky; Stevens, An-Sofie; Fraguas, Susanna; Plusquin, Michelle; Van Roten, Andromeda; Van Belleghem, Frank; Paesen, Rik; Ameloot, Marcel; Cebrià, Francesc; Artois, Tom; Smeets, Karen

    2015-01-01

    Recent research highlighted the impact of ROS as upstream regulators of tissue regeneration. We investigated their role and targeted processes during the regeneration of different body structures using the planarian Schmidtea mediterranea, an organism capable of regenerating its entire body, including its brain. The amputation of head and tail compartments induces a ROS burst at the wound site independently of the orientation. Inhibition of ROS production by diphenyleneiodonium (DPI) or apocynin (APO) causes regeneration defaults at both the anterior and posterior wound sites, resulting in reduced regeneration sites (blastemas) and improper tissue homeostasis. ROS signaling is necessary for early differentiation and inhibition of the ROS burst results in defects on the regeneration of the nervous system and on the patterning process. Stem cell proliferation was not affected, as indicated by histone H3-P immunostaining, fluorescence-activated cell sorting (FACS), in situ hybridization of smedwi-1, and transcript levels of proliferation-related genes. We showed for the first time that ROS modulate both anterior and posterior regeneration in a context where regeneration is not limited to certain body structures. Our results indicate that ROS are key players in neuroregeneration through interference with the differentiation and patterning processes. PMID:26180588

  13. Methylmercury Modulation in Amazon Rivers Linked to Basin Characteristics and Seasonal Flood-Pulse.

    PubMed

    Kasper, Daniele; Forsberg, Bruce R; Amaral, João H F; Py-Daniel, Sarah S; Bastos, Wanderley R; Malm, Olaf

    2017-12-19

    We investigated the impact of the seasonal inundation of wetlands on methylmercury (MeHg) concentration dynamics in the Amazon river system. We sampled 38 sites along the Solimões/Amazon and Negro rivers and their tributaries during distinct phases of the annual flood-pulse. MeHg dynamics in both basins was contrasted to provide insight into the factors controlling export of MeHg to the Amazon system. The export of MeHg by rivers was substantially higher during high-water in both basins since elevated MeHg concentrations and discharge occurred during this time. MeHg concentration was positively correlated to %flooded area upstream of the sampling site in the Solimões/Amazon Basin with the best correlation obtained using 100 km buffers instead of whole basin areas. The lower correlations obtained with the whole basin apparently reflected variable losses of MeHg exported from upstream wetlands due to demethylation, absorption, deposition, and degradation before reaching the sampling site. A similar correlation between %flooded area and MeHg concentrations was not observed in the Negro Basin probably due to the variable export of MeHg from poorly drained soils that are abundant in this basin but not consistently flooded.

  14. Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

    PubMed Central

    Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

    2015-01-01

    Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

  15. Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

    PubMed

    Kel, AlexanderE

    2017-02-01

    Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

  16. Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

    PubMed

    Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

    1999-11-19

    As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

  17. A mechanism underlying position-specific regulation of alternative splicing

    PubMed Central

    Hamid, Fursham M.

    2017-01-01

    Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.

  18. An approach to natalizumab hypersensitivity: a case series of induction of tolerance.

    PubMed

    Camacho-Halili, Marie; George, Roxanne; Gottesman, Malcolm; Davis-Lorton, Mark

    2011-02-01

    Induction of tolerance protocols have been applied successfully to manage allergic reactions to many medications. Hypersensitivity reactions to natalizumab (TYSABRI®) have been recognized as a growing problem. In circumstances where a hypersensitivity reaction to a medication has occurred, but no suitable alternative exists, drug induction of tolerance protocols may be considered. Drug induction of tolerance protocols were performed in three patients with prior hypersensitivity reactions to natalizumab. All three patients tolerated the protocol without adverse reactions, allowing for the safe reintroduction of natalizumab. To conclude, this case series demonstrates success with an induction of tolerance procedure to a highly effective biological agent for multiple sclerosis, in patients with allergic reactions to natalizumab.

  19. Dentin Hypersensitivity: Etiology, Diagnosis and Treatment; A Literature Review

    PubMed Central

    Davari, AR; Ataei, E; Assarzadeh, H

    2013-01-01

    The objective of this review is to inform practitioners about dentin hypersensitivity (DH); to provide a brief overview of the diagnosis, etiology and clinical management of dentin hypersensitivity and to discuss technical approaches to relieve sensitivity. This clinical information is described in the context of the underlying biology. The author used PUBMED to find relevant English-language literature published in the period 1999 to 2010. The author used combinations of the search terms “dentin*”, “tooth”, “teeth”, “hypersensit*”, “desensitiz*”. Abstracts and also full text articles to identify studies describing etiology, prevalence, clinical features, controlled clinical trials of treatments and relevant laboratory research on mechanisms of action were used. PMID:24724135

  20. Entomologic evaluation of insect hypersensitivity in horses.

    PubMed

    Greiner, E C

    1995-04-01

    Potential methods of incriminating insects as the cause of insect hypersensitivity are presented. A listing of the biting midges known to attack horses in North America is presented also. An example of how species may be determined to be the cause of the hypersensitivity is given using data from a recent study in Florida. Light trap collections indicated the temporal and geographic distribution of potential contributing species and collections made by vacuuming horses further delineated species by proving they feed on horses and the correct locations on the horses to match lesion distribution. Culicoides hypersensitivity in horses in Florida seems to be caused by a series of species active and feeding on the horses at different times of the year.

  1. Abundance of three bacterial populations in selected streams

    Treesearch

    O.A. Olapade; X. Gao; L.G. LEff

    2005-01-01

    The population sizes of three bacterial species, Acinetobacter calcoaceticw, Burkholderia cepacia, and Pseudomonas putida, were examined in water and sediment from nine streams in different parts of the United States using fluorescent in situ hybridization (FISH). Population sizes were determined from three sites (upstream,...

  2. Metal loading in Soda Butte Creek upstream of Yellowstone National Park, Montana and Wyoming; a retrospective analysis of previous research; and quantification of metal loading, August 1999

    USGS Publications Warehouse

    Boughton, G.K.

    2001-01-01

    Acid drainage from historic mining activities has affected the water quality and aquatic biota of Soda Butte Creek upstream of Yellowstone National Park. Numerous investigations focusing on metals contamination have been conducted in the Soda Butte Creek basin, but interpretations of how metals contamination is currently impacting Soda Butte Creek differ greatly. A retrospective analysis of previous research on metal loading in Soda Butte Creek was completed to provide summaries of studies pertinent to metal loading in Soda Butte Creek and to identify data gaps warranting further investigation. Identification and quantification of the sources of metal loading to Soda Butte Creek was recognized as a significant data gap. The McLaren Mine tailings impoundment and mill site has long been identified as a source of metals but its contribution relative to the total metal load entering Yellowstone National Park was unknown. A tracer-injection and synoptic-sampling study was designed to determine metal loads upstream of Yellowstone National Park.A tracer-injection and synoptic-sampling study was conducted on an 8,511-meter reach of Soda Butte Creek from upstream of the McLaren Mine tailings impoundment and mill site downstream to the Yellowstone National Park boundary in August 1999. Synoptic-sampling sites were selected to divide the creek into discrete segments. A lithium bromide tracer was injected continuously into Soda Butte Creek for 24.5 hours. Downstream dilution of the tracer and current-meter measurements were used to calculate the stream discharge. Stream discharge values, combined with constituent concentrations obtained by synoptic sampling, were used to quantify constituent loading in each segment of Soda Butte Creek.Loads were calculated for dissolved calcium, silica, and sulfate, as well as for dissolved and total-recoverable iron, aluminum, and manganese. Loads were not calculated for cadmium, copper, lead, and zinc because these elements were infrequently detected in mainstem synoptic samples. All of these elements were detected at high concentrations in the seeps draining the McLaren Mine tailings impoundment. The lack of detection of these elements in the downstream mainstem synoptic samples is probably because of sorption (coprecipitation and adsorption) to metal colloids in the stream.Most of the metal load that entered Soda Butte Creek was contributed by the inflows draining the McLaren Mine tailings impoundment (between 505 meters and 760 meters downstream from the tracer-injection site), Republic Creek (1,859 meters), and Unnamed Tributary (8,267 meters). Results indicate that treatment or removal of the McLaren Mine tailings impoundment would greatly reduce metal loading in Soda Butte Creek upstream of Yellowstone National Park. However, removing only that single source may not reduce metal loads to acceptable levels. The sources of metal loading in Republic Creek and Unnamed Tributary merit further investigation.

