Numerical Investigation of a Model Scramjet Combustor Using DDES

NASA Astrophysics Data System (ADS)

Shin, Junsu; Sung, Hong-Gye

2017-04-01

Non-reactive flows moving through a model scramjet were investigated using a delayed detached eddy simulation (DDES), which is a hybrid scheme combining Reynolds averaged Navier-Stokes scheme and a large eddy simulation. The three dimensional Navier-Stokes equations were solved numerically on a structural grid using finite volume methods. An in-house was developed. This code used a monotonic upstream-centered scheme for conservation laws (MUSCL) with an advection upstream splitting method by pressure weight function (AUSMPW+) for space. In addition, a 4th order Runge-Kutta scheme was used with preconditioning for time integration. The geometries and boundary conditions of a scramjet combustor operated by DLR, a German aerospace center, were considered. The profiles of the lower wall pressure and axial velocity obtained from a time-averaged solution were compared with experimental results. Also, the mixing efficiency and total pressure recovery factor were provided in order to inspect the performance of the combustor.

Upstream vertical cavity surface-emitting lasers for fault monitoring and localization in WDM passive optical networks

NASA Astrophysics Data System (ADS)

Wong, Elaine; Zhao, Xiaoxue; Chang-Hasnain, Connie J.

2008-04-01

As wavelength division multiplexed passive optical networks (WDM-PONs) are expected to be first deployed to transport high capacity services to business customers, real-time knowledge of fiber/device faults and the location of such faults will be a necessity to guarantee reliability. Nonetheless, the added benefit of implementing fault monitoring capability should only incur minimal cost associated with upgrades to the network. In this work, we propose and experimentally demonstrate a fault monitoring and localization scheme based on a highly-sensitive and potentially low-cost monitor in conjunction with vertical cavity surface-emitting lasers (VCSELs). The VCSELs are used as upstream transmitters in the WDM-PON. The proposed scheme benefits from the high reflectivity of the top distributed Bragg reflector (DBR) mirror of optical injection-locked (OIL) VCSELs to reflect monitoring channels back to the central office for monitoring. Characterization of the fault monitor demonstrates high sensitivity, low bandwidth requirements, and potentially low output power. The added advantage of the proposed fault monitoring scheme incurs only a 0.5 dB penalty on the upstream transmissions on the existing infrastructure.

ESS-FH: Enhanced Security Scheme for Fast Handover in Hierarchical Mobile IPv6

NASA Astrophysics Data System (ADS)

You, Ilsun; Lee, Jong-Hyouk; Sakurai, Kouichi; Hori, Yoshiaki

Fast Handover for Hierarchical Mobile IPv6 (F-HMIPv6) that combines advantages of Fast Handover for Mobile IPv6 (FMIPv6) and Hierarchical Mobile IPv6 (HMIPv6) achieves the superior performance in terms of handover latency and signaling overhead compared with previously developed mobility protocols. However, without being secured, F-HMIPv6 is vulnerable to various security threats. In 2007, Kang and Park proposed a security scheme, which is seamlessly integrated into F-HMIPv6. In this paper, we reveal that Kang-Park's scheme cannot defend against the Denial of Service (DoS) and redirect attacks while largely relying on the group key. Then, we propose an Enhanced Security Scheme for F-HMIPv6 (ESS-FH) that achieves the strong key exchange and the key independence as well as addresses the weaknesses of Kang-Park's scheme. More importantly, it enables fast handover between different MAP domains. The proposed scheme is formally verified based on BAN-logic, and its handover latency is analyzed and compared with that of Kang-Park's scheme.

Cost-effective handoff scheme based on mobility-aware dual pointer forwarding in proxy mobile IPv6 networks.

PubMed

Son, Seungsik; Jeong, Jongpil

2014-01-01

In this paper, a mobility-aware Dual Pointer Forwarding scheme (mDPF) is applied in Proxy Mobile IPv6 (PMIPv6) networks. The movement of a Mobile Node (MN) is classified as intra-domain and inter-domain handoff. When the MN moves, this scheme can reduce the high signaling overhead for intra-handoff/inter-handoff, because the Local Mobility Anchor (LMA) and Mobile Access Gateway (MAG) are connected by pointer chains. In other words, a handoff is aware of low mobility between the previously attached MAG (pMAG) and newly attached MAG (nMAG), and another handoff between the previously attached LMA (pLMA) and newly attached LMA (nLMA) is aware of high mobility. Based on these mobility-aware binding updates, the overhead of the packet delivery can be reduced. Also, we analyse the binding update cost and packet delivery cost for route optimization, based on the mathematical analytic model. Analytical results show that our mDPF outperforms the PMIPv6 and the other pointer forwarding schemes, in terms of reducing the total cost of signaling.

Nutrient, suspended sediment, and trace element loads in the Blackstone River Basin in Massachusetts and Rhode Island, 2007 to 2009

USGS Publications Warehouse

Zimmerman, Marc J.; Waldron, Marcus C.; DeSimone, Leslie A.

2015-01-01

Analysis of the representative constituents (total phosphorus, total chromium, and suspended sediment) upstream and downstream of impoundments indicated that the existing impoundments, such as Rice City Pond, can be sources of particulate contaminant loads in the Blackstone River. Loads of particulate phosphorus, particulate chromium, and suspended sediment were consistently higher downstream from Rice City Pond than upstream during high-flow events, and there was a positive, linear relation between streamflow and changes in these constituents from upstream to downstream of the impoundment. Thus, particulate contaminants were mobilized from Rice City Pond during high-flow events and transported downstream. In contrast, downstream loads of particulate phosphorus, particulate chromium, and suspended sediment were generally lower than or equal to upstream loads for the former Rockdale Pond impoundment. Sediments associated with the former impoundment at Rockdale Pond, breached in the late 1960s, did not appear to be mobilized during the high-flow events monitored during this study.

Security analysis and enhanced user authentication in proxy mobile IPv6 networks.

PubMed

Kang, Dongwoo; Jung, Jaewook; Lee, Donghoon; Kim, Hyoungshick; Won, Dongho

2017-01-01

The Proxy Mobile IPv6 (PMIPv6) is a network-based mobility management protocol that allows a Mobile Node(MN) connected to the PMIPv6 domain to move from one network to another without changing the assigned IPv6 address. The user authentication procedure in this protocol is not standardized, but many smartcard based authentication schemes have been proposed. Recently, Alizadeh et al. proposed an authentication scheme for the PMIPv6. However, it could allow an attacker to derive an encryption key that must be securely shared between MN and the Mobile Access Gate(MAG). As a result, outsider adversary can derive MN's identity, password and session key. In this paper, we analyze Alizadeh et al.'s scheme regarding security and propose an enhanced authentication scheme that uses a dynamic identity to satisfy anonymity. Furthermore, we use BAN logic to show that our scheme can successfully generate and communicate with the inter-entity session key.

Unified Approach To Control Of Motions Of Mobile Robots

NASA Technical Reports Server (NTRS)

Seraji, Homayoun

1995-01-01

Improved computationally efficient scheme developed for on-line coordinated control of both manipulation and mobility of robots that include manipulator arms mounted on mobile bases. Present scheme similar to one described in "Coordinated Control of Mobile Robotic Manipulators" (NPO-19109). Both schemes based on configuration-control formalism. Present one incorporates explicit distinction between holonomic and nonholonomic constraints. Several other prior articles in NASA Tech Briefs discussed aspects of configuration-control formalism. These include "Increasing the Dexterity of Redundant Robots" (NPO-17801), "Redundant Robot Can Avoid Obstacles" (NPO-17852), "Configuration-Control Scheme Copes with Singularities" (NPO-18556), "More Uses for Configuration Control of Robots" (NPO-18607/NPO-18608).

Mobility as a Continuum: European Commission Mobility Policies for Schools and Higher Education

ERIC Educational Resources Information Center

Dvir, Yuval; Yemini, Miri

2017-01-01

This study explores the rationale and aims of European Commission (EC) mobility programmes for schools and higher education systems, namely the Comenius and the European Action Scheme for the Mobility of University Students (ERASMUS) funding schemes. Our findings indicate that the aims, rationales and means of mobility programmes for the school…

Power and spectrally efficient M-ARY QAM schemes for future mobile satellite communications

NASA Technical Reports Server (NTRS)

Sreenath, K.; Feher, K.

1990-01-01

An effective method to compensate nonlinear phase distortion caused by the mobile amplifier is proposed. As a first step towards the future use of spectrally efficient modulation schemes for mobile satellite applications, we have investigated effects of nonlinearities and the phase compensation method on 16-QAM. The new method provides about 2 dB savings in power for 16-QAM operation with cost effective amplifiers near saturation and thereby promising use of spectrally efficient linear modulation schemes for future mobile satellite applications.

A three-dimensional multiphase flow model for assesing NAPL contamination in porous and fractured media, 1. Formulation

NASA Astrophysics Data System (ADS)

Huyakorn, P. S.; Panday, S.; Wu, Y. S.

1994-06-01

A three-dimensional, three-phase numerical model is presented for stimulating the movement on non-aqueous-phase liquids (NAPL's) through porous and fractured media. The model is designed for practical application to a wide variety of contamination and remediation scenarios involving light or dense NAPL's in heterogeneous subsurface systems. The model formulation is first derived for three-phase flow of water, NAPL and air (or vapor) in porous media. The formulation is then extended to handle fractured systems using the dual-porosity and discrete-fracture modeling approaches The model accommodates a wide variety of boundary conditions, including withdrawal and injection well conditions which are treated rigorously using fully implicit schemes. The three-phase of formulation collapses to its simpler forms when air-phase dynamics are neglected, capillary effects are neglected, or two-phase-air-liquid, liquid-liquid systems with one or two active phases are considered. A Galerkin procedure with upstream weighting of fluid mobilities, storage matrix lumping, and fully implicit treatment of nonlinear coefficients and well conditions is used. A variety of nodal connectivity schemes leading to finite-difference, finite-element and hybrid spatial approximations in three dimensions are incorporated in the formulation. Selection of primary variables and evaluation of the terms of the Jacobian matrix for the Newton-Raphson linearized equations is discussed. The various nodal lattice options, and their significance to the computational time and memory requirements with regards to the block-Orthomin solution scheme are noted. Aggressive time-stepping schemes and under-relaxation formulas implemented in the code further alleviate the computational burden.

Cryptanalysis and Improvement of "A Secure Password Authentication Mechanism for Seamless Handover in Proxy Mobile IPv6 Networks".

PubMed

Alizadeh, Mojtaba; Zamani, Mazdak; Baharun, Sabariah; Abdul Manaf, Azizah; Sakurai, Kouichi; Anada, Hiroaki; Anada, Hiroki; Keshavarz, Hassan; Ashraf Chaudhry, Shehzad; Khurram Khan, Muhammad

2015-01-01

Proxy Mobile IPv6 is a network-based localized mobility management protocol that supports mobility without mobile nodes' participation in mobility signaling. The details of user authentication procedure are not specified in this standard, hence, many authentication schemes have been proposed for this standard. In 2013, Chuang et al., proposed an authentication method for PMIPv6, called SPAM. However, Chuang et al.'s Scheme protects the network against some security attacks, but it is still vulnerable to impersonation and password guessing attacks. In addition, we discuss other security drawbacks such as lack of revocation procedure in case of loss or stolen device, and anonymity issues of the Chuang et al.'s scheme. We further propose an enhanced authentication method to mitigate the security issues of SPAM method and evaluate our scheme using BAN logic.

Cryptanalysis and Improvement of "A Secure Password Authentication Mechanism for Seamless Handover in Proxy Mobile IPv6 Networks"

PubMed Central

Alizadeh, Mojtaba; Zamani, Mazdak; Baharun, Sabariah; Abdul Manaf, Azizah; Sakurai, Kouichi; Anada, Hiroki; Keshavarz, Hassan; Ashraf Chaudhry, Shehzad; Khurram Khan, Muhammad

2015-01-01

Proxy Mobile IPv6 is a network-based localized mobility management protocol that supports mobility without mobile nodes’ participation in mobility signaling. The details of user authentication procedure are not specified in this standard, hence, many authentication schemes have been proposed for this standard. In 2013, Chuang et al., proposed an authentication method for PMIPv6, called SPAM. However, Chuang et al.’s Scheme protects the network against some security attacks, but it is still vulnerable to impersonation and password guessing attacks. In addition, we discuss other security drawbacks such as lack of revocation procedure in case of loss or stolen device, and anonymity issues of the Chuang et al.’s scheme. We further propose an enhanced authentication method to mitigate the security issues of SPAM method and evaluate our scheme using BAN logic. PMID:26580963

Privacy-Preserving Location-Based Service Scheme for Mobile Sensing Data.

PubMed

Xie, Qingqing; Wang, Liangmin

2016-11-25

With the wide use of mobile sensing application, more and more location-embedded data are collected and stored in mobile clouds, such as iCloud, Samsung cloud, etc. Using these data, the cloud service provider (CSP) can provide location-based service (LBS) for users. However, the mobile cloud is untrustworthy. The privacy concerns force the sensitive locations to be stored on the mobile cloud in an encrypted form. However, this brings a great challenge to utilize these data to provide efficient LBS. To solve this problem, we propose a privacy-preserving LBS scheme for mobile sensing data, based on the RSA (for Rivest, Shamir and Adleman) algorithm and ciphertext policy attribute-based encryption (CP-ABE) scheme. The mobile cloud can perform location distance computing and comparison efficiently for authorized users, without location privacy leakage. In the end, theoretical security analysis and experimental evaluation demonstrate that our scheme is secure against the chosen plaintext attack (CPA) and efficient enough for practical applications in terms of user side computation overhead.

Privacy-Preserving Location-Based Service Scheme for Mobile Sensing Data †

PubMed Central

Xie, Qingqing; Wang, Liangmin

2016-01-01

With the wide use of mobile sensing application, more and more location-embedded data are collected and stored in mobile clouds, such as iCloud, Samsung cloud, etc. Using these data, the cloud service provider (CSP) can provide location-based service (LBS) for users. However, the mobile cloud is untrustworthy. The privacy concerns force the sensitive locations to be stored on the mobile cloud in an encrypted form. However, this brings a great challenge to utilize these data to provide efficient LBS. To solve this problem, we propose a privacy-preserving LBS scheme for mobile sensing data, based on the RSA (for Rivest, Shamir and Adleman) algorithm and ciphertext policy attribute-based encryption (CP-ABE) scheme. The mobile cloud can perform location distance computing and comparison efficiently for authorized users, without location privacy leakage. In the end, theoretical security analysis and experimental evaluation demonstrate that our scheme is secure against the chosen plaintext attack (CPA) and efficient enough for practical applications in terms of user side computation overhead. PMID:27897984

Agent Based Fault Tolerance for the Mobile Environment

NASA Astrophysics Data System (ADS)

Park, Taesoon

This paper presents a fault-tolerance scheme based on mobile agents for the reliable mobile computing systems. Mobility of the agent is suitable to trace the mobile hosts and the intelligence of the agent makes it efficient to support the fault tolerance services. This paper presents two approaches to implement the mobile agent based fault tolerant service and their performances are evaluated and compared with other fault-tolerant schemes.

Spatial-Temporal Data Collection with Compressive Sensing in Mobile Sensor Networks

PubMed Central

Li, Jiayin; Guo, Wenzhong; Chen, Zhonghui; Xiong, Neal

2017-01-01

Compressive sensing (CS) provides an energy-efficient paradigm for data gathering in wireless sensor networks (WSNs). However, the existing work on spatial-temporal data gathering using compressive sensing only considers either multi-hop relaying based or multiple random walks based approaches. In this paper, we exploit the mobility pattern for spatial-temporal data collection and propose a novel mobile data gathering scheme by employing the Metropolis-Hastings algorithm with delayed acceptance, an improved random walk algorithm for a mobile collector to collect data from a sensing field. The proposed scheme exploits Kronecker compressive sensing (KCS) for spatial-temporal correlation of sensory data by allowing the mobile collector to gather temporal compressive measurements from a small subset of randomly selected nodes along a random routing path. More importantly, from the theoretical perspective we prove that the equivalent sensing matrix constructed from the proposed scheme for spatial-temporal compressible signal can satisfy the property of KCS models. The simulation results demonstrate that the proposed scheme can not only significantly reduce communication cost but also improve recovery accuracy for mobile data gathering compared to the other existing schemes. In particular, we also show that the proposed scheme is robust in unreliable wireless environment under various packet losses. All this indicates that the proposed scheme can be an efficient alternative for data gathering application in WSNs. PMID:29117152

Spatial-Temporal Data Collection with Compressive Sensing in Mobile Sensor Networks.

PubMed

Zheng, Haifeng; Li, Jiayin; Feng, Xinxin; Guo, Wenzhong; Chen, Zhonghui; Xiong, Neal

2017-11-08

Compressive sensing (CS) provides an energy-efficient paradigm for data gathering in wireless sensor networks (WSNs). However, the existing work on spatial-temporal data gathering using compressive sensing only considers either multi-hop relaying based or multiple random walks based approaches. In this paper, we exploit the mobility pattern for spatial-temporal data collection and propose a novel mobile data gathering scheme by employing the Metropolis-Hastings algorithm with delayed acceptance, an improved random walk algorithm for a mobile collector to collect data from a sensing field. The proposed scheme exploits Kronecker compressive sensing (KCS) for spatial-temporal correlation of sensory data by allowing the mobile collector to gather temporal compressive measurements from a small subset of randomly selected nodes along a random routing path. More importantly, from the theoretical perspective we prove that the equivalent sensing matrix constructed from the proposed scheme for spatial-temporal compressible signal can satisfy the property of KCS models. The simulation results demonstrate that the proposed scheme can not only significantly reduce communication cost but also improve recovery accuracy for mobile data gathering compared to the other existing schemes. In particular, we also show that the proposed scheme is robust in unreliable wireless environment under various packet losses. All this indicates that the proposed scheme can be an efficient alternative for data gathering application in WSNs .

Adaptive Detection and ISI Mitigation for Mobile Molecular Communication.

PubMed

Chang, Ge; Lin, Lin; Yan, Hao

2018-03-01

Current studies on modulation and detection schemes in molecular communication mainly focus on the scenarios with static transmitters and receivers. However, mobile molecular communication is needed in many envisioned applications, such as target tracking and drug delivery. Until now, investigations about mobile molecular communication have been limited. In this paper, a static transmitter and a mobile bacterium-based receiver performing random walk are considered. In this mobile scenario, the channel impulse response changes due to the dynamic change of the distance between the transmitter and the receiver. Detection schemes based on fixed distance fail in signal detection in such a scenario. Furthermore, the intersymbol interference (ISI) effect becomes more complex due to the dynamic character of the signal which makes the estimation and mitigation of the ISI even more difficult. In this paper, an adaptive ISI mitigation method and two adaptive detection schemes are proposed for this mobile scenario. In the proposed scheme, adaptive ISI mitigation, estimation of dynamic distance, and the corresponding impulse response reconstruction are performed in each symbol interval. Based on the dynamic channel impulse response in each interval, two adaptive detection schemes, concentration-based adaptive threshold detection and peak-time-based adaptive detection, are proposed for signal detection. Simulations demonstrate that the ISI effect is significantly reduced and the adaptive detection schemes are reliable and robust for mobile molecular communication.

Security analysis and enhanced user authentication in proxy mobile IPv6 networks

PubMed Central

Kang, Dongwoo; Jung, Jaewook; Lee, Donghoon; Kim, Hyoungshick

2017-01-01

The Proxy Mobile IPv6 (PMIPv6) is a network-based mobility management protocol that allows a Mobile Node(MN) connected to the PMIPv6 domain to move from one network to another without changing the assigned IPv6 address. The user authentication procedure in this protocol is not standardized, but many smartcard based authentication schemes have been proposed. Recently, Alizadeh et al. proposed an authentication scheme for the PMIPv6. However, it could allow an attacker to derive an encryption key that must be securely shared between MN and the Mobile Access Gate(MAG). As a result, outsider adversary can derive MN’s identity, password and session key. In this paper, we analyze Alizadeh et al.’s scheme regarding security and propose an enhanced authentication scheme that uses a dynamic identity to satisfy anonymity. Furthermore, we use BAN logic to show that our scheme can successfully generate and communicate with the inter-entity session key. PMID:28719621

A New Hybrid Scheme for Preventing Channel Interference and Collision in Mobile Networks

NASA Astrophysics Data System (ADS)

Kim, Kyungjun; Han, Kijun

This paper proposes a new hybrid scheme based on a given set of channels for preventing channel interference and collision in mobile networks. The proposed scheme is designed for improving system performance, focusing on enhancement of performance related to path breakage and channel interference. The objective of this scheme is to improve the performance of inter-node communication. Simulation results from this paper show that the new hybrid scheme can reduce a more control message overhead than a conventional random scheme.

A group communication approach for mobile computing mobile channel: An ISIS tool for mobile services

NASA Astrophysics Data System (ADS)

Cho, Kenjiro; Birman, Kenneth P.

1994-05-01

This paper examines group communication as an infrastructure to support mobility of users, and presents a simple scheme to support user mobility by means of switching a control point between replicated servers. We describe the design and implementation of a set of tools, called Mobile Channel, for use with the ISIS system. Mobile Channel is based on a combination of the two replication schemes: the primary-backup approach and the state machine approach. Mobile Channel implements a reliable one-to-many FIFO channel, in which a mobile client sees a single reliable server; servers, acting as a state machine, see multicast messages from clients. Migrations of mobile clients are handled as an intentional primary switch, and hand-offs or server failures are completely masked to mobile clients. To achieve high performance, servers are replicated at a sliding-window level. Our scheme provides a simple abstraction of migration, eliminates complicated hand-off protocols, provides fault-tolerance and is implemented within the existing group communication mechanism.

LoWMob: Intra-PAN Mobility Support Schemes for 6LoWPAN

PubMed Central

Bag, Gargi; Raza, Muhammad Taqi; Kim, Ki-Hyung; Yoo, Seung-Wha

2009-01-01

Mobility in 6LoWPAN (IPv6 over Low Power Personal Area Networks) is being utilized in realizing many applications where sensor nodes, while moving, sense and transmit the gathered data to a monitoring server. By employing IEEE802.15.4 as a baseline for the link layer technology, 6LoWPAN implies low data rate and low power consumption with periodic sleep and wakeups for sensor nodes, without requiring them to incorporate complex hardware. Also enabling sensor nodes with IPv6 ensures that the sensor data can be accessed anytime and anywhere from the world. Several existing mobility-related schemes like HMIPv6, MIPv6, HAWAII, and Cellular IP require active participation of mobile nodes in the mobility signaling, thus leading to the mobility-related changes in the protocol stack of mobile nodes. In this paper, we present LoWMob, which is a network-based mobility scheme for mobile 6LoWPAN nodes in which the mobility of 6LoWPAN nodes is handled at the network-side. LoWMob ensures multi-hop communication between gateways and mobile nodes with the help of the static nodes within a 6LoWPAN. In order to reduce the signaling overhead of static nodes for supporting mobile nodes, LoWMob proposes a mobility support packet format at the adaptation layer of 6LoWPAN. Also we present a distributed version of LoWMob, named as DLoWMob (or Distributed LoWMob), which employs Mobility Support Points (MSPs) to distribute the traffic concentration at the gateways and to optimize the multi-hop routing path between source and destination nodes in a 6LoWPAN. Moreover, we have also discussed the security considerations for our proposed mobility schemes. The performance of our proposed schemes is evaluated in terms of mobility signaling costs, end-to-end delay, and packet success ratio. PMID:22346730

LoWMob: Intra-PAN Mobility Support Schemes for 6LoWPAN.

PubMed

Bag, Gargi; Raza, Muhammad Taqi; Kim, Ki-Hyung; Yoo, Seung-Wha

2009-01-01

Mobility in 6LoWPAN (IPv6 over Low Power Personal Area Networks) is being utilized in realizing many applications where sensor nodes, while moving, sense and transmit the gathered data to a monitoring server. By employing IEEE802.15.4 as a baseline for the link layer technology, 6LoWPAN implies low data rate and low power consumption with periodic sleep and wakeups for sensor nodes, without requiring them to incorporate complex hardware. Also enabling sensor nodes with IPv6 ensures that the sensor data can be accessed anytime and anywhere from the world. Several existing mobility-related schemes like HMIPv6, MIPv6, HAWAII, and Cellular IP require active participation of mobile nodes in the mobility signaling, thus leading to the mobility-related changes in the protocol stack of mobile nodes. In this paper, we present LoWMob, which is a network-based mobility scheme for mobile 6LoWPAN nodes in which the mobility of 6LoWPAN nodes is handled at the network-side. LoWMob ensures multi-hop communication between gateways and mobile nodes with the help of the static nodes within a 6LoWPAN. In order to reduce the signaling overhead of static nodes for supporting mobile nodes, LoWMob proposes a mobility support packet format at the adaptation layer of 6LoWPAN. Also we present a distributed version of LoWMob, named as DLoWMob (or Distributed LoWMob), which employs Mobility Support Points (MSPs) to distribute the traffic concentration at the gateways and to optimize the multi-hop routing path between source and destination nodes in a 6LoWPAN. Moreover, we have also discussed the security considerations for our proposed mobility schemes. The performance of our proposed schemes is evaluated in terms of mobility signaling costs, end-to-end delay, and packet success ratio.

Enhanced Security and Pairing-free Handover Authentication Scheme for Mobile Wireless Networks

NASA Astrophysics Data System (ADS)

Chen, Rui; Shu, Guangqiang; Chen, Peng; Zhang, Lijun

2017-10-01

With the widely deployment of mobile wireless networks, we aim to propose a secure and seamless handover authentication scheme that allows users to roam freely in wireless networks without worrying about security and privacy issues. Given the open characteristic of wireless networks, safety and efficiency should be considered seriously. Several previous protocols are designed based on a bilinear pairing mapping, which is time-consuming and inefficient work, as well as unsuitable for practical situations. To address these issues, we designed a new pairing-free handover authentication scheme for mobile wireless networks. This scheme is an effective improvement of the protocol by Xu et al., which is suffer from the mobile node impersonation attack. Security analysis and simulation experiment indicate that the proposed protocol has many excellent security properties when compared with other recent similar handover schemes, such as mutual authentication and resistance to known network threats, as well as requiring lower computation and communication cost.

Prediction of Geomagnetic Activity and Key Parameters in High-latitude Ionosphere

NASA Technical Reports Server (NTRS)

Khazanov, George V.; Lyatsky, Wladislaw; Tan, Arjun; Ridley, Aaron

2007-01-01

Prediction of geomagnetic activity and related events in the Earth's magnetosphere and ionosphere are important tasks of US Space Weather Program. Prediction reliability is dependent on the prediction method, and elements included in the prediction scheme. Two of the main elements of such prediction scheme are: an appropriate geomagnetic activity index, and an appropriate coupling function (the combination of solar wind parameters providing the best correlation between upstream solar wind data and geomagnetic activity). We have developed a new index of geomagnetic activity, the Polar Magnetic (PM) index and an improved version of solar wind coupling function. PM index is similar to the existing polar cap PC index but it shows much better correlation with upstream solar wind/IMF data and other events in the magnetosphere and ionosphere. We investigate the correlation of PM index with upstream solar wind/IMF data for 10 years (1995-2004) that include both low and high solar activity. We also have introduced a new prediction function for the predicting of cross-polar-cap voltage and Joule heating based on using both PM index and upstream solar wind/IMF data. As we show such prediction function significantly increase the reliability of prediction of these important parameters. The correlation coefficients between the actual and predicted values of these parameters are approx. 0.9 and higher.

An Effective Collaborative Mobile Weighted Clustering Schemes for Energy Balancing in Wireless Sensor Networks.

PubMed

Tang, Chengpei; Shokla, Sanesy Kumcr; Modhawar, George; Wang, Qiang

2016-02-19

Collaborative strategies for mobile sensor nodes ensure the efficiency and the robustness of data processing, while limiting the required communication bandwidth. In order to solve the problem of pipeline inspection and oil leakage monitoring, a collaborative weighted mobile sensing scheme is proposed. By adopting a weighted mobile sensing scheme, the adaptive collaborative clustering protocol can realize an even distribution of energy load among the mobile sensor nodes in each round, and make the best use of battery energy. A detailed theoretical analysis and experimental results revealed that the proposed protocol is an energy efficient collaborative strategy such that the sensor nodes can communicate with a fusion center and produce high power gain.

Supporting Seamless Mobility for P2P Live Streaming

PubMed Central

Kim, Eunsam; Kim, Sangjin; Lee, Choonhwa

2014-01-01

With advent of various mobile devices with powerful networking and computing capabilities, the users' demand to enjoy live video streaming services such as IPTV with mobile devices has been increasing rapidly. However, it is challenging to get over the degradation of service quality due to data loss caused by the handover. Although many handover schemes were proposed at protocol layers below the application layer, they inherently suffer from data loss while the network is being disconnected during the handover. We therefore propose an efficient application-layer handover scheme to support seamless mobility for P2P live streaming. By simulation experiments, we show that the P2P live streaming system with our proposed handover scheme can improve the playback continuity significantly compared to that without our scheme. PMID:24977171

LMIP/AAA: Local Authentication, Authorization and Accounting (AAA) Protocol for Mobile IP

NASA Astrophysics Data System (ADS)

Chenait, Manel

Mobile IP represents a simple and scalable global mobility solution. However, it inhibits various vulnerabilities to malicious attacks and, therefore, requires the integration of appropriate security services. In this paper, we discuss two authentication schemes suggested for Mobile IP: standard authentication and Mobile IP/AAA authentication. In order to provide Mobile IP roaming services including identity verication, we propose an improvement to Mobile/AAA authentication scheme by applying a local politic key management in each domain, hence we reduce hando latency by avoiding the involvement of AAA infrastructure during mobile node roaming.

Security Analysis and Improvement of an Anonymous Authentication Scheme for Roaming Services

PubMed Central

Lee, Youngsook; Paik, Juryon

2014-01-01

An anonymous authentication scheme for roaming services in global mobility networks allows a mobile user visiting a foreign network to achieve mutual authentication and session key establishment with the foreign-network operator in an anonymous manner. In this work, we revisit He et al.'s anonymous authentication scheme for roaming services and present previously unpublished security weaknesses in the scheme: (1) it fails to provide user anonymity against any third party as well as the foreign agent, (2) it cannot protect the passwords of mobile users due to its vulnerability to an offline dictionary attack, and (3) it does not achieve session-key security against a man-in-the-middle attack. We also show how the security weaknesses of He et al.'s scheme can be addressed without degrading the efficiency of the scheme. PMID:25302330

Security analysis and improvement of an anonymous authentication scheme for roaming services.

PubMed

Lee, Youngsook; Paik, Juryon

2014-01-01

An anonymous authentication scheme for roaming services in global mobility networks allows a mobile user visiting a foreign network to achieve mutual authentication and session key establishment with the foreign-network operator in an anonymous manner. In this work, we revisit He et al.'s anonymous authentication scheme for roaming services and present previously unpublished security weaknesses in the scheme: (1) it fails to provide user anonymity against any third party as well as the foreign agent, (2) it cannot protect the passwords of mobile users due to its vulnerability to an offline dictionary attack, and (3) it does not achieve session-key security against a man-in-the-middle attack. We also show how the security weaknesses of He et al.'s scheme can be addressed without degrading the efficiency of the scheme.

An explicit mixed numerical method for mesoscale model

NASA Technical Reports Server (NTRS)

Hsu, H.-M.

1981-01-01

A mixed numerical method has been developed for mesoscale models. The technique consists of a forward difference scheme for time tendency terms, an upstream scheme for advective terms, and a central scheme for the other terms in a physical system. It is shown that the mixed method is conditionally stable and highly accurate for approximating the system of either shallow-water equations in one dimension or primitive equations in three dimensions. Since the technique is explicit and two time level, it conserves computer and programming resources.

An Effective Collaborative Mobile Weighted Clustering Schemes for Energy Balancing in Wireless Sensor Networks

PubMed Central

Tang, Chengpei; Shokla, Sanesy Kumcr; Modhawar, George; Wang, Qiang

2016-01-01

Collaborative strategies for mobile sensor nodes ensure the efficiency and the robustness of data processing, while limiting the required communication bandwidth. In order to solve the problem of pipeline inspection and oil leakage monitoring, a collaborative weighted mobile sensing scheme is proposed. By adopting a weighted mobile sensing scheme, the adaptive collaborative clustering protocol can realize an even distribution of energy load among the mobile sensor nodes in each round, and make the best use of battery energy. A detailed theoretical analysis and experimental results revealed that the proposed protocol is an energy efficient collaborative strategy such that the sensor nodes can communicate with a fusion center and produce high power gain. PMID:26907285

Advanced mobility handover for mobile IPv6 based wireless networks.