  3. Digital flow model of the Chowan River estuary, North Carolina

    USGS Publications Warehouse

    Daniel, C.C.

    1977-01-01

    A one-dimensional deterministic flow model based on the continuity equation had been developed to provide estimates of daily flow past a number of points on the Chowan River estuary of northeast North Carolina. The digital model, programmed in Fortran IV, computes daily average discharge for nine sites; four of these represent inflow at the mouths of major tributaries, the five other sites are at stage stations along the estuary. Because flows within the Chowan River and the lower reaches of its tributaries are tidally affected, flows occur in both upstream and downstream directions. The period of record generated by the model extends from April 1, 1974, to March 31, 1976. During the two years of model operation the average discharge at Edenhouse near the mouth of the estuary was 5,830 cfs (cubic feet per second). Daily average flows during this period ranged from 55,900 cfs in the downstream direction on July 17, 1975, to 14,200 cfs in the upstream direction on November 30, 1974

  4. Contribution of waste water treatment plants to pesticide toxicity in agriculture catchments.

    PubMed

    Le, Trong Dieu Hien; Scharmüller, Andreas; Kattwinkel, Mira; Kühne, Ralph; Schüürmann, Gerrit; Schäfer, Ralf B

    2017-11-01

    Pesticide residues are frequently found in water bodies and may threaten freshwater ecosystems and biodiversity. In addition to runoff or leaching from treated agricultural fields, pesticides may enter streams via effluents from wastewater treatment plants (WWTPs). We compared the pesticide toxicity in terms of log maximum Toxic Unit (log mTU) of sampling sites in small agricultural streams of Germany with and without WWTPs in the upstream catchments. We found an approximately half log unit higher pesticide toxicity for sampling sites with WWTPs (p < 0.001). Compared to fungicides and insecticides, herbicides contributed most to the total pesticide toxicity in streams with WWTPs. A few compounds (diuron, terbuthylazin, isoproturon, terbutryn and Metazachlor) dominated the herbicide toxicity. Pesticide toxicity was not correlated with upstream distance to WWTP (Spearman's rank correlation, rho = - 0.11, p > 0.05) suggesting that other context variables are more important to explain WWTP-driven pesticide toxicity. Our results suggest that WWTPs contribute to pesticide toxicity in German streams. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Hydrology and water-quality characteristics of Muddy Creek and Wolford Mountain Reservoir near Kremmling, Colorado, 1990 through 2001

    USGS Publications Warehouse

    Stevens, Michael R.; Sprague, Lori A.

    2003-01-01

    A water-quality monitoring program was begun in March 1985 on Muddy Creek in anticipation of the construction of a reservoir water-storage project. Wolford Mountain Reservoir was constructed by the Colorado River Water Conservation District during 1992-94. The reservoir began to be filled in 1995. Water quality generally was good in Muddy Creek and Wolford Mountain Reservoir throughout the period of record (collectively, 1990 through 2001), with low concentrations of nutrients (median total nitrogen less than 0.6 and median total phosphorus less than 0.05 milligrams per liter) and trace elements (median dissolved copper less than 2, median dissolved lead less than 1, and median dissolved zinc less than 20 micrograms per liter). Specific conductance ranged from 99 to 1,720 microsiemens per centimeter. Cation compositions at Muddy Creek sites were mixed calcium-magnesium-sodium. Anion compositions were primarily bicarbonate and sulfate. Suspended-sediment concentrations ranged from less than 50 milligrams per liter during low-flow periods to hundreds of milligrams per liter during snowmelt. Turbidity in prereservoir Muddy Creek generally was measured at less than 10 nephelometric turbidity units during low-flow periods and ranged to more than 360 nephelometric turbidity units during snowmelt. Compared to prereservoir conditions, turbidity in Muddy Creek downstream from the reservoir was substantially reduced because the reservoir acted as a sediment trap. During most years, peak flows were slightly reduced by the reservoir or similar to peaks upstream from the reservoir. The upper first to fifteenth percentiles of flows were decreased by operation of the reservoir compared to prereservoir flows. Generally, the fifteenth to one-hundredth percentiles of flow were increased by operation of the reservoir outflow compared to prereservoir flows. Nutrient transport in the inflow is proportional to the amount of inflow-water discharge in a given year. Some nitrogen was stored in the water column and gain/loss patterns for total nitrogen were somewhat related to reservoir storage. Nitrogen tended to move through the reservoir, whereas phosphorus was mostly trapped within the reservoir in bottom sediments. The reservoir gained phosphorus every year (1996- 2001) and, as a percentage, more phosphorus was retained than nitrogen in years when both were retained in the reservoir due to stronger phosphorus tendencies for adsorption, coprecipitation, and settling. Only small amounts of phosphorus were available in the water column at the outflow, and reservoir water-column storage did not influence phosphorus outflowloading patterns as much as settling further upstream in the reservoir. From 1990 to 2001, upstream from the reservoir, concentrations and values of dissolved solids, turbidity, some major ions, and dissolved iron increased (p-value less than 0.10), and acid-neutralizing capacity decreased. From 1990 to 2001, there were no significant (p-value less than 0.10) trends in nutrient concentrations upstream from the reservoir. From 1990 to 2001, downstream from the reservoir, trends in concentrations and values of dissolved solids, turbidity, major ions, total ammonia plus organic nitrogen, dissolved and total-recoverable iron, and total-recoverable manganese were downward. Upstream and downstream water-quality constituents for the prereservoir (1990 to 1995) period were compared. Concentrations and values of dissolved solids, major ions, turbidity, and manganese were greater (p-value less than 0.10) at the downstream site. From 1995 to 2001 (postconstruction), upstream and downstream water-quality constituents also were compared. Concentrations of specific conductance and major ions increased at the downstream site when compared to the upstream site (p-value less than 0.10), except for acid-neutralizing capacity and silica, which decreased. Turbidity, concentrations of total-recoverable and dissolved manganese, and

  6. Suspended-sediment and nutrient loads for Waiakea and Alenaio Streams, Hilo, Hawaii, 2003-2006

    USGS Publications Warehouse

    Presley, Todd K.; Jamison, Marcael T.J.; Nishimoto, Dale C.

    2008-01-01

    Suspended sediment and nutrient samples were collected during wet-weather conditions at three sites on two ephemeral streams in the vicinity of Hilo, Hawaii during March 2004 to March 2006. Two sites were sampled on Waiakea Stream at 80- and 860-foot altitudes during March 2004 to August 2005. One site was sampled on Alenaio Stream at 10-foot altitude during November 2005 to March 2006. The sites were selected to represent different land uses and land covers in the area. Most of the drainage area above the upper Waiakea Stream site is conservation land. The drainage areas above the lower site on Waiakea Stream, and the site on Alenaio Stream, are a combination of conservation land, agriculture, rural, and urban land uses. In addition to the sampling, continuous-record streamflow sites were established at the three sampling sites, as well as an additional site on Alenaio Stream at altitude of 75 feet and 0.47 miles upstream from the sampling site. Stage was measured continuously at 15-minute intervals at these sites. Discharge, for any particular instant, or for selected periods of time, were computed based on a stage-discharge relation determined from individual discharge measurements. Continuous records of discharge were computed at the two sites on Waiakea Stream and the upper site on Aleniao Stream. Due to non-ideal hydraulic conditions within the channel of Alenaio Stream, a continuous record of discharge was not computed at the lower site on Alenaio Stream where samples were taken. Samples were analyzed for suspended sediment, and the nutrients total nitrogen, dissolved nitrite plus nitrate, and total phosphorus. Concentration data were converted to instantaneous load values: loads are the product of discharge and concentration, and are presented as tons per day for suspended sediment or pounds per day for nutrients. Daily-mean loads were computed by estimating concentrations relative to discharge using graphical constituent loading analysis techniques. Daily-mean loads were computed at the two Waiakea Stream sampling sites for the analyzed constituents, during the period October 1, 2003 to September 30, 2005. No record of daily-mean load was computed for the Alenaio Stream sampling site due to the problems with computing a discharge record. The maximum daily-mean loads for the upper site on Waiakea Stream for suspended sediment was 79 tons per day, and the maximum daily-mean loads for total nitrogen, dissolved nitrite plus nitrate, and total phosphorus were 1,350, 13, and 300 pounds per day, respectively. The maximum daily-mean loads for the lower site on Waiakea Stream for suspended sediment was 468 tons per day, and the maximum daily-mean loads for total nitrogen, nitrite plus nitrate, and total phosphorus were 913, 8.5, and 176 pounds per day, respectively. From the estimated continuous daily-mean load record, all of the maximum daily-mean loads occurred during October 2003 and September 2004, except for suspended sediment load for the lower site, which occurred on September 15, 2005. Maximum values were not all caused by a single storm event. Overall, the record of daily-mean loads showed lower loads during storm events for suspended sediments and nutrients at the downstream site of Waiakea Stream during 2004 than at the upstream site. During 2005, however, the suspended sediment loads were higher at the downstream site than the upstream site. Construction of a flood control channel between the two sites in 2005 may have contributed to the change in relative suspended-sediment loads.

  7. Clinical efficacy of a herbal dentifrice on dentinal hypersensitivity: a randomized controlled clinical trial.

    PubMed

    Kumari, M; Naik, S B; Rao, N S; Martande, S S; Pradeep, A R

    2013-12-01

    Dentinal hypersensitivity is a common problem and there is a growing interest in herbal based formulations for the treatment of oral diseases. This study was conducted to assess the efficacy of a commercially available novel herbal dentifrice in reduction of dentinal hypersensitivity. A total of 73 subjects (38 males and 35 females; aged 25-60 years) were randomly divided into two groups: Group 1 - a placebo dentifrice (The Himalaya Drug Company Research and Development, Makali, Bangalore) and Group 2 - (test group), a commercially available herbal dentifrice (Hi Ora K, The Himalaya Drug Company Research and Development, Makali, Bangalore). Sensitivity scores for controlled air stimulus and cold water were recorded at baseline, 6 weeks and 12 weeks. The test group was found to be significantly better compared to the placebo group at the end of 6 and 12 weeks in reduction of dentinal hypersensitivity. The novel herbal dentifrice can be recommended for treatment of dentinal hypersensitivity. © 2013 Australian Dental Association.

  8. Aspirin allergy desensitization in cerebrovascular disease. A report of two cases, literature review and management guide for the neurointerventionalist.

    PubMed

    Zuckerman, Scott L; Seder, David B; Tsujiura, Crystiana; Cushing, Deborah; Gallup, Holly; Mocco, J; Hanel, Richard A; Ecker, Robert D

    2014-01-01

    Aspirin (ASA) is the mainstay of treatment in cerebrovascular and systemic vascular disease. ASA hypersensitivity can pose a challenge to achieving optimum medical management prior to and after neurointerventional treatment. Desensitization to ASA is well described in the allergy and cardiovascular literature, but there are no similar discussions specific to neurointervention. The purpose of our study was to describe our experience with ASA hypersensitivity management and review the relevant literature. Two cases of patients with symptomatic cerebrovascular disease requiring neurointervention who were successfully desensitized to their ASA hypersensitivity prior to treatment are described. The subsequent literature is reviewed. Several ASA desensitization protocols exist and have been proven to successfully treat ASA hypersensitivity and allow for ASA therapy to be safely initiated. We describe several previously published protocols. ASA desensitization is a safe and simple way to manage ASA hypersensitivity. We provide comprehensive management guidelines for the neurointerventionalist engaging in ASA desensitization.

  9. Drug allergies

    MedlinePlus

    Allergic reaction - drug (medication); Drug hypersensitivity; Medication hypersensitivity ... A drug allergy involves an immune response in the body that produces an allergic reaction to a medicine. The ...

  10. The hairpin region of Ndc80 is important for the kinetochore recruitment of Mph1/MPS1 in fission yeast.

    PubMed

    Chmielewska, Aldona Ewa; Tang, Ngang Heok; Toda, Takashi

    2016-01-01

    The establishment of proper kinetochore-microtubule attachments facilitates faithful chromosome segregation. Incorrect attachments activate the spindle assembly checkpoint (SAC), which blocks anaphase onset via recruitment of a cohort of SAC components (Mph1/MPS1, Mad1, Mad2, Mad3/BubR1, Bub1 and Bub3) to kinetochores. KNL1, a component of the outer kinetochore KMN network (KNL1/Mis12 complex/Ndc80 complex), acts as a platform for Bub1 and Bub3 localization upon its phosphorylation by Mph1/MPS1. The Ndc80 protein, a major microtubule-binding site, is critical for MPS1 localization to the kinetochores in mammalian cells. Here we characterized the newly isolated mutant ndc80-AK01 in fission yeast, which contains a single point mutation within the hairpin region. This hairpin connects the preceding calponin-homology domain with the coiled-coil region. ndc80-AK01 was hypersensitive to microtubule depolymerizing reagents with no apparent growth defects without drugs. Subsequent analyses indicated that ndc80-AK01 is defective in SAC signaling, as mutant cells proceeded into lethal cell division in the absence of microtubules. Under mitotic arrest conditions, all SAC components (Ark1/Aurora B, Mph1, Bub1, Bub3, Mad3, Mad2 and Mad1) did not localize to the kinetochore. Further genetic analyses indicated that the Ndc80 hairpin region might act as a platform for the kinetochore recruitment of Mph1, which is one of the most upstream SAC components in the hierarchy. Intriguingly, artificial tethering of Mph1 to the kinetochore fully restored checkpoint signaling in ndc80-AK01 cells, further substantiating the notion that Ndc80 is a kinetochore platform for Mph1. The hairpin region of Ndc80, therefore, plays a critical role in kinetochore recruitment of Mph1.