PubMed

Safa Sadiq, Ali; Fisal, Norsheila Binti; Ghafoor, Kayhan Zrar; Lloret, Jaime

2014-01-01

We propose an Advanced Mobility Handover scheme (AMH) in this paper for seamless mobility in MIPv6-based wireless networks. In the proposed scheme, the mobile node utilizes a unique home IPv6 address developed to maintain communication with other corresponding nodes without a care-of-address during the roaming process. The IPv6 address for each MN during the first round of AMH process is uniquely identified by HA using the developed MN-ID field as a global permanent, which is identifying uniquely the IPv6 address of MN. Moreover, a temporary MN-ID is generated by access point each time an MN is associated with a particular AP and temporarily saved in a developed table inside the AP. When employing the AMH scheme, the handover process in the network layer is performed prior to its default time. That is, the mobility handover process in the network layer is tackled by a trigger developed AMH message to the next access point. Thus, a mobile node keeps communicating with the current access point while the network layer handover is executed by the next access point. The mathematical analyses and simulation results show that the proposed scheme performs better as compared with the existing approaches.

Applications of 1.55 μm optically injection-locked VCSELs in wavelength division multiplexed passive optical networks

NASA Astrophysics Data System (ADS)

Wong, Elaine; Zhao, Xiaoxue; Chang-Hasnain, Connie J.; Hofmann, Werner; Amann, Marcus C.

2007-11-01

In this paper, we will discuss the utilization of optically injection-locked (OIL) 1.55 μm vertical-cavity surface-emitting lasers (VCSELs) for operation as low-cost, stable, directly modulated, and potentially uncooled transmitters, whereby the injection-locking master source is furnished by modulated downstream signals. Such a transmitter will find useful application in wavelength division multiplexed passive optical networks (WDM-PONs) which is actively being developed to meet the ever-increasing bandwidth demands of end users. Our scheme eliminates the need for external injection locking optical sources, external modulators, and wavelength stabilization circuitry. We show through experiments that the injection-locked VCSEL favors low injection powers and responds only strongly to the carrier but not the modulated data of the downstream signal. Further, we will discuss results from experimental studies performed on the dependence of OIL-VCSELs in bidirectional networks on the degree of Rayleigh backscattered signal and extinction ratio. We show that error-free upstream performance can be achieved when the upstream signal to Rayleigh backscattering ratio is greater than 13.4 dB, and with minimal dependence on the downstream extinction ratio. We will also review a fault monitoring and localization scheme based on a highly-sensitive yet low-cost monitor comprising a low output power broadband source and low bandwidth detectors. The proposed scheme benefits from the high reflectivity top distributed Bragg reflector mirror of the OIL-VCSEL, incurring only a minimal penalty on the upstream transmissions of the existing infrastructure. Such a scheme provides fault monitoring without having to further invest in the upgrade of customer premises.

Security enhancement of a biometric based authentication scheme for telecare medicine information systems with nonce.

PubMed

Mishra, Dheerendra; Mukhopadhyay, Sourav; Kumari, Saru; Khan, Muhammad Khurram; Chaturvedi, Ankita

2014-05-01

Telecare medicine information systems (TMIS) present the platform to deliver clinical service door to door. The technological advances in mobile computing are enhancing the quality of healthcare and a user can access these services using its mobile device. However, user and Telecare system communicate via public channels in these online services which increase the security risk. Therefore, it is required to ensure that only authorized user is accessing the system and user is interacting with the correct system. The mutual authentication provides the way to achieve this. Although existing schemes are either vulnerable to attacks or they have higher computational cost while an scalable authentication scheme for mobile devices should be secure and efficient. Recently, Awasthi and Srivastava presented a biometric based authentication scheme for TMIS with nonce. Their scheme only requires the computation of the hash and XOR functions.pagebreak Thus, this scheme fits for TMIS. However, we observe that Awasthi and Srivastava's scheme does not achieve efficient password change phase. Moreover, their scheme does not resist off-line password guessing attack. Further, we propose an improvement of Awasthi and Srivastava's scheme with the aim to remove the drawbacks of their scheme.

Improved passive optical network architectures to support local area network emulation and protection

NASA Astrophysics Data System (ADS)

Wong, Elaine; Nadarajah, Nishaanthan; Chae, Chang-Joon; Nirmalathas, Ampalavanapillai; Attygalle, Sanjeewa M.

2006-01-01

We describe two optical layer schemes which simultaneously facilitate local area network emulation and automatic protection switching against distribution fiber breaks in passive optical networks. One scheme employs a narrowband fiber Bragg grating placed close to the star coupler in the feeder fiber of the passive optical network, while the other uses an additional short length distribution fiber from the star coupler to each customer for the redirection of the customer traffic. Both schemes use RF subcarrier multiplexed transmission for intercommunication between customers in conjunction with upstream access to the central office at baseband. Failure detection and automatic protection switching are performed independently by each optical network unit that is located at the customer premises in a distributed manner. The restoration of traffic transported between the central office and an optical network unit in the event of the distribution fiber break is performed by interconnecting adjacent optical network units and carrying out signal transmissions via an independent but interconnected optical network unit. Such a protection mechanism enables multiple adjacent optical network units to be simultaneously protected by a single optical network unit utilizing its maximum available bandwidth. We experimentally verify the feasibility of both schemes with 1.25 Gb/s upstream baseband transmission to the central office and 155 Mb/s local area network data transmission on a RF subcarrier frequency. The experimental results obtained from both schemes are compared, and the power budgets are calculated to analyze the scalability of each scheme.

Adaptive multi-node multiple input and multiple output (MIMO) transmission for mobile wireless multimedia sensor networks.

PubMed

Cho, Sunghyun; Choi, Ji-Woong; You, Cheolwoo

2013-10-02

Mobile wireless multimedia sensor networks (WMSNs), which consist of mobile sink or sensor nodes and use rich sensing information, require much faster and more reliable wireless links than static wireless sensor networks (WSNs). This paper proposes an adaptive multi-node (MN) multiple input and multiple output (MIMO) transmission to improve the transmission reliability and capacity of mobile sink nodes when they experience spatial correlation. Unlike conventional single-node (SN) MIMO transmission, the proposed scheme considers the use of transmission antennas from more than two sensor nodes. To find an optimal antenna set and a MIMO transmission scheme, a MN MIMO channel model is introduced first, followed by derivation of closed-form ergodic capacity expressions with different MIMO transmission schemes, such as space-time transmit diversity coding and spatial multiplexing. The capacity varies according to the antenna correlation and the path gain from multiple sensor nodes. Based on these statistical results, we propose an adaptive MIMO mode and antenna set switching algorithm that maximizes the ergodic capacity of mobile sink nodes. The ergodic capacity of the proposed scheme is compared with conventional SN MIMO schemes, where the gain increases as the antenna correlation and path gain ratio increase.

Adaptive Multi-Node Multiple Input and Multiple Output (MIMO) Transmission for Mobile Wireless Multimedia Sensor Networks

PubMed Central

Cho, Sunghyun; Choi, Ji-Woong; You, Cheolwoo

2013-01-01

Mobile wireless multimedia sensor networks (WMSNs), which consist of mobile sink or sensor nodes and use rich sensing information, require much faster and more reliable wireless links than static wireless sensor networks (WSNs). This paper proposes an adaptive multi-node (MN) multiple input and multiple output (MIMO) transmission to improve the transmission reliability and capacity of mobile sink nodes when they experience spatial correlation. Unlike conventional single-node (SN) MIMO transmission, the proposed scheme considers the use of transmission antennas from more than two sensor nodes. To find an optimal antenna set and a MIMO transmission scheme, a MN MIMO channel model is introduced first, followed by derivation of closed-form ergodic capacity expressions with different MIMO transmission schemes, such as space-time transmit diversity coding and spatial multiplexing. The capacity varies according to the antenna correlation and the path gain from multiple sensor nodes. Based on these statistical results, we propose an adaptive MIMO mode and antenna set switching algorithm that maximizes the ergodic capacity of mobile sink nodes. The ergodic capacity of the proposed scheme is compared with conventional SN MIMO schemes, where the gain increases as the antenna correlation and path gain ratio increase. PMID:24152920

Autonomous distributed self-organization for mobile wireless sensor networks.

PubMed

Wen, Chih-Yu; Tang, Hung-Kai

2009-01-01

This paper presents an adaptive combined-metrics-based clustering scheme for mobile wireless sensor networks, which manages the mobile sensors by utilizing the hierarchical network structure and allocates network resources efficiently A local criteria is used to help mobile sensors form a new cluster or join a current cluster. The messages transmitted during hierarchical clustering are applied to choose distributed gateways such that communication for adjacent clusters and distributed topology control can be achieved. In order to balance the load among clusters and govern the topology change, a cluster reformation scheme using localized criterions is implemented. The proposed scheme is simulated and analyzed to abstract the network behaviors in a number of settings. The experimental results show that the proposed algorithm provides efficient network topology management and achieves high scalability in mobile sensor networks.

Efficient Buffering Scheme in the LMA for Seamless Handover in PMIPv6

NASA Astrophysics Data System (ADS)

Kim, Kwang-Ryoul; Lee, Hyo-Beom; Choi, Hyon-Young; Min, Sung-Gi; Han, Youn-Hee

Proxy Mobile IPv6 (PMIPv6) is proposed as a new network-based local mobility protocol which does not involve the Mobile Node (MN) in mobility management. PMIPv6, which uses link-layer attachment information, reduces the movement detection time and eliminates duplicate address detection procedures in order to provide faster handover than Mobile IPv6 (MIPv6). To eliminate packet loss during the handover period, the Local Mobility Anchor (LMA) buffering scheme is proposed. In this scheme, the LMA buffers lost packets of the Mobile Access Gateway (MAG) and the MN during the handover and recovers them after handover. A new Automatic Repeat reQuest (ARQ) handler is defined which efficiently manages the LMA buffer. The ARQ handler relays ARQ result between the MAG and the MN to the LMA. The LMA removes any buffered packets which have been successfully delivered to the MN. The ARQ handler recovers the packet loss during the handover using buffered packets in the LMA. The ARQ information, between the MAG and LMA, is inserted in the outer header of IP-in-IP encapsulated packets of a standard PMIPv6 tunnel. Since the proposed scheme simply adds information to the standard operation of an IP-in-IP tunnel between the LMA and the MAG, it can be implemented seamlessly without modification to the original PMIPv6 messages and signaling sequence. Unlike other Fast Handovers for Mobile IPv6 (FMIPv6) based enhancement for PMIPv6, the proposed scheme does not require any handover related information before the actual handover.

Turbomachine rotor with improved cooling

DOEpatents

Hultgren, Kent Goran; McLaurin, Leroy Dixon; Bertsch, Oran Leroy; Lowe, Perry Eugene

1998-01-01

A gas turbine rotor has an essentially closed loop cooling air scheme in which cooling air drawn from the compressor discharge air that is supplied to the combustion chamber is further compressed, cooled, and then directed to the aft end of the turbine rotor. Downstream seal rings attached to the downstream face of each rotor disc direct the cooling air over the downstream disc face, thereby cooling it, and then to cooling air passages formed in the rotating blades. Upstream seal rings attached to the upstream face of each disc direct the heated cooling air away from the blade root while keeping the disc thermally isolated from the heated cooling air. From each upstream seal ring, the heated cooling air flows through passages in the upstream discs and is then combined and returned to the combustion chamber from which it was drawn.

Turbomachine rotor with improved cooling

DOEpatents

Hultgren, K.G.; McLaurin, L.D.; Bertsch, O.L.; Lowe, P.E.

1998-05-26

A gas turbine rotor has an essentially closed loop cooling air scheme in which cooling air drawn from the compressor discharge air that is supplied to the combustion chamber is further compressed, cooled, and then directed to the aft end of the turbine rotor. Downstream seal rings attached to the downstream face of each rotor disc direct the cooling air over the downstream disc face, thereby cooling it, and then to cooling air passages formed in the rotating blades. Upstream seal rings attached to the upstream face of each disc direct the heated cooling air away from the blade root while keeping the disc thermally isolated from the heated cooling air. From each upstream seal ring, the heated cooling air flows through passages in the upstream discs and is then combined and returned to the combustion chamber from which it was drawn. 5 figs.

Self-healing ring-based WDM-PON

NASA Astrophysics Data System (ADS)

Zhou, Yang; Gan, Chaoqin; Zhu, Long

2010-05-01

In this paper, a survivable ring-based wavelength-division-multiplexing (WDM)-passive optical network (PON) for fiber protection is proposed. Protections for feeder fiber and distributed fiber are independent in the scheme. Optical line terminal (OLT) and optical network units (ONUs) can automatically switch to protection link when fiber failure occurs. Protection distributed fiber is not required in the scheme. Cost-effective components are used in ONUs to minimize costs of network. A simulation study is performed to demonstrate the scheme. Its result shows good performance of upstream and downstream signals.

Experimental demonstration of large capacity WSDM optical access network with multicore fibers and advanced modulation formats.

PubMed

Li, Borui; Feng, Zhenhua; Tang, Ming; Xu, Zhilin; Fu, Songnian; Wu, Qiong; Deng, Lei; Tong, Weijun; Liu, Shuang; Shum, Perry Ping

2015-05-04

Towards the next generation optical access network supporting large capacity data transmission to enormous number of users covering a wider area, we proposed a hybrid wavelength-space division multiplexing (WSDM) optical access network architecture utilizing multicore fibers with advanced modulation formats. As a proof of concept, we experimentally demonstrated a WSDM optical access network with duplex transmission using our developed and fabricated multicore (7-core) fibers with 58.7km distance. As a cost-effective modulation scheme for access network, the optical OFDM-QPSK signal has been intensity modulated on the downstream transmission in the optical line terminal (OLT) and it was directly detected in the optical network unit (ONU) after MCF transmission. 10 wavelengths with 25GHz channel spacing from an optical comb generator are employed and each wavelength is loaded with 5Gb/s OFDM-QPSK signal. After amplification, power splitting, and fan-in multiplexer, 10-wavelength downstream signal was injected into six outer layer cores simultaneously and the aggregation downstream capacity reaches 300 Gb/s. -16 dBm sensitivity has been achieved for 3.8 × 10^-3 bit error ratio (BER) with 7% Forward Error Correction (FEC) limit for all wavelengths in every core. Upstream signal from ONU side has also been generated and the bidirectional transmission in the same core causes negligible performance degradation to the downstream signal. As a universal platform for wired/wireless data access, our proposed architecture provides additional dimension for high speed mobile signal transmission and we hence demonstrated an upstream delivery of 20Gb/s per wavelength with QPSK modulation formats using the inner core of MCF emulating a mobile backhaul service. The IQ modulated data was coherently detected in the OLT side. -19 dBm sensitivity has been achieved under the FEC limit and more than 18 dB power budget is guaranteed.

Advanced Mobility Handover for Mobile IPv6 Based Wireless Networks

PubMed Central

Safa Sadiq, Ali; Fisal, Norsheila Binti; Ghafoor, Kayhan Zrar; Lloret, Jaime

2014-01-01

We propose an Advanced Mobility Handover scheme (AMH) in this paper for seamless mobility in MIPv6-based wireless networks. In the proposed scheme, the mobile node utilizes a unique home IPv6 address developed to maintain communication with other corresponding nodes without a care-of-address during the roaming process. The IPv6 address for each MN during the first round of AMH process is uniquely identified by HA using the developed MN-ID field as a global permanent, which is identifying uniquely the IPv6 address of MN. Moreover, a temporary MN-ID is generated by access point each time an MN is associated with a particular AP and temporarily saved in a developed table inside the AP. When employing the AMH scheme, the handover process in the network layer is performed prior to its default time. That is, the mobility handover process in the network layer is tackled by a trigger developed AMH message to the next access point. Thus, a mobile node keeps communicating with the current access point while the network layer handover is executed by the next access point. The mathematical analyses and simulation results show that the proposed scheme performs better as compared with the existing approaches. PMID:25614890

A study of malware detection on smart mobile devices

NASA Astrophysics Data System (ADS)

Yu, Wei; Zhang, Hanlin; Xu, Guobin

2013-05-01

The growing in use of smart mobile devices for everyday applications has stimulated the spread of mobile malware, especially on popular mobile platforms. As a consequence, malware detection becomes ever more critical in sustaining the mobile market and providing a better user experience. In this paper, we review the existing malware and detection schemes. Using real-world malware samples with known signatures, we evaluate four popular commercial anti-virus tools and our data shows that these tools can achieve high detection accuracy. To deal with the new malware with unknown signatures, we study the anomaly based detection using decision tree algorithm. We evaluate the effectiveness of our detection scheme using malware and legitimate software samples. Our data shows that the detection scheme using decision tree can achieve a detection rate up to 90% and a false positive rate as low as 10%.

A Tree Based Self-routing Scheme for Mobility Support in Wireless Sensor Networks

NASA Astrophysics Data System (ADS)

Kim, Young-Duk; Yang, Yeon-Mo; Kang, Won-Seok; Kim, Jin-Wook; An, Jinung

Recently, WSNs (Wireless Sensor Networks) with mobile robot is a growing technology that offer efficient communication services for anytime and anywhere applications. However, the tiny sensor node has very limited network resources due to its low battery power, low data rate, node mobility, and channel interference constraint between neighbors. Thus, in this paper, we proposed a tree based self-routing protocol for autonomous mobile robots based on beacon mode and implemented in real test-bed environments. The proposed scheme offers beacon based real-time scheduling for reliable association process between parent and child nodes. In addition, it supports smooth handover procedure by reducing flooding overhead of control packets. Throughout the performance evaluation by using a real test-bed system and simulation, we illustrate that our proposed scheme demonstrates promising performance for wireless sensor networks with mobile robots.

Fast rerouting schemes for protected mobile IP over MPLS networks

NASA Astrophysics Data System (ADS)

Wen, Chih-Chao; Chang, Sheng-Yi; Chen, Huan; Chen, Kim-Joan

2005-10-01

Fast rerouting is a critical traffic engineering operation in the MPLS networks. To implement the Mobile IP service over the MPLS network, one can collaborate with the fast rerouting operation to enhance the availability and survivability. MPLS can protect critical LSP tunnel between Home Agent (HA) and Foreign Agent (FA) using the fast rerouting scheme. In this paper, we propose a simple but efficient algorithm to address the triangle routing problem for the Mobile IP over the MPLS networks. We consider this routing issue as a link weighting and capacity assignment (LW-CA) problem. The derived solution is used to plan the fast restoration mechanism to protect the link or node failure. In this paper, we first model the LW-CA problem as a mixed integer optimization problem. Our goal is to minimize the call blocking probability on the most congested working truck for the mobile IP connections. Many existing network topologies are used to evaluate the performance of our scheme. Results show that our proposed scheme can obtain the best performance in terms of the smallest blocking probability compared to other schemes.

An adaptive actuator failure compensation scheme for two linked 2WD mobile robots

NASA Astrophysics Data System (ADS)

Ma, Yajie; Al-Dujaili, Ayad; Cocquempot, Vincent; El Badaoui El Najjar, Maan

2017-01-01

This paper develops a new adaptive compensation control scheme for two linked mobile robots with actuator failurs. A configuration with two linked two-wheel drive (2WD) mobile robots is proposed, and the modelling of its kinematics and dynamics are given. An adaptive failure compensation scheme is developed to compensate actuator failures, consisting of a kinematic controller and a multi-design integration based dynamic controller. The kinematic controller is a virtual one, and based on which, multiple adaptive dynamic control signals are designed which covers all possible failure cases. By combing these dynamic control signals, the dynamic controller is designed, which ensures system stability and asymptotic tracking properties. Simulation results verify the effectiveness of the proposed adaptive failure compensation scheme.

CP-ABE Based Privacy-Preserving User Profile Matching in Mobile Social Networks

PubMed Central

Cui, Weirong; Du, Chenglie; Chen, Jinchao

2016-01-01

Privacy-preserving profile matching, a challenging task in mobile social networks, is getting more attention in recent years. In this paper, we propose a novel scheme that is based on ciphertext-policy attribute-based encryption to tackle this problem. In our scheme, a user can submit a preference-profile and search for users with matching-profile in decentralized mobile social networks. In this process, no participant’s profile and the submitted preference-profile is exposed. Meanwhile, a secure communication channel can be established between the pair of successfully matched users. In contrast to existing related schemes which are mainly based on the secure multi-party computation, our scheme can provide verifiability (both the initiator and any unmatched user cannot cheat each other to pretend to be matched), and requires few interactions among users. We provide thorough security analysis and performance evaluation on our scheme, and show its advantages in terms of security, efficiency and usability over state-of-the-art schemes. PMID:27337001

CP-ABE Based Privacy-Preserving User Profile Matching in Mobile Social Networks.

PubMed

Cui, Weirong; Du, Chenglie; Chen, Jinchao

2016-01-01

Privacy-preserving profile matching, a challenging task in mobile social networks, is getting more attention in recent years. In this paper, we propose a novel scheme that is based on ciphertext-policy attribute-based encryption to tackle this problem. In our scheme, a user can submit a preference-profile and search for users with matching-profile in decentralized mobile social networks. In this process, no participant's profile and the submitted preference-profile is exposed. Meanwhile, a secure communication channel can be established between the pair of successfully matched users. In contrast to existing related schemes which are mainly based on the secure multi-party computation, our scheme can provide verifiability (both the initiator and any unmatched user cannot cheat each other to pretend to be matched), and requires few interactions among users. We provide thorough security analysis and performance evaluation on our scheme, and show its advantages in terms of security, efficiency and usability over state-of-the-art schemes.

Implementation of fast handover for proxy mobile IPv6: Resolving out-of-order packets

PubMed Central

Anh, Khuong Quoc; Choo, Hyunseung

2017-01-01

Mobile IP allows for location-independent routing of IP datagrams on the Internet. Mobile IP specifies how a mobile node (MN) registers with its home agent and how the home agent routes datagrams to the MN through the tunnel. Current Mobile IP protocols have difficulties meeting the stringent handover delay requirements of future wireless networks. Fast handover for Proxy Mobile IPv6 (FPMIPv6) is used to resolve handover latency and packet loss problems that occur in the Proxy Mobile IPv6 (PMIPv6) protocol. However, while implementing the FPMIPv6 scheme in a testbed, we encounter the out-of-order packet (OoOP) problem. The cause of this problem is the existence of two paths for data transmitted from a correspondent node (CN) to an MN. Since the problem affects the quality of service (QoS) of the network and the performance of the MN, we propose a new scheme using the last packet marker and packet buffering to solve this problem in FPMIPv6. The new Mobile Access Gateway (MAG) can control and deliver the data transmitted via the old path or the new path to an MN in order, using the last packet marker to notify the end of the data delivery in the old path and the packet buffering for holding the data delivered in the new path. We implement both the proposed scheme and FPMIPv6 in a testbed as a real network environment to demonstrate the correctness, cost effectiveness, and performance of the proposed scheme. A performance evaluation reveals that the proposed scheme can handle the OoOP problem efficiently. PMID:28968450

Implementation of fast handover for proxy mobile IPv6: Resolving out-of-order packets.

PubMed

Kang, Byungseok; Anh, Khuong Quoc; Choo, Hyunseung

2017-01-01

Mobile IP allows for location-independent routing of IP datagrams on the Internet. Mobile IP specifies how a mobile node (MN) registers with its home agent and how the home agent routes datagrams to the MN through the tunnel. Current Mobile IP protocols have difficulties meeting the stringent handover delay requirements of future wireless networks. Fast handover for Proxy Mobile IPv6 (FPMIPv6) is used to resolve handover latency and packet loss problems that occur in the Proxy Mobile IPv6 (PMIPv6) protocol. However, while implementing the FPMIPv6 scheme in a testbed, we encounter the out-of-order packet (OoOP) problem. The cause of this problem is the existence of two paths for data transmitted from a correspondent node (CN) to an MN. Since the problem affects the quality of service (QoS) of the network and the performance of the MN, we propose a new scheme using the last packet marker and packet buffering to solve this problem in FPMIPv6. The new Mobile Access Gateway (MAG) can control and deliver the data transmitted via the old path or the new path to an MN in order, using the last packet marker to notify the end of the data delivery in the old path and the packet buffering for holding the data delivered in the new path. We implement both the proposed scheme and FPMIPv6 in a testbed as a real network environment to demonstrate the correctness, cost effectiveness, and performance of the proposed scheme. A performance evaluation reveals that the proposed scheme can handle the OoOP problem efficiently.

A Continuing Search for a Near-Perfect Numerical Flux Scheme. Part 1; [AUSM+

NASA Technical Reports Server (NTRS)

Liou, Meng-Sing

1994-01-01

While enjoying demonstrated improvement in accuracy, efficiency, and robustness over existing schemes, the Advection Upstream Splitting Scheme (AUSM) was found to have some deficiencies in extreme cases. This recent progress towards improving the AUSM while retaining its advantageous features is described. The new scheme, termed AUSM+, features: unification of velocity and Mach number splitting; exact capture of a single stationary shock; and improvement in accuracy. A general construction of the AUSM+ scheme is layed out and then focus is on the analysis of the a scheme and its mathematical properties, heretofore unreported. Monotonicity and positivity are proved, and a CFL-like condition is given for first and second order schemes and for generalized curvilinear co-ordinates. Finally, results of numerical tests on many problems are given to confirm the capability and improvements on a variety of problems including those failed by prominent schemes.

Intelligent call admission control for multi-class services in mobile cellular networks

NASA Astrophysics Data System (ADS)

Ma, Yufeng; Hu, Xiulin; Zhang, Yunyu

2005-11-01

Scarcity of the spectrum resource and mobility of users make quality of service (QoS) provision a critical issue in mobile cellular networks. This paper presents a fuzzy call admission control scheme to meet the requirement of the QoS. A performance measure is formed as a weighted linear function of new call and handoff call blocking probabilities of each service class. Simulation compares the proposed fuzzy scheme with complete sharing and guard channel policies. Simulation results show that fuzzy scheme has a better robust performance in terms of average blocking criterion.

Joint Transmit Antenna Selection and Power Allocation for ISDF Relaying Mobile-to-Mobile Sensor Networks

PubMed Central

Xu, Lingwei; Zhang, Hao; Gulliver, T. Aaron

2016-01-01

The outage probability (OP) performance of multiple-relay incremental-selective decode-and-forward (ISDF) relaying mobile-to-mobile (M2M) sensor networks with transmit antenna selection (TAS) over N-Nakagami fading channels is investigated. Exact closed-form OP expressions for both optimal and suboptimal TAS schemes are derived. The power allocation problem is formulated to determine the optimal division of transmit power between the broadcast and relay phases. The OP performance under different conditions is evaluated via numerical simulation to verify the analysis. These results show that the optimal TAS scheme has better OP performance than the suboptimal scheme. Further, the power allocation parameter has a significant influence on the OP performance. PMID:26907282

An Efficient Offloading Scheme For MEC System Considering Delay and Energy Consumption

NASA Astrophysics Data System (ADS)

Sun, Yanhua; Hao, Zhe; Zhang, Yanhua

2018-01-01

With the increasing numbers of mobile devices, mobile edge computing (MEC) which provides cloud computing capabilities proximate to mobile devices in 5G networks has been envisioned as a promising paradigm to enhance users experience. In this paper, we investigate a joint consideration of delay and energy consumption offloading scheme (JCDE) for MEC system in 5G heterogeneous networks. An optimization is formulated to minimize the delay as well as energy consumption of the offloading system, which the delay and energy consumption of transmitting and calculating tasks are taken into account. We adopt an iterative greedy algorithm to solve the optimization problem. Furthermore, simulations were carried out to validate the utility and effectiveness of our proposed scheme. The effect of parameter variations on the system is analysed as well. Numerical results demonstrate delay and energy efficiency promotion of our proposed scheme compared with another paper’s scheme.

75 FR 11468 - Final Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-11

...] Elevation in meters (MSL) Modified Mobile County, Alabama, and Incorporated Areas Docket No.: FEMA-B-7732..., rounded to the nearest 0.1 meter. ADDRESSES City of Mobile Maps are available for inspection at 205... Incorporated Areas Docket No.: FEMA-B-1022 Bear Creek 9,400 feet upstream of +266 Unincorporated Areas of Weiss...

Hybrid Upwinding for Two-Phase Flow in Heterogeneous Porous Media with Buoyancy and Capillarity

NASA Astrophysics Data System (ADS)

Hamon, F. P.; Mallison, B.; Tchelepi, H.

2016-12-01

In subsurface flow simulation, efficient discretization schemes for the partial differential equations governing multiphase flow and transport are critical. For highly heterogeneous porous media, the temporal discretization of choice is often the unconditionally stable fully implicit (backward-Euler) method. In this scheme, the simultaneous update of all the degrees of freedom requires solving large algebraic nonlinear systems at each time step using Newton's method. This is computationally expensive, especially in the presence of strong capillary effects driven by abrupt changes in porosity and permeability between different rock types. Therefore, discretization schemes that reduce the simulation cost by improving the nonlinear convergence rate are highly desirable. To speed up nonlinear convergence, we present an efficient fully implicit finite-volume scheme for immiscible two-phase flow in the presence of strong capillary forces. In this scheme, the discrete viscous, buoyancy, and capillary spatial terms are evaluated separately based on physical considerations. We build on previous work on Implicit Hybrid Upwinding (IHU) by using the upstream saturations with respect to the total velocity to compute the relative permeabilities in the viscous term, and by determining the directionality of the buoyancy term based on the phase density differences. The capillary numerical flux is decomposed into a rock- and geometry-dependent transmissibility factor, a nonlinear capillary diffusion coefficient, and an approximation of the saturation gradient. Combining the viscous, buoyancy, and capillary terms, we obtain a numerical flux that is consistent, bounded, differentiable, and monotone for homogeneous one-dimensional flow. The proposed scheme also accounts for spatially discontinuous capillary pressure functions. Specifically, at the interface between two rock types, the numerical scheme accurately honors the entry pressure condition by solving a local nonlinear problem to compute the numerical flux. Heterogeneous numerical tests demonstrate that this extended IHU scheme is non-oscillatory and convergent upon refinement. They also illustrate the superior accuracy and nonlinear convergence rate of the IHU scheme compared with the standard phase-based upstream weighting approach.

Scalable Video Streaming Relay for Smart Mobile Devices in Wireless Networks

PubMed Central

Kwon, Dongwoo; Je, Huigwang; Kim, Hyeonwoo; Ju, Hongtaek; An, Donghyeok

2016-01-01

Recently, smart mobile devices and wireless communication technologies such as WiFi, third generation (3G), and long-term evolution (LTE) have been rapidly deployed. Many smart mobile device users can access the Internet wirelessly, which has increased mobile traffic. In 2014, more than half of the mobile traffic around the world was devoted to satisfying the increased demand for the video streaming. In this paper, we propose a scalable video streaming relay scheme. Because many collisions degrade the scalability of video streaming, we first separate networks to prevent excessive contention between devices. In addition, the member device controls the video download rate in order to adapt to video playback. If the data are sufficiently buffered, the member device stops the download. If not, it requests additional video data. We implemented apps to evaluate the proposed scheme and conducted experiments with smart mobile devices. The results showed that our scheme improves the scalability of video streaming in a wireless local area network (WLAN). PMID:27907113

Scalable Video Streaming Relay for Smart Mobile Devices in Wireless Networks.

PubMed

Kwon, Dongwoo; Je, Huigwang; Kim, Hyeonwoo; Ju, Hongtaek; An, Donghyeok

2016-01-01

Recently, smart mobile devices and wireless communication technologies such as WiFi, third generation (3G), and long-term evolution (LTE) have been rapidly deployed. Many smart mobile device users can access the Internet wirelessly, which has increased mobile traffic. In 2014, more than half of the mobile traffic around the world was devoted to satisfying the increased demand for the video streaming. In this paper, we propose a scalable video streaming relay scheme. Because many collisions degrade the scalability of video streaming, we first separate networks to prevent excessive contention between devices. In addition, the member device controls the video download rate in order to adapt to video playback. If the data are sufficiently buffered, the member device stops the download. If not, it requests additional video data. We implemented apps to evaluate the proposed scheme and conducted experiments with smart mobile devices. The results showed that our scheme improves the scalability of video streaming in a wireless local area network (WLAN).

LPTA: Location Predictive and Time Adaptive Data Gathering Scheme with Mobile Sink for Wireless Sensor Networks

PubMed Central

Rodrigues, Joel J. P. C.