  11. The hairpin region of Ndc80 is important for the kinetochore recruitment of Mph1/MPS1 in fission yeast

    PubMed Central

    Chmielewska, Aldona Ewa; Tang, Ngang Heok; Toda, Takashi

    2016-01-01

    ABSTRACT The establishment of proper kinetochore-microtubule attachments facilitates faithful chromosome segregation. Incorrect attachments activate the spindle assembly checkpoint (SAC), which blocks anaphase onset via recruitment of a cohort of SAC components (Mph1/MPS1, Mad1, Mad2, Mad3/BubR1, Bub1 and Bub3) to kinetochores. KNL1, a component of the outer kinetochore KMN network (KNL1/Mis12 complex/Ndc80 complex), acts as a platform for Bub1 and Bub3 localization upon its phosphorylation by Mph1/MPS1. The Ndc80 protein, a major microtubule-binding site, is critical for MPS1 localization to the kinetochores in mammalian cells. Here we characterized the newly isolated mutant ndc80-AK01 in fission yeast, which contains a single point mutation within the hairpin region. This hairpin connects the preceding calponin-homology domain with the coiled-coil region. ndc80-AK01 was hypersensitive to microtubule depolymerizing reagents with no apparent growth defects without drugs. Subsequent analyses indicated that ndc80-AK01 is defective in SAC signaling, as mutant cells proceeded into lethal cell division in the absence of microtubules. Under mitotic arrest conditions, all SAC components (Ark1/Aurora B, Mph1, Bub1, Bub3, Mad3, Mad2 and Mad1) did not localize to the kinetochore. Further genetic analyses indicated that the Ndc80 hairpin region might act as a platform for the kinetochore recruitment of Mph1, which is one of the most upstream SAC components in the hierarchy. Intriguingly, artificial tethering of Mph1 to the kinetochore fully restored checkpoint signaling in ndc80-AK01 cells, further substantiating the notion that Ndc80 is a kinetochore platform for Mph1. The hairpin region of Ndc80, therefore, plays a critical role in kinetochore recruitment of Mph1. PMID:26900649

  12. Low incidence of abacavir hypersensitivity reaction among African children initiating antiretroviral therapy.

    PubMed

    Nahirya-Ntege, Patricia; Musiime, Victor; Naidoo, Bethany; Bakeera-Kitaka, Sabrina; Nathoo, Kusum; Munderi, Paula; Mugyenyi, Peter; Kekitiinwa, Adeodata; Bwakura-Dangarembizi, Mutsa F; Crawley, Jane

    2011-06-01

    Hypersensitivity reactions are reported in approximately 5% of adults receiving abacavir, but there are few published data in children. Among 1150 African children receiving antiretroviral therapy in a randomized trial, suspected hypersensitivity reactions to abacavir were rare (0.3%; 95% CI, 0.01-0.9). Patients were managed successfully through the provision of clear guidelines and education of clinical staff, children, and their caregivers.

  13. Immediate-type hypersensitivity reaction to Mannitol as drug excipient (E421): a case report.

    PubMed

    Calogiuri, G F; Muratore, L; Nettis, E; Casto, A M; Di Leo, E; Vacca, A

    2015-05-01

    Allergic reactions to mannitol have been reported rarely, despite its widespread use as a drug and as a food excipient. This is the first case report in which oral mannitol induces an immediate type hypersensitivity as a drug excipient, in a 42 year old man affected by rhinitis to olive tree pollen. Unusual and undervalued risk factors for mannitol hypersensitivity are examined.

  14. COX2 in CNS neural cells mediates mechanical inflammatory pain hypersensitivity in mice

    PubMed Central

    Vardeh, Daniel; Wang, Dairong; Costigan, Michael; Lazarus, Michael; Saper, Clifford B.; Woolf, Clifford J.; FitzGerald, Garret A.; Samad, Tarek A.

    2009-01-01

    A cardinal feature of peripheral inflammation is pain. The most common way of managing inflammatory pain is to use nonsteroidal antiinflammatory agents (NSAIDs) that reduce prostanoid production, for example, selective inhibitors of COX2. Prostaglandins produced after induction of COX2 in immune cells in inflamed tissue contribute both to the inflammation itself and to pain hypersensitivity, acting on peripheral terminals of nociceptors. COX2 is also induced after peripheral inflammation in neurons in the CNS, where it aids in developing a central component of inflammatory pain hypersensitivity by increasing neuronal excitation and reducing inhibition. We engineered mice with conditional deletion of Cox2 in neurons and glial cells to determine the relative contribution of peripheral and central COX2 to inflammatory pain hypersensitivity. In these mice, basal nociceptive pain was unchanged, as was the extent of peripheral inflammation, inflammatory thermal pain hypersensitivity, and fever induced by lipopolysaccharide. By contrast, peripheral inflammation–induced COX2 expression in the spinal cord was reduced, and mechanical hypersensitivity after both peripheral soft tissue and periarticular inflammation was abolished. Mechanical pain is a major symptom of most inflammatory conditions, such as postoperative pain and arthritis, and induction of COX2 in neural cells in the CNS seems to contribute to this. PMID:19127021

  15. Carboplatin Hypersensitivity Reactions in Pediatric Low Grade Glioma Are Protocol Specific and Desensitization Shows Poor Efficacy.

    PubMed

    Dodgshun, Andrew J; Hansford, Jordan R; Cole, Theresa; Choo, Sharon; Sullivan, Michael J

    2016-01-01

    The use of carboplatin for the treatment of pediatric low grade gliomas (PLGG) is often limited by the development of carboplatin hypersensitivity. Reported rates of carboplatin hypersensitivity reactions vary between 6% and 32% in these patients. Here we report the frequency of carboplatin hypersensitivity reactions depending on the treatment regimen used, and outcomes of carboplatin desensitization. The records of all patients in a single institution who were treated with carboplatin for PLGG were accessed and all patients receiving more than one dose of carboplatin are reported. Thirty four patients with PLGG were treated with carboplatin according to one of the two different regimens. Carboplatin hypersensitivity was documented in 47% of patients, but the frequency differed by treatment protocol. Those patients treated with 4-weekly single agent carboplatin had carboplatin allergy in 8% of cases whereas 68% of those treated with combined carboplatin and vincristine (every three weeks, according to the SIOP 2004 low grade glioma protocol) had carboplatin reactions (OR 23.6, P < 0.01). Desensitization was only successful in two out of 10 patients in whom it was attempted. Hypersensitivity reactions to carboplatin are more common in this cohort than previously reported and rates are protocol-dependent. Desensitization showed limited effectiveness in this cohort. © 2015 Wiley Periodicals, Inc.

  16. Role of insular cortex in visceral hypersensitivity model in rats subjected to chronic stress.

    PubMed

    Yi, LiSha; Sun, HuiHui; Ge, Chao; Chen, Ying; Peng, HaiXia; Jiang, YuanXi; Wu, Ping; Tang, YinHan; Meng, QingWei; Xu, ShuChang

    2014-12-30

    Abnormal processing of visceral sensation at the level of the central nervous system has been proven to be important in the pathophysiologic mechanisms of stress related functional gastrointestinal disorders. However, the specific mechanism is still not clear. The insular cortex (IC) was considered as one important visceral sensory area. Moreover, the IC has been shown to be involved in various neuropsychiatric diseases such as panic disorders and post-traumatic stress disorder. However, whether the IC is important in psychological stress related visceral hypersensitivity has not been studied yet. In our study, through destruction of the bilateral IC, we explored whether the IC played a critical role in the formation of visceral hypersensitivity induced by chronic stress on rats. Chronic partial restraint stress was used to establish viscerally hypersensitive rat model. Bilateral IC lesions were generated by N-methyl-D-day (door) aspartate. After a recovery period of 7 days, 14-day consecutive restraint stress was performed. The visceromotor response to colorectal distension was monitored by recording electromyogram to measure rats׳ visceral sensitivity. We found that bilateral insular cortex lesion could markedly inhibit the formation of visceral hypersensitivity induced by chronic stress. The insular cortex plays a critical role in the pathophysiology of stress-related visceral hypersensitivity.

  17. Lymphocyte blastogenic responses to inciting food allergens in dogs with food hypersensitivity.

    PubMed

    Ishida, Rinei; Masuda, Kenichi; Kurata, Keigo; Ohno, Koichi; Tsujimoto, Hajime

    2004-01-01

    Lymphocyte blastogenic responses against food allergens in dogs with food hypersensitivity were evaluated in this study. Eleven dogs with food hypersensitivity, based on food elimination and oral food provocation tests and allergic responses to food allergens, were examined by various tests such as intradermal testing, antigen-specific IgE testing, and lymphocyte blastogenic responses. The number and kinds of food allergens identified as positive by these tests were compared with the offending food allergens that were found in an oral food provocation test. In 9 (82%) of the 11 dogs with food hypersensitivity, there was close agreement for positive allergens between the results of lymphocyte blastogenic responses and oral food provocation test; however, there was little agreement for intradermal and IgE testing of the positive allergens with those of the oral food provocation test (11% and 31%, respectively). In the 9 dogs, the stimulation indices of lymphocyte blastogenic responses increased to 2.0-10.1 upon food provocation but decreased significantly to 0.7-1.4 upon feeding the elimination diet until clinical signs disappeared. These results indicate that lymphocyte blastogenic responses may fluctuate because of exposure to offending food allergens in dogs with food hypersensitivity. Lymphocytes reactive to food allergens may play an important role in the pathogenesis of food hypersensitivity in dogs.

  18. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  19. Functional elements in the minimal promoter of the human proton-coupled folate transporter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G., E-mail: assaraf@tx.technion.ac.il

    2009-10-09

    The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 andmore » AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.« less

  20. COUP-TF1 antagonizes Nkx2.5-mediated activation of the calreticulin gene during cardiac development.

    PubMed

    Guo, L; Lynch, J; Nakamura, K; Fliegel, L; Kasahara, H; Izumo, S; Komuro, I; Agellon, L B; Michalak, M

    2001-01-26

    Calreticulin, a Ca(2+) binding chaperone of the endoplasmic reticulum, is also highly expressed in the embryonic heart, and knockout of the calreticulin gene is lethal during embryogenesis because of impaired cardiac development. The protein is down-regulated after birth, and elevated expression of calreticulin in newborn hearts is associated with severe cardiac pathology and death. Here we show that the transcription factor Nkx2.5 activates expression of the calreticulin gene in the heart. Binding of chicken ovalbumin upstream promoter-transcription factor 1 to the Nkx2.5 binding site suppresses transcription from the calreticulin promoter. Nkx2.5 and chicken ovalbumin upstream promoter-transcription factor 1 play antagonistic roles in regulating the expression of calreticulin during cardiac development. These studies indicate that cardiac-specific transcription factor Nkx2.5 plays a central role in activating calreticulin expression and that there is a cooperation between chicken ovalbumin upstream promoter-transcription factor 1 and Nkx2.5 at the calreticulin promoter.

  1. Effectiveness of an in-office arginine-calcium carbonate paste on dentine hypersensitivity in periodontitis patients: a double-blind, randomized controlled trial.

    PubMed

    Pepelassi, Eudoxie; Rahiotis, Christos; Peponi, Eleni; Kakaboura, Afrodite; Vrotsos, Ioannis

    2015-01-01

    The aim of this single-centre, two-cell, double-blind, randomized controlled clinical study was to evaluate the effectiveness of an in-office desensitizing paste containing 8% arginine and calcium carbonate in providing relief on dentine hypersensitivity immediately after scaling and root planing and its sustained relief over a 6-week period. Fifty periodontitis subjects presenting hypersensitivity were subjected to scaling and root planing and in-office application of either 8% arginine and calcium carbonate desensitizing paste (25 subjects, test group) or fluoride-free prophylaxis paste (25 subjects, control group). Air-blast hypersensitivity was assessed using Schiff and Visual Analogue (VAS) scales at baseline, post-scaling, post-application, 2, 4 and 6 weeks. At all evaluation times, the test group presented significant % reduction in hypersensitivity relative to post-scaling (t-test, p < 0.05) (Schiff - Test: 57, 58.6, 60.2, 68; 28.6, 22.2, 23, 23) (VAS - Test: 60, 55.6, 60.1, 68.4; 25.9, 18.2, 20.6, 22.7) and significant % hypersensitivity difference relative to control (ancova, p < 0.05) (Schiff: 38.9, 45.9, 47.4, 57.7; VAS: 49.1, 48.9, 52.6, 61). The single in-office application of the 8% arginine-calcium carbonate desensitizing paste after scaling and root planing provided significant immediate reduction in dentine hypersensitivity, which sustained over a 6-week period. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Expressions of Mast Cell Tryptase and Brain Natriuretic Peptide in Myocardium of Sudden Death due to Hypersensitivity and Coronary Atherosclerotic Heart Disease.

    PubMed

    Shi, J R; Tian, C J; Zeng, Q; Guo, X J; Lu, J; Gao, C R

    2016-06-01

    To explore the value of mast cell tryptase and brain natriuretic peptide(BNP) in the differential diagnostic of sudden death due to hypersensitivity and coronary atherosclerotic heart disease. Totally 30 myocardial samples were collected from the autopsy cases in the Department of Forensic Pathology, Shanxi Medical University during 2010-2015. All samples were divided into three groups: death of craniocerebral injury group, sudden death of hypersensitivity group and sudden death of coronary atherosclerotic heart disease group, 10 cases in each group. Mast cell tryptase and BNP in myocardium were detected by immunofluorescence staining and Western Blotting. Immunofluorescence staining showed that the positive staining mast cell tryptase appeared in myocardium of sudden death of hypersensitivity group and coronary atherosclerotic heart disease group. Among the three groups, the expression of mast cell tryptase showed significantly differences through pairwise comparison ( P <0.05); The expression level of BNP in sudden death of coronary atherosclerotic heart disease group were significantly higher than the sudden death of hypersensitivity group and death of craniocerebral injury group ( P <0.05). The difference of the expression level of BNP between the sudden death of hypersensitivity group and the death of craniocerebral injury group had no statistical significance ( P >0.05). The combined detection of the mast cell tryptase and BNP in myocardium is expected to provide help for the forensic differential diagnosis of sudden death due to hypersensitivity and coronary atherosclerotic heart disease. Copyright© by the Editorial Department of Journal of Forensic Medicine