2014-01-01

This paper exploits sink mobility to prolong the lifetime of sensor networks while maintaining the data transmission delay relatively low. A location predictive and time adaptive data gathering scheme is proposed. In this paper, we introduce a sink location prediction principle based on loose time synchronization and deduce the time-location formulas of the mobile sink. According to local clocks and the time-location formulas of the mobile sink, nodes in the network are able to calculate the current location of the mobile sink accurately and route data packets timely toward the mobile sink by multihop relay. Considering that data packets generating from different areas may be different greatly, an adaptive dwelling time adjustment method is also proposed to balance energy consumption among nodes in the network. Simulation results show that our data gathering scheme enables data routing with less data transmission time delay and balance energy consumption among nodes. PMID:25302327

Enhanced Predictive Handover for Fast Proxy Mobile IPv6

NASA Astrophysics Data System (ADS)

Jeon, Seil; Kang, Namhi; Kim, Younghan

Proxy Mobile IPv6 (PMIPv6) has been proposed in order to overcome the limitations of host-based mobility management in IPv6 networks. However, packet losses during doing handover are still a problem. To solve this issue, several schemes have been developed, and can be classified into two approaches: predictive and reactive handover. Both approaches commonly use bi-directional tunnel between mobile access gateways (MAGs). In predictive schemes especially, mobility support for a mobile node (MN) is triggered by simplified link signal strength. Thereafter, the MN sends handover notification to its serving MAG, and is then able to initiate packet forwarding. Therefore, if the MN moves toward an unexpected MAG that does not have any pre-established tunnel with the serving MAG, it may lead to packet losses. In this paper, we define this problem as Early Packet Forwarding (EPF). As a solution, we propose an enhanced PMIPv6 scheme using two-phase tunnel control based on the IEEE 802.21 Media Independent Handover (MIH).

HiCoDG: a hierarchical data-gathering scheme using cooperative multiple mobile elements.

PubMed

Van Le, Duc; Oh, Hoon; Yoon, Seokhoon

2014-12-17

In this paper, we study mobile element (ME)-based data-gathering schemes in wireless sensor networks. Due to the physical speed limits of mobile elements, the existing data-gathering schemes that use mobile elements can suffer from high data-gathering latency. In order to address this problem, this paper proposes a new hierarchical and cooperative data-gathering (HiCoDG) scheme that enables multiple mobile elements to cooperate with each other to collect and relay data. In HiCoDG, two types of mobile elements are used: the mobile collector (MC) and the mobile relay (MR). MCs collect data from sensors and forward them to the MR, which will deliver them to the sink. In this work, we also formulated an integer linear programming (ILP) optimization problem to find the optimal trajectories for MCs and the MR, such that the traveling distance of MEs is minimized. Two variants of HiCoDG, intermediate station (IS)-based and cooperative movement scheduling (CMS)-based, are proposed to facilitate cooperative data forwarding from MCs to the MR. An analytical model for estimating the average data-gathering latency in HiCoDG was also designed. Simulations were performed to compare the performance of the IS and CMS variants, as well as a multiple traveling salesman problem (mTSP)-based approach. The simulation results show that HiCoDG outperforms mTSP in terms of latency. The results also show that CMS can achieve the lowest latency with low energy consumption.

HiCoDG: A Hierarchical Data-Gathering Scheme Using Cooperative Multiple Mobile Elements †

PubMed Central

Van Le, Duc; Oh, Hoon; Yoon, Seokhoon

2014-01-01

In this paper, we study mobile element (ME)-based data-gathering schemes in wireless sensor networks. Due to the physical speed limits of mobile elements, the existing data-gathering schemes that use mobile elements can suffer from high data-gathering latency. In order to address this problem, this paper proposes a new hierarchical and cooperative data-gathering (HiCoDG) scheme that enables multiple mobile elements to cooperate with each other to collect and relay data. In HiCoDG, two types of mobile elements are used: the mobile collector (MC) and the mobile relay (MR). MCs collect data from sensors and forward them to the MR, which will deliver them to the sink. In this work, we also formulated an integer linear programming (ILP) optimization problem to find the optimal trajectories for MCs and the MR, such that the traveling distance of MEs is minimized. Two variants of HiCoDG, intermediate station (IS)-based and cooperative movement scheduling (CMS)-based, are proposed to facilitate cooperative data forwarding from MCs to the MR. An analytical model for estimating the average data-gathering latency in HiCoDG was also designed. Simulations were performed to compare the performance of the IS and CMS variants, as well as a multiple traveling salesman problem (mTSP)-based approach. The simulation results show that HiCoDG outperforms mTSP in terms of latency. The results also show that CMS can achieve the lowest latency with low energy consumption. PMID:25526356

Design of an anti-Rician-fading modem for mobile satellite communication systems

NASA Technical Reports Server (NTRS)

Kojima, Toshiharu; Ishizu, Fumio; Miyake, Makoto; Murakami, Keishi; Fujino, Tadashi

1995-01-01

To design a demodulator applicable to mobile satellite communication systems using differential phase shift keying modulation, we have developed key technologies including an anti-Rician-fading demodulation scheme, an initial acquisition scheme, automatic gain control (AGC), automatic frequency control (AFC), and bit timing recovery (BTR). Using these technologies, we have developed one-chip digital signal processor (DSP) modem for mobile terminal, which is compact, of light weight, and of low power consumption. Results of performance test show that the developed DSP modem achieves good performance in terms of bit error ratio in mobile satellite communication environment, i.e., Rician fading channel. It is also shown that the initial acquisition scheme acquires received signal rapidly even if the carrier-to-noise power ratio (CNR) of the received signal is considerably low.

Sensor Proxy Mobile IPv6 (SPMIPv6)—A Novel Scheme for Mobility Supported IP-WSNs

PubMed Central

Islam, Md. Motaharul; Huh, Eui-Nam

2011-01-01

IP based Wireless Sensor Networks (IP-WSNs) are gaining importance for their broad range of applications in health-care, home automation, environmental monitoring, industrial control, vehicle telematics and agricultural monitoring. In all these applications, mobility in the sensor network with special attention to energy efficiency is a major issue to be addressed. Host-based mobility management protocols are not suitable for IP-WSNs because of their energy inefficiency, so network based mobility management protocols can be an alternative for the mobility supported IP-WSNs. In this paper we propose a network based mobility supported IP-WSN protocol called Sensor Proxy Mobile IPv6 (SPMIPv6). We present its architecture, message formats and also evaluate its performance considering signaling cost, mobility cost and energy consumption. Our analysis shows that with respect to the number of IP-WSN nodes, the proposed scheme reduces the signaling cost by 60% and 56%, as well as the mobility cost by 62% and 57%, compared to MIPv6 and PMIPv6, respectively. The simulation results also show that in terms of the number of hops, SPMIPv6 decreases the signaling cost by 56% and 53% as well as mobility cost by 60% and 67% as compared to MIPv6 and PMIPv6 respectively. It also indicates that proposed scheme reduces the level of energy consumption significantly. PMID:22319386

Sensor proxy mobile IPv6 (SPMIPv6)--a novel scheme for mobility supported IP-WSNs.

PubMed

Islam, Md Motaharul; Huh, Eui-Nam

2011-01-01

IP based Wireless Sensor Networks (IP-WSNs) are gaining importance for their broad range of applications in health-care, home automation, environmental monitoring, industrial control, vehicle telematics and agricultural monitoring. In all these applications, mobility in the sensor network with special attention to energy efficiency is a major issue to be addressed. Host-based mobility management protocols are not suitable for IP-WSNs because of their energy inefficiency, so network based mobility management protocols can be an alternative for the mobility supported IP-WSNs. In this paper we propose a network based mobility supported IP-WSN protocol called Sensor Proxy Mobile IPv6 (SPMIPv6). We present its architecture, message formats and also evaluate its performance considering signaling cost, mobility cost and energy consumption. Our analysis shows that with respect to the number of IP-WSN nodes, the proposed scheme reduces the signaling cost by 60% and 56%, as well as the mobility cost by 62% and 57%, compared to MIPv6 and PMIPv6, respectively. The simulation results also show that in terms of the number of hops, SPMIPv6 decreases the signaling cost by 56% and 53% as well as mobility cost by 60% and 67% as compared to MIPv6 and PMIPv6 respectively. It also indicates that proposed scheme reduces the level of energy consumption significantly.

Differential metabolic profiles associated to movement behaviour of stream-resident brown trout (Salmo trutta).

PubMed

Oromi, Neus; Jové, Mariona; Pascual-Pons, Mariona; Royo, Jose Luis; Rocaspana, Rafel; Aparicio, Enric; Pamplona, Reinald; Palau, Antoni; Sanuy, Delfi; Fibla, Joan; Portero-Otin, Manuel

2017-01-01

The mechanisms that can contribute in the fish movement strategies and the associated behaviour can be complex and related to the physiology, genetic and ecology of each species. In the case of the brown trout (Salmo trutta), in recent research works, individual differences in mobility have been observed in a population living in a high mountain river reach (Pyrenees, NE Spain). The population is mostly sedentary but a small percentage of individuals exhibit a mobile behavior, mainly upstream movements. Metabolomics can reflect changes in the physiological process and can determine different profiles depending on behaviour. Here, a non-targeted metabolomics approach was used to find possible changes in the blood metabolomic profile of S. trutta related to its movement behaviour, using a minimally invasive sampling. Results showed a differentiation in the metabolomic profiles of the trouts and different level concentrations of some metabolites (e.g. cortisol) according to the home range classification (pattern of movements: sedentary or mobile). The change in metabolomic profiles can generally occur during the upstream movement and probably reflects the changes in metabolite profile from the non-mobile season to mobile season. This study reveals the contribution of the metabolomic analyses to better understand the behaviour of organisms.

Performance Enhancement of Multichannel Gigabit Rate Bidirectional WDM-PON Using RSOA and Optimized Modulation Format

NASA Astrophysics Data System (ADS)

Parkash, Sooraj; Sharma, Anurag; Singh, Harsukhpreet

2016-09-01

This paper successfully demonstrates bidirectional wavelength division multiplexing passive optical network (WDM-PON) system for 32 channels, 0.8 nm (100 GHz) channels spacing with 3.5 GHz filter bandwidth. The system delivers 160 GB/s data rate and 80 GB/s data rate in downstream and upstream, respectively. The optical source for downstream data and upstream data is mode-locked laser at central office and reflective semiconductor optical amplifier (RSOA) at optical network unit. The maximum reach of designed system is 50 km without using any dispersion compensation scheme. This paper comprises comparison of series of modulation format in downstream and upstream such as SOLITON, NRZ, RZ, MANCHESTER, CSRZ and CRZ-DPSK and optimization of the performance of designed system. It has been observed that CRZ-DPSK/NRZ gives best performance in downstream and upstream transmission for designed system. The simulation work report of minimum BER is e-13 for CRZ-DPSK in downstream and e-16 for NRZ in upstream transmission in case of 32-channel bidirectional WDM-PON.

On-Line Method and Apparatus for Coordinated Mobility and Manipulation of Mobile Robots

NASA Technical Reports Server (NTRS)

Seraji, Homayoun (Inventor)

1996-01-01

A simple and computationally efficient approach is disclosed for on-line coordinated control of mobile robots consisting of a manipulator arm mounted on a mobile base. The effect of base mobility on the end-effector manipulability index is discussed. The base mobility and arm manipulation degrees-of-freedom are treated equally as the joints of a kinematically redundant composite robot. The redundancy introduced by the mobile base is exploited to satisfy a set of user-defined additional tasks during the end-effector motion. A simple on-line control scheme is proposed which allows the user to assign weighting factors to individual degrees-of-mobility and degrees-of-manipulation, as well as to each task specification. The computational efficiency of the control algorithm makes it particularly suitable for real-time implementations. Four case studies are discussed in detail to demonstrate the application of the coordinated control scheme to various mobile robots.

A new flux splitting scheme

NASA Technical Reports Server (NTRS)

Liou, Meng-Sing; Steffen, Christopher J., Jr.

1993-01-01

A new flux splitting scheme is proposed. The scheme is remarkably simple and yet its accuracy rivals and in some cases surpasses that of Roe's solver in the Euler and Navier-Stokes solutions performed in this study. The scheme is robust and converges as fast as the Roe splitting. An approximately defined cell-face advection Mach number is proposed using values from the two straddling cells via associated characteristic speeds. This interface Mach number is then used to determine the upwind extrapolation for the convective quantities. Accordingly, the name of the scheme is coined as Advection Upstream Splitting Method (AUSM). A new pressure splitting is introduced which is shown to behave successfully, yielding much smoother results than other existing pressure splittings. Of particular interest is the supersonic blunt body problem in which the Roe scheme gives anomalous solutions. The AUSM produces correct solutions without difficulty for a wide range of flow conditions as well as grids.

A new flux splitting scheme

NASA Technical Reports Server (NTRS)

Liou, Meng-Sing; Steffen, Christopher J., Jr.

1991-01-01

A new flux splitting scheme is proposed. The scheme is remarkably simple and yet its accuracy rivals and in some cases surpasses that of Roe's solver in the Euler and Navier-Stokes solutions performed in this study. The scheme is robust and converges as fast as the Roe splitting. An approximately defined cell-face advection Mach number is proposed using values from the two straddling cells via associated characteristic speeds. This interface Mach number is then used to determine the upwind extrapolation for the convective quantities. Accordingly, the name of the scheme is coined as Advection Upstream Splitting Method (AUSM). A new pressure splitting is introduced which is shown to behave successfully, yielding much smoother results than other existing pressure splittings. Of particular interest is the supersonic blunt body problem in which the Roe scheme gives anomalous solutions. The AUSM produces correct solutions without difficulty for a wide range of flow conditions as well as grids.

Path scheduling for multiple mobile actors in wireless sensor network

NASA Astrophysics Data System (ADS)

Trapasiya, Samir D.; Soni, Himanshu B.

2017-05-01

In wireless sensor network (WSN), energy is the main constraint. In this work we have addressed this issue for single as well as multiple mobile sensor actor network. In this work, we have proposed Rendezvous Point Selection Scheme (RPSS) in which Rendezvous Nodes are selected by set covering problem approach and from that, Rendezvous Points are selected in a way to reduce the tour length. The mobile actors tour is scheduled to pass through those Rendezvous Points as per Travelling Salesman Problem (TSP). We have also proposed novel rendezvous node rotation scheme for fair utilisation of all the nodes. We have compared RPSS with Stationery Actor scheme as well as RD-VT, RD-VT-SMT and WRP-SMT for performance metrics like energy consumption, network lifetime, route length and found the better outcome in all the cases for single actor. We have also applied RPSS for multiple mobile actor case like Multi-Actor Single Depot (MASD) termination and Multi-Actor Multiple Depot (MAMD) termination and observed by extensive simulation that MAMD saves the network energy in optimised way and enhance network lifetime compared to all other schemes.

Cost-effective WDM-PON Delivering Up/Down-stream Data on a Single Wavelength Using Soliton Pulse

NASA Astrophysics Data System (ADS)

Tawade, Laxman

2013-06-01

This paper presents wavelength division multiplexing passive optical network (WDM-PON) system delivering downstream 2.5 Gbit/s data and upstream 1 Gbit/s data on a single wavelength using pulse source is mode locked laser which generating a single pulse of "sech" shape with specified power and width i.e. soliton pulse. The optical source for downstream data and upstream data is sech pulse generator at central office and reflective semiconductor optical amplifier (RSOA) at each optical network unit. We also investigate analysis of backscattered optical signal for upstream data and downstream data simultaneously. Bit error rate, Q-Factor were measured to demonstrate the proposed scheme. In this paper Long reach aspects of an access network is investigated using single channel scenario.

A Security Analysis on Kempf-Koodli's Security Scheme for Fast Mobile IPv6

NASA Astrophysics Data System (ADS)

You, Ilsun; Sakurai, Kouichi; Hori, Yoshiaki

Recently, the security scheme, proposed by Kempf and Koodli, has been adopted as a security standard for Fast handover for Mobile IPv6. But, it does not prevent denial of service attacks while resulting in high computation cost. More importantly, we find that it is still vulnerable to redirection attacks because it fails to secure the Unsolicited Neighbor Advertisement messages. In this paper, Kempf-Koodli's scheme is formally analyzed through BAN-logic and its weaknesses are demonstrated.

Electromechanical Displacement Detection With an On-Chip High Electron Mobility Transistor Amplifier

NASA Astrophysics Data System (ADS)

Oda, Yasuhiko; Onomitsu, Koji; Kometani, Reo; Warisawa, Shin-ichi; Ishihara, Sunao; Yamaguchi, Hiroshi

2011-06-01

We developed a highly sensitive displacement detection scheme for a GaAs-based electromechanical resonator using an integrated high electron mobility transistor (HEMT). Piezoelectric voltage generated by the vibration of the resonator is applied to the gate of the HEMT, resulting in the on-chip amplification of the signal voltage. This detection scheme achieves a displacement sensitivity of ˜9 pm·Hz-1/2, which is one of the highest among on-chip purely electrical displacement detection schemes at room temperature.

Full duplex dense-wavelength-division-multiplexing radio-over-fiber system transmission of 75-GHz W-band frequency multiple-input multiple-output orthogonal-frequency-division-multiplexing signals with 3×12 Gbps downstream and 6 Gbps upstream

NASA Astrophysics Data System (ADS)

Fang, Wei Jin; Huang, Xu Guang; Yang, Kai; Zhang, Xiao Min

2012-09-01

We propose and demonstrate a full duplex dense-wavelength-division-multiplexing radio-over-fiber (DWDM-ROF) system for transmitting 75-GHz W-band frequency multiple-input multiple-output orthogonal-frequency-division-multiplexing (MIMO-OFDM) signals with 12 Gbps downstream and 6 Gbps upstream. The downstream transmitting terminal is based on a three-channels sextupling-frequency scheme using an external modulation of a distributed feedback laser diode (DFB-LD) and dual drive Mach-Zehnder modulator (DD-MZM) for carrying downstream signals. MIMO-OFDM algorithms effectively compensate for impairments in the wireless link. Without using costly W-band components in the transmitter, a 12 Gbps downstream transmission system operation at 75 GHz is experimentally validated. For the downstream transmission, a power penalty of less than 3 dB was observed after a 50 km single mode fiber (SMF) and 4 m wireless transmission at a bit error rate (BER) of 3.8×10-3. For the upstream transmission, we use a commercially available 1.5 GHz bandwidth reflective semiconductor optical amplifier (RSOA) to achieve 6 Gbps upstream traffic for 16 QAM-OFDM signals. A power penalty of 3 dB was observed after a 50 km SMF transmission at a BER of 3.8×10-3. The frequency of the local oscillator is reduced due to the frequency sextupling scheme. The cost of the proposed system is largely reduced.

Zadoff-Chu sequence-based hitless ranging scheme for OFDMA-PON configured 5G fronthaul uplinks

NASA Astrophysics Data System (ADS)

Reza, Ahmed Galib; Rhee, June-Koo Kevin

2017-05-01

A Zadoff-Chu (ZC) sequence-based low-complexity hitless upstream time synchronization scheme is proposed for an orthogonal frequency division multiple access passive optical network configured cloud radio access network fronthaul. The algorithm is based on gradual loading of the ZC sequences, where the phase discontinuity due to the cyclic prefix is alleviated by a frequency domain phase precoder, eliminating the requirements of guard bands to mitigate intersymbol interference and inter-carrier interference. Simulation results for uncontrolled-wavelength asynchronous transmissions from four concurrent transmitting optical network units are presented to demonstrate the effectiveness of the proposed scheme.

A novel survivable WDM passive optical networks

NASA Astrophysics Data System (ADS)

Cheng, Xiaofei; Fang, Qin; Zhang, Yong; Chen, Bin; Lu, Fucai

2008-11-01

We propose a novel survivable wavelength-division multiplexed-passive optical network (WDM-PON) based on an N × N cyclic array waveguide grating (AWG) and reflective semiconductor optical amplifiers (RSOAs). ONUs are grouped and connected with extra connection fibres (CFs). Protection resources are provided mutually in ONU pairs. The characteristics of the proposed survivable WDM-PON and wavelength routing scheme are analyzed. Experiments of 10- Gb/s downstream and 1.25-Gb/s upstream transmission experiments are demonstrated to verify our proposed scheme.

Reducing numerical diffusion for incompressible flow calculations

NASA Technical Reports Server (NTRS)

Claus, R. W.; Neely, G. M.; Syed, S. A.

1984-01-01

A number of approaches for improving the accuracy of incompressible, steady-state flow calculations are examined. Two improved differencing schemes, Quadratic Upstream Interpolation for Convective Kinematics (QUICK) and Skew-Upwind Differencing (SUD), are applied to the convective terms in the Navier-Stokes equations and compared with results obtained using hybrid differencing. In a number of test calculations, it is illustrated that no single scheme exhibits superior performance for all flow situations. However, both SUD and QUICK are shown to be generally more accurate than hybrid differencing.

Improving upstream transmission performance using a receiver with decision threshold level adjustment in a loopback WDM-PON

NASA Astrophysics Data System (ADS)

Cho, Seung-Hyun; Lee, Sang-Soo; Shin, Dong-Wook

2010-06-01

We have experimentally demonstrated that the use of an optical receiver with decision threshold level adjustment (DTLA) improved the performance of an upstream transmission in reflective semiconductor optical amplifier (RSOA)-based loopback wavelength division multiplexing-passive optical network (WDM-PON). Even though the extinction ratio (ER) of the downstream signal was as much as 9 dB and the injection power into the RSOA at the optical network unit was about -24 dBm, we successfully obtained error-free transmission results for the upstream signal through careful control of the decision threshold value in the optical receiver located at optical line terminal (OLT). Using an optical receiver with DTLA for upstream signal detection overcame significant obstacles related to the injection power into the RSOA and the ER of the downstream signal, which were previously considered limitations of the wavelength remodulation scheme. This technique is expected to provide flexibility for the optical link design in the practical deployment of a WDM-PON.

Quantitative simulation tools to analyze up- and downstream interactions of soil and water conservation measures: supporting policy making in the Green Water Credits program of Kenya.

PubMed

Hunink, J E; Droogers, P; Kauffman, S; Mwaniki, B M; Bouma, J

2012-11-30

Upstream soil and water conservation measures in catchments can have positive impact both upstream in terms of less erosion and higher crop yields, but also downstream by less sediment flow into reservoirs and increased groundwater recharge. Green Water Credits (GWC) schemes are being developed to encourage upstream farmers to invest in soil and water conservation practices which will positively effect upstream and downstream water availability. Quantitative information on water and sediment fluxes is crucial as a basis for such financial schemes. A pilot design project in the large and strategically important Upper-Tana Basin in Kenya has the objective to develop a methodological framework for this purpose. The essence of the methodology is the integration and use of a collection of public domain tools and datasets: the so-called Green water and Blue water Assessment Toolkit (GBAT). This toolkit was applied in order to study different options to implement GWC in agricultural rainfed land for the pilot study. Impact of vegetative contour strips, mulching, and tied ridges were determined for: (i) three upstream key indicators: soil loss, crop transpiration and soil evaporation, and (ii) two downstream indicators: sediment inflow in reservoirs and groundwater recharge. All effects were compared with a baseline scenario of average conditions. Thus, not only actual land management was considered but also potential benefits of changed land use practices. Results of the simulations indicate that especially applying contour strips or tied ridges significantly reduces soil losses and increases groundwater recharge in the catchment. The model was used to build spatial expressions of the proposed management practices in order to assess their effectiveness. The developed procedure allows exploring the effects of soil conservation measures in a catchment to support the implementation of GWC. Copyright © 2012 Elsevier Ltd. All rights reserved.

Channel evolution on the dammed Elwha River, Washington, USA

USGS Publications Warehouse

Draut, A.E.; Logan, J.B.; Mastin, M.C.

2011-01-01

Like many rivers in the western U.S., the Elwha River, Washington, has changed substantially over the past century in response to natural and human forcing. The lower river is affected by two upstream dams that are slated for removal as part of a major river restoration effort. In preparation for studying the effects of dam removal, we present a comprehensive field and aerial photographic analysis of dam influence on an anabranching, gravel-bed river. Over the past century with the dams in place, loss of the upstream sediment supply has caused spatial variations in the sedimentary and geomorphic character of the lower Elwha River channel. Bed sediment is armored and better sorted than on the naturally evolving bed upstream of the dams. On time scales of flood seasons, the channel immediately below the lower dam is fairly stable, but progresses toward greater mobility downstream such that the lowermost portion of the river responded to a recent 40-year flood with bank erosion and bed-elevation changes on a scale approaching that of the natural channel above the dams. In general, channel mobility in the lowest 4 km of the Elwha River has not decreased substantially with time. Enough fine sediment remains in the floodplain that – given sufficient flood forcing – the channel position, sinuosity, and braiding index change substantially. The processes by which this river accesses new fine sediment below the dams (rapid migration into noncohesive banks and avulsion of new channels) allow it to compensate for loss of upstream sediment supply more readily than would a dammed river with cohesive banks or a more limited supply of alluvium. The planned dam removal will provide a valuable opportunity to evaluate channel response to the future restoration of natural upstream sediment supply.

The concentration and chemical speciation of arsenic in the Nanpan River, the upstream of the Pearl River, China.

PubMed

Yang, Silin; Zhao, Ning; Zhou, Dequn; Wei, Rong; Yang, Bin; Pan, Bo

2016-04-01

The concentration and chemical speciation of arsenic (As) in different environmental matrixes (water, sediment, agricultural soils, and non-agricultural soils) were investigated in the Nanpan River area, the upstream of Pearl River, China. The results did not show any obvious transport of As along the flow direction of the river (from upstream to downstream). Total As concentrations in sediment were significantly different from those in agricultural soil. According to the comparison to quality standards, the As in sediments of the studied area have potential ecological risks and a minority of the sampling sites of agricultural soils in the studied area were polluted with As. As speciations were analyzed using sequential extraction and the percentage of non-residual fraction in sediment predominated over residual fraction. We thus believe that As in the studied area was with low mobility and bioavailability in sediment, agricultural soils, and non-agricultural soils. However, the bioavailability and mobility of As in sediment were higher than in both agricultural and non-agricultural soils, and thus, special attention should be paid for the risk assessment of As in the river in future studies.

Coordinated Control Of Mobile Robotic Manipulators

NASA Technical Reports Server (NTRS)

Seraji, Homayoun

1995-01-01

Computationally efficient scheme developed for on-line coordinated control of both manipulation and mobility of robots that include manipulator arms mounted on mobile bases. Applicable to variety of mobile robotic manipulators, including robots that move along tracks (typically, painting and welding robots), robots mounted on gantries and capable of moving in all three dimensions, wheeled robots, and compound robots (consisting of robots mounted on other robots). Theoretical basis discussed in several prior articles in NASA Tech Briefs, including "Increasing the Dexterity of Redundant Robots" (NPO-17801), "Redundant Robot Can Avoid Obstacles" (NPO-17852), "Configuration-Control Scheme Copes With Singularities" (NPO-18556), "More Uses for Configuration Control of Robots" (NPO-18607/NPO-18608).

A new performance index for the repetitive motion of mobile manipulators.

PubMed

Xiao, Lin; Zhang, Yunong

2014-02-01

A mobile manipulator is a robotic device composed of a mobile platform and a stationary manipulator fixed to the platform. To achieve the repetitive motion control of mobile manipulators, the mobile platform and the manipulator have to realize the repetitive motion simultaneously. To do so, a novel quadratic performance index is, for the first time, designed and presented in this paper, of which the effectiveness is analyzed by following a neural dynamics method. Then, a repetitive motion scheme is proposed by combining the criterion, physical constraints, and integrated kinematical equations of mobile manipulators, which is further reformulated as a quadratic programming (QP) subject to equality and bound constraints. In addition, two important Bridge theorems are established to prove that such a QP can be converted equivalently into a linear variational inequality, and then equivalently into a piecewise-linear projection equation (PLPE). A real-time numerical algorithm based on PLPE is thus developed and applied for the online solution of the resultant QP. Two tracking-path tasks demonstrate the effectiveness and accuracy of the repetitive motion scheme. In addition, comparisons between the nonrepetitive and repetitive motion further validate the superiority and novelty of the proposed scheme.

A framework for implementing data services in multi-service mobile satellite systems

NASA Technical Reports Server (NTRS)

Ali, Mohammed O.; Leung, Victor C. M.; Spolsky, Andrew I.

1988-01-01

Mobile satellite systems being planned for introduction in the early 1990s are expected to be invariably of the multi-service type. Mobile Telephone Service (MTS), Mobile Radio Service (MRS), and Mobile Data Service (MDS) are the major classifications used to categorize the many user applications to be supported. The MTS and MRS services encompass circuit-switched voice communication applications, and may be efficiently implemented using a centralized Demand-Assigned Multiple Access (DAMA) scheme. Applications under the MDS category are, on the other hand, message-oriented and expected to vary widely in characteristics; from simplex mode short messaging applications to long duration, full-duplex interactive data communication and large file transfer applications. For some applications under this service category, the conventional circuit-based DAMA scheme may prove highly inefficient due to the long time required to set up and establish communication links relative to the actual message transmission time. It is proposed that by defining a set of basic bearer services to be supported in MDS and optimizing their transmission and access schemes independent of the MTS and MRS services, the MDS applications can be more efficiently integrated into the multi-service design of mobile satellite systems.

A framework for implementing data services in multi-service mobile satellite systems

NASA Astrophysics Data System (ADS)

Ali, Mohammed O.; Leung, Victor C. M.; Spolsky, Andrew I.

1988-05-01

Mobile satellite systems being planned for introduction in the early 1990s are expected to be invariably of the multi-service type. Mobile Telephone Service (MTS), Mobile Radio Service (MRS), and Mobile Data Service (MDS) are the major classifications used to categorize the many user applications to be supported. The MTS and MRS services encompass circuit-switched voice communication applications, and may be efficiently implemented using a centralized Demand-Assigned Multiple Access (DAMA) scheme. Applications under the MDS category are, on the other hand, message-oriented and expected to vary widely in characteristics; from simplex mode short messaging applications to long duration, full-duplex interactive data communication and large file transfer applications. For some applications under this service category, the conventional circuit-based DAMA scheme may prove highly inefficient due to the long time required to set up and establish communication links relative to the actual message transmission time. It is proposed that by defining a set of basic bearer services to be supported in MDS and optimizing their transmission and access schemes independent of the MTS and MRS services, the MDS applications can be more efficiently integrated into the multi-service design of mobile satellite systems.

Bed load tracer mobility in a mixed bedrock/alluvial channel

NASA Astrophysics Data System (ADS)

Ferguson, R. I.; Sharma, B. P.; Hodge, R. A.; Hardy, R. J.; Warburton, J.

2017-04-01

The presence of bare or partially covered rock in an otherwise alluvial river implies a downstream change in transport capacity relative to supply. Field investigations of this change and what causes it are lacking. We used two sets of magnet-tagged tracer clasts to investigate bed load transport during the same sequence of floods in fully alluvial, bare rock, and partial-cover reaches of an upland stream. High-flow shear stresses in different reaches were calculated by using stage loggers. Tracers seeded in the upstream alluvial channel moved more slowly than elsewhere until the frontrunners reached bare rock and sped up. Tracers seeded on bare rock moved rapidly off it and accumulated just upstream from, and later in, a partial-cover zone with many boulders. The backwater effect of the boulder-rich zone is significant in reducing tracer mobility. Tracer movement over full or partial sediment cover was size selective but dispersion over bare rock was not. Along-channel changes in tracer mobility are interpreted in terms of measured differences in shear stress and estimated differences in threshold stress.

Multistage Estimation Of Frequency And Phase

NASA Technical Reports Server (NTRS)

Kumar, Rajendra

1991-01-01

Conceptual two-stage software scheme serves as prototype of multistage scheme for digital estimation of phase, frequency, and rate of change of frequency ("Doppler rate") of possibly phase-modulated received sinusoidal signal in communication system in which transmitter and/or receiver traveling rapidly, accelerating, and/or jerking severely. Each additional stage of multistage scheme provides increasingly refined estimate of frequency and phase of signal. Conceived for use in estimating parameters of signals from spacecraft and high dynamic GPS signal parameters, also applicable, to terrestrial stationary/mobile (e.g., cellular radio) and land-mobile/satellite communication systems.

Implicit approximate-factorization schemes for the low-frequency transonic equation

NASA Technical Reports Server (NTRS)

Ballhaus, W. F.; Steger, J. L.

1975-01-01

Two- and three-level implicit finite-difference algorithms for the low-frequency transonic small disturbance-equation are constructed using approximate factorization techniques. The schemes are unconditionally stable for the model linear problem. For nonlinear mixed flows, the schemes maintain stability by the use of conservatively switched difference operators for which stability is maintained only if shock propagation is restricted to be less than one spatial grid point per time step. The shock-capturing properties of the schemes were studied for various shock motions that might be encountered in problems of engineering interest. Computed results for a model airfoil problem that produces a flow field similar to that about a helicopter rotor in forward flight show the development of a shock wave and its subsequent propagation upstream off the front of the airfoil.

Tone calibration technique: A digital signaling scheme for mobile applications

NASA Technical Reports Server (NTRS)

Davarian, F.

1986-01-01

Residual carrier modulation is conventionally used in a communication link to assist the receiver with signal demodulation and detection. Although suppressed carrier modulation has a slight power advantage over the residual carrier approach in systems enjoying a high level of stability, it lacks sufficient robustness to be used in channels severely contaminated by noise, interference and propagation effects. In mobile links, in particular, the vehicle motion and multipath waveform propagation affect the received carrier in an adverse fashion. A residual carrier scheme that uses a pilot carrier to calibrate a mobile channel against multipath fading anomalies is described. The benefits of this scheme, known as tone calibration technique, are described. A brief study of the system performance in the presence of implementation anomalies is also given.

Adaptive Tracking Control for Robots With an Interneural Computing Scheme.

PubMed

Tsai, Feng-Sheng; Hsu, Sheng-Yi; Shih, Mau-Hsiang

2018-04-01

Adaptive tracking control of mobile robots requires the ability to follow a trajectory generated by a moving target. The conventional analysis of adaptive tracking uses energy minimization to study the convergence and robustness of the tracking error when the mobile robot follows a desired trajectory. However, in the case that the moving target generates trajectories with uncertainties, a common Lyapunov-like function for energy minimization may be extremely difficult to determine. Here, to solve the adaptive tracking problem with uncertainties, we wish to implement an interneural computing scheme in the design of a mobile robot for behavior-based navigation. The behavior-based navigation adopts an adaptive plan of behavior patterns learning from the uncertainties of the environment. The characteristic feature of the interneural computing scheme is the use of neural path pruning with rewards and punishment interacting with the environment. On this basis, the mobile robot can be exploited to change its coupling weights in paths of neural connections systematically, which can then inhibit or enhance the effect of flow elimination in the dynamics of the evolutionary neural network. Such dynamical flow translation ultimately leads to robust sensory-to-motor transformations adapting to the uncertainties of the environment. A simulation result shows that the mobile robot with the interneural computing scheme can perform fault-tolerant behavior of tracking by maintaining suitable behavior patterns at high frequency levels.

Energy-saving scheme based on downstream packet scheduling in ethernet passive optical networks

NASA Astrophysics Data System (ADS)

Zhang, Lincong; Liu, Yejun; Guo, Lei; Gong, Xiaoxue

2013-03-01

With increasing network sizes, the energy consumption of Passive Optical Networks (PONs) has grown significantly. Therefore, it is important to design effective energy-saving schemes in PONs. Generally, energy-saving schemes have focused on sleeping the low-loaded Optical Network Units (ONUs), which tends to bring large packet delays. Further, the traditional ONU sleep modes are not capable of sleeping the transmitter and receiver independently, though they are not required to transmit or receive packets. Clearly, this approach contributes to wasted energy. Thus, in this paper, we propose an Energy-Saving scheme that is based on downstream Packet Scheduling (ESPS) in Ethernet PON (EPON). First, we design both an algorithm and a rule for downstream packet scheduling at the inter- and intra-ONU levels, respectively, to reduce the downstream packet delay. After that, we propose a hybrid sleep mode that contains not only ONU deep sleep mode but also independent sleep modes for the transmitter and the receiver. This ensures that the energy consumed by the ONUs is minimal. To realize the hybrid sleep mode, a modified GATE control message is designed that involves 10 time points for sleep processes. In ESPS, the 10 time points are calculated according to the allocated bandwidths in both the upstream and the downstream. The simulation results show that ESPS outperforms traditional Upstream Centric Scheduling (UCS) scheme in terms of energy consumption and the average delay for both real-time and non-real-time packets downstream. The simulation results also show that the average energy consumption of each ONU in larger-sized networks is less than that in smaller-sized networks; hence, our ESPS is better suited for larger-sized networks.

A New Privacy-Preserving Handover Authentication Scheme for Wireless Networks

PubMed Central

Wang, Changji; Yuan, Yuan; Wu, Jiayuan

2017-01-01

Handover authentication is a critical issue in wireless networks, which is being used to ensure mobile nodes wander over multiple access points securely and seamlessly. A variety of handover authentication schemes for wireless networks have been proposed in the literature. Unfortunately, existing handover authentication schemes are vulnerable to a few security attacks, or incur high communication and computation costs. Recently, He et al. proposed a handover authentication scheme PairHand and claimed it can resist various attacks without rigorous security proofs. In this paper, we show that PairHand does not meet forward secrecy and strong anonymity. More seriously, it is vulnerable to key compromise attack, where an adversary can recover the private key of any mobile node. Then, we propose a new efficient and provably secure handover authentication scheme for wireless networks based on elliptic curve cryptography. Compared with existing schemes, our proposed scheme can resist key compromise attack, and achieves forward secrecy and strong anonymity. Moreover, it is more efficient in terms of computation and communication. PMID:28632171

A New Privacy-Preserving Handover Authentication Scheme for Wireless Networks.

PubMed

Wang, Changji; Yuan, Yuan; Wu, Jiayuan

2017-06-20

Handover authentication is a critical issue in wireless networks, which is being used to ensure mobile nodes wander over multiple access points securely and seamlessly. A variety of handover authentication schemes for wireless networks have been proposed in the literature. Unfortunately, existing handover authentication schemes are vulnerable to a few security attacks, or incur high communication and computation costs. Recently, He et al. proposed a handover authentication scheme PairHand and claimed it can resist various attacks without rigorous security proofs. In this paper, we show that PairHand does not meet forward secrecy and strong anonymity. More seriously, it is vulnerable to key compromise attack, where an adversary can recover the private key of any mobile node. Then, we propose a new efficient and provably secure handover authentication scheme for wireless networks based on elliptic curve cryptography. Compared with existing schemes, our proposed scheme can resist key compromise attack, and achieves forward secrecy and strong anonymity. Moreover, it is more efficient in terms of computation and communication.

Determining the Impact of Personal Mobility Carbon Allowance Schemes in Transportation Networks

DOE PAGES

Aziz, H. M. Abdul; Ukkusuri, Satish V.; Zhan, Xianyuan

2016-10-17

We know that personal mobility carbon allowance (PMCA) schemes are designed to reduce carbon consumption from transportation networks. PMCA schemes influence the travel decision process of users and accordingly impact the system metrics including travel time and greenhouse gas (GHG) emissions. Here, we develop a multi-user class dynamic user equilibrium model to evaluate the transportation system performance when PMCA scheme is implemented. The results using Sioux-Falls test network indicate that PMCA schemes can achieve the emissions reduction goals for transportation networks. Further, users characterized by high value of travel time are found to be less sensitive to carbon budget inmore » the context of work trips. Results also show that PMCA scheme can lead to higher emissions for a path compared with the case without PMCA because of flow redistribution. The developed network equilibrium model allows us to examine the change in system states at different carbon allocation levels and to design parameters of PMCA schemes accounting for population heterogeneity.« less

Determining the Impact of Personal Mobility Carbon Allowance Schemes in Transportation Networks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aziz, H. M. Abdul; Ukkusuri, Satish V.; Zhan, Xianyuan

We know that personal mobility carbon allowance (PMCA) schemes are designed to reduce carbon consumption from transportation networks. PMCA schemes influence the travel decision process of users and accordingly impact the system metrics including travel time and greenhouse gas (GHG) emissions. Here, we develop a multi-user class dynamic user equilibrium model to evaluate the transportation system performance when PMCA scheme is implemented. The results using Sioux-Falls test network indicate that PMCA schemes can achieve the emissions reduction goals for transportation networks. Further, users characterized by high value of travel time are found to be less sensitive to carbon budget inmore » the context of work trips. Results also show that PMCA scheme can lead to higher emissions for a path compared with the case without PMCA because of flow redistribution. The developed network equilibrium model allows us to examine the change in system states at different carbon allocation levels and to design parameters of PMCA schemes accounting for population heterogeneity.« less

A lightweight and secure two factor anonymous authentication protocol for Global Mobility Networks.

PubMed

Baig, Ahmed Fraz; Hassan, Khwaja Mansoor Ul; Ghani, Anwar; Chaudhry, Shehzad Ashraf; Khan, Imran; Ashraf, Muhammad Usman

2018-01-01

Global Mobility Networks(GLOMONETs) in wireless communication permits the global roaming services that enable a user to leverage the mobile services in any foreign country. Technological growth in wireless communication is also accompanied by new security threats and challenges. A threat-proof authentication protocol in wireless communication may overcome the security flaws by allowing only legitimate users to access a particular service. Recently, Lee et al. found Mun et al. scheme vulnerable to different attacks and proposed an advanced secure scheme to overcome the security flaws. However, this article points out that Lee et al. scheme lacks user anonymity, inefficient user authentication, vulnerable to replay and DoS attacks and Lack of local password verification. Furthermore, this article presents a more robust anonymous authentication scheme to handle the threats and challenges found in Lee et al.'s protocol. The proposed protocol is formally verified with an automated tool(ProVerif). The proposed protocol has superior efficiency in comparison to the existing protocols.

A lightweight and secure two factor anonymous authentication protocol for Global Mobility Networks

PubMed Central

2018-01-01

Global Mobility Networks(GLOMONETs) in wireless communication permits the global roaming services that enable a user to leverage the mobile services in any foreign country. Technological growth in wireless communication is also accompanied by new security threats and challenges. A threat-proof authentication protocol in wireless communication may overcome the security flaws by allowing only legitimate users to access a particular service. Recently, Lee et al. found Mun et al. scheme vulnerable to different attacks and proposed an advanced secure scheme to overcome the security flaws. However, this article points out that Lee et al. scheme lacks user anonymity, inefficient user authentication, vulnerable to replay and DoS attacks and Lack of local password verification. Furthermore, this article presents a more robust anonymous authentication scheme to handle the threats and challenges found in Lee et al.’s protocol. The proposed protocol is formally verified with an automated tool(ProVerif). The proposed protocol has superior efficiency in comparison to the existing protocols. PMID:29702675

Enhancement of the Open National Combustion Code (OpenNCC) and Initial Simulation of Energy Efficient Engine Combustor

NASA Technical Reports Server (NTRS)

Miki, Kenji; Moder, Jeff; Liou, Meng-Sing

2016-01-01

In this paper, we present the recent enhancement of the Open National Combustion Code (OpenNCC) and apply the OpenNCC to model a realistic combustor configuration (Energy Efficient Engine (E3)). First, we perform a series of validation tests for the newly-implemented advection upstream splitting method (AUSM) and the extended version of the AUSM-family schemes (AUSM+-up). Compared with the analytical/experimental data of the validation tests, we achieved good agreement. In the steady-state E3 cold flow results using the Reynolds-averaged Navier-Stokes(RANS), we find a noticeable difference in the flow fields calculated by the two different numerical schemes, the standard Jameson- Schmidt-Turkel (JST) scheme and the AUSM scheme. The main differences are that the AUSM scheme is less numerical dissipative and it predicts much stronger reverse flow in the recirculation zone. This study indicates that two schemes could show different flame-holding predictions and overall flame structures.

Dual adaptive dynamic control of mobile robots using neural networks.

PubMed

Bugeja, Marvin K; Fabri, Simon G; Camilleri, Liberato

2009-02-01

This paper proposes two novel dual adaptive neural control schemes for the dynamic control of nonholonomic mobile robots. The two schemes are developed in discrete time, and the robot's nonlinear dynamic functions are assumed to be unknown. Gaussian radial basis function and sigmoidal multilayer perceptron neural networks are used for function approximation. In each scheme, the unknown network parameters are estimated stochastically in real time, and no preliminary offline neural network training is used. In contrast to other adaptive techniques hitherto proposed in the literature on mobile robots, the dual control laws presented in this paper do not rely on the heuristic certainty equivalence property but account for the uncertainty in the estimates. This results in a major improvement in tracking performance, despite the plant uncertainty and unmodeled dynamics. Monte Carlo simulation and statistical hypothesis testing are used to illustrate the effectiveness of the two proposed stochastic controllers as applied to the trajectory-tracking problem of a differentially driven wheeled mobile robot.

Evaluation of Euler fluxes by a high-order CFD scheme: shock instability

NASA Astrophysics Data System (ADS)

Tu, Guohua; Zhao, Xiaohui; Mao, Meiliang; Chen, Jianqiang; Deng, Xiaogang; Liu, Huayong

2014-05-01

The construction of Euler fluxes is an important step in shock-capturing/upwind schemes. It is well known that unsuitable fluxes are responsible for many shock anomalies, such as the carbuncle phenomenon. Three kinds of flux vector splittings (FVSs) as well as three kinds of flux difference splittings (FDSs) are evaluated for the shock instability by a fifth-order weighted compact nonlinear scheme. The three FVSs are Steger-Warming splitting, van Leer splitting and kinetic flux vector splitting (KFVS). The three FDSs are Roe's splitting, advection upstream splitting method (AUSM) type splitting and Harten-Lax-van Leer (HLL) type splitting. Numerical results indicate that FVSs and high dissipative FDSs undergo a relative lower risk on the shock instability than that of low dissipative FDSs. However, none of the fluxes evaluated in the present study can entirely avoid the shock instability. Generally, the shock instability may be caused by any of the following factors: low dissipation, high Mach number, unsuitable grid distribution, large grid aspect ratio, and the relative shock-internal flow state (or position) between upstream and downstream shock waves. It comes out that the most important factor is the relative shock-internal state. If the shock-internal state is closer to the downstream state, the computation is at higher susceptibility to the shock instability. Wall-normal grid distribution has a greater influence on the shock instability than wall-azimuthal grid distribution because wall-normal grids directly impact on the shock-internal position. High shock intensity poses a high risk on the shock instability, but its influence is not as much as the shock-internal state. Large grid aspect ratio is also a source of the shock instability. Some results of a second-order scheme and a first-order scheme are also given. The comparison between the high-order scheme and the two low-order schemes indicates that high-order schemes are at a higher risk of the shock instability. Adding an entropy fix is very helpful in suppressing the shock instability for the two low-order schemes. When the high-order scheme is used, the entropy fix still works well for Roe's flux, but its effect on the Steger-Warming flux is trivial and not much clear.

Pseudo-coherent demodulation for mobile satellite systems

NASA Technical Reports Server (NTRS)

Divsalar, Dariush; Simon, Marvin K.

1993-01-01

This paper proposes three so-called pseudo-coherent demodulation schemes for use in land mobile satellite channels. The schemes are derived based on maximum likelihood (ML) estimation and detection of an N-symbol observation of the received signal. Simulation results for all three demodulators are presented to allow comparison with the performance of differential PSK (DPSK) and ideal coherent demodulation for various system parameter sets of practical interest.

Multi-Source Cooperative Data Collection with a Mobile Sink for the Wireless Sensor Network.

PubMed

Han, Changcai; Yang, Jinsheng

2017-10-30

The multi-source cooperation integrating distributed low-density parity-check codes is investigated to jointly collect data from multiple sensor nodes to the mobile sink in the wireless sensor network. The one-round and two-round cooperative data collection schemes are proposed according to the moving trajectories of the sink node. Specifically, two sparse cooperation models are firstly formed based on geographical locations of sensor source nodes, the impairment of inter-node wireless channels and moving trajectories of the mobile sink. Then, distributed low-density parity-check codes are devised to match the directed graphs and cooperation matrices related with the cooperation models. In the proposed schemes, each source node has quite low complexity attributed to the sparse cooperation and the distributed processing. Simulation results reveal that the proposed cooperative data collection schemes obtain significant bit error rate performance and the two-round cooperation exhibits better performance compared with the one-round scheme. The performance can be further improved when more source nodes participate in the sparse cooperation. For the two-round data collection schemes, the performance is evaluated for the wireless sensor networks with different moving trajectories and the variant data sizes.

Multi-Source Cooperative Data Collection with a Mobile Sink for the Wireless Sensor Network

PubMed Central

Han, Changcai; Yang, Jinsheng

2017-01-01

The multi-source cooperation integrating distributed low-density parity-check codes is investigated to jointly collect data from multiple sensor nodes to the mobile sink in the wireless sensor network. The one-round and two-round cooperative data collection schemes are proposed according to the moving trajectories of the sink node. Specifically, two sparse cooperation models are firstly formed based on geographical locations of sensor source nodes, the impairment of inter-node wireless channels and moving trajectories of the mobile sink. Then, distributed low-density parity-check codes are devised to match the directed graphs and cooperation matrices related with the cooperation models. In the proposed schemes, each source node has quite low complexity attributed to the sparse cooperation and the distributed processing. Simulation results reveal that the proposed cooperative data collection schemes obtain significant bit error rate performance and the two-round cooperation exhibits better performance compared with the one-round scheme. The performance can be further improved when more source nodes participate in the sparse cooperation. For the two-round data collection schemes, the performance is evaluated for the wireless sensor networks with different moving trajectories and the variant data sizes. PMID:29084155

Key Management Scheme Based on Route Planning of Mobile Sink in Wireless Sensor Networks.

PubMed

Zhang, Ying; Liang, Jixing; Zheng, Bingxin; Jiang, Shengming; Chen, Wei

2016-01-29

In many wireless sensor network application scenarios the key management scheme with a Mobile Sink (MS) should be fully investigated. This paper proposes a key management scheme based on dynamic clustering and optimal-routing choice of MS. The concept of Traveling Salesman Problem with Neighbor areas (TSPN) in dynamic clustering for data exchange is proposed, and the selection probability is used in MS route planning. The proposed scheme extends static key management to dynamic key management by considering the dynamic clustering and mobility of MSs, which can effectively balance the total energy consumption during the activities. Considering the different resources available to the member nodes and sink node, the session key between cluster head and MS is established by modified an ECC encryption with Diffie-Hellman key exchange (ECDH) algorithm and the session key between member node and cluster head is built with a binary symmetric polynomial. By analyzing the security of data storage, data transfer and the mechanism of dynamic key management, the proposed scheme has more advantages to help improve the resilience of the key management system of the network on the premise of satisfying higher connectivity and storage efficiency.

A Chaos MIMO-OFDM Scheme for Mobile Communication with Physical-Layer Security

NASA Astrophysics Data System (ADS)

Okamoto, Eiji

Chaos communications enable a physical-layer security, which can enhance the transmission security in combining with upper-layer encryption techniques, or can omit the upper-layer secure protocol and enlarges the transmission efficiency. However, the chaos communication usually degrades the error rate performance compared to unencrypted digital modulations. To achieve both physical-layer security and channel coding gain, we have proposed a chaos multiple-input multiple-output (MIMO) scheme in which a rate-one chaos convolution is applied to MIMO multiplexing. However, in the conventional study only flat fading is considered. To apply this scheme to practical mobile environments, i.e., multipath fading channels, we propose a chaos MIMO-orthogonal frequency division multi-plexing (OFDM) scheme and show its effectiveness through computer simulations.

Suppression of pattern dependence in 10 Gbps upstream transmission of WDM-PON with RSOA-based ONUs

NASA Astrophysics Data System (ADS)

Zhang, Min; Wang, Danshi; Cao, Zhihui; Chen, Xue; Huang, Shanguo

2013-11-01

The finite gain recovery time of the reflective semiconductor optical amplifier (RSOA) causes distortion and pattern dependence at high bit rates in colorless optical network units (ONUs) of WDM passive optical network (WDN-PON). We propose and demonstrate a scheme of upstream transmission of 10 Gbps NRZ signals directly modulated via a RSOA in a 25 km single fiber, where we use a fiber Bragg grating (FBG) as an offset filter to suppress the pattern dependence and improve the RSOA modulation bandwidth. Both experimental and simulation results are provided, which are useful results for designing cost-effective colorless transceivers.

Simplified flexible-PON upstream transmission using pulse position modulation at ONU and DSP-enabled soft-combining at OLT for adaptive link budgets.

PubMed

Liu, Xiang; Effenberger, Frank; Chand, Naresh

2015-03-09

We demonstrate a flexible modulation and detection scheme for upstream transmission in passive optical networks using pulse position modulation at optical network unit, facilitating burst-mode detection with automatic decision threshold tracking, and DSP-enabled soft-combining at optical line terminal. Adaptive receiver sensitivities of -33.1 dBm, -36.6 dBm and -38.3 dBm at a bit error ratio of 10(-4) are respectively achieved for 2.5 Gb/s, 1.25 Gb/s and 625 Mb/s after transmission over a 20-km standard single-mode fiber without any optical amplification.

Trellis-coded CPM for satellite-based mobile communications

NASA Technical Reports Server (NTRS)

Abrishamkar, Farrokh; Biglieri, Ezio

1988-01-01

Digital transmission for satellite-based land mobile communications is discussed. To satisfy the power and bandwidth limitations imposed on such systems, a combination of trellis coding and continuous-phase modulated signals are considered. Some schemes based on this idea are presented, and their performance is analyzed by computer simulation. The results obtained show that a scheme based on directional detection and Viterbi decoding appears promising for practical applications.

Distributed Sensor Nodes Charged by Mobile Charger with Directional Antenna and by Energy Trading for Balancing.

PubMed

Moraes, Celso; Myung, Sunghee; Lee, Sangkeum; Har, Dongsoo

2017-01-10

Provision of energy to wireless sensor networks is crucial for their sustainable operation. Sensor nodes are typically equipped with batteries as their operating energy sources. However, when the sensor nodes are sited in almost inaccessible locations, replacing their batteries incurs high maintenance cost. Under such conditions, wireless charging of sensor nodes by a mobile charger with an antenna can be an efficient solution. When charging distributed sensor nodes, a directional antenna, rather than an omnidirectional antenna, is more energy-efficient because of smaller proportion of off-target radiation. In addition, for densely distributed sensor nodes, it can be more effective for some undercharged sensor nodes to harvest energy from neighboring overcharged sensor nodes than from the remote mobile charger, because this reduces the pathloss of charging signal due to smaller distances. In this paper, we propose a hybrid charging scheme that combines charging by a mobile charger with a directional antenna, and energy trading, e.g., transferring and harvesting, between neighboring sensor nodes. The proposed scheme is compared with other charging scheme. Simulations demonstrate that the hybrid charging scheme with a directional antenna achieves a significant reduction in the total charging time required for all sensor nodes to reach a target energy level.

Distributed Sensor Nodes Charged by Mobile Charger with Directional Antenna and by Energy Trading for Balancing

PubMed Central

Moraes, Celso; Myung, Sunghee; Lee, Sangkeum; Har, Dongsoo

2017-01-01

Provision of energy to wireless sensor networks is crucial for their sustainable operation. Sensor nodes are typically equipped with batteries as their operating energy sources. However, when the sensor nodes are sited in almost inaccessible locations, replacing their batteries incurs high maintenance cost. Under such conditions, wireless charging of sensor nodes by a mobile charger with an antenna can be an efficient solution. When charging distributed sensor nodes, a directional antenna, rather than an omnidirectional antenna, is more energy-efficient because of smaller proportion of off-target radiation. In addition, for densely distributed sensor nodes, it can be more effective for some undercharged sensor nodes to harvest energy from neighboring overcharged sensor nodes than from the remote mobile charger, because this reduces the pathloss of charging signal due to smaller distances. In this paper, we propose a hybrid charging scheme that combines charging by a mobile charger with a directional antenna, and energy trading, e.g., transferring and harvesting, between neighboring sensor nodes. The proposed scheme is compared with other charging scheme. Simulations demonstrate that the hybrid charging scheme with a directional antenna achieves a significant reduction in the total charging time required for all sensor nodes to reach a target energy level. PMID:28075372

Hybrid Packet-Pheromone-Based Probabilistic Routing for Mobile Ad Hoc Networks

NASA Astrophysics Data System (ADS)

Kashkouli Nejad, Keyvan; Shawish, Ahmed; Jiang, Xiaohong; Horiguchi, Susumu

Ad-Hoc networks are collections of mobile nodes communicating using wireless media without any fixed infrastructure. Minimal configuration and quick deployment make Ad-Hoc networks suitable for emergency situations like natural disasters or military conflicts. The current Ad-Hoc networks can only support either high mobility or high transmission rate at a time because they employ static approaches in their routing schemes. However, due to the continuous expansion of the Ad-Hoc network size, node-mobility and transmission rate, the development of new adaptive and dynamic routing schemes has become crucial. In this paper we propose a new routing scheme to support high transmission rates and high node-mobility simultaneously in a big Ad-Hoc network, by combining a new proposed packet-pheromone-based approach with the Hint Based Probabilistic Protocol (HBPP) for congestion avoidance with dynamic path selection in packet forwarding process. Because of using the available feedback information, the proposed algorithm does not introduce any additional overhead. The extensive simulation-based analysis conducted in this paper indicates that the proposed algorithm offers small packet-latency and achieves a significantly higher delivery probability in comparison with the available Hint-Based Probabilistic Protocol (HBPP).

A Fine-Grained and Privacy-Preserving Query Scheme for Fog Computing-Enhanced Location-Based Service

PubMed Central

Yin, Fan; Tang, Xiaohu

2017-01-01

Location-based services (LBS), as one of the most popular location-awareness applications, has been further developed to achieve low-latency with the assistance of fog computing. However, privacy issues remain a research challenge in the context of fog computing. Therefore, in this paper, we present a fine-grained and privacy-preserving query scheme for fog computing-enhanced location-based services, hereafter referred to as FGPQ. In particular, mobile users can obtain the fine-grained searching result satisfying not only the given spatial range but also the searching content. Detailed privacy analysis shows that our proposed scheme indeed achieves the privacy preservation for the LBS provider and mobile users. In addition, extensive performance analyses and experiments demonstrate that the FGPQ scheme can significantly reduce computational and communication overheads and ensure the low-latency, which outperforms existing state-of-the art schemes. Hence, our proposed scheme is more suitable for real-time LBS searching. PMID:28696395

A Fine-Grained and Privacy-Preserving Query Scheme for Fog Computing-Enhanced Location-Based Service.

PubMed

Yang, Xue; Yin, Fan; Tang, Xiaohu

2017-07-11

Location-based services (LBS), as one of the most popular location-awareness applications, has been further developed to achieve low-latency with the assistance of fog computing. However, privacy issues remain a research challenge in the context of fog computing. Therefore, in this paper, we present a fine-grained and privacy-preserving query scheme for fog computing-enhanced location-based services, hereafter referred to as FGPQ. In particular, mobile users can obtain the fine-grained searching result satisfying not only the given spatial range but also the searching content. Detailed privacy analysis shows that our proposed scheme indeed achieves the privacy preservation for the LBS provider and mobile users. In addition, extensive performance analyses and experiments demonstrate that the FGPQ scheme can significantly reduce computational and communication overheads and ensure the low-latency, which outperforms existing state-of-the art schemes. Hence, our proposed scheme is more suitable for real-time LBS searching.

Mobility management techniques for the next-generation wireless networks

NASA Astrophysics Data System (ADS)

Sun, Junzhao; Howie, Douglas P.; Sauvola, Jaakko J.

2001-10-01

The tremendous demands from social market are pushing the booming development of mobile communications faster than ever before, leading to plenty of new advanced techniques emerging. With the converging of mobile and wireless communications with Internet services, the boundary between mobile personal telecommunications and wireless computer networks is disappearing. Wireless networks of the next generation need the support of all the advances on new architectures, standards, and protocols. Mobility management is an important issue in the area of mobile communications, which can be best solved at the network layer. One of the key features of the next generation wireless networks is all-IP infrastructure. This paper discusses the mobility management schemes for the next generation mobile networks through extending IP's functions with mobility support. A global hierarchical framework model for the mobility management of wireless networks is presented, in which the mobility management is divided into two complementary tasks: macro mobility and micro mobility. As the macro mobility solution, a basic principle of Mobile IP is introduced, together with the optimal schemes and the advances in IPv6. The disadvantages of the Mobile IP on solving the micro mobility problem are analyzed, on the basis of which three main proposals are discussed as the micro mobility solutions for mobile communications, including Hierarchical Mobile IP (HMIP), Cellular IP, and Handoff-Aware Wireless Access Internet Infrastructure (HAWAII). A unified model is also described in which the different micro mobility solutions can coexist simultaneously in mobile networks.

Extended bounds limiter for high-order finite-volume schemes on unstructured meshes

NASA Astrophysics Data System (ADS)

Tsoutsanis, Panagiotis

2018-06-01

This paper explores the impact of the definition of the bounds of the limiter proposed by Michalak and Ollivier-Gooch in [56] (2009), for higher-order Monotone-Upstream Central Scheme for Conservation Laws (MUSCL) numerical schemes on unstructured meshes in the finite-volume (FV) framework. A new modification of the limiter is proposed where the bounds are redefined by utilising all the spatial information provided by all the elements in the reconstruction stencil. Numerical results obtained on smooth and discontinuous test problems of the Euler equations on unstructured meshes, highlight that the newly proposed extended bounds limiter exhibits superior performance in terms of accuracy and mesh sensitivity compared to the cell-based or vertex-based bounds implementations.

Three-Factor User Authentication and Key Agreement Using Elliptic Curve Cryptosystem in Wireless Sensor Networks.

PubMed

Park, YoHan; Park, YoungHo

2016-12-14

Secure communication is a significant issue in wireless sensor networks. User authentication and key agreement are essential for providing a secure system, especially in user-oriented mobile services. It is also necessary to protect the identity of each individual in wireless environments to avoid personal privacy concerns. Many authentication and key agreement schemes utilize a smart card in addition to a password to support security functionalities. However, these schemes often fail to provide security along with privacy. In 2015, Chang et al. analyzed the security vulnerabilities of previous schemes and presented the two-factor authentication scheme that provided user privacy by using dynamic identities. However, when we cryptanalyzed Chang et al.'s scheme, we found that it does not provide sufficient security for wireless sensor networks and fails to provide accurate password updates. This paper proposes a security-enhanced authentication and key agreement scheme to overcome these security weaknesses using biometric information and an elliptic curve cryptosystem. We analyze the security of the proposed scheme against various attacks and check its viability in the mobile environment.

A Novel Physical Layer Assisted Authentication Scheme for Mobile Wireless Sensor Networks

PubMed Central

Wang, Qiuhua

2017-01-01

Physical-layer authentication can address physical layer vulnerabilities and security threats in wireless sensor networks, and has been considered as an effective complementary enhancement to existing upper-layer authentication mechanisms. In this paper, to advance the existing research and improve the authentication performance, we propose a novel physical layer assisted authentication scheme for mobile wireless sensor networks. In our proposed scheme, we explore the reciprocity and spatial uncorrelation of the wireless channel to verify the identities of involved transmitting users and decide whether all data frames are from the same sender. In our proposed scheme, a new method is developed for the legitimate users to compare their received signal strength (RSS) records, which avoids the information from being disclosed to the adversary. Our proposed scheme can detect the spoofing attack even in a high dynamic environment. We evaluate our scheme through experiments under indoor and outdoor environments. Experiment results show that our proposed scheme is more efficient and achieves a higher detection rate as well as keeping a lower false alarm rate. PMID:28165423

Three-Factor User Authentication and Key Agreement Using Elliptic Curve Cryptosystem in Wireless Sensor Networks

PubMed Central

Park, YoHan; Park, YoungHo

2016-01-01

Secure communication is a significant issue in wireless sensor networks. User authentication and key agreement are essential for providing a secure system, especially in user-oriented mobile services. It is also necessary to protect the identity of each individual in wireless environments to avoid personal privacy concerns. Many authentication and key agreement schemes utilize a smart card in addition to a password to support security functionalities. However, these schemes often fail to provide security along with privacy. In 2015, Chang et al. analyzed the security vulnerabilities of previous schemes and presented the two-factor authentication scheme that provided user privacy by using dynamic identities. However, when we cryptanalyzed Chang et al.’s scheme, we found that it does not provide sufficient security for wireless sensor networks and fails to provide accurate password updates. This paper proposes a security-enhanced authentication and key agreement scheme to overcome these security weaknesses using biometric information and an elliptic curve cryptosystem. We analyze the security of the proposed scheme against various attacks and check its viability in the mobile environment. PMID:27983616

A Novel Physical Layer Assisted Authentication Scheme for Mobile Wireless Sensor Networks.