  3. Acute hypersensitivity reactions associated with administration of crotalidae polyvalent immune Fab antivenom.

    PubMed

    Cannon, Robert; Ruha, Anne-Michelle; Kashani, John

    2008-04-01

    Acute hypersensitivity reactions are well known to occur with the administration of the Antivenin (Crotalidae) Polyvalent (Wyeth Laboratories, Marietta, PA). Crotalidae polyvalent immune Fab (ovine) (CroFab; FabAV, Protherics, Inc., Brentwood, TN) was introduced in 2001, and early studies reported a hypersensitivity reaction rate up to 19%. We describe the incidence of acute hypersensitivity reactions to FabAV in patients bitten by rattlesnakes. This was a nonconcurrent observational cohort study, with data obtained by chart review of all patients admitted to our service for rattlesnake bites from July 2000 to June 2004. The study was conducted at an urban Level I trauma center and urban children's hospital. All patients treated with FabAV were included. Those who received no antivenom or who were treated with Antivenin (Crotalidae) Polyvalent were excluded. The main outcome variable was whether an acute hypersensitivity reaction developed. Ninety-three patients were included in the review (72 male and 21 female patients). The mean age was 34.5 years (range 16 months to 91 years), and the mean dose of antivenom was 12 vials (range 4 to 32 vials). The incidence of acute hypersensitivity reactions was 5 of 93, or 5.4%. Four patients developed a mild reaction that was easily treated and were able to finish the full course of antivenom. Only 1 patient developed a reaction that prevented further antivenom administration. FabAV appears to be associated with a lower incidence of acute hypersensitivity than initially reported. Most reactions are mild and easily treated and do not preclude further dosing of antivenom.

  4. Drug hypersensitivity in human immunodeficiency virus-infected patient: challenging diagnosis and management

    PubMed Central

    Widhani, Alvina; Karjadi, Teguh Harjono

    2014-01-01

    Human immunodeficiency virus (HIV)-infected patients present complex immunological alterations. Multiple drugs that usually prescribed for prevention or treatment of opportunistic infections and antiretroviral pose these patients a higher risk of developing drug hypersensitivity. All antiretroviral agents and drugs to treat opportunistic infections have been reported to cause drug hypersensitivity reactions. Allergic reactions with antiretroviral are not restricted to older agents, although newer drugs usually more tolerated. Cutaneous adverse drug reactions are the most common manifestation of drug hypersensitivity in HIV, typically manifesting as maculopapular rash with or without systemic symptoms in the presence or absence of internal organ involvement. The onset of an allergic reaction is usually delayed. Severe drug hypersensitity reactions as erythema multiforme, Stevens Johnson syndrome and toxic epidermal necrolysis develop more often in HIV-infected patients compared to other populations. Mild to moderate rash without systemic symptom or organ involvement usually do not need drug discontinuation. Appropriate diagnosis and management of drug hypersensitivity reactions are essential, especially in patients with very low CD4+ T-cell count and multiple opportunistic infections. Clinicians should aware of different half-life of each drug when decided to stop the drug. Knowledge of the metabolism, recognition of the risk factors, and the ability to suggest the probability of particular drug as causative are also important points. A step wise rechallenge test or desensitization with the offending drug might be a preferable action and more commonly used in managing drug hypersensitivity in HIV-infected patients. Desensitization protocols have been successfully done for several antiretroviral and opportunistic infection drugs. PMID:24527412

  5. Management of hypersensitivity to platinum- and taxane-based chemotherapy: cepo review and clinical recommendations

    PubMed Central

    Boulanger, J.; Boursiquot, J.N.; Cournoyer, G.; Lemieux, J.; Masse, M.S.; Almanric, K.; Guay, M.P.

    2014-01-01

    Background Although antineoplastic agents are critical in the treatment of cancer, they can potentially cause hypersensitivity reactions that can have serious consequences. When such a reaction occurs, clinicians can either continue the treatment, at the risk of causing a severe or a potentially fatal anaphylactic reaction, or stop the treatment, although it might be the only one available. The objective of the present work was to evaluate the effectiveness of methods used to prevent and treat hypersensitivity reactions to platinum- or taxane-based chemotherapy and to develop evidence-based recommendations. Methods The scientific literature published to December 2013, inclusive, was reviewed. Results Premedication with antihistamines, H2 blockers, and corticosteroids is not effective in preventing hypersensitivity reactions to platinum salts. However, premedication significantly reduces the incidence of hypersensitivity to taxanes. A skin test can generally be performed to screen for patients at risk of developing a severe reaction to platinum salts in the presence of grade 1 or 2 reactions, but skin testing does not appear to be useful for taxanes. A desensitization protocol allows for re-administration of either platinum- or taxane-based chemotherapy to some patients without causing severe hypersensitivity reactions. Conclusions Several strategies such as premedication, skin testing, and desensitization protocols are available to potentially allow for administration of platinum- or taxane-based chemotherapy to patients who have had a hypersensitivity reaction and for whom no other treatment options are available. Considering the available evidence, the Comité de l’évolution des pratiques en oncologie made recommendations for clinical practice in Quebec. PMID:25089112

  6. Level II scour analysis for Bridge 26 (ROYATH00540026) on Town Highway 54, crossing Broad Brook, Royalton, Vermont

    USGS Publications Warehouse

    Burns, Ronda L.; Weber, Matthew A.

    1997-01-01

    This report provides the results of a detailed Level II analysis of scour potential at structure ROYATH00540026 on Town Highway 54 crossing Broad Brook, Royalton, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the New England Upland section of the New England physiographic province in central Vermont. The 11.9-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover on the left bank upstream and downstream is pasture with trees and brush on the immediate banks. The right bank, upstream and downstream of the bridge, is forested. In the study area, Broad Brook has an incised, sinuous channel with a slope of approximately 0.01 ft/ft, an average channel top width of 37 ft and an average bank height of 4 ft. The channel bed material ranges from sand to boulders with a median grain size (D50) of 66.3 mm (0.218 ft). The geomorphic assessment at the time of the Level I site visit on April 13, 1995 and the Level II site visit on July 11, 1996, indicated that the reach was stable. The Town Highway 54 crossing of Broad Brook is a 29-ft-long, one-lane bridge consisting of one 24-foot steel-beam span with a timber deck (Vermont Agency of Transportation, written communication, March 23, 1995). The opening length of the structure parallel to the bridge face is 23.3 ft. The bridge is supported by a vertical, concrete face laid-up stone abutment with concrete wingwalls on the left and a laid-up stone abutment on the right. The channel is skewed approximately 20 degrees to the opening while the opening-skew-to-roadway is zero degrees. A scour hole 1.0 ft deeper than the mean thalweg depth was observed along the downstream end of the right abutment during the Level I assessment. Also, at the upstream end of the left abutment, the footing is exposed 0.5 ft. The scour protection measures at the site included type-2 stone fill (less than 36 inches diameter) along the upstream left bank, at the upstream end of the upstream left wingwall, along the entire length of the downstream left wingwall, and at the upstream end of the right abutment. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 1.4 ft. The worst-case contraction scour occurred at the incipient roadway-overtopping discharge, which was less than the 100-year discharge. Abutment scour ranged from 2.2 to 7.4 ft on the left and from 14.7 to 17.7 ft on the right. The worst-case abutment scour occurred at the incipient roadway-overtopping discharge for the left and at the 500-year discharge for the right. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