PubMed

Wang, Qiuhua

2017-02-04

Physical-layer authentication can address physical layer vulnerabilities and security threats in wireless sensor networks, and has been considered as an effective complementary enhancement to existing upper-layer authentication mechanisms. In this paper, to advance the existing research and improve the authentication performance, we propose a novel physical layer assisted authentication scheme for mobile wireless sensor networks. In our proposed scheme, we explore the reciprocity and spatial uncorrelation of the wireless channel to verify the identities of involved transmitting users and decide whether all data frames are from the same sender. In our proposed scheme, a new method is developed for the legitimate users to compare their received signal strength (RSS) records, which avoids the information from being disclosed to the adversary. Our proposed scheme can detect the spoofing attack even in a high dynamic environment. We evaluate our scheme through experiments under indoor and outdoor environments. Experiment results show that our proposed scheme is more efficient and achieves a higher detection rate as well as keeping a lower false alarm rate.

Optical beat interference noise reduction in OFDMA optical access link using self-homodyne balanced detection

NASA Astrophysics Data System (ADS)

Jung, Sang-Min; Won, Yong-Yuk; Han, Sang-Kook

2013-12-01

A Novel technique for reducing the OBI noise in optical OFDMA-PON uplink is presented. OFDMA is a multipleaccess/ multiplexing scheme that can provide multiplexing operation of user data streams onto the downlink sub-channels and uplink multiple access by means of dividing OFDM subcarriers as sub-channels. The main issue of high-speed, single-wavelength upstream OFDMA-PON arises from optical beating interference noise. Because the sub-channels are allocated dynamically to multiple access users over same nominal wavelength, it generates the optical beating interference among upstream signals. In this paper, we proposed a novel scheme using self-homodyne balanced detection in the optical line terminal (OLT) to reduce OBI noise which is generated in the uplink transmission of OFDMA-PON system. When multiple OFDMA sub-channels over the same nominal wavelength are received at the same time in the proposed architecture, OBI noises can be removed using balanced detection. Using discrete multitone modulation (DMT) to generate real valued OFDM signals, the proposed technique is verified through experimental demonstration.

Integrated data lookup and replication scheme in mobile ad hoc networks

NASA Astrophysics Data System (ADS)

Chen, Kai; Nahrstedt, Klara

2001-11-01

Accessing remote data is a challenging task in mobile ad hoc networks. Two problems have to be solved: (1) how to learn about available data in the network; and (2) how to access desired data even when the original copy of the data is unreachable. In this paper, we develop an integrated data lookup and replication scheme to solve these problems. In our scheme, a group of mobile nodes collectively host a set of data to improve data accessibility for all members of the group. They exchange data availability information by broadcasting advertising (ad) messages to the group using an adaptive sending rate policy. The ad messages are used by other nodes to derive a local data lookup table, and to reduce data redundancy within a connected group. Our data replication scheme predicts group partitioning based on each node's current location and movement patterns, and replicates data to other partitions before partitioning occurs. Our simulations show that data availability information can quickly propagate throughout the network, and that the successful data access ratio of each node is significantly improved.

FPGA implementation cost and performance evaluation of IEEE 802.11 protocol encryption security schemes

NASA Astrophysics Data System (ADS)

Sklavos, N.; Selimis, G.; Koufopavlou, O.

2005-01-01

The explosive growth of internet and consumer demand for mobility has fuelled the exponential growth of wireless communications and networks. Mobile users want access to services and information, from both internet and personal devices, from a range of locations without the use of a cable medium. IEEE 802.11 is one of the most widely used wireless standards of our days. The amount of access and mobility into wireless networks requires a security infrastructure that protects communication within that network. The security of this protocol is based on the wired equivalent privacy (WEP) scheme. Currently, all the IEEE 802.11 market products support WEP. But recently, the 802.11i working group introduced the advanced encryption standard (AES), as the security scheme for the future IEEE 802.11 applications. In this paper, the hardware integrations of WEP and AES are studied. A field programmable gate array (FPGA) device has been used as the hardware implementation platform, for a fair comparison between the two security schemes. Measurements for the FPGA implementation cost, operating frequency, power consumption and performance are given.

A Reverse Localization Scheme for Underwater Acoustic Sensor Networks

PubMed Central

Moradi, Marjan; Rezazadeh, Javad; Ismail, Abdul Samad

2012-01-01

Underwater Wireless Sensor Networks (UWSNs) provide new opportunities to observe and predict the behavior of aquatic environments. In some applications like target tracking or disaster prevention, sensed data is meaningless without location information. In this paper, we propose a novel 3D centralized, localization scheme for mobile underwater wireless sensor network, named Reverse Localization Scheme or RLS in short. RLS is an event-driven localization method triggered by detector sensors for launching localization process. RLS is suitable for surveillance applications that require very fast reactions to events and could report the location of the occurrence. In this method, mobile sensor nodes report the event toward the surface anchors as soon as they detect it. They do not require waiting to receive location information from anchors. Simulation results confirm that the proposed scheme improves the energy efficiency and reduces significantly localization response time with a proper level of accuracy in terms of mobility model of water currents. Major contributions of this method lie on reducing the numbers of message exchange for localization, saving the energy and decreasing the average localization response time. PMID:22666034

A reverse localization scheme for underwater acoustic sensor networks.

PubMed

Moradi, Marjan; Rezazadeh, Javad; Ismail, Abdul Samad

2012-01-01

Underwater Wireless Sensor Networks (UWSNs) provide new opportunities to observe and predict the behavior of aquatic environments. In some applications like target tracking or disaster prevention, sensed data is meaningless without location information. In this paper, we propose a novel 3D centralized, localization scheme for mobile underwater wireless sensor network, named Reverse Localization Scheme or RLS in short. RLS is an event-driven localization method triggered by detector sensors for launching localization process. RLS is suitable for surveillance applications that require very fast reactions to events and could report the location of the occurrence. In this method, mobile sensor nodes report the event toward the surface anchors as soon as they detect it. They do not require waiting to receive location information from anchors. Simulation results confirm that the proposed scheme improves the energy efficiency and reduces significantly localization response time with a proper level of accuracy in terms of mobility model of water currents. Major contributions of this method lie on reducing the numbers of message exchange for localization, saving the energy and decreasing the average localization response time.

Cooperative Position Aware Mobility Pattern of AUVs for Avoiding Void Zones in Underwater WSNs.

PubMed

Javaid, Nadeem; Ejaz, Mudassir; Abdul, Wadood; Alamri, Atif; Almogren, Ahmad; Niaz, Iftikhar Azim; Guizani, Nadra

2017-03-13

In this paper, we propose two schemes; position-aware mobility pattern (PAMP) and cooperative PAMP (Co PAMP). The first one is an optimization scheme that avoids void hole occurrence and minimizes the uncertainty in the position estimation of glider's. The second one is a cooperative routing scheme that reduces the packet drop ratio by using the relay cooperation. Both techniques use gliders that stay at sojourn positions for a predefined time, at sojourn position self-confidence (s-confidence) and neighbor-confidence (n-confidence) regions that are estimated for balanced energy consumption. The transmission power of a glider is adjusted according to those confidence regions. Simulation results show that our proposed schemes outperform the compared existing one in terms of packet delivery ratio, void zones and energy consumption.

Personal Information Search on Mobile Devices

DTIC Science & Technology

2007-09-01

Networking .....................28 a. Bluetooth ...............................28 b. Infrared ................................29 2. Mobile Data...Also in this chapter, the connection techniques and schemes including Bluetooth , GPRS, Wi-Fi will be discussed. Chapter IV is devoted to a...characteristics of mobile devices. Recent advances in networking technologies such as 802.11 and Bluetooth enable these new mobile devices to connect to

An Overview and Analysis of Mobile Internet Protocols in Cellular Environments.

ERIC Educational Resources Information Center

Chao, Han-Chieh

2001-01-01

Notes that cellular is the inevitable future architecture for the personal communication service system. Discusses the current cellular support based on Mobile Internet Protocol version 6 (Ipv6) and points out the shortfalls of using Mobile IP. Highlights protocols especially for mobile management schemes which can optimize a high-speed mobile…

Optimal JPWL Forward Error Correction Rate Allocation for Robust JPEG 2000 Images and Video Streaming over Mobile Ad Hoc Networks

NASA Astrophysics Data System (ADS)

Agueh, Max; Diouris, Jean-François; Diop, Magaye; Devaux, François-Olivier; De Vleeschouwer, Christophe; Macq, Benoit

2008-12-01

Based on the analysis of real mobile ad hoc network (MANET) traces, we derive in this paper an optimal wireless JPEG 2000 compliant forward error correction (FEC) rate allocation scheme for a robust streaming of images and videos over MANET. The packet-based proposed scheme has a low complexity and is compliant to JPWL, the 11th part of the JPEG 2000 standard. The effectiveness of the proposed method is evaluated using a wireless Motion JPEG 2000 client/server application; and the ability of the optimal scheme to guarantee quality of service (QoS) to wireless clients is demonstrated.

Adaptive MANET multipath routing algorithm based on the simulated annealing approach.

PubMed

Kim, Sungwook

2014-01-01

Mobile ad hoc network represents a system of wireless mobile nodes that can freely and dynamically self-organize network topologies without any preexisting communication infrastructure. Due to characteristics like temporary topology and absence of centralized authority, routing is one of the major issues in ad hoc networks. In this paper, a new multipath routing scheme is proposed by employing simulated annealing approach. The proposed metaheuristic approach can achieve greater and reciprocal advantages in a hostile dynamic real world network situation. Therefore, the proposed routing scheme is a powerful method for finding an effective solution into the conflict mobile ad hoc network routing problem. Simulation results indicate that the proposed paradigm adapts best to the variation of dynamic network situations. The average remaining energy, network throughput, packet loss probability, and traffic load distribution are improved by about 10%, 10%, 5%, and 10%, respectively, more than the existing schemes.

Reducing the Handover Delay in FMIPv6 Using Proactive Care-of Address Scheme

NASA Astrophysics Data System (ADS)

Li, Yong; Jin, Depeng; Su, Li; Zeng, Lieguang

To deal with the increasing number of mobile devices accessing the Internet and the increasing demands of mobility management, IETF has proposed Mobile IPv6 and its fast handover protocol FMIPv6. In FMIPv6, the possibility of Care-of Address (CoA) collision and the time for Return Routability (RR) procedure result in long handover delay, which makes it unsuitable for real-time applications. In this paper, we propose an improved handover scheme for FMIPv6, which reduces the handover delay by using proactive CoA acquisition, configuration and test method. In our proposal, collision-free CoA is proactively prepared, and the time for RR procedure does not contribute to the handover delay. Furthermore, we analyze our proposal's benefits and overhead tradeoff. The numerical results demonstrate that it outperforms the current schemes, such as FMIPv6 and enhanced FMIPv6, on the aspect of handover delay and packet transmission delay.

Greedy data transportation scheme with hard packet deadlines for wireless ad hoc networks.

PubMed

Lee, HyungJune

2014-01-01

We present a greedy data transportation scheme with hard packet deadlines in ad hoc sensor networks of stationary nodes and multiple mobile nodes with scheduled trajectory path and arrival time. In the proposed routing strategy, each stationary ad hoc node en route decides whether to relay a shortest-path stationary node toward destination or a passing-by mobile node that will carry closer to destination. We aim to utilize mobile nodes to minimize the total routing cost as far as the selected route can satisfy the end-to-end packet deadline. We evaluate our proposed routing algorithm in terms of routing cost, packet delivery ratio, packet delivery time, and usability of mobile nodes based on network level simulations. Simulation results show that our proposed algorithm fully exploits the remaining time till packet deadline to turn into networking benefits of reducing the overall routing cost and improving packet delivery performance. Also, we demonstrate that the routing scheme guarantees packet delivery with hard deadlines, contributing to QoS improvement in various network services.

Greedy Data Transportation Scheme with Hard Packet Deadlines for Wireless Ad Hoc Networks

PubMed Central

Lee, HyungJune

2014-01-01

We present a greedy data transportation scheme with hard packet deadlines in ad hoc sensor networks of stationary nodes and multiple mobile nodes with scheduled trajectory path and arrival time. In the proposed routing strategy, each stationary ad hoc node en route decides whether to relay a shortest-path stationary node toward destination or a passing-by mobile node that will carry closer to destination. We aim to utilize mobile nodes to minimize the total routing cost as far as the selected route can satisfy the end-to-end packet deadline. We evaluate our proposed routing algorithm in terms of routing cost, packet delivery ratio, packet delivery time, and usability of mobile nodes based on network level simulations. Simulation results show that our proposed algorithm fully exploits the remaining time till packet deadline to turn into networking benefits of reducing the overall routing cost and improving packet delivery performance. Also, we demonstrate that the routing scheme guarantees packet delivery with hard deadlines, contributing to QoS improvement in various network services. PMID:25258736

Dynamic Multiple-Threshold Call Admission Control Based on Optimized Genetic Algorithm in Wireless/Mobile Networks

NASA Astrophysics Data System (ADS)

Wang, Shengling; Cui, Yong; Koodli, Rajeev; Hou, Yibin; Huang, Zhangqin

Due to the dynamics of topology and resources, Call Admission Control (CAC) plays a significant role for increasing resource utilization ratio and guaranteeing users' QoS requirements in wireless/mobile networks. In this paper, a dynamic multi-threshold CAC scheme is proposed to serve multi-class service in a wireless/mobile network. The thresholds are renewed at the beginning of each time interval to react to the changing mobility rate and network load. To find suitable thresholds, a reward-penalty model is designed, which provides different priorities between different service classes and call types through different reward/penalty policies according to network load and average call arrival rate. To speed up the running time of CAC, an Optimized Genetic Algorithm (OGA) is presented, whose components such as encoding, population initialization, fitness function and mutation etc., are all optimized in terms of the traits of the CAC problem. The simulation demonstrates that the proposed CAC scheme outperforms the similar schemes, which means the optimization is realized. Finally, the simulation shows the efficiency of OGA.

Security patterns and a weighting scheme for mobile agents

NASA Astrophysics Data System (ADS)

Walker, Jessie J.

The notion of mobility has always been a prime factor in human endeavor and achievement. This need to migrate by humans has been distilled into software entities, which are their representatives on distant environments. Software agents are developed to act on behalf of a user. Mobile agents were born from the understanding that many times it was much more useful to move the code (program) to where the resources are located, instead of connecting remotely. Within the mobile agent research community, security has traditionally been the most defining issue facing the community and preventing the paradigm from gaining wide acceptance. There are still numerous difficult problems being addressed with very few practical solutions, such as the malicious host and agent problems. These problems are some of the most active areas of research within the mobile agent community. The major principles, facets, fundamental concepts, techniques and architectures of the field are well understood within the community. This is evident by the many mobile agent systems developed in the last decade that share common core components such as agent management, communication facilities, and mobility services. In other words new mobile agent systems and frameworks do not provide any new insights into agent system architecture or mobility services, agent coordination, communication that could be useful to the agent research community, although these new mobile agent systems do in many instances validate, refine, demonstrate the reuse of many previously proposed and discussed mobile agent research elements. Since mobile agent research for the last decade has been defined by security and related issues, our research into security patterns are within this narrow arena of mobile agent research. The research presented in this thesis examines the issue of mobile agent security from the standpoint of security pattern documented from the universe of mobile agent systems. In addition, we explore how these documented security patterns can be quantitatively compared based on a unique weighting scheme. The scheme is formalized into a theory that can be used improve the development of secure mobile agents and agent-based systems.

Reliable Wide-Area Wavelength Division Multiplexing Passive Optical Network Accommodating Gigabit Ethernet and 10-Gb Ethernet Services

NASA Astrophysics Data System (ADS)

Nakamura, Hirotaka; Suzuki, Hiro; Kani, Jun-Ichi; Iwatsuki, Katsumi

2006-05-01

This paper proposes and demonstrates a reliable wide-area wavelength-division-multiplexing passive optical network (WDM-PON) with a wavelength-shifted protection scheme. This protection scheme utilizes the cyclic property of 2 × N athermal arrayed-waveguide grating and two kinds of wavelength allocations, each of which is assigned for working and protection, respectively. Compared with conventional protection schemes, this scheme does not need a 3-dB optical coupler, thus leading to ensure the large loss budget that is suited for wide-area WDM-PONs. It also features a passive access node and does not have a protection function in the optical network unit (ONU). The feasibility of the proposed scheme is experimentally confirmed by the carrier-distributed WDM-PON with gigabit Ethernet interface (GbE-IF) and 10-GbE-IF, in which the ONU does not employ a light source, and all wavelengths for upstream signals are centralized and distributed from the central office.

OSLG: A new granting scheme in WDM Ethernet passive optical networks

NASA Astrophysics Data System (ADS)

Razmkhah, Ali; Rahbar, Akbar Ghaffarpour

2011-12-01

Several granting schemes have been proposed to grant transmission window and dynamic bandwidth allocation (DBA) in passive optical networks (PON). Generally, granting schemes suffer from bandwidth wastage of granted windows. Here, we propose a new granting scheme for WDM Ethernet PONs, called optical network unit (ONU) Side Limited Granting (OSLG) that conserves upstream bandwidth, thus resulting in decreasing queuing delay and packet drop ratio. In OSLG instead of optical line terminal (OLT), each ONU determines its transmission window. Two OSLG algorithms are proposed in this paper: the OSLG_GA algorithm that determines the size of its transmission window in such a way that the bandwidth wastage problem is relieved, and the OSLG_SC algorithm that saves unused bandwidth for more bandwidth utilization later on. The OSLG can be used as granting scheme of any DBA to provide better performance in the terms of packet drop ratio and queuing delay. Our performance evaluations show the effectiveness of OSLG in reducing packet drop ratio and queuing delay under different DBA techniques.

Energy-Aware Multipath Routing Scheme Based on Particle Swarm Optimization in Mobile Ad Hoc Networks

PubMed Central

Robinson, Y. Harold; Rajaram, M.

2015-01-01

Mobile ad hoc network (MANET) is a collection of autonomous mobile nodes forming an ad hoc network without fixed infrastructure. Dynamic topology property of MANET may degrade the performance of the network. However, multipath selection is a great challenging task to improve the network lifetime. We proposed an energy-aware multipath routing scheme based on particle swarm optimization (EMPSO) that uses continuous time recurrent neural network (CTRNN) to solve optimization problems. CTRNN finds the optimal loop-free paths to solve link disjoint paths in a MANET. The CTRNN is used as an optimum path selection technique that produces a set of optimal paths between source and destination. In CTRNN, particle swarm optimization (PSO) method is primly used for training the RNN. The proposed scheme uses the reliability measures such as transmission cost, energy factor, and the optimal traffic ratio between source and destination to increase routing performance. In this scheme, optimal loop-free paths can be found using PSO to seek better link quality nodes in route discovery phase. PSO optimizes a problem by iteratively trying to get a better solution with regard to a measure of quality. The proposed scheme discovers multiple loop-free paths by using PSO technique. PMID:26819966

Adaptive Data Gathering in Mobile Sensor Networks Using Speedy Mobile Elements

PubMed Central

Lai, Yongxuan; Xie, Jinshan; Lin, Ziyu; Wang, Tian; Liao, Minghong

2015-01-01

Data gathering is a key operator for applications in wireless sensor networks; yet it is also a challenging problem in mobile sensor networks when considering that all nodes are mobile and the communications among them are opportunistic. This paper proposes an efficient data gathering scheme called ADG that adopts speedy mobile elements as the mobile data collector and takes advantage of the movement patterns of the network. ADG first extracts the network meta-data at initial epochs, and calculates a set of proxy nodes based on the meta-data. Data gathering is then mapped into the Proxy node Time Slot Allocation (PTSA) problem that schedules the time slots and orders, according to which the data collector could gather the maximal amount of data within a limited period. Finally, the collector follows the schedule and picks up the sensed data from the proxy nodes through one hop of message transmissions. ADG learns the period when nodes are relatively stationary, so that the collector is able to pick up the data from them during the limited data gathering period. Moreover, proxy nodes and data gathering points could also be timely updated so that the collector could adapt to the change of node movements. Extensive experimental results show that the proposed scheme outperforms other data gathering schemes on the cost of message transmissions and the data gathering rate, especially under the constraint of limited data gathering period. PMID:26389903

A queuing model for road traffic simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guerrouahane, N.; Aissani, D.; Bouallouche-Medjkoune, L.

We present in this article a stochastic queuing model for the raod traffic. The model is based on the M/G/c/c state dependent queuing model, and is inspired from the deterministic Godunov scheme for the road traffic simulation. We first propose a variant of M/G/c/c state dependent model that works with density-flow fundamental diagrams rather than density-speed relationships. We then extend this model in order to consider upstream traffic demand as well as downstream traffic supply. Finally, we show how to model a whole raod by concatenating raod sections as in the deterministic Godunov scheme.

Advection of Microphysical Scalars in Terminal Area Simulation System (TASS)

NASA Technical Reports Server (NTRS)

Ahmad, Nashat N.; Proctor, Fred H.

2011-01-01

The Terminal Area Simulation System (TASS) is a large eddy scale atmospheric flow model with extensive turbulence and microphysics packages. It has been applied successfully in the past to a diverse set of problems ranging from prediction of severe convective events (Proctor et al. 2002), tracking storms and for simulating weapons effects such as the dispersion and fallout of fission debris (Bacon and Sarma 1991), etc. More recently, TASS has been used for predicting the transport and decay of wake vortices behind aircraft (Proctor 2009). An essential part of the TASS model is its comprehensive microphysics package, which relies on the accurate computation of microphysical scalar transport. This paper describes an evaluation of the Leonard scheme implemented in the TASS model for transporting microphysical scalars. The scheme is validated against benchmark cases with exact solutions and compared with two other schemes - a Monotone Upstream-centered Scheme for Conservation Laws (MUSCL)-type scheme after van Leer and LeVeque's high-resolution wave propagation method. Finally, a comparison between the schemes is made against an incident of severe tornadic super-cell convection near Del City, Oklahoma.

Multi-stream face recognition on dedicated mobile devices for crime-fighting

NASA Astrophysics Data System (ADS)

Jassim, Sabah A.; Sellahewa, Harin

2006-09-01

Automatic face recognition is a useful tool in the fight against crime and terrorism. Technological advance in mobile communication systems and multi-application mobile devices enable the creation of hybrid platforms for active and passive surveillance. A dedicated mobile device that incorporates audio-visual sensors would not only complement existing networks of fixed surveillance devices (e.g. CCTV) but could also provide wide geographical coverage in almost any situation and anywhere. Such a device can hold a small portion of a law-enforcing agency biometric database that consist of audio and/or visual data of a number of suspects/wanted or missing persons who are expected to be in a local geographical area. This will assist law-enforcing officers on the ground in identifying persons whose biometric templates are downloaded onto their devices. Biometric data on the device can be regularly updated which will reduce the number of faces an officer has to remember. Such a dedicated device would act as an active/passive mobile surveillance unit that incorporate automatic identification. This paper is concerned with the feasibility of using wavelet-based face recognition schemes on such devices. The proposed schemes extend our recently developed face verification scheme for implementation on a currently available PDA. In particular we will investigate the use of a combination of wavelet frequency channels for multi-stream face recognition. We shall present experimental results on the performance of our proposed schemes for a number of publicly available face databases including a new AV database of videos recorded on a PDA.

Simulation of the Australian Mobilesat signalling scheme

NASA Technical Reports Server (NTRS)

Rahman, Mushfiqur

1990-01-01

The proposed Australian Mobilesat system will provide a range of circuit switched voice/data services using the B-series satellites. The reliability of the signalling scheme between the Network Management Station (NMS) and the mobile terminal (MT) is of critical importance to the performance of the overall system. Simulation results of the performance of the signalling scheme under various channel conditions and coding schemes are presented.

Large scale Brownian dynamics of confined suspensions of rigid particles

NASA Astrophysics Data System (ADS)

Sprinkle, Brennan; Balboa Usabiaga, Florencio; Patankar, Neelesh A.; Donev, Aleksandar

2017-12-01

We introduce methods for large-scale Brownian Dynamics (BD) simulation of many rigid particles of arbitrary shape suspended in a fluctuating fluid. Our method adds Brownian motion to the rigid multiblob method [F. Balboa Usabiaga et al., Commun. Appl. Math. Comput. Sci. 11(2), 217-296 (2016)] at a cost comparable to the cost of deterministic simulations. We demonstrate that we can efficiently generate deterministic and random displacements for many particles using preconditioned Krylov iterative methods, if kernel methods to efficiently compute the action of the Rotne-Prager-Yamakawa (RPY) mobility matrix and its "square" root are available for the given boundary conditions. These kernel operations can be computed with near linear scaling for periodic domains using the positively split Ewald method. Here we study particles partially confined by gravity above a no-slip bottom wall using a graphical processing unit implementation of the mobility matrix-vector product, combined with a preconditioned Lanczos iteration for generating Brownian displacements. We address a major challenge in large-scale BD simulations, capturing the stochastic drift term that arises because of the configuration-dependent mobility. Unlike the widely used Fixman midpoint scheme, our methods utilize random finite differences and do not require the solution of resistance problems or the computation of the action of the inverse square root of the RPY mobility matrix. We construct two temporal schemes which are viable for large-scale simulations, an Euler-Maruyama traction scheme and a trapezoidal slip scheme, which minimize the number of mobility problems to be solved per time step while capturing the required stochastic drift terms. We validate and compare these schemes numerically by modeling suspensions of boomerang-shaped particles sedimented near a bottom wall. Using the trapezoidal scheme, we investigate the steady-state active motion in dense suspensions of confined microrollers, whose height above the wall is set by a combination of thermal noise and active flows. We find the existence of two populations of active particles, slower ones closer to the bottom and faster ones above them, and demonstrate that our method provides quantitative accuracy even with relatively coarse resolutions of the particle geometry.

Cooperative Position Aware Mobility Pattern of AUVs for Avoiding Void Zones in Underwater WSNs

PubMed Central

Javaid, Nadeem; Ejaz, Mudassir; Abdul, Wadood; Alamri, Atif; Almogren, Ahmad; Niaz, Iftikhar Azim; Guizani, Nadra

2017-01-01

In this paper, we propose two schemes; position-aware mobility pattern (PAMP) and cooperative PAMP (Co PAMP). The first one is an optimization scheme that avoids void hole occurrence and minimizes the uncertainty in the position estimation of glider’s. The second one is a cooperative routing scheme that reduces the packet drop ratio by using the relay cooperation. Both techniques use gliders that stay at sojourn positions for a predefined time, at sojourn position self-confidence (s-confidence) and neighbor-confidence (n-confidence) regions that are estimated for balanced energy consumption. The transmission power of a glider is adjusted according to those confidence regions. Simulation results show that our proposed schemes outperform the compared existing one in terms of packet delivery ratio, void zones and energy consumption. PMID:28335377

A novel multiple description scalable coding scheme for mobile wireless video transmission

NASA Astrophysics Data System (ADS)

Zheng, Haifeng; Yu, Lun; Chen, Chang Wen

2005-03-01

We proposed in this paper a novel multiple description scalable coding (MDSC) scheme based on in-band motion compensation temporal filtering (IBMCTF) technique in order to achieve high video coding performance and robust video transmission. The input video sequence is first split into equal-sized groups of frames (GOFs). Within a GOF, each frame is hierarchically decomposed by discrete wavelet transform. Since there is a direct relationship between wavelet coefficients and what they represent in the image content after wavelet decomposition, we are able to reorganize the spatial orientation trees to generate multiple bit-streams and employed SPIHT algorithm to achieve high coding efficiency. We have shown that multiple bit-stream transmission is very effective in combating error propagation in both Internet video streaming and mobile wireless video. Furthermore, we adopt the IBMCTF scheme to remove the redundancy for inter-frames along the temporal direction using motion compensated temporal filtering, thus high coding performance and flexible scalability can be provided in this scheme. In order to make compressed video resilient to channel error and to guarantee robust video transmission over mobile wireless channels, we add redundancy to each bit-stream and apply error concealment strategy for lost motion vectors. Unlike traditional multiple description schemes, the integration of these techniques enable us to generate more than two bit-streams that may be more appropriate for multiple antenna transmission of compressed video. Simulate results on standard video sequences have shown that the proposed scheme provides flexible tradeoff between coding efficiency and error resilience.

Distinguishing the Effects of Local Point Sources from Those Caused by Upstream Nonpoint Source (NPS) Inputs: Refinement of a Watershed Development Index for New England

EPA Science Inventory

Using EMAP data from the NE Wadeable Stream Survey and state datasets (CT, ME), assessment tools were developed to predict diffuse NPS effects from watershed development and distinguish these from local impacts (point sources, contaminated sediments). Classification schemes were...

MPDATA: A positive definite solver for geophysical flows

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smolarkiewicz, P.K.; Margolin, L.G.

1997-12-31

This paper is a review of MPDATA, a class of methods for the numerical simulation of advection based on the sign-preserving properties of upstream differencing. MPDATA was designed originally as an inexpensive alternative to flux-limited schemes for evaluating the transport of nonnegative thermodynamic variables (such as liquid water or water vapor) in atmospheric models. During the last decade, MPDATA has evolved from a simple advection scheme to a general approach for integrating the conservation laws of geophysical fluids on micro-to-planetary scales. The purpose of this paper is to summarize the basic concepts leading to a family of MPDATA schemes, reviewmore » the existing MPDATA options, as well as to demonstrate the efficacy of the approach using diverse examples of complex geophysical flows.« less

Performance analysis of cross-seeding WDM-PON system using transfer matrix method

NASA Astrophysics Data System (ADS)

Simatupang, Joni Welman; Pukhrambam, Puspa Devi; Huang, Yen-Ru

2016-12-01

In this paper, a model based on the transfer matrix method is adopted to analyze the effects of Rayleigh backscattering and Fresnel multiple reflections on a cross-seeding WDM-PON system. As part of analytical approximation methods, this time-independent model is quite simple but very efficient when it is applied to various WDM-PON transmission systems, including the cross-seeding scheme. The cross seeding scheme is most beneficial for systems with low loop-back ONU gain or low reflection loss at the drop fiber for upstream data in bidirectional transmission. However for downstream data transmission, multiple reflections power could destroy the usefulness of the cross-seeding scheme when the reflectivity is high enough and the RN is positioned near OLT or close to ONU.

Computational flow field in energy efficient engine (EEE)

NASA Astrophysics Data System (ADS)

Miki, Kenji; Moder, Jeff; Liou, Meng-Sing

2016-11-01

In this paper, preliminary results for the recently-updated Open National Combustor Code (Open NCC) as applied to the EEE are presented. The comparison between two different numerical schemes, the standard Jameson-Schmidt-Turkel (JST) scheme and the advection upstream splitting method (AUSM), is performed for the cold flow and the reacting flow calculations using the RANS. In the cold flow calculation, the AUSM scheme predicts a much stronger reverse flow in the central recirculation zone. In the reacting flow calculation, we test two cases: gaseous fuel injection and liquid spray injection. In the gaseous fuel injection case, the overall flame structures of the two schemes are similar to one another, in the sense that the flame is attached to the main nozzle, but is detached from the pilot nozzle. However, in the exit temperature profile, the AUSM scheme shows a more uniform profile than that of the JST scheme, which is close to the experimental data. In the liquid spray injection case, we expect different flame structures in this scenario. We will give a brief discussion on how two numerical schemes predict the flame structures inside the Eusing different ways to introduce the fuel injection. Supported by NASA's Transformational Tools and Technologies project.

Computational Flow Field in Energy Efficient Engine (EEE)

NASA Technical Reports Server (NTRS)

Miki, Kenji; Moder, Jeff; Liou, Meng-Sing

2016-01-01

In this paper, preliminary results for the recently-updated Open National Combustion Code (Open NCC) as applied to the EEE are presented. The comparison between two different numerical schemes, the standard Jameson-Schmidt-Turkel (JST) scheme and the advection upstream splitting method (AUSM), is performed for the cold flow and the reacting flow calculations using the RANS. In the cold flow calculation, the AUSM scheme predicts a much stronger reverse flow in the central recirculation zone. In the reacting flow calculation, we test two cases: gaseous fuel injection and liquid spray injection. In the gaseous fuel injection case, the overall flame structures of the two schemes are similar to one another, in the sense that the flame is attached to the main nozzle, but is detached from the pilot nozzle. However, in the exit temperature profile, the AUSM scheme shows a more uniform profile than that of the JST scheme, which is close to the experimental data. In the liquid spray injection case, we expect different flame structures in this scenario. We will give a brief discussion on how two numerical schemes predict the flame structures inside the EEE using different ways to introduce the fuel injection.

Network coding based joint signaling and dynamic bandwidth allocation scheme for inter optical network unit communication in passive optical networks

NASA Astrophysics Data System (ADS)

Wei, Pei; Gu, Rentao; Ji, Yuefeng

2014-06-01

As an innovative and promising technology, network coding has been introduced to passive optical networks (PON) in recent years to support inter optical network unit (ONU) communication, yet the signaling process and dynamic bandwidth allocation (DBA) in PON with network coding (NC-PON) still need further study. Thus, we propose a joint signaling and DBA scheme for efficiently supporting differentiated services of inter ONU communication in NC-PON. In the proposed joint scheme, the signaling process lays the foundation to fulfill network coding in PON, and it can not only avoid the potential threat to downstream security in previous schemes but also be suitable for the proposed hybrid dynamic bandwidth allocation (HDBA) scheme. In HDBA, a DBA cycle is divided into two sub-cycles for applying different coding, scheduling and bandwidth allocation strategies to differentiated classes of services. Besides, as network traffic load varies, the entire upstream transmission window for all REPORT messages slides accordingly, leaving the transmission time of one or two sub-cycles to overlap with the bandwidth allocation calculation time at the optical line terminal (the OLT), so that the upstream idle time can be efficiently eliminated. Performance evaluation results validate that compared with the existing two DBA algorithms deployed in NC-PON, HDBA demonstrates the best quality of service (QoS) support in terms of delay for all classes of services, especially guarantees the end-to-end delay bound of high class services. Specifically, HDBA can eliminate queuing delay and scheduling delay of high class services, reduce those of lower class services by at least 20%, and reduce the average end-to-end delay of all services over 50%. Moreover, HDBA also achieves the maximum delay fairness between coded and uncoded lower class services, and medium delay fairness for high class services.

Integration of Model-Based Estimation Theory With an Adaptive Finite Volume Method for the Detection of a Moving Gaseous Source via a Mobile Sensor

DTIC Science & Technology

2012-02-29

couples the estimation scheme with the computational scheme, using one to enhance the other. Numerically, this switching changes several of the matrices...2011. 11. M.A. Demetriou, Enforcing and enhancing consensus of spatially distributed filters utilizing mobile sensor networks, Proceedings of the 49th...expected May, 2012. References [1] J. H. Seinfeld and S. N. Pandis, Atmospheric Chemistry and Physics: From Air Pollution to Climate Change. New York

A Classification Scheme for Analyzing Mobile Apps Used to Prevent and Manage Disease in Late Life

PubMed Central

Wang, Aiguo; Lu, Xin; Chen, Hongtu; Li, Changqun; Levkoff, Sue

2014-01-01

Background There are several mobile apps that offer tools for disease prevention and management among older adults, and promote health behaviors that could potentially reduce or delay the onset of disease. A classification scheme that categorizes apps could be useful to both older adult app users and app developers. Objective The objective of our study was to build and evaluate the effectiveness of a classification scheme that classifies mobile apps available for older adults in the “Health & Fitness” category of the iTunes App Store. Methods We constructed a classification scheme for mobile apps according to three dimensions: (1) the Precede-Proceed Model (PPM), which classifies mobile apps in terms of predisposing, enabling, and reinforcing factors for behavior change; (2) health care process, specifically prevention versus management of disease; and (3) health conditions, including physical health and mental health. Content analysis was conducted by the research team on health and fitness apps designed specifically for older adults, as well as those applicable to older adults, released during the months of June and August 2011 and August 2012. Face validity was assessed by a different group of individuals, who were not related to the study. A reliability analysis was conducted to confirm the accuracy of the coding scheme of the sample apps in this study. Results After applying sample inclusion and exclusion criteria, a total of 119 apps were included in the study sample, of which 26/119 (21.8%) were released in June 2011, 45/119 (37.8%) in August 2011, and 48/119 (40.3%) in August 2012. Face validity was determined by interviewing 11 people, who agreed that this scheme accurately reflected the nature of this application. The entire study sample was successfully coded, demonstrating satisfactory inter-rater reliability by two independent coders (95.8% initial concordance and 100% concordance after consensus was reached). The apps included in the study sample were more likely to be used for the management of disease than prevention of disease (109/119, 91.6% vs 15/119, 12.6%). More apps contributed to physical health rather than mental health (81/119, 68.1% vs 47/119, 39.5%). Enabling apps (114/119, 95.8%) were more common than reinforcing (20/119, 16.8%) or predisposing apps (10/119, 8.4%). Conclusions The findings, including face validity and inter-rater reliability, support the integrity of the proposed classification scheme for categorizing mobile apps for older adults in the “Health and Fitness” category available in the iTunes App Store. Using the proposed classification system, older adult app users would be better positioned to identify apps appropriate for their needs, and app developers would be able to obtain the distributions of available mobile apps for health-related concerns of older adults more easily. PMID:25098687

Nonlinearity Analysis for Efficient Modelling of Long-Term CO2 Storage

NASA Astrophysics Data System (ADS)

Li, Boxiao; Benson, Sally; Tchelepi, Hamdi

2014-05-01

Numerical simulation is widely used to predict the long-term fate of the injected CO2 in a storage formation. Performing large-scale simulations is often limited by the computational speed, where convergence failure of Newton iterations is one of the main bottlenecks. In order to design better numerical schemes and faster nonlinear solvers for modelling long-term CO2 storage, the nonlinearity in the simulations has to be analysed thoroughly, and the cause of convergence failures has to be identified clearly. We focus on the transport of CO2 and water in the presence of viscous, gravity, and heterogeneous capillary forces. We investigate the nonlinearity of the discrete transport equation obtained from finite-volume discretization with single-point phase-based upstream weighting, which is the industry standard. In particular, we study the discretized flux expressed as a function of saturations at the upstream and downstream (with respect to the total velocity) of each gridblock interface. We analyse the locations and complexity of the unit-flux, zero-flux, and inflection lines on the numerical flux. The unit- and zero-flux lines, referred to as kinks, correspond to a change of the flow direction, which often occurs when strong buoyancy and capillarity are present. We observe that these kinks and inflection lines are major sources of nonlinear convergence difficulties. We find that kinks create more challenges than inflection lines, especially when their locations depend on both the upstream and downstream saturations of the total velocity. When the flow is driven by viscous and gravity forces (e.g., during CO2 injection), one kink will occur in the numerical flux and its location depends only on the upstream saturation. However, when capillarity is dominant (e.g., during the post-injection period), two kinks will occur and both are functions of the upstream and downstream saturations, causing severe convergence difficulties particularly when heterogeneity is present. Our analysis of the numerical flux theoretically describes the cause of the convergence failures for simulating long-term CO2 storage. This understanding provides useful guidance in designing numerical schemes and nonlinear solvers that overcome the convergence bottlenecks. For example, to reduce the nonlinearity introduced by the two kinks in the presence of capillarity, we modify the method of Cances (2009) to discretize the capillary flux. Consequently, only one kink will occur even for coupled viscous, buoyancy, and heterogeneous capillary forces, and the kink depends only on the upstream saturation of the total velocity. An efficient nonlinear solver that is a significant refinement of the works of Jenny et al. (2009) and Wang and Tchelepi (2013) has also been proposed and demonstrated. References [1] C. Cances. Finite volume scheme for two-phase flows in heterogeneous porous media involving capillary pressure discontinuities. ESAIM:M2AN., 43, 973-1001, (2009). [2] P. Jenny, H.A. Tchelepi, and S.H. Lee. Unconditionally convergent nonlinear solver for hyperbolic conservation laws with S-shaped flux functions. J. Comput. Phys., 228, 7497-7512, (2009). [3] X. Wang and H.A. Tchelepi. Trust-region based solver for nonlinear transport in heterogeneous porous media. J. Comput. Phys., 253, 114-137, (2013).

A fuzzy call admission control scheme in wireless networks

NASA Astrophysics Data System (ADS)

Ma, Yufeng; Gong, Shenguang; Hu, Xiulin; Zhang, Yunyu

2007-11-01

Scarcity of the spectrum resource and mobility of users make quality of service (QoS) provision a critical issue in wireless networks. This paper presents a fuzzy call admission control scheme to meet the requirement of the QoS. A performance measure is formed as a weighted linear function of new call and handoff call blocking probabilities. Simulation compares the proposed fuzzy scheme with an adaptive channel reservation scheme. Simulation results show that fuzzy scheme has a better robust performance in terms of average blocking criterion.

BossPro: a biometrics-based obfuscation scheme for software protection

NASA Astrophysics Data System (ADS)

Kuseler, Torben; Lami, Ihsan A.; Al-Assam, Hisham

2013-05-01

This paper proposes to integrate biometric-based key generation into an obfuscated interpretation algorithm to protect authentication application software from illegitimate use or reverse-engineering. This is especially necessary for mCommerce because application programmes on mobile devices, such as Smartphones and Tablet-PCs are typically open for misuse by hackers. Therefore, the scheme proposed in this paper ensures that a correct interpretation / execution of the obfuscated program code of the authentication application requires a valid biometric generated key of the actual person to be authenticated, in real-time. Without this key, the real semantics of the program cannot be understood by an attacker even if he/she gains access to this application code. Furthermore, the security provided by this scheme can be a vital aspect in protecting any application running on mobile devices that are increasingly used to perform business/financial or other security related applications, but are easily lost or stolen. The scheme starts by creating a personalised copy of any application based on the biometric key generated during an enrolment process with the authenticator as well as a nuance created at the time of communication between the client and the authenticator. The obfuscated code is then shipped to the client's mobile devise and integrated with real-time biometric extracted data of the client to form the unlocking key during execution. The novelty of this scheme is achieved by the close binding of this application program to the biometric key of the client, thus making this application unusable for others. Trials and experimental results on biometric key generation, based on client's faces, and an implemented scheme prototype, based on the Android emulator, prove the concept and novelty of this proposed scheme.

Secure and Efficient Signature Scheme Based on NTRU for Mobile Payment

NASA Astrophysics Data System (ADS)

Xia, Yunhao; You, Lirong; Sun, Zhe; Sun, Zhixin

2017-10-01

Mobile payment becomes more and more popular, however the traditional public-key encryption algorithm has higher requirements for hardware which is not suitable for mobile terminals of limited computing resources. In addition, these public-key encryption algorithms do not have the ability of anti-quantum computing. This paper researches public-key encryption algorithm NTRU for quantum computation through analyzing the influence of parameter q and k on the probability of generating reasonable signature value. Two methods are proposed to improve the probability of generating reasonable signature value. Firstly, increase the value of parameter q. Secondly, add the authentication condition that meet the reasonable signature requirements during the signature phase. Experimental results show that the proposed signature scheme can realize the zero leakage of the private key information of the signature value, and increase the probability of generating the reasonable signature value. It also improve rate of the signature, and avoid the invalid signature propagation in the network, but the scheme for parameter selection has certain restrictions.

A Study on Architecture of Malicious Code Blocking Scheme with White List in Smartphone Environment

NASA Astrophysics Data System (ADS)

Lee, Kijeong; Tolentino, Randy S.; Park, Gil-Cheol; Kim, Yong-Tae

Recently, the interest and demands for mobile communications are growing so fast because of the increasing prevalence of smartphones around the world. In addition, the existing feature phones were replaced by smartphones and it has widely improved while using the explosive growth of Internet users using smartphones, e-commerce enabled Internet banking transactions and the importance of protecting personal information. Therefore, the development of smartphones antivirus products was developed and launched in order to prevent malicious code or virus infection. In this paper, we proposed a new scheme to protect the smartphone from malicious codes and malicious applications that are element of security threats in mobile environment and to prevent information leakage from malicious code infection. The proposed scheme is based on the white list smartphone application which only allows installing authorized applications and to prevent the installation of malicious and untrusted mobile applications which can possibly infect the applications and programs of smartphones.

A novel equivalent definition of Caputo fractional derivative without singular kernel and superconvergent analysis

NASA Astrophysics Data System (ADS)

Liu, Zhengguang; Li, Xiaoli

2018-05-01

In this article, we present a new second-order finite difference discrete scheme for a fractal mobile/immobile transport model based on equivalent transformative Caputo formulation. The new transformative formulation takes the singular kernel away to make the integral calculation more efficient. Furthermore, this definition is also effective where α is a positive integer. Besides, the T-Caputo derivative also helps us to increase the convergence rate of the discretization of the α-order(0 < α < 1) Caputo derivative from O(τ2-α) to O(τ3-α), where τ is the time step. For numerical analysis, a Crank-Nicolson finite difference scheme to solve the fractal mobile/immobile transport model is introduced and analyzed. The unconditional stability and a priori estimates of the scheme are given rigorously. Moreover, the applicability and accuracy of the scheme are demonstrated by numerical experiments to support our theoretical analysis.

A Mobile IPv6 based Distributed Mobility Management Mechanism of Mobile Internet

NASA Astrophysics Data System (ADS)

Yan, Shi; Jiayin, Cheng; Shanzhi, Chen

A flatter architecture is one of the trends of mobile Internet. Traditional centralized mobility management mechanism faces the challenges such as scalability and UE reachability. A MIPv6 based distributed mobility management mechanism is proposed in this paper. Some important network entities and signaling procedures are defined. UE reachability is also considered in this paper through extension to DNS servers. Simulation results show that the proposed approach can overcome the scalability problem of the centralized scheme.

Performance Analysis of Inter-Domain Handoff Scheme Based on Virtual Layer in PMIPv6 Networks for IP-Based Internet of Things.

PubMed

Cho, Chulhee; Choi, Jae-Young; Jeong, Jongpil; Chung, Tai-Myoung

2017-01-01

Lately, we see that Internet of things (IoT) is introduced in medical services for global connection among patients, sensors, and all nearby things. The principal purpose of this global connection is to provide context awareness for the purpose of bringing convenience to a patient's life and more effectively implementing clinical processes. In health care, monitoring of biosignals of a patient has to be continuously performed while the patient moves inside and outside the hospital. Also, to monitor the accurate location and biosignals of the patient, appropriate mobility management is necessary to maintain connection between the patient and the hospital network. In this paper, a binding update scheme on PMIPv6, which reduces signal traffic during location updates by Virtual LMA (VLMA) on the top original Local Mobility Anchor (LMA) Domain, is proposed to reduce the total cost. If a Mobile Node (MN) moves to a Mobile Access Gateway (MAG)-located boundary of an adjacent LMA domain, the MN changes itself into a virtual mode, and this movement will be assumed to be a part of the VLMA domain. In the proposed scheme, MAGs eliminate global binding updates for MNs between LMA domains and significantly reduce the packet loss and latency by eliminating the handoff between LMAs. In conclusion, the performance analysis results show that the proposed scheme improves performance significantly versus PMIPv6 and HMIPv6 in terms of the binding update rate per user and average handoff latency.

Demonstration of hybrid orbital angular momentum multiplexing and time-division multiplexing passive optical network.

PubMed

Wang, Andong; Zhu, Long; Liu, Jun; Du, Cheng; Mo, Qi; Wang, Jian

2015-11-16

Mode-division multiplexing passive optical network (MDM-PON) is a promising scheme for next-generation access networks to further increase fiber transmission capacity. In this paper, we demonstrate the proof-of-concept experiment of hybrid mode-division multiplexing (MDM) and time-division multiplexing (TDM) PON architecture by exploiting orbital angular momentum (OAM) modes. Bidirectional transmissions with 2.5-Gbaud 4-level pulse amplitude modulation (PAM-4) downstream and 2-Gbaud on-off keying (OOK) upstream are demonstrated in the experiment. The observed optical signal-to-noise ratio (OSNR) penalties for downstream and upstream transmissions at a bit-error rate (BER) of 2 × 10(-3) are less than 2.0 dB and 3.0 dB, respectively.

Simulation of 2-dimensional viscous flow through cascades using a semi-elliptic analysis and hybrid C-H grids

NASA Technical Reports Server (NTRS)

Ramamurti, R.; Ghia, U.; Ghia, K. N.

1988-01-01

A semi-elliptic formulation, termed the interacting parabolized Navier-Stokes (IPNS) formulation, is developed for the analysis of a class of subsonic viscous flows for which streamwise diffusion is neglible but which are significantly influenced by upstream interactions. The IPNS equations are obtained from the Navier-Stokes equations by dropping the streamwise viscous-diffusion terms but retaining upstream influence via the streamwise pressure-gradient. A two-step alternating-direction-explicit numerical scheme is developed to solve these equations. The quasi-linearization and discretization of the equations are carefully examined so that no artificial viscosity is added externally to the scheme. Also, solutions to compressible as well as nearly compressible flows are obtained without any modification either in the analysis or in the solution process. The procedure is applied to constricted channels and cascade passages formed by airfoils of various shapes. These geometries are represented using numerically generated curilinear boundary-oriented coordinates forming an H-grid. A hybrid C-H grid, more appropriate for cascade of airfoils with rounded leading edges, was also developed. Satisfactory results are obtained for flows through cascades of Joukowski airfoils.

Analysis and prediction of spatiotemporal impact of traffic incidents for better mobility and safety in transportation systems.

DOT National Transportation Integrated Search

2015-12-01

The goal of this research is to develop a machine learning framework to predict the spatiotemporal impact : of traffic accidents on the upstream traffic and surrounding region. The main objective of the framework : is, given a road accident, to forec...

Mobilization and degradation of particulate organic carbon from retrogressive thaw slumps in the western Canadian Arctic

NASA Astrophysics Data System (ADS)

Shakil, S.; Tank, S. E.; Kokelj, S.

2016-12-01

Rapid arctic climate warming has contributed to a significant intensification in the rate and occurrence of thermokarst features which can cause large quantities of frozen organic carbon to suddenly become an active part of the contemporary carbon cycle. Mobilized organic carbon becomes susceptible to bacterial decomposition to CO2, which can then act as a significant positive feedback to climate change. Increasingly, studies are showing dissolved organic carbon (DOC) released from thawing permafrost is highly biodegradable, however, we know little about the biodegradability of permafrost-derived particulate organic carbon (POC). On the Peel Plateau, NWT, Canada, where a warming and wetting climate has intensified the activity of massive retrogressive thaw slumps (RTS), and where some of the Arctic's largest RTS features occur, POC can be more than an order of magnitude greater in streams impacted by an RTS feature when compared to upstream, un-impacted locations, and this mobilization causes POC concentrations to be more than 200 times greater than DOC downstream of slumps. Furthermore, POC released from RTS features can be 6,000 to 13,000 years older than POC in un-impacted streams, indicating a significant mobilization of permafrost carbon in the particulate form. To determine the biodegradability of RTS-released POC in this region, incubations using water samples collected upstream, at, and downstream of RTS sites were conducted during the summer of 2015. Dissolved oxygen measurements were taken 1-2 times per day, and samples for POC and DOC concentration, SUVA254, and bacterial abundance were collected at 0 days, 7 days, and 11 days. Treatments containing a spike of RTS-runoff in filtered water declined in oxygen at a rate as much as 10 times greater than treatments containing filtered DOC controls and unfiltered upstream water indicating that the released of RTS-derived POC substantially increases carbon mineralization in impacted streams. This pool of organic carbon could therefore substantially contribute to the transfer of organic carbon from permafrost soils to the atmospheric carbon pool. Ongoing work is examining the balance between POC decomposition during downstream transport and re-sequestration into streambed sediments.

Time domain numerical calculations of unsteady vortical flows about a flat plate airfoil

NASA Technical Reports Server (NTRS)

Hariharan, S. I.; Yu, Ping; Scott, J. R.

1989-01-01

A time domain numerical scheme is developed to solve for the unsteady flow about a flat plate airfoil due to imposed upstream, small amplitude, transverse velocity perturbations. The governing equation for the resulting unsteady potential is a homogeneous, constant coefficient, convective wave equation. Accurate solution of the problem requires the development of approximate boundary conditions which correctly model the physics of the unsteady flow in the far field. A uniformly valid far field boundary condition is developed, and numerical results are presented using this condition. The stability of the scheme is discussed, and the stability restriction for the scheme is established as a function of the Mach number. Finally, comparisons are made with the frequency domain calculation by Scott and Atassi, and the relative strengths and weaknesses of each approach are assessed.

Effects of Data Replication on Data Exfiltration in Mobile Ad Hoc Networks Utilizing Reactive Protocols

DTIC Science & Technology

2015-03-01

2.5.5 Availability Schemes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42 2.6 Simulation Environments...routing scheme can prove problematic. Two prominent proactive protocols, 7 Destination-Sequenced Distance-Vector (DSDV) and Optimized Link State...distributed file management systems such as Tahoe- LAFS as part of its replication scheme . Altman and De Pellegrini [4] examine the impact of FEC and

Record surface state mobility and quantum Hall effect in topological insulator thin films via interface engineering

DOE PAGES

Koirala, Nikesh; Han, Myung -Geun; Brahlek, Matthew; ...

2015-11-19

Material defects remain as the main bottleneck to the progress of topological insulators (TIs). In particular, efforts to achieve thin TI samples with dominant surface transport have always led to increased defects and degraded mobilities, thus making it difficult to probe the quantum regime of the topological surface states. Here, by utilizing a novel buffer layer scheme composed of an In 2Se 3/(Bi 0.5In 0.5) 2Se 3 heterostructure, we introduce a quantum generation of Bi 2Se 3 films with an order of magnitude enhanced mobilities than before. Furthermore, this scheme has led to the first observation of the quantum Hallmore » effect in Bi 2Se 3.« less

Design of Secure and Lightweight Authentication Protocol for Wearable Devices Environment.

PubMed

Das, Ashok Kumar; Wazid, Mohammad; Kumar, Neeraj; Khan, Muhammad Khurram; Choo, Kim-Kwang Raymond; Park, YoungHo

2017-09-18

Wearable devices are used in various applications to collect information including step information, sleeping cycles, workout statistics, and health related information. Due to the nature and richness of the data collected by such devices, it is important to ensure the security of the collected data. This paper presents a new lightweight authentication scheme suitable for wearable device deployment. The scheme allows a user to mutually authenticate his/her wearable device(s) and the mobile terminal (e.g., Android and iOS device) and establish a session key among these devices (worn and carried by the same user) for secure communication between the wearable device and the mobile terminal. The security of the proposed scheme is then demonstrated through the broadly-accepted Real-Or-Random model, as well as using the popular formal security verification tool, known as the Automated Validation of Internet Security Protocols and Applications (AVISPA). Finally, we present a comparative summary of the proposed scheme in terms of the overheads such as computation and communication costs, security and functionality features of the proposed scheme and related schemes, and also the evaluation findings from the NS2 simulation.

Reputation-Based Internet Protocol Security: A Multilayer Security Framework for Mobile Ad Hoc Networks

DTIC Science & Technology

2010-09-01

secure ad-hoc networks of mobile sensors deployed in a hostile environment . These sensors are normally small 86 and resource...Communications Magazine, 51, 2008. 45. Kumar, S.A. “Classification and Review of Security Schemes in Mobile Comput- ing”. Wireless Sensor Network , 2010... Networks ”. Wireless /Mobile Network Security , 2008. 85. Xiao, Y. “Accountability for Wireless LANs, Ad Hoc Networks , and Wireless

A Unified Approach to Motion Control of Motion Robots

NASA Technical Reports Server (NTRS)

Seraji, H.

1994-01-01

This paper presents a simple on-line approach for motion control of mobile robots made up of a manipulator arm mounted on a mobile base. The proposed approach is equally applicable to nonholonomic mobile robots, such as rover-mounted manipulators and to holonomic mobile robots such as tracked robots or compound manipulators. The computational efficiency of the proposed control scheme makes it particularly suitable for real-time implementation.

An Adaptive Handover Prediction Scheme for Seamless Mobility Based Wireless Networks

PubMed Central

Safa Sadiq, Ali; Fisal, Norsheila Binti; Ghafoor, Kayhan Zrar; Lloret, Jaime

2014-01-01

We propose an adaptive handover prediction (AHP) scheme for seamless mobility based wireless networks. That is, the AHP scheme incorporates fuzzy logic with AP prediction process in order to lend cognitive capability to handover decision making. Selection metrics, including received signal strength, mobile node relative direction towards the access points in the vicinity, and access point load, are collected and considered inputs of the fuzzy decision making system in order to select the best preferable AP around WLANs. The obtained handover decision which is based on the calculated quality cost using fuzzy inference system is also based on adaptable coefficients instead of fixed coefficients. In other words, the mean and the standard deviation of the normalized network prediction metrics of fuzzy inference system, which are collected from available WLANs are obtained adaptively. Accordingly, they are applied as statistical information to adjust or adapt the coefficients of membership functions. In addition, we propose an adjustable weight vector concept for input metrics in order to cope with the continuous, unpredictable variation in their membership degrees. Furthermore, handover decisions are performed in each MN independently after knowing RSS, direction toward APs, and AP load. Finally, performance evaluation of the proposed scheme shows its superiority compared with representatives of the prediction approaches. PMID:25574490

An adaptive handover prediction scheme for seamless mobility based wireless networks.

PubMed

Sadiq, Ali Safa; Fisal, Norsheila Binti; Ghafoor, Kayhan Zrar; Lloret, Jaime

2014-01-01

We propose an adaptive handover prediction (AHP) scheme for seamless mobility based wireless networks. That is, the AHP scheme incorporates fuzzy logic with AP prediction process in order to lend cognitive capability to handover decision making. Selection metrics, including received signal strength, mobile node relative direction towards the access points in the vicinity, and access point load, are collected and considered inputs of the fuzzy decision making system in order to select the best preferable AP around WLANs. The obtained handover decision which is based on the calculated quality cost using fuzzy inference system is also based on adaptable coefficients instead of fixed coefficients. In other words, the mean and the standard deviation of the normalized network prediction metrics of fuzzy inference system, which are collected from available WLANs are obtained adaptively. Accordingly, they are applied as statistical information to adjust or adapt the coefficients of membership functions. In addition, we propose an adjustable weight vector concept for input metrics in order to cope with the continuous, unpredictable variation in their membership degrees. Furthermore, handover decisions are performed in each MN independently after knowing RSS, direction toward APs, and AP load. Finally, performance evaluation of the proposed scheme shows its superiority compared with representatives of the prediction approaches.

A study on agent-based secure scheme for electronic medical record system.

PubMed

Chen, Tzer-Long; Chung, Yu-Fang; Lin, Frank Y S

2012-06-01

Patient records, including doctors' diagnoses of diseases, trace of treatments and patients' conditions, nursing actions, and examination results from allied health profession departments, are the most important medical records of patients in medical systems. With patient records, medical staff can instantly understand the entire medical information of a patient so that, according to the patient's conditions, more accurate diagnoses and more appropriate in-depth treatments can be provided. Nevertheless, in such a modern society with booming information technologies, traditional paper-based patient records have faced a lot of problems, such as lack of uniform formats, low data mobility, slow data transfer, illegible handwritings, enormous and insufficient storage space, difficulty of conservation, being easily damaged, and low transferability. To improve such drawbacks, reduce medical costs, and advance medical quality, paper-based patient records are modified into electronic medical records and reformed into electronic patient records. However, since electronic patient records used in various hospitals are diverse and different, in consideration of cost, it is rather difficult to establish a compatible and complete integrated electronic patient records system to unify patient records from heterogeneous systems in hospitals. Moreover, as the booming of the Internet, it is no longer necessary to build an integrated system. Instead, doctors can instantly look up patients' complete information through the Internet access to electronic patient records as well as avoid the above difficulties. Nonetheless, the major problem of accessing to electronic patient records cross-hospital systems exists in the security of transmitting and accessing to the records in case of unauthorized medical personnels intercepting or stealing the information. This study applies the Mobile Agent scheme to cope with the problem. Since a Mobile Agent is a program, which can move among hosts and automatically disperse arithmetic processes, and moves from one host to another in heterogeneous network systems with the characteristics of autonomy and mobility, decreasing network traffic, reducing transfer lag, encapsulating protocol, availability on heterogeneous platforms, fault-tolerance, high flexibility, and personalization. However, since a Mobile Agent contacts and exchanges information with other hosts or agents on the Internet for rapid exchange and access to medical information, the security is threatened. In order to solve the problem, this study proposes a key management scheme based on Lagrange interpolation formulas and hierarchical management structure to make Mobile Agents a more secure and efficient access control scheme for electronic patient record systems when applied to the access of patients' personal electronic patient records cross hospitals. Meanwhile, with the comparison of security and efficacy analyses being the feasibility of validation scheme and the basis of better efficiency, the security of Mobile Agents in the process of operation can be guaranteed, key management efficacy can be advanced, and the security of the Mobile Agent system can be protected.

Numerical simulation of steady and unsteady viscous flow in turbomachinery using pressure based algorithm

NASA Astrophysics Data System (ADS)

Lakshminarayana, B.; Ho, Y.; Basson, A.

1993-07-01

The objective of this research is to simulate steady and unsteady viscous flows, including rotor/stator interaction and tip clearance effects in turbomachinery. The numerical formulation for steady flow developed here includes an efficient grid generation scheme, particularly suited to computational grids for the analysis of turbulent turbomachinery flows and tip clearance flows, and a semi-implicit, pressure-based computational fluid dynamics scheme that directly includes artificial dissipation, and is applicable to both viscous and inviscid flows. The values of these artificial dissipation is optimized to achieve accuracy and convergency in the solution. The numerical model is used to investigate the structure of tip clearance flows in a turbine nozzle. The structure of leakage flow is captured accurately, including blade-to-blade variation of all three velocity components, pitch and yaw angles, losses and blade static pressures in the tip clearance region. The simulation also includes evaluation of such quantities of leakage mass flow, vortex strength, losses, dominant leakage flow regions and the spanwise extent affected by the leakage flow. It is demonstrated, through optimization of grid size and artificial dissipation, that the tip clearance flow field can be captured accurately. The above numerical formulation was modified to incorporate time accurate solutions. An inner loop iteration scheme is used at each time step to account for the non-linear effects. The computation of unsteady flow through a flat plate cascade subjected to a transverse gust reveals that the choice of grid spacing and the amount of artificial dissipation is critical for accurate prediction of unsteady phenomena. The rotor-stator interaction problem is simulated by starting the computation upstream of the stator, and the upstream rotor wake is specified from the experimental data. The results show that the stator potential effects have appreciable influence on the upstream rotor wake. The predicted unsteady wake profiles are compared with the available experimental data and the agreement is good. The numerical results are interpreted to draw conclusions on the unsteady wake transport mechanism in the blade passage.

Spawning chronology, nest site selection and nest success of smallmouth bass during benign streamflow conditions

USGS Publications Warehouse

Dauwalter, D.C.; Fisher, W.L.

2007-01-01

We documented the nesting chronology, nest site selection and nest success of smallmouth bass Micropterus dolomieu in an upstream (4th order) and downstream (5th order) reach of Baron Fork Creek, Oklahoma. Males started nesting in mid-Apr. when water temperatures increased to 16.9 C upstream, and in late-Apr. when temperatures increased to 16.2 C downstream. Streamflows were low (77% upstream to 82% downstream of mean Apr. streamflow, and 12 and 18% of meanjun. streamflow; 47 and 55 y of record), and decreased throughout the spawning period. Larger males nested first upstream, as has been observed in other populations, but not downstream. Upstream, progeny in 62 of 153 nests developed to swim-up stage. Downstream, progeny in 31 of 73 nests developed to swim-up. Nesting densities upstream (147/km) and downstream (100/km) were both higher than any densities previously reported. Males selected nest sites with intermediate water depths, low water velocity and near cover, behavior that is typical of smallmouth bass. Documented nest failures resulted from human disturbance, angling, and longear sunfish predation. Logistic exposure models showed that water velocity at the nest was negatively related and length of the guarding male was positively related to nest success upstream. Male length and number of degree days were both positively related to nest success downstream. Our results, and those of other studies, suggest that biological factors account for most nest failures during benign (stable, low flow) streamflow conditions, whereas nest failures attributed to substrate mobility or nest abandonment dominate when harsh streamflow conditions (spring floods) coincide with the spawning season.