  7. Ionic mechanisms of spinal neuronal cold hypersensitivity in ciguatera.

    PubMed

    Patel, Ryan; Brice, Nicola L; Lewis, Richard J; Dickenson, Anthony H

    2015-12-01

    Cold hypersensitivity is evident in a range of neuropathies and can evoke sensations of paradoxical burning cold pain. Ciguatoxin poisoning is known to induce a pain syndrome caused by consumption of contaminated tropical fish that can persist for months and include pruritus and cold allodynia; at present no suitable treatment is available. This study examined, for the first time, the neural substrates and molecular components of Pacific ciguatoxin-2-induced cold hypersensitivity. Electrophysiological recordings of dorsal horn lamina V/VI wide dynamic range neurones were made in non-sentient rats. Subcutaneous injection of 10 nm ciguatoxin-2 into the receptive field increased neuronal responses to innocuous and noxious cooling. In addition, neuronal responses to low-threshold but not noxious punctate mechanical stimuli were also elevated. The resultant cold hypersensitivity was not reversed by 6-({2-[2-fluoro-6-(trifluoromethyl)phenoxy]-2-methylpropyl}carbamoyl)pyridine-3-carboxylic acid, an antagonist of transient receptor potential melastatin 8 (TRPM8). Both mechanical and cold hypersensitivity were completely prevented by co-injection with the Nav 1.8 antagonist A803467, whereas the transient receptor potential ankyrin 1 (TRPA1) antagonist A967079 only prevented hypersensitivity to innocuous cooling and partially prevented hypersensitivity to noxious cooling. In naive rats, neither innocuous nor noxious cold-evoked neuronal responses were inhibited by antagonists of Nav 1.8, TRPA1 or TRPM8 alone. Ciguatoxins may confer cold sensitivity to a subpopulation of cold-insensitive Nav 1.8/TRPA1-positive primary afferents, which could underlie the cold allodynia reported in ciguatera. These data expand the understanding of central spinal cold sensitivity under normal conditions and the role of these ion channels in this translational rat model of ciguatoxin-induced hypersensitivity. © 2015 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  8. Incidence of immediate hypersensitivity reaction and serum sickness following administration of Crotalidae polyvalent immune Fab antivenom: a meta-analysis.

    PubMed

    Schaeffer, Tammi H; Khatri, Vaishali; Reifler, Liza M; Lavonas, Eric J

    2012-02-01

      Crotalidae polyvalent immune Fab (ovine) (FabAV) is commonly used in the treatment of symptomatic North American crotaline snake envenomation. When approved by the U.S. Food and Drug Administration in 2000, the incidences of immediate hypersensitivity reactions and serum sickness were reported as 0.14 and 0.18, respectively. The objective of this meta-analysis was to evaluate the incidence of immediate hypersensitivity reactions and serum sickness reported in studies of patients treated with FabAV therapy after North American crotaline envenomation.   The authors searched PubMed, Ovid MEDLINE, and EMBASE from January 1, 1997, to September 20, 2010, for English-language medical literature and cross-referenced bibliographies of reviewed articles. The published abstracts of the major toxicology conferences were also searched. All prospective and retrospective cohort studies with patients receiving FabAV therapy for North American crotaline envenomations were eligible for data abstraction. Two content experts reviewed full-text articles and extracted relevant study design and outcome data. Proportions of immediate hypersensitivity and serum sickness for each study were analyzed in a random-effects model to produce an overall estimate of immediate hypersensitivity and serum sickness incidence associated with FabAV administration.   The literature search revealed 11 unique studies of patients who received FabAV that contained information on immediate hypersensitivity reactions and serum sickness. The meta-analysis produced a combined estimate of the incidence of immediate hypersensitivity of 0.08 (95% confidence interval [CI] = 0.05 to 0.11) and a combined estimate of the incidence of serum sickness of 0.13 (95% CI = 0.07 to 0.21).   In this systematic literature review and meta-analysis, the combined estimates of the incidence of immediate hypersensitivity reactions and serum sickness from FabAV in the treatment of symptomatic North American crotaline envenomations appear to be lower than previously reported, at 0.08 and 0.13, respectively. © 2012 by the Society for Academic Emergency Medicine.

  9. Effect of Prophylactic Extended-Infusion Carboplatin on Incidence of Hypersensitivity Reactions in Patients with Ovarian, Fallopian Tube, or Peritoneal Carcinomas.

    PubMed

    Pasternak, Amy L; Link, Nicholas A; Richardson, Carolyn M; Rose, Peter G

    2016-07-01

    To determine whether extended-infusion carboplatin, initiated at approximately the eighth cumulative carboplatin cycle and prior to development of carboplatin hypersensitivity, reduces the incidence of carboplatin hypersensitivity reactions in patients with ovarian, fallopian tube, or peritoneal cancer. Retrospective chart review. Large integrated health system. A total of 326 patients with ovarian, fallopian tube, or primary peritoneal cancer who received at least eight cumulative cycles of carboplatin between January 2007 and September 2014 were included. Of these, 161 patients received all doses of carboplatin infused over 30 or 60 minutes (standard-infusion group [total of 1317 carboplatin cycles]), and 165 patients received the 3-hour extended infusion of carboplatin administered at approximately the eighth cumulative cycle and prior to development of a hypersensitivity reaction (extended-infusion group [total of 1527 carboplatin cycles]). Baseline characteristics were similar between the groups, except significantly more patients in the extended-infusion group received triple premedication therapy prior to infusion (p<0.001). Hypersensitivity reactions occurred in 64 patients (40%) who received standard-infusion carboplatin and 40 patients (24.2%) who received extended-infusion carboplatin (p=0.0027). The median cycle of hypersensitivity reaction development did not differ significantly between the groups: 9 cycles in patients who received standard-infusion versus 11 cycles in patients who received extended-infusion carboplatin (p=0.06). Through regression analysis, the premedication regimen received prior to carboplatin infusion was the only variable significantly associated with hypersensitivity reactions (odds ratio 0.59, 95% confidence interval 0.36-0.97, p=0.038). Patients who received extended-infusion carboplatin experienced a lower incidence of hypersensitivity reactions than patients who received standard-infusion carboplatin, which may be attributed to the triple premedication regimen received more frequently in patients in the extended-infusion group. © 2016 Pharmacotherapy Publications, Inc.

  10. Histological features of pseudotumor-like tissues from metal-on-metal hips.

    PubMed

    Campbell, Pat; Ebramzadeh, Edward; Nelson, Scott; Takamura, Karren; De Smet, Koen; Amstutz, Harlan C

    2010-09-01

    Pseudotumor-like periprosthetic tissue reactions around metal-on-metal (M-M) hip replacements can cause pain and lead to revision surgery. The cause of these reactions is not well understood but could be due to excessive wear, or metal hypersensitivity or an as-yet unknown cause. The tissue features may help distinguish reactions to high wear from those with suspected metal hypersensitivity. We therefore examined the synovial lining integrity, inflammatory cell infiltrates, tissue organization, necrosis and metal wear particles of pseudotumor-like tissues from M-M hips revised for suspected high wear related and suspected metal hypersensitivity causes. Tissue samples from 32 revised hip replacements with pseudotumor-like reactions were studied. A 10-point histological score was used to rank the degree of aseptic lymphocytic vasculitis-associated lesions (ALVAL) by examination of synovial lining integrity, inflammatory cell infiltrates, and tissue organization. Lymphocytes, macrophages, plasma cells, giant cells, necrosis and metal wear particles were semiquantitatively rated. Implant wear was measured with a coordinate measuring machine. The cases were divided into those suspected of having high wear and those suspected of having metal hypersensitivity based on clinical, radiographic and retrieval findings. The Mann-Whitney test was used to compare the histological features in these two groups. The tissues from patients revised for suspected high wear had a lower ALVAL score, fewer lymphocytes, but more macrophages and metal particles than those tissues from hips revised for pain and suspected metal hypersensitivity. The highest ALVAL scores occurred in patients who were revised for pain and suspected metal hypersensitivity. Component wear was lower in that group. Pseudotumor-like reactions can be caused by high wear, but may also occur around implants with low wear, likely because of a metal hypersensitivity reaction. Histologic features including synovial integrity, inflammatory cell infiltrates, tissue organization, and metal particles may help differentiate these causes. Painful hips with periprosthetic masses may be caused by high wear, but if this can be ruled out, metal hypersensitivity should be considered.