Performance Analysis of Inter-Domain Handoff Scheme Based on Virtual Layer in PMIPv6 Networks for IP-Based Internet of Things

PubMed Central

Choi, Jae-Young; Jeong, Jongpil; Chung, Tai-Myoung

2017-01-01

Lately, we see that Internet of things (IoT) is introduced in medical services for global connection among patients, sensors, and all nearby things. The principal purpose of this global connection is to provide context awareness for the purpose of bringing convenience to a patient’s life and more effectively implementing clinical processes. In health care, monitoring of biosignals of a patient has to be continuously performed while the patient moves inside and outside the hospital. Also, to monitor the accurate location and biosignals of the patient, appropriate mobility management is necessary to maintain connection between the patient and the hospital network. In this paper, a binding update scheme on PMIPv6, which reduces signal traffic during location updates by Virtual LMA (VLMA) on the top original Local Mobility Anchor (LMA) Domain, is proposed to reduce the total cost. If a Mobile Node (MN) moves to a Mobile Access Gateway (MAG)-located boundary of an adjacent LMA domain, the MN changes itself into a virtual mode, and this movement will be assumed to be a part of the VLMA domain. In the proposed scheme, MAGs eliminate global binding updates for MNs between LMA domains and significantly reduce the packet loss and latency by eliminating the handoff between LMAs. In conclusion, the performance analysis results show that the proposed scheme improves performance significantly versus PMIPv6 and HMIPv6 in terms of the binding update rate per user and average handoff latency. PMID:28129355

A Privacy-Protecting Authentication Scheme for Roaming Services with Smart Cards

NASA Astrophysics Data System (ADS)

Son, Kyungho; Han, Dong-Guk; Won, Dongho

In this work we propose a novel smart card based privacy-protecting authentication scheme for roaming services. Our proposal achieves so-called Class 2 privacy protection, i.e., no information identifying a roaming user and also linking the user's behaviors is not revealed in a visited network. It can be used to overcome the inherent structural flaws of smart card based anonymous authentication schemes issued recently. As shown in our analysis, our scheme is computationally efficient for a mobile user.

A Quantum Proxy Weak Blind Signature Scheme Based on Controlled Quantum Teleportation

NASA Astrophysics Data System (ADS)

Cao, Hai-Jing; Yu, Yao-Feng; Song, Qin; Gao, Lan-Xiang

2015-04-01

Proxy blind signature is applied to the electronic paying system, electronic voting system, mobile agent system, security of internet, etc. A quantum proxy weak blind signature scheme is proposed in this paper. It is based on controlled quantum teleportation. Five-qubit entangled state functions as quantum channel. The scheme uses the physical characteristics of quantum mechanics to implement message blinding, so it could guarantee not only the unconditional security of the scheme but also the anonymity of the messages owner.

FD/DAMA Scheme For Mobile/Satellite Communications

NASA Technical Reports Server (NTRS)

Yan, Tsun-Yee; Wang, Charles C.; Cheng, Unjeng; Rafferty, William; Dessouky, Khaled I.

1992-01-01

Integrated-Adaptive Mobile Access Protocol (I-AMAP) proposed to allocate communication channels to subscribers in first-generation MSAT-X mobile/satellite communication network. Based on concept of frequency-division/demand-assigned multiple access (FD/DAMA) where partition of available spectrum adapted to subscribers' demands for service. Requests processed, and competing requests resolved according to channel-access protocol, or free-access tree algorithm described in "Connection Protocol for Mobile/Satellite Communications" (NPO-17735). Assigned spectrum utilized efficiently.

Computation of Feedback Aeroacoustic System by the CE/SE Method

NASA Technical Reports Server (NTRS)

Loh, Ching Y.; Wang, Xiao Y.; Chang, Sin-Chung; Jorgenson, Philip C. E.

2000-01-01

It is well known that due to vortex shedding in high speed flow over cutouts, cavities, and gaps, intense noise may be generated. Strong tonal oscillations occur in a feedback cycle in which the vortices shed from the upstream edge of the cavity convect downstream and impinge on the cavity lip, generating acoustic waves that propagate upstream to excite new vortices. Numerical simulation of such a complicated process requires a scheme that can: (1) resolve acoustic waves with low dispersion and numerical dissipation, (2) handle nonlinear and discontinuous waves (e.g. shocks), and (3) have an effective (near field) nonreflecting boundary condition (NRBC). The new space time conservation element and solution element method, or CE/SE for short, is a numerical method that meets the above requirements.

CCS-DTN: clustering and network coding-based efficient routing in social DTNs.

PubMed

Zhang, Zhenjing; Ma, Maode; Jin, Zhigang

2014-12-25

With the development of mobile Internet, wireless communication via mobile devices has become a hot research topic, which is typically in the form of Delay Tolerant Networks (DTNs). One critical issue in the development of DTNs is routing. Although there is a lot research work addressing routing issues in DTNs, they cannot produce an advanced solution to the comprehensive challenges since only one or two aspects (nodes' movements, clustering, centricity and so on) are considered when the routing problem is handled. In view of these defects in the existing works, we propose a novel solution to address the routing issue in social DTNs. By this solution, mobile nodes are divided into different clusters. The scheme, Spray and Wait, is used for the intra-cluster communication while a new forwarding mechanism is designed for the inter-cluster version. In our solution, the characteristics of nodes and the relation between nodes are fully considered. The simulation results show that our proposed scheme can significantly improve the performance of the routing scheme in social DTNs.

CCS-DTN: Clustering and Network Coding-Based Efficient Routing in Social DTNs

PubMed Central

Zhang, Zhenjing; Ma, Maode; Jin, Zhigang

2015-01-01

With the development of mobile Internet, wireless communication via mobile devices has become a hot research topic, which is typically in the form of Delay Tolerant Networks (DTNs). One critical issue in the development of DTNs is routing. Although there is a lot research work addressing routing issues in DTNs, they cannot produce an advanced solution to the comprehensive challenges since only one or two aspects (nodes' movements, clustering, centricity and so on) are considered when the routing problem is handled. In view of these defects in the existing works, we propose a novel solution to address the routing issue in social DTNs. By this solution, mobile nodes are divided into different clusters. The scheme, Spray and Wait, is used for the intra-cluster communication while a new forwarding mechanism is designed for the inter-cluster version. In our solution, the characteristics of nodes and the relation between nodes are fully considered. The simulation results show that our proposed scheme can significantly improve the performance of the routing scheme in social DTNs. PMID:25609047

Large Eddy Simulation of the fuel transport and mixing process in a scramjet combustor with rearwall-expansion cavity

NASA Astrophysics Data System (ADS)

Cai, Zun; Liu, Xiao; Gong, Cheng; Sun, Mingbo; Wang, Zhenguo; Bai, Xue-Song

2016-09-01

Large Eddy Simulation (LES) was employed to investigate the fuel/oxidizer mixing process in an ethylene fueled scramjet combustor with a rearwall-expansion cavity. The numerical solver was first validated for an experimental flow, the DLR strut-based scramjet combustor case. Shock wave structures and wall-pressure distribution from the numerical simulations were compared with experimental data and the numerical results were shown in good agreement with the available experimental data. Effects of the injection location on the flow and mixing process were then studied. It was found that with a long injection distance upstream the cavity, the fuel is transported much further into the main flow and a smaller subsonic zone is formed inside the cavity. Conversely, with a short injection distance, the fuel is entrained more into the cavity and a larger subsonic zone is formed inside the cavity, which is favorable for ignition in the cavity. For the rearwall-expansion cavity, it is suggested that the optimized ignition location with a long upstream injection distance should be in the bottom wall in the middle part of the cavity, while the optimized ignition location with a short upstream injection distance should be in the bottom wall in the front side of the cavity. By employing a cavity direct injection on the rear wall, the fuel mass fraction inside the cavity and the local turbulent intensity will both be increased due to this fueling, and it will also enhance the mixing process which will also lead to increased mixing efficiency. For the rearwall-expansion cavity, the combined injection scheme is expected to be an optimized injection scheme.

Two Phase Admission Control for QoS Mobile Ad Hoc Networks

NASA Astrophysics Data System (ADS)

Chen, Chien-Sheng; Su, Yi-Wen; Liu, Wen-Hsiung; Chi, Ching-Lung

In this paper a novel and effective two phase admission control (TPAC) for QoS mobile ad hoc networks is proposed that satisfies the real-time traffic requirements in mobile ad hoc networks. With a limited amount of extra overhead, TPAC can avoid network congestions by a simple and precise admission control which blocks most of the overloading flow-requests in the route discovery process. When compared with previous QoS routing schemes such as QoS-aware routing protocol and CACP protocols, it is shown from system simulations that the proposed scheme can increase the system throughput and reduce both the dropping rate and the end-to-end delay. Therefore, TPAC is surely an effective QoS-guarantee protocol to provide for real-time traffic.

Proposal of DCS-OFDM-PON upstream transmission with intensity modulator and collective self-coherent detection

NASA Astrophysics Data System (ADS)

Zhang, Jing; Yang, Heming; Zhao, Difu; Qiu, Kun

2016-07-01

We introduce digital coherent superposition (DCS) into optical access network and propose a DCS-OFDM-PON upstream transmission scheme using intensity modulator and collective self-coherent detection. The generated OFDM signal is real based on Hermitian symmetry, which can be used to estimate the common phase error (CPE) by complex conjugate subcarrier pairs without any pilots. In simulation, we transmit an aggregated 40 Gb/s optical OFDM signal from two ONUs. The transmission performance with DCS is slightly better after 25 km transmission without relative transmission time delay. The fiber distance for different ONUs to RN are not same in general and there is relative transmission time delay between ONUs, which causes inter-carrier-interference (ICI) power increasing and degrades the transmission performance. The DCS can mitigate the ICI power and the DCS-OFDM-PON upstream transmission outperforms the conventional OFDM-PON. The CPE estimation is by using two pairs of complex conjugate subcarriers without redundancy. The power variation can be 9 dB in DCS-OFDM-PON, which is enough to tolerate several kilometers fiber length difference between the ONUs.

Effects of Distributed Generation on Overcurrent Relay Coordination and an Adaptive Protection Scheme

NASA Astrophysics Data System (ADS)

Ilik, Semih C.; Arsoy, Aysen B.

2017-07-01

Integration of distributed generation (DG) such as renewable energy sources to electrical network becomes more prevalent in recent years. Grid connection of DG has effects on load flow directions, voltage profile, short circuit power and especially protection selectivity. Applying traditional overcurrent protection scheme is inconvenient when system reliability and sustainability are considered. If a fault happens in DG connected network, short circuit contribution of DG, creates additional branch element feeding the fault current; compels to consider directional overcurrent (OC) protection scheme. Protection coordination might get lost for changing working conditions when DG sources are connected. Directional overcurrent relay parameters are determined for downstream and upstream relays when different combinations of DG connected singular or plural, on radial test system. With the help of proposed flow chart, relay parameters are updated and coordination between relays kept sustained for different working conditions in DigSILENT PowerFactory program.

Filter Bank Multicarrier (FBMC) for long-reach intensity modulated optical access networks

NASA Astrophysics Data System (ADS)

Saljoghei, Arsalan; Gutiérrez, Fernando A.; Perry, Philip; Barry, Liam P.

2017-04-01

Filter Bank Multi Carrier (FBMC) is a modulation scheme which has recently attracted significant interest in both wireless and optical communications. The interest in optical communications arises due to FBMC's capability to operate without a Cyclic Prefix (CP) and its high resilience to synchronisation errors. However, the operation of FBMC in optical access networks has not been extensively studied either in downstream or upstream. In this work we use experimental work to investigate the operation of FBMC in intensity modulated Passive Optical Networks (PONs) employing direct detection in conjunction with both direct and external modulation schemes. The data rates and propagation lengths employed here vary from 8.4 to 14.8 Gb/s and 0-75 km. The results suggest that by using FBMC it is possible to accomplish CP-Less transmission up to 75 km of SSMF in passive links using cost effective intensity modulation and detection schemes.

Relativistic and Slowing Down: The Flow in the Hotspots of Powerful Radio Galaxies and Quasars

NASA Technical Reports Server (NTRS)

Kazanas, D.

2003-01-01

The 'hotspots' of powerful radio galaxies (the compact, high brightness regions, where the jet flow collides with the intergalactic medium (IGM)) have been imaged in radio, optical and recently in X-ray frequencies. We propose a scheme that unifies their, at first sight, disparate broad band (radio to X-ray) spectral properties. This scheme involves a relativistic flow upstream of the hotspot that decelerates to the sub-relativistic speed of its inferred advance through the IGM and it is viewed at different angles to its direction of motion, as suggested by two independent orientation estimators (the presence or not of broad emission lines in their optical spectra and the core-to-extended radio luminosity). This scheme, besides providing an account of the hotspot spectral properties with jet orientation, it also suggests that the large-scale jets remain relativistic all the way to the hotspots.

An improved anonymous authentication scheme for roaming in ubiquitous networks.

PubMed

Lee, Hakjun; Lee, Donghoon; Moon, Jongho; Jung, Jaewook; Kang, Dongwoo; Kim, Hyoungshick; Won, Dongho

2018-01-01

With the evolution of communication technology and the exponential increase of mobile devices, the ubiquitous networking allows people to use our data and computing resources anytime and everywhere. However, numerous security concerns and complicated requirements arise as these ubiquitous networks are deployed throughout people's lives. To meet the challenge, the user authentication schemes in ubiquitous networks should ensure the essential security properties for the preservation of the privacy with low computational cost. In 2017, Chaudhry et al. proposed a password-based authentication scheme for the roaming in ubiquitous networks to enhance the security. Unfortunately, we found that their scheme remains insecure in its protection of the user privacy. In this paper, we prove that Chaudhry et al.'s scheme is vulnerable to the stolen-mobile device and user impersonation attacks, and its drawbacks comprise the absence of the incorrect login-input detection, the incorrectness of the password change phase, and the absence of the revocation provision. Moreover, we suggest a possible way to fix the security flaw in Chaudhry et al's scheme by using the biometric-based authentication for which the bio-hash is applied in the implementation of a three-factor authentication. We prove the security of the proposed scheme with the random oracle model and formally verify its security properties using a tool named ProVerif, and analyze it in terms of the computational and communication cost. The analysis result shows that the proposed scheme is suitable for resource-constrained ubiquitous environments.

An improved anonymous authentication scheme for roaming in ubiquitous networks

PubMed Central

Lee, Hakjun; Lee, Donghoon; Moon, Jongho; Jung, Jaewook; Kang, Dongwoo; Kim, Hyoungshick

2018-01-01

With the evolution of communication technology and the exponential increase of mobile devices, the ubiquitous networking allows people to use our data and computing resources anytime and everywhere. However, numerous security concerns and complicated requirements arise as these ubiquitous networks are deployed throughout people’s lives. To meet the challenge, the user authentication schemes in ubiquitous networks should ensure the essential security properties for the preservation of the privacy with low computational cost. In 2017, Chaudhry et al. proposed a password-based authentication scheme for the roaming in ubiquitous networks to enhance the security. Unfortunately, we found that their scheme remains insecure in its protection of the user privacy. In this paper, we prove that Chaudhry et al.’s scheme is vulnerable to the stolen-mobile device and user impersonation attacks, and its drawbacks comprise the absence of the incorrect login-input detection, the incorrectness of the password change phase, and the absence of the revocation provision. Moreover, we suggest a possible way to fix the security flaw in Chaudhry et al’s scheme by using the biometric-based authentication for which the bio-hash is applied in the implementation of a three-factor authentication. We prove the security of the proposed scheme with the random oracle model and formally verify its security properties using a tool named ProVerif, and analyze it in terms of the computational and communication cost. The analysis result shows that the proposed scheme is suitable for resource-constrained ubiquitous environments. PMID:29505575

Complex Conjugated certificateless-based signcryption with differential integrated factor for secured message communication in mobile network

PubMed Central

Rajagopalan, S. P.

2017-01-01

Certificateless-based signcryption overcomes inherent shortcomings in traditional Public Key Infrastructure (PKI) and Key Escrow problem. It imparts efficient methods to design PKIs with public verifiability and cipher text authenticity with minimum dependency. As a classic primitive in public key cryptography, signcryption performs validity of cipher text without decryption by combining authentication, confidentiality, public verifiability and cipher text authenticity much more efficiently than the traditional approach. In this paper, we first define a security model for certificateless-based signcryption called, Complex Conjugate Differential Integrated Factor (CC-DIF) scheme by introducing complex conjugates through introduction of the security parameter and improving secured message distribution rate. However, both partial private key and secret value changes with respect to time. To overcome this weakness, a new certificateless-based signcryption scheme is proposed by setting the private key through Differential (Diff) Equation using an Integration Factor (DiffEIF), minimizing computational cost and communication overhead. The scheme is therefore said to be proven secure (i.e. improving the secured message distributing rate) against certificateless access control and signcryption-based scheme. In addition, compared with the three other existing schemes, the CC-DIF scheme has the least computational cost and communication overhead for secured message communication in mobile network. PMID:29040290

Complex Conjugated certificateless-based signcryption with differential integrated factor for secured message communication in mobile network.

PubMed

Alagarsamy, Sumithra; Rajagopalan, S P

2017-01-01

Certificateless-based signcryption overcomes inherent shortcomings in traditional Public Key Infrastructure (PKI) and Key Escrow problem. It imparts efficient methods to design PKIs with public verifiability and cipher text authenticity with minimum dependency. As a classic primitive in public key cryptography, signcryption performs validity of cipher text without decryption by combining authentication, confidentiality, public verifiability and cipher text authenticity much more efficiently than the traditional approach. In this paper, we first define a security model for certificateless-based signcryption called, Complex Conjugate Differential Integrated Factor (CC-DIF) scheme by introducing complex conjugates through introduction of the security parameter and improving secured message distribution rate. However, both partial private key and secret value changes with respect to time. To overcome this weakness, a new certificateless-based signcryption scheme is proposed by setting the private key through Differential (Diff) Equation using an Integration Factor (DiffEIF), minimizing computational cost and communication overhead. The scheme is therefore said to be proven secure (i.e. improving the secured message distributing rate) against certificateless access control and signcryption-based scheme. In addition, compared with the three other existing schemes, the CC-DIF scheme has the least computational cost and communication overhead for secured message communication in mobile network.

Method for operating a spark-ignition, direct-injection internal combustion engine

DOEpatents

Narayanaswamy, Kushal; Koch, Calvin K.; Najt, Paul M.; Szekely, Jr., Gerald A.; Toner, Joel G.

2015-06-02

A spark-ignition, direct-injection internal combustion engine is coupled to an exhaust aftertreatment system including a three-way catalytic converter upstream of an NH3-SCR catalyst. A method for operating the engine includes operating the engine in a fuel cutoff mode and coincidentally executing a second fuel injection control scheme upon detecting an engine load that permits operation in the fuel cutoff mode.

Purifying fluoride-contaminated water by a novel forward osmosis design with enhanced flux under reduced concentration polarization.

PubMed

Pal, Madhubonti; Chakrabortty, Sankha; Pal, Parimal; Linnanen, Lassi

2015-08-01

For purifying fluoride-contaminated water, a new forward osmosis scheme in horizontal flat-sheet cross flow module was designed and investigated. Effects of pressure, cross flow rate, draw solution and alignment of membrane module on separation and flux were studied. Concentration polarization and reverse salt diffusion got significantly reduced in the new hydrodynamic regime. This resulted in less membrane fouling, better solute separation and higher pure water flux than in a conventional module. The entire scheme was completed in two stages-an upstream forward osmosis for separating pure water from contaminated water and a downstream nanofiltration operation for continuous recovery and recycle of draw solute. Synchronization of these two stages of operation resulted in a continuous, steady-state process. From a set of commercial membranes, two polyamide composite membranes were screened out for the upstream and downstream filtrations. A 0.3-M NaCl solution was found to be the best one for forward osmosis draw solution. Potable water with less than 1% residual fluoride could be produced at a high flux of 60-62 L m(-2) h(-1) whereas more than 99% draw solute could be recovered and recycled in the downstream nanofiltration stage from where flux was 62-65 L m(-2) h(-1).

An Artificial Neural Network Embedded Position and Orientation Determination Algorithm for Low Cost MEMS INS/GPS Integrated Sensors

PubMed Central

Chiang, Kai-Wei; Chang, Hsiu-Wen; Li, Chia-Yuan; Huang, Yun-Wen

2009-01-01

Digital mobile mapping, which integrates digital imaging with direct geo-referencing, has developed rapidly over the past fifteen years. Direct geo-referencing is the determination of the time-variable position and orientation parameters for a mobile digital imager. The most common technologies used for this purpose today are satellite positioning using Global Positioning System (GPS) and Inertial Navigation System (INS) using an Inertial Measurement Unit (IMU). They are usually integrated in such a way that the GPS receiver is the main position sensor, while the IMU is the main orientation sensor. The Kalman Filter (KF) is considered as the optimal estimation tool for real-time INS/GPS integrated kinematic position and orientation determination. An intelligent hybrid scheme consisting of an Artificial Neural Network (ANN) and KF has been proposed to overcome the limitations of KF and to improve the performance of the INS/GPS integrated system in previous studies. However, the accuracy requirements of general mobile mapping applications can’t be achieved easily, even by the use of the ANN-KF scheme. Therefore, this study proposes an intelligent position and orientation determination scheme that embeds ANN with conventional Rauch-Tung-Striebel (RTS) smoother to improve the overall accuracy of a MEMS INS/GPS integrated system in post-mission mode. By combining the Micro Electro Mechanical Systems (MEMS) INS/GPS integrated system and the intelligent ANN-RTS smoother scheme proposed in this study, a cheaper but still reasonably accurate position and orientation determination scheme can be anticipated. PMID:22574034

Urban search mobile platform modeling in hindered access conditions

NASA Astrophysics Data System (ADS)

Barankova, I. I.; Mikhailova, U. V.; Kalugina, O. B.; Barankov, V. V.

2018-05-01

The article explores the control system simulation and the design of the experimental model of the rescue robot mobile platform. The functional interface, a structural functional diagram of the mobile platform control unit, and a functional control scheme for the mobile platform of secure robot were modeled. The task of design a mobile platform for urban searching in hindered access conditions is realized through the use of a mechanical basis with a chassis and crawler drive, a warning device, human heat sensors and a microcontroller based on Arduino platforms.

A Source Anonymity-Based Lightweight Secure AODV Protocol for Fog-Based MANET

PubMed Central

Fang, Weidong; Zhang, Wuxiong; Xiao, Jinchao; Yang, Yang; Chen, Wei

2017-01-01

Fog-based MANET (Mobile Ad hoc networks) is a novel paradigm of a mobile ad hoc network with the advantages of both mobility and fog computing. Meanwhile, as traditional routing protocol, ad hoc on-demand distance vector (AODV) routing protocol has been applied widely in fog-based MANET. Currently, how to improve the transmission performance and enhance security are the two major aspects in AODV’s research field. However, the researches on joint energy efficiency and security seem to be seldom considered. In this paper, we propose a source anonymity-based lightweight secure AODV (SAL-SAODV) routing protocol to meet the above requirements. In SAL-SAODV protocol, source anonymous and secure transmitting schemes are proposed and applied. The scheme involves the following three parts: the source anonymity algorithm is employed to achieve the source node, without being tracked and located; the improved secure scheme based on the polynomial of CRC-4 is applied to substitute the RSA digital signature of SAODV and guarantee the data integrity, in addition to reducing the computation and energy consumption; the random delayed transmitting scheme (RDTM) is implemented to separate the check code and transmitted data, and achieve tamper-proof results. The simulation results show that the comprehensive performance of the proposed SAL-SAODV is a trade-off of the transmission performance, energy efficiency, and security, and better than AODV and SAODV. PMID:28629142

A Source Anonymity-Based Lightweight Secure AODV Protocol for Fog-Based MANET.

PubMed

Fang, Weidong; Zhang, Wuxiong; Xiao, Jinchao; Yang, Yang; Chen, Wei

2017-06-17

Fog-based MANET (Mobile Ad hoc networks) is a novel paradigm of a mobile ad hoc network with the advantages of both mobility and fog computing. Meanwhile, as traditional routing protocol, ad hoc on-demand distance vector (AODV) routing protocol has been applied widely in fog-based MANET. Currently, how to improve the transmission performance and enhance security are the two major aspects in AODV's research field. However, the researches on joint energy efficiency and security seem to be seldom considered. In this paper, we propose a source anonymity-based lightweight secure AODV (SAL-SAODV) routing protocol to meet the above requirements. In SAL-SAODV protocol, source anonymous and secure transmitting schemes are proposed and applied. The scheme involves the following three parts: the source anonymity algorithm is employed to achieve the source node, without being tracked and located; the improved secure scheme based on the polynomial of CRC-4 is applied to substitute the RSA digital signature of SAODV and guarantee the data integrity, in addition to reducing the computation and energy consumption; the random delayed transmitting scheme (RDTM) is implemented to separate the check code and transmitted data, and achieve tamper-proof results. The simulation results show that the comprehensive performance of the proposed SAL-SAODV is a trade-off of the transmission performance, energy efficiency, and security, and better than AODV and SAODV.

A Systematic Scheme for Multiple Access in Ethernet Passive Optical Access Networks

NASA Astrophysics Data System (ADS)

Ma, Maode; Zhu, Yongqing; Hiang Cheng, Tee

2005-11-01

While backbone networks have experienced substantial changes in the last decade, access networks have not changed much. Recently, passive optical networks (PONs) seem to be ready for commercial deployment as access networks, due to the maturity of a number of enabling technologies. Among the PON technologies, Ethernet PON (EPON) standardized by the IEEE 802.3ah Ethernet in the First Mile (EFM) Task Force is the most attractive one because of its high speed, low cost, familiarity, interoperability, and low overhead. In this paper, we consider the issue of upstream channel sharing in the EPONs. We propose a novel multiple-access control scheme to provide bandwidth-guaranteed service for high-demand customers, while providing best effort service to low-demand customers according to the service level agreement (SLA). The analytical and simulation results prove that the proposed scheme performs best in what it is designed to do compared to another well-known scheme that has not considered providing differentiated services. With business customers preferring premium services with guaranteed bandwidth and residential users preferring low-cost best effort services, our scheme could benefit both groups of subscribers, as well as the operators.

Consensus in evolving networks of mobile agents

NASA Astrophysics Data System (ADS)

Baronchelli, Andrea; Díaz-Guilera, Albert

2012-02-01

Populations of mobile and communicating agents describe a vast array of technological and natural systems, ranging from sensor networks to animal groups. Here, we investigate how a group-level agreement may emerge in the continuously evolving networks defined by the local interactions of the moving individuals. We adopt a general scheme of motion in two dimensions and we let the individuals interact through the minimal naming game, a prototypical scheme to investigate social consensus. We distinguish different regimes of convergence determined by the emission range of the agents and by their mobility, and we identify the corresponding scaling behaviors of the consensus time. In the same way, we rationalize also the behavior of the maximum memory used during the convergence process, which determines the minimum cognitive/storage capacity needed by the individuals. Overall, we believe that the simple and general model presented in this talk can represent a helpful reference for a better understanding of the behavior of populations of mobile agents.

Consensus in networks of mobile communicating agents

NASA Astrophysics Data System (ADS)

Baronchelli, Andrea; Díaz-Guilera, Albert

2012-01-01

Populations of mobile and communicating agents describe a vast array of technological and natural systems, ranging from sensor networks to animal groups. Here, we investigate how a group-level agreement may emerge in the continuously evolving network defined by the local interactions of the moving individuals. We adopt a general scheme of motion in two dimensions and we let the individuals interact through the minimal naming game, a prototypical scheme to investigate social consensus. We distinguish different regimes of convergence determined by the emission range of the agents and by their mobility, and we identify the corresponding scaling behaviors of the consensus time. In the same way, we rationalize also the behavior of the maximum memory used during the convergence process, which determines the minimum cognitive/storage capacity needed by the individuals. Overall, we believe that the simple and general model presented in this paper can represent a helpful reference for a better understanding of the behavior of populations of mobile agents.

Data-Gathering Scheme Using AUVs in Large-Scale Underwater Sensor Networks: A Multihop Approach

PubMed Central

Khan, Jawaad Ullah; Cho, Ho-Shin

2016-01-01

In this paper, we propose a data-gathering scheme for hierarchical underwater sensor networks, where multiple Autonomous Underwater Vehicles (AUVs) are deployed over large-scale coverage areas. The deployed AUVs constitute an intermittently connected multihop network through inter-AUV synchronization (in this paper, synchronization means an interconnection between nodes for communication) for forwarding data to the designated sink. In such a scenario, the performance of the multihop communication depends upon the synchronization among the vehicles. The mobility parameters of the vehicles vary continuously because of the constantly changing underwater currents. The variations in the AUV mobility parameters reduce the inter-AUV synchronization frequency contributing to delays in the multihop communication. The proposed scheme improves the AUV synchronization frequency by permitting neighboring AUVs to share their status information via a pre-selected node called an agent-node at the static layer of the network. We evaluate the proposed scheme in terms of the AUV synchronization frequency, vertical delay (node→AUV), horizontal delay (AUV→AUV), end-to-end delay, and the packet loss ratio. Simulation results show that the proposed scheme significantly reduces the aforementioned delays without the synchronization time-out process employed in conventional works. PMID:27706042

Data-Gathering Scheme Using AUVs in Large-Scale Underwater Sensor Networks: A Multihop Approach.

PubMed

Khan, Jawaad Ullah; Cho, Ho-Shin

2016-09-30

In this paper, we propose a data-gathering scheme for hierarchical underwater sensor networks, where multiple Autonomous Underwater Vehicles (AUVs) are deployed over large-scale coverage areas. The deployed AUVs constitute an intermittently connected multihop network through inter-AUV synchronization (in this paper, synchronization means an interconnection between nodes for communication) for forwarding data to the designated sink. In such a scenario, the performance of the multihop communication depends upon the synchronization among the vehicles. The mobility parameters of the vehicles vary continuously because of the constantly changing underwater currents. The variations in the AUV mobility parameters reduce the inter-AUV synchronization frequency contributing to delays in the multihop communication. The proposed scheme improves the AUV synchronization frequency by permitting neighboring AUVs to share their status information via a pre-selected node called an agent-node at the static layer of the network. We evaluate the proposed scheme in terms of the AUV synchronization frequency, vertical delay (node→AUV), horizontal delay (AUV→AUV), end-to-end delay, and the packet loss ratio. Simulation results show that the proposed scheme significantly reduces the aforementioned delays without the synchronization time-out process employed in conventional works.

High-fidelity and low-latency mobile fronthaul based on segment-wise TDM and MIMO-interleaved arraying.

PubMed

Li, Longsheng; Bi, Meihua; Miao, Xin; Fu, Yan; Hu, Weisheng

2018-01-22

In this paper, we firstly demonstrate an advanced arraying scheme in the TDM-based analog mobile fronthaul system to enhance the signal fidelity, in which the segment of the antenna carrier signal (AxC) with an appropriate length is served as the granularity for TDM aggregation. Without introducing extra processing, the entire system can be realized by simple DSP. The theoretical analysis is presented to verify the feasibility of this scheme, and to evaluate its effectiveness, the experiment with ~7-GHz bandwidth and 20 8 × 8 MIMO group signals are conducted. Results show that the segment-wise TDM is completely compatible with the MIMO-interleaved arraying, which is employed in an existing TDM scheme to improve the bandwidth efficiency. Moreover, compared to the existing TDM schemes, our scheme can not only satisfy the latency requirement of 5G but also significantly reduce the multiplexed signal bandwidth, hence providing higher signal fidelity in the bandwidth-limited fronthaul system. The experimental result of EVM verifies that 256-QAM is supportable using the segment-wise TDM arraying with only 250-ns latency, while with the ordinary TDM arraying, only 64-QAM is bearable.

Hierarchical scheme for detecting the rotating MIMO transmission of the in-door RGB-LED visible light wireless communications using mobile-phone camera

NASA Astrophysics Data System (ADS)

Chen, Shih-Hao; Chow, Chi-Wai

2015-01-01

Multiple-input and multiple-output (MIMO) scheme can extend the transmission capacity for the light-emitting-diode (LED) based visible light communication (VLC) systems. The MIMO VLC system that uses the mobile-phone camera as the optical receiver (Rx) to receive MIMO signal from the n×n Red-Green-Blue (RGB) LED array is desirable. The key step of decoding this signal is to detect the signal direction. If the LED transmitter (Tx) is rotated, the Rx may not realize the rotation and transmission error can occur. In this work, we propose and demonstrate a novel hierarchical transmission scheme which can reduce the computation complexity of rotation detection in LED array VLC system. We use the n×n RGB LED array as the MIMO Tx. In our study, a novel two dimensional Hadamard coding scheme is proposed. Using the different LED color layers to indicate the rotation, a low complexity rotation detection method can be used for improving the quality of received signal. The detection correction rate is above 95% in the indoor usage distance. Experimental results confirm the feasibility of the proposed scheme.