  11. The Membrane Mucin Msb2 Regulates Invasive Growth and Plant Infection in Fusarium oxysporum[W

    PubMed Central

    Pérez-Nadales, Elena; Di Pietro, Antonio

    2011-01-01

    Fungal pathogenicity in plants requires a conserved mitogen-activated protein kinase (MAPK) cascade homologous to the yeast filamentous growth pathway. How this signaling cascade is activated during infection remains poorly understood. In the soil-borne vascular wilt fungus Fusarium oxysporum, the orthologous MAPK Fmk1 (Fusarium MAPK1) is essential for root penetration and pathogenicity in tomato (Solanum lycopersicum) plants. Here, we show that Msb2, a highly glycosylated transmembrane protein, is required for surface-induced phosphorylation of Fmk1 and contributes to a subset of Fmk1-regulated functions related to invasive growth and virulence. Mutants lacking Msb2 share characteristic phenotypes with the Δfmk1 mutant, including defects in cellophane invasion, penetration of the root surface, and induction of vascular wilt symptoms in tomato plants. In contrast with Δfmk1, Δmsb2 mutants were hypersensitive to cell wall targeting compounds, a phenotype that was exacerbated in a Δmsb2 Δfmk1 double mutant. These results suggest that the membrane mucin Msb2 promotes invasive growth and plant infection upstream of Fmk1 while contributing to cell integrity through a distinct pathway. PMID:21441438

  12. Rme1 is necessary for Mi-1-mediated resistance and acts early in the resistance pathway.

    PubMed

    Martinez de Ilarduya, Oscar; Nombela, Gloria; Hwang, Chin-Feng; Williamson, Valerie M; Muñiz, Mariano; Kaloshian, Isgouhi

    2004-01-01

    The tomato gene Mi-1 confers resistance to root-knot nematodes (Meloidogyne spp.), potato aphid, and whitefly. Using genetic screens, we have isolated a mutant, rme1 (resistance to Meloidogyne spp.), compromised in resistance to M. javanica and potato aphid. Here, we show that the rme1 mutant is also compromised in resistance to M. incognita, M. arenaria, and whitefly. In addition, using an Agrobacterium-mediated transient assay in leaves to express constitutive gain-of-function mutant Pto(L205D), we demonstrated that the rme1 mutation is not compromised in Pto-mediated hypersensitive response. Moreover, the mutation in rme1 does not result in increased virulence of pathogenic Pseudomonas syringae or Mi-1-virulent M. incognita. Using a chimeric Mi-1 construct, Mi-DS4, which confers constitutive cell death phenotype and A. rhizogenes root transformation, we showed that the Mi-1-mediated cell death pathway is intact in this mutant. Our results indicate that Rme1 is required for Mi-1-mediated resistance and acts either at the same step in the signal transduction pathway as Mi-1 or upstream of Mi-1.

  13. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    PubMed Central

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  14. Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

    PubMed

    DeVry, C G; Tsai, W; Clarke, S

    1996-11-15

    The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

  15. CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

    PubMed Central

    Qiao, Huan; May, James M.

    2013-01-01

    SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

  16. Examining spatial patterns in polycyclic aromatic compounds measured in stream macroinvertebrates near a small subarctic oil and gas operation.

    PubMed

    Korosi, J B; Eickmeyer, D C; Chin, K S; Palmer, M J; Kimpe, L E; Blais, J M

    2016-03-01

    The Cameron River runs through a small, remote petrochemical development in the Cameron Hills (Northwest Territories, Canada). In order to evaluate the exposure of aquatic biota to contaminants from oil and gas activities, we measured polycyclic aromatic compounds (PACs) in macroinvertebrates collected from sites and tributaries along the Cameron River, including upstream and downstream of the development, and sites located near drilled wells (developed). Macroinvertebrate tissue PAC burdens ranged from 0.2-2.8 μg g(-1) lipid for unsubstituted compounds, and from 4.2-63.2 μg g(-1) lipid for alkylated compounds, relatively low compared to similar studies from more industrialized regions in North America. There was no significant difference in tissue PAC burdens between upstream, downstream, or developed sites (p = 0.12), although alkyl PACs in five out of seven developed sites were higher than the regional average. Petrogenic PACs were dominant in most samples, including alkyl fluorines, alkyl phenanthrene/anthracenes, and alkyl dibenzothiophenes. Minimal changes in PAC composition in macroinvertebrate tissues were detected along the Cameron River, with the exception of the two sites furthest downstream that had high concentrations of C3-C4 naphthalene. Overall, our results suggest that oil and gas development in the Cameron Hills has not resulted in substantial increases in PAC bioaccumulation in stream macroinvertebrates, although the potential that alkyl naphthalenes are being transported downstream from the development warrants further attention.

  17. The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

    PubMed Central

    Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

    1997-01-01

    The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

  18. Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

    PubMed

    Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

    2009-01-01

    Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

  19. Influence of rice field agrochemicals on the ecological status of a tropical stream.

    PubMed

    Rasmussen, Jes Jessen; Reiler, Emilie Marie; Carazo, Elizabeth; Matarrita, Jessie; Muñoz, Alejandro; Cedergreen, Nina

    2016-01-15

    Many tropical countries contain a high density of protected ecosystems, and these may often be bordered by intensive agricultural systems. We investigated the chemical and ecological status of a stream connecting an area with conventional rice production and a downstream protected nature reserve; Mata Redonda. Three sites were sampled: 1) an upstream control, 2) in the rice production area and 3) a downstream site in Mata Redonda. We sampled benthic macroinvertebrates and pesticides in water and sediments along with supporting physical and chemical data. Pesticide concentrations in water exceeded current safety thresholds at sites 2 and 3, especially during the rainy season, and sediment associated pesticide concentrations exceeded current safety thresholds in three of six samples. Importantly, the highest predicted pesticide toxicity in sediments was observed at site 3 in the Mata Redonda confirming that the nature reserve received critical levels of pesticide pollution from upstream sections. The currently used macroinvertebrate index in Costa Rica (BMWP-CR) and an adjusted version of the SPecies At Risk index (SPEAR) were not significantly correlated to any measure of anthropogenic stress, but the Average Score Per Taxon (ASPT) index was significantly correlated with the predicted pesticide toxicity (sumTUD.magna), oxygen concentrations and substrate composition. Our results suggest that pesticide pollution was likely involved in the impairment of the ecological status of the sampling sites, including site 3 in Mata Redonda. Based on our results, we give guidance to biomonitoring in Costa Rica and call for increased focus on pesticide transport from agricultural regions to protected areas. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

    PubMed Central

    Mavrothalassitis, G J; Watson, D K; Papas, T S

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Top