An Energy-Efficient Secure Routing and Key Management Scheme for Mobile Sinks in Wireless Sensor Networks Using Deployment Knowledge

PubMed Central

Hung, Le Xuan; Canh, Ngo Trong; Lee, Sungyoung; Lee, Young-Koo; Lee, Heejo

2008-01-01

For many sensor network applications such as military or homeland security, it is essential for users (sinks) to access the sensor network while they are moving. Sink mobility brings new challenges to secure routing in large-scale sensor networks. Previous studies on sink mobility have mainly focused on efficiency and effectiveness of data dissemination without security consideration. Also, studies and experiences have shown that considering security during design time is the best way to provide security for sensor network routing. This paper presents an energy-efficient secure routing and key management for mobile sinks in sensor networks, called SCODEplus. It is a significant extension of our previous study in five aspects: (1) Key management scheme and routing protocol are considered during design time to increase security and efficiency; (2) The network topology is organized in a hexagonal plane which supports more efficiency than previous square-grid topology; (3) The key management scheme can eliminate the impacts of node compromise attacks on links between non-compromised nodes; (4) Sensor node deployment is based on Gaussian distribution which is more realistic than uniform distribution; (5) No GPS or like is required to provide sensor node location information. Our security analysis demonstrates that the proposed scheme can defend against common attacks in sensor networks including node compromise attacks, replay attacks, selective forwarding attacks, sinkhole and wormhole, Sybil attacks, HELLO flood attacks. Both mathematical and simulation-based performance evaluation show that the SCODEplus significantly reduces the communication overhead, energy consumption, packet delivery latency while it always delivers more than 97 percent of packets successfully. PMID:27873956

An Energy-Efficient Secure Routing and Key Management Scheme for Mobile Sinks in Wireless Sensor Networks Using Deployment Knowledge.

PubMed

Hung, Le Xuan; Canh, Ngo Trong; Lee, Sungyoung; Lee, Young-Koo; Lee, Heejo

2008-12-03

For many sensor network applications such as military or homeland security, it is essential for users (sinks) to access the sensor network while they are moving. Sink mobility brings new challenges to secure routing in large-scale sensor networks. Previous studies on sink mobility have mainly focused on efficiency and effectiveness of data dissemination without security consideration. Also, studies and experiences have shown that considering security during design time is the best way to provide security for sensor network routing. This paper presents an energy-efficient secure routing and key management for mobile sinks in sensor networks, called SCODE plus . It is a significant extension of our previous study in five aspects: (1) Key management scheme and routing protocol are considered during design time to increase security and efficiency; (2) The network topology is organized in a hexagonal plane which supports more efficiency than previous square-grid topology; (3) The key management scheme can eliminate the impacts of node compromise attacks on links between non-compromised nodes; (4) Sensor node deployment is based on Gaussian distribution which is more realistic than uniform distribution; (5) No GPS or like is required to provide sensor node location information. Our security analysis demonstrates that the proposed scheme can defend against common attacks in sensor networks including node compromise attacks, replay attacks, selective forwarding attacks, sinkhole and wormhole, Sybil attacks, HELLO flood attacks. Both mathematical and simulation-based performance evaluation show that the SCODE plus significantly reduces the communication overhead, energy consumption, packet delivery latency while it always delivers more than 97 percent of packets successfully.

A Novel Loss Recovery and Tracking Scheme for Maneuvering Target in Hybrid WSNs.

PubMed

Qian, Hanwang; Fu, Pengcheng; Li, Baoqing; Liu, Jianpo; Yuan, Xiaobing

2018-01-25

Tracking a mobile target, which aims to timely monitor the invasion of specific target, is one of the most prominent applications in wireless sensor networks (WSNs). Traditional tracking methods in WSNs only based on static sensor nodes (SNs) have several critical problems. For example, to void the loss of mobile target, many SNs must be active to track the target in all possible directions, resulting in excessive energy consumption. Additionally, when entering coverage holes in the monitoring area, the mobile target may be missing and then its state is unknown during this period. To tackle these problems, in this paper, a few mobile sensor nodes (MNs) are introduced to cooperate with SNs to form a hybrid WSN due to their stronger abilities and less constrained energy. Then, we propose a valid target tracking scheme for hybrid WSNs to dynamically schedule the MNs and SNs. Moreover, a novel loss recovery mechanism is proposed to find the lost target and recover the tracking with fewer SNs awakened. Furthermore, to improve the robustness and accuracy of the recovery mechanism, an adaptive unscented Kalman filter (AUKF) algorithm is raised to dynamically adjust the process noise covariance. Simulation results demonstrate that our tracking scheme for maneuvering target in hybrid WSNs can not only track the target effectively even if the target is lost but also maintain an excellent accuracy and robustness with fewer activated nodes.

A Novel Loss Recovery and Tracking Scheme for Maneuvering Target in Hybrid WSNs

PubMed Central

Liu, Jianpo; Yuan, Xiaobing

2018-01-01

Tracking a mobile target, which aims to timely monitor the invasion of specific target, is one of the most prominent applications in wireless sensor networks (WSNs). Traditional tracking methods in WSNs only based on static sensor nodes (SNs) have several critical problems. For example, to void the loss of mobile target, many SNs must be active to track the target in all possible directions, resulting in excessive energy consumption. Additionally, when entering coverage holes in the monitoring area, the mobile target may be missing and then its state is unknown during this period. To tackle these problems, in this paper, a few mobile sensor nodes (MNs) are introduced to cooperate with SNs to form a hybrid WSN due to their stronger abilities and less constrained energy. Then, we propose a valid target tracking scheme for hybrid WSNs to dynamically schedule the MNs and SNs. Moreover, a novel loss recovery mechanism is proposed to find the lost target and recover the tracking with fewer SNs awakened. Furthermore, to improve the robustness and accuracy of the recovery mechanism, an adaptive unscented Kalman filter (AUKF) algorithm is raised to dynamically adjust the process noise covariance. Simulation results demonstrate that our tracking scheme for maneuvering target in hybrid WSNs can not only track the target effectively even if the target is lost but also maintain an excellent accuracy and robustness with fewer activated nodes. PMID:29370103

Integrating AlGaN/GaN high electron mobility transistor with Si: A comparative study of integration schemes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohan, Nagaboopathy; Raghavan, Srinivasan; Centre for Nano Science and Engineering, Indian Institute of Science, Bangalore 560012

2015-10-07

AlGaN/GaN high electron mobility transistor stacks deposited on a single growth platform are used to compare the most common transition, AlN to GaN, schemes used for integrating GaN with Si. The efficiency of these transitions based on linearly graded, step graded, interlayer, and superlattice schemes on dislocation density reduction, stress management, surface roughness, and eventually mobility of the 2D-gas are evaluated. In a 500 nm GaN probe layer deposited, all of these transitions result in total transmission electron microscopy measured dislocations densities of 1 to 3 × 10{sup 9}/cm{sup 2} and <1 nm surface roughness. The 2-D electron gas channels formed atmore » an AlGaN-1 nm AlN/GaN interface deposited on this GaN probe layer all have mobilities of 1600–1900 cm{sup 2}/V s at a carrier concentration of 0.7–0.9 × 10{sup 13}/cm{sup 2}. Compressive stress and changes in composition in GaN rich regions of the AlN-GaN transition are the most effective at reducing dislocation density. Amongst all the transitions studied the step graded transition is the one that helps to implement this feature of GaN integration in the simplest and most consistent manner.« less

Cooperative Search and Rescue with Artificial Fishes Based on Fish-Swarm Algorithm for Underwater Wireless Sensor Networks

PubMed Central

Zhao, Wei; Tang, Zhenmin; Yang, Yuwang; Wang, Lei; Lan, Shaohua

2014-01-01

This paper presents a searching control approach for cooperating mobile sensor networks. We use a density function to represent the frequency of distress signals issued by victims. The mobile nodes' moving in mission space is similar to the behaviors of fish-swarm in water. So, we take the mobile node as artificial fish node and define its operations by a probabilistic model over a limited range. A fish-swarm based algorithm is designed requiring local information at each fish node and maximizing the joint detection probabilities of distress signals. Optimization of formation is also considered for the searching control approach and is optimized by fish-swarm algorithm. Simulation results include two schemes: preset route and random walks, and it is showed that the control scheme has adaptive and effective properties. PMID:24741341

Cooperative search and rescue with artificial fishes based on fish-swarm algorithm for underwater wireless sensor networks.

PubMed

Zhao, Wei; Tang, Zhenmin; Yang, Yuwang; Wang, Lei; Lan, Shaohua

2014-01-01

This paper presents a searching control approach for cooperating mobile sensor networks. We use a density function to represent the frequency of distress signals issued by victims. The mobile nodes' moving in mission space is similar to the behaviors of fish-swarm in water. So, we take the mobile node as artificial fish node and define its operations by a probabilistic model over a limited range. A fish-swarm based algorithm is designed requiring local information at each fish node and maximizing the joint detection probabilities of distress signals. Optimization of formation is also considered for the searching control approach and is optimized by fish-swarm algorithm. Simulation results include two schemes: preset route and random walks, and it is showed that the control scheme has adaptive and effective properties.

Direct measurements of wall shear stress by buried wire gages in a shock-wave boundary-layer interaction region

NASA Technical Reports Server (NTRS)

Murthy, V. S.; Rose, W. C.

1977-01-01

Detailed measurements of wall shear stress (skin friction) were made with specially developed buried wire gages in the interaction regions of a Mach 2.9 turbulent boundary layer with externally generated shocks. Separation and reattachment points inferred by these measurements support the findings of earlier experiments which used a surface oil flow technique and pitot profile measurements. The measurements further indicate that the boundary layer tends to attain significantly higher skin-friction values downstream of the interaction region as compared to upstream. Comparisons between measured wall shear stress and published results of some theoretical calculation schemes show that the general, but not detailed, behavior is predicted well by such schemes.

Implementation of LSCMA adaptive array terminal for mobile satellite communications

NASA Astrophysics Data System (ADS)

Zhou, Shun; Wang, Huali; Xu, Zhijun

2007-11-01

This paper considers the application of adaptive array antenna based on the least squares constant modulus algorithm (LSCMA) for interference rejection in mobile SATCOM terminals. A two-element adaptive array scheme is implemented with a combination of ADI TS201S DSP chips and Altera Stratix II FPGA device, which makes a cooperating computation for adaptive beamforming. Its interference suppressing performance is verified via Matlab simulations. Digital hardware system is implemented to execute the operations of LSCMA beamforming algorithm that is represented by an algorithm flowchart. The result of simulations and test indicate that this scheme can improve the anti-jamming performance of terminals.

A cooperative positioning with Kalman filters and handover mechanism for indoor microcellular visible light communication network

NASA Astrophysics Data System (ADS)

Xiong, Jieqing; Huang, Zhitong; Zhuang, Kaiyu; Ji, Yuefeng

2016-08-01

We propose a novel handover scheme for indoor microcellular visible light communication (VLC) network. With such a scheme, the room, which is fully coverage by light, is divided into several microcells according to the layout of light-emitting diodes (LEDs). However, the directionality of light arises new challenges in keeping the connectivity between the mobile devices and light source under the mobile circumstances. The simplest solution is that all LEDs broadcast data of every user simultaneously, but it wastes too much bandwidth resource, especially when the amount of users increases. To solve this key problem, we utilize the optical positioning assisting handover procedure in this paper. In the positioning stage, the network manager obtains the location information of user device via downlink and uplink signal strength information, which is white light and infrared, respectively. After that, a Kalman filter is utilized for improving the tracking performance of a mobile device. Then, the network manager decides how to initiate the handover process by the previous information. Results show that the proposed scheme can achieve low-cost, seamless data communication, and a high probability of successful handover.

Dynamic Call Admission Control Scheme Based on Predictive User Mobility Behavior for Cellular Networks

NASA Astrophysics Data System (ADS)

Intarasothonchun, Silada; Thipchaksurat, Sakchai; Varakulsiripunth, Ruttikorn; Onozato, Yoshikuni

In this paper, we propose a modified scheme of MSODB and PMS, called Predictive User Mobility Behavior (PUMB) to improve performance of resource reservation and call admission control for cellular networks. This algorithm is proposed in which bandwidth is allocated more efficiently to neighboring cells by key mobility parameters in order to provide QoS guarantees for transferring traffic. The probability is used to form a cluster of cells and the shadow cluster, where a mobile unit is likely to visit. When a mobile unit may change the direction and migrate to the cell that does not belong to its shadow cluster, we can support it by making efficient use of predicted nonconforming call. Concomitantly, to ensure continuity of on-going calls with better utilization of resources, bandwidth is borrowed from predicted nonconforming calls and existing adaptive calls without affecting the minimum QoS guarantees. The performance of the PUMB is demonstrated by simulation results in terms of new call blocking probability, handoff call dropping probability, bandwidth utilization, call successful probability, and overhead message transmission when arrival rate and speed of mobile units are varied. Our results show that PUMB provides the better performances comparing with those of MSODB and PMS under different traffic conditions.

A Pre-Emptive Horizontal Channel Borrowing and Vertical Traffic Overflowing Channel Allocation Scheme for Overlay Networks

NASA Astrophysics Data System (ADS)

Zhao, Fang-Ming; Jiang, Ling-Ge; He, Chen

In this paper, a channel allocation scheme is studied for overlay wireless networks to optimize connection-level QoS. The contributions of our work are threefold. First, a channel allocation strategy using both horizontal channel borrowing and vertical traffic overflowing (HCBVTO) is presented and analyzed. When all the channels in a given macrocell are used, high-mobility real-time handoff requests can borrow channels from adjacent homogeneous cells. In case that the borrowing requests fail, handoff requests may also be overflowed to heterogeneous cells, if possible. Second, high-mobility real-time service is prioritized by allowing it to preempt channels currently used by other services. And third, to meet the high QoS requirements of some services and increase the utilization of radio resources, certain services can be transformed between real-time services and non-real-time services as necessary. Simulation results demonstrate that the proposed schemes can improve system performance.

A pattern jitter free AFC scheme for mobile satellite systems

NASA Technical Reports Server (NTRS)

Yoshida, Shousei

1993-01-01

This paper describes a scheme for pattern jitter free automatic frequency control (AFC) with a wide frequency acquisition range. In this scheme, equalizing signals fed to the frequency discriminator allow pattern jitter free performance to be achieved for all roll-off factors. In order to define the acquisition range, frequency discrimination characateristics are analyzed on a newly derived frequency domain model. As a result, it is shown that a sufficiently wide acquisition range over a given system symbol rate can be achieved independent of symbol timing errors. Additionally, computer simulation demonstrates that frequency jitter performance improves in proportion to E(sub b)/N(sub 0) because pattern-dependent jitter is suppressed in the discriminator output. These results show significant promise for applciation to mobile satellite systems, which feature relatively low symbol rate transmission with an approximately 0.4-0.7 roll-off factor.

What Does "Active Citizenship" Mean for Erasmus Students?

ERIC Educational Resources Information Center

Golubeva, Irina; Gómez Parra, Ma. Elena; Espejo Mohedano, Roberto

2018-01-01

Since ERASMUS (European Region Action Scheme for the Mobility of University Students) was launched there has been a constant debate about the civic significance of this mobility programme. The purpose of this article is to analyse the understanding of "active citizenship" by Erasmus students. In order to discover Erasmus students'…

An Improved Forwarding of Diverse Events with Mobile Sinks in Underwater Wireless Sensor Networks.

PubMed

Raza, Waseem; Arshad, Farzana; Ahmed, Imran; Abdul, Wadood; Ghouzali, Sanaa; Niaz, Iftikhar Azim; Javaid, Nadeem

2016-11-04

In this paper, a novel routing strategy to cater the energy consumption and delay sensitivity issues in deep underwater wireless sensor networks is proposed. This strategy is named as ESDR: Event Segregation based Delay sensitive Routing. In this strategy sensed events are segregated on the basis of their criticality and, are forwarded to their respective destinations based on forwarding functions. These functions depend on different routing metrics like: Signal Quality Index, Localization free Signal to Noise Ratio, Energy Cost Function and Depth Dependent Function. The problem of incomparable values of previously defined forwarding functions causes uneven delays in forwarding process. Hence forwarding functions are redefined to ensure their comparable values in different depth regions. Packet forwarding strategy is based on the event segregation approach which forwards one third of the generated events (delay sensitive) to surface sinks and two third events (normal events) are forwarded to mobile sinks. Motion of mobile sinks is influenced by the relative distribution of normal nodes. We have also incorporated two different mobility patterns named as; adaptive mobility and uniform mobility for mobile sinks. The later one is implemented for collecting the packets generated by the normal nodes. These improvements ensure optimum holding time, uniform delay and in-time reporting of delay sensitive events. This scheme is compared with the existing ones and outperforms the existing schemes in terms of network lifetime, delay and throughput.

PS-CARA: Context-Aware Resource Allocation Scheme for Mobile Public Safety Networks.

PubMed

Kaleem, Zeeshan; Khaliq, Muhammad Zubair; Khan, Ajmal; Ahmad, Ishtiaq; Duong, Trung Q

2018-05-08

The fifth-generation (5G) communications systems are expecting to support users with diverse quality-of-service (QoS) requirements. Beside these requirements, the task with utmost importance is to support the emergency communication services during natural or man-made disasters. Most of the conventional base stations are not properly functional during a disaster situation, so deployment of emergency base stations such as mobile personal cell (mPC) is crucial. An mPC having moving capability can move in the disaster area to provide emergency communication services. However, mPC deployment causes severe co-channel interference to the users in its vicinity. The problem in the existing resource allocation schemes is its support for static environment, that does not fit well for mPC. So, a resource allocation scheme for mPC users is desired that can dynamically allocate resources based on users’ location and its connection establishment priority. In this paper, we propose a public safety users priority-based context-aware resource allocation (PS-CARA) scheme for users sum-rate maximization in disaster environment. Simulations results demonstrate that the proposed PS-CARA scheme can increase the user average and edge rate around 10.3% and 32.8% , respectively because of context information availability and by prioritizing the public safety users. The simulation results ensure that call blocking probability is also reduced considerably under the PS-CARA scheme.

PS-CARA: Context-Aware Resource Allocation Scheme for Mobile Public Safety Networks

PubMed Central

Khaliq, Muhammad Zubair; Khan, Ajmal; Ahmad, Ishtiaq

2018-01-01

The fifth-generation (5G) communications systems are expecting to support users with diverse quality-of-service (QoS) requirements. Beside these requirements, the task with utmost importance is to support the emergency communication services during natural or man-made disasters. Most of the conventional base stations are not properly functional during a disaster situation, so deployment of emergency base stations such as mobile personal cell (mPC) is crucial. An mPC having moving capability can move in the disaster area to provide emergency communication services. However, mPC deployment causes severe co-channel interference to the users in its vicinity. The problem in the existing resource allocation schemes is its support for static environment, that does not fit well for mPC. So, a resource allocation scheme for mPC users is desired that can dynamically allocate resources based on users’ location and its connection establishment priority. In this paper, we propose a public safety users priority-based context-aware resource allocation (PS-CARA) scheme for users sum-rate maximization in disaster environment. Simulations results demonstrate that the proposed PS-CARA scheme can increase the user average and edge rate around 10.3% and 32.8% , respectively because of context information availability and by prioritizing the public safety users. The simulation results ensure that call blocking probability is also reduced considerably under the PS-CARA scheme. PMID:29738499

A Network Topology Control and Identity Authentication Protocol with Support for Movable Sensor Nodes

PubMed Central

Zhang, Ying; Chen, Wei; Liang, Jixing; Zheng, Bingxin; Jiang, Shengming

2015-01-01

It is expected that in the near future wireless sensor network (WSNs) will be more widely used in the mobile environment, in applications such as Autonomous Underwater Vehicles (AUVs) for marine monitoring and mobile robots for environmental investigation. The sensor nodes’ mobility can easily cause changes to the structure of a network topology, and lead to the decline in the amount of transmitted data, excessive energy consumption, and lack of security. To solve these problems, a kind of efficient Topology Control algorithm for node Mobility (TCM) is proposed. In the topology construction stage, an efficient clustering algorithm is adopted, which supports sensor node movement. It can ensure the balance of clustering, and reduce the energy consumption. In the topology maintenance stage, the digital signature authentication based on Error Correction Code (ECC) and the communication mechanism of soft handover are adopted. After verifying the legal identity of the mobile nodes, secure communications can be established, and this can increase the amount of data transmitted. Compared to some existing schemes, the proposed scheme has significant advantages regarding network topology stability, amounts of data transferred, lifetime and safety performance of the network. PMID:26633405

A Network Topology Control and Identity Authentication Protocol with Support for Movable Sensor Nodes.

PubMed

Zhang, Ying; Chen, Wei; Liang, Jixing; Zheng, Bingxin; Jiang, Shengming

2015-12-01

It is expected that in the near future wireless sensor network (WSNs) will be more widely used in the mobile environment, in applications such as Autonomous Underwater Vehicles (AUVs) for marine monitoring and mobile robots for environmental investigation. The sensor nodes' mobility can easily cause changes to the structure of a network topology, and lead to the decline in the amount of transmitted data, excessive energy consumption, and lack of security. To solve these problems, a kind of efficient Topology Control algorithm for node Mobility (TCM) is proposed. In the topology construction stage, an efficient clustering algorithm is adopted, which supports sensor node movement. It can ensure the balance of clustering, and reduce the energy consumption. In the topology maintenance stage, the digital signature authentication based on Error Correction Code (ECC) and the communication mechanism of soft handover are adopted. After verifying the legal identity of the mobile nodes, secure communications can be established, and this can increase the amount of data transmitted. Compared to some existing schemes, the proposed scheme has significant advantages regarding network topology stability, amounts of data transferred, lifetime and safety performance of the network.

Design and Analysis of a Data Fusion Scheme in Mobile Wireless Sensor Networks Based on Multi-Protocol Mobile Agents

PubMed Central

Wu, Chunxue; Wu, Wenliang; Wan, Caihua

2017-01-01

Sensors are increasingly used in mobile environments with wireless network connections. Multiple sensor types measure distinct aspects of the same event. Their measurements are then combined to produce integrated, reliable results. As the number of sensors in networks increases, low energy requirements and changing network connections complicate event detection and measurement. We present a data fusion scheme for use in mobile wireless sensor networks with high energy efficiency and low network delays, that still produces reliable results. In the first phase, we used a network simulation where mobile agents dynamically select the next hop migration node based on the stability parameter of the link, and perform the data fusion at the migration node. Agents use the fusion results to decide if it should return the fusion results to the processing center or continue to collect more data. In the second phase. The feasibility of data fusion at the node level is confirmed by an experimental design where fused data from color sensors show near-identical results to actual physical temperatures. These results are potentially important for new large-scale sensor network applications. PMID:29099793

Efficient Data Gathering in 3D Linear Underwater Wireless Sensor Networks Using Sink Mobility

PubMed Central

Akbar, Mariam; Javaid, Nadeem; Khan, Ayesha Hussain; Imran, Muhammad; Shoaib, Muhammad; Vasilakos, Athanasios

2016-01-01

Due to the unpleasant and unpredictable underwater environment, designing an energy-efficient routing protocol for underwater wireless sensor networks (UWSNs) demands more accuracy and extra computations. In the proposed scheme, we introduce a mobile sink (MS), i.e., an autonomous underwater vehicle (AUV), and also courier nodes (CNs), to minimize the energy consumption of nodes. MS and CNs stop at specific stops for data gathering; later on, CNs forward the received data to the MS for further transmission. By the mobility of CNs and MS, the overall energy consumption of nodes is minimized. We perform simulations to investigate the performance of the proposed scheme and compare it to preexisting techniques. Simulation results are compared in terms of network lifetime, throughput, path loss, transmission loss and packet drop ratio. The results show that the proposed technique performs better in terms of network lifetime, throughput, path loss and scalability. PMID:27007373

Efficient Data Gathering in 3D Linear Underwater Wireless Sensor Networks Using Sink Mobility.

PubMed

Akbar, Mariam; Javaid, Nadeem; Khan, Ayesha Hussain; Imran, Muhammad; Shoaib, Muhammad; Vasilakos, Athanasios

2016-03-19

Due to the unpleasant and unpredictable underwater environment, designing an energy-efficient routing protocol for underwater wireless sensor networks (UWSNs) demands more accuracy and extra computations. In the proposed scheme, we introduce a mobile sink (MS), i.e., an autonomous underwater vehicle (AUV), and also courier nodes (CNs), to minimize the energy consumption of nodes. MS and CNs stop at specific stops for data gathering; later on, CNs forward the received data to the MS for further transmission. By the mobility of CNs and MS, the overall energy consumption of nodes is minimized. We perform simulations to investigate the performance of the proposed scheme and compare it to preexisting techniques. Simulation results are compared in terms of network lifetime, throughput, path loss, transmission loss and packet drop ratio. The results show that the proposed technique performs better in terms of network lifetime, throughput, path loss and scalability.

Adaptive AOA-aided TOA self-positioning for mobile wireless sensor networks.

PubMed

Wen, Chih-Yu; Chan, Fu-Kai

2010-01-01

Location-awareness is crucial and becoming increasingly important to many applications in wireless sensor networks. This paper presents a network-based positioning system and outlines recent work in which we have developed an efficient principled approach to localize a mobile sensor using time of arrival (TOA) and angle of arrival (AOA) information employing multiple seeds in the line-of-sight scenario. By receiving the periodic broadcasts from the seeds, the mobile target sensors can obtain adequate observations and localize themselves automatically. The proposed positioning scheme performs location estimation in three phases: (I) AOA-aided TOA measurement, (II) Geometrical positioning with particle filter, and (III) Adaptive fuzzy control. Based on the distance measurements and the initial position estimate, adaptive fuzzy control scheme is applied to solve the localization adjustment problem. The simulations show that the proposed approach provides adaptive flexibility and robust improvement in position estimation.

The importance of lake-specific characteristics for water quality across the continental United States.

PubMed

Read, Emily K; Patil, Vijay P; Oliver, Samantha K; Hetherington, Amy L; Brentrup, Jennifer A; Zwart, Jacob A; Winters, Kirsten M; Corman, Jessica R; Nodine, Emily R; Woolway, R Iestyn; Dugan, Hilary A; Jaimes, Aline; Santoso, Arianto B; Hong, Grace S; Winslow, Luke A; Hanson, Paul C; Weathers, Kathleen C

2015-06-01

Lake water quality is affected by local and regional drivers, including lake physical characteristics, hydrology, landscape position, land cover, land use, geology, and climate. Here, we demonstrate the utility of hypothesis testing within the landscape limnology framework using a random forest algorithm on a national-scale, spatially explicit data set, the United States Environmental Protection Agency's 2007 National Lakes Assessment. For 1026 lakes, we tested the relative importance of water quality drivers across spatial scales, the importance of hydrologic connectivity in mediating water quality drivers, and how the importance of both spatial scale and connectivity differ across response variables for five important in-lake water quality metrics (total phosphorus, total nitrogen, dissolved organic carbon, turbidity, and conductivity). By modeling the effect of water quality predictors at different spatial scales, we found that lake-specific characteristics (e.g., depth, sediment area-to-volume ratio) were important for explaining water quality (54-60% variance explained), and that regionalization schemes were much less effective than lake specific metrics (28-39% variance explained). Basin-scale land use and land cover explained between 45-62% of variance, and forest cover and agricultural land uses were among the most important basin-scale predictors. Water quality drivers did not operate independently; in some cases, hydrologic connectivity (the presence of upstream surface water features) mediated the effect of regional-scale drivers. For example, for water quality in lakes with upstream lakes, regional classification schemes were much less effective predictors than lake-specific variables, in contrast to lakes with no upstream lakes or with no surface inflows. At the scale of the continental United States, conductivity was explained by drivers operating at larger spatial scales than for other water quality responses. The current regulatory practice of using regionalization schemes to guide water quality criteria could be improved by consideration of lake-specific characteristics, which were the most important predictors of water quality at the scale of the continental United States. The spatial extent and high quality of contextual data available for this analysis makes this work an unprecedented application of landscape limnology theory to water quality data. Further, the demonstrated importance of lake morphology over other controls on water quality is relevant to both aquatic scientists and managers.

An Efficient Authenticated Key Transfer Scheme in Client-Server Networks

NASA Astrophysics Data System (ADS)

Shi, Runhua; Zhang, Shun

2017-10-01

In this paper, we presented a novel authenticated key transfer scheme in client-server networks, which can achieve two secure goals of remote user authentication and the session key establishment between the remote user and the server. Especially, the proposed scheme can subtly provide two fully different authentications: identity-base authentication and anonymous authentication, while the remote user only holds a private key. Furthermore, our scheme only needs to transmit 1-round messages from the remote user to the server, thus it is very efficient in communication complexity. In addition, the most time-consuming computation in our scheme is elliptic curve scalar point multiplication, so it is also feasible even for mobile devices.

Frequency stabilization for mobile satellite terminals via LORAN

NASA Technical Reports Server (NTRS)

Ernst, Gregory J.; Kee, Steven M.; Marquart, Robert C.

1990-01-01

Digital satellite communication systems require careful management of frequency stability. Historically, frequency stability has been accomplished by continuously powered, high cost, high performance reference oscillators. Today's low cost mobile satellite communication equipment must operate under wide ranging environmental conditions, stabilize quickly after application of power, and provide adequate performance margin to overcome RF link impairments unique to the land mobile environment. Methods for frequency stabilization in land mobile applications must meet these objectives without incurring excessive performance degradation. A frequency stabilization scheme utilizing the LORAN (Long Range Navigation) system is presented.

Efficient demodulation scheme for rolling-shutter-patterning of CMOS image sensor based visible light communications.

PubMed

Chen, Chia-Wei; Chow, Chi-Wai; Liu, Yang; Yeh, Chien-Hung

2017-10-02

Recently even the low-end mobile-phones are equipped with a high-resolution complementary-metal-oxide-semiconductor (CMOS) image sensor. This motivates using a CMOS image sensor for visible light communication (VLC). Here we propose and demonstrate an efficient demodulation scheme to synchronize and demodulate the rolling shutter pattern in image sensor based VLC. The implementation algorithm is discussed. The bit-error-rate (BER) performance and processing latency are evaluated and compared with other thresholding schemes.

10-Gbps optical duobinary signal generated by bandwidth-limited reflective semiconductor optical amplifier in colorless optical network units and compensated by fiber Bragg grating-based equalizer in optical line terminal

NASA Astrophysics Data System (ADS)

Fu, Meixia; Zhang, Min; Wang, Danshi; Cui, Yue; Han, Huanhuan

2016-10-01

We propose a scheme of optical duobinary-modulated upstream transmission system for reflective semiconductor optical amplifier-based colorless optical network units in 10-Gbps wavelength-division multiplexed passive optical network (WDM-PON), where a fiber Bragg grating (FBG) is adopted as an optical equalizer for better performance. The demodulation module is extremely simple, only needing a binary intensity modulation direct detection receiver. A better received sensitivity of -16.98 dBm at bit rate error (BER)=1.0×10-4 can be achieved at 120 km without FBG, and the BER at the sensitivity of -18.49 dBm can be up to 2.1×10-5 at the transmission distance of 160 km with FBG, which demonstrates the feasibility of our proposed scheme. Moreover, it could be a high cost-effectiveness scheme for WDM-PON in the future.

Hybrid scheduling mechanisms for Next-generation Passive Optical Networks based on network coding

NASA Astrophysics Data System (ADS)

Zhao, Jijun; Bai, Wei; Liu, Xin; Feng, Nan; Maier, Martin

2014-10-01

Network coding (NC) integrated into Passive Optical Networks (PONs) is regarded as a promising solution to achieve higher throughput and energy efficiency. To efficiently support multimedia traffic under this new transmission mode, novel NC-based hybrid scheduling mechanisms for Next-generation PONs (NG-PONs) including energy management, time slot management, resource allocation, and Quality-of-Service (QoS) scheduling are proposed in this paper. First, we design an energy-saving scheme that is based on Bidirectional Centric Scheduling (BCS) to reduce the energy consumption of both the Optical Line Terminal (OLT) and Optical Network Units (ONUs). Next, we propose an intra-ONU scheduling and an inter-ONU scheduling scheme, which takes NC into account to support service differentiation and QoS assurance. The presented simulation results show that BCS achieves higher energy efficiency under low traffic loads, clearly outperforming the alternative NC-based Upstream Centric Scheduling (UCS) scheme. Furthermore, BCS is shown to provide better QoS assurance.

Employment and Training Schemes for Rural Youth: Learning from Experience.

ERIC Educational Resources Information Center

Phan-Thuy, N.

1985-01-01

Over the past two decades a number of African and Asian governments have experimented with various types of youth mobilization or employment and training schemes in trying to cope with rural youth unemployment. A critical appraisal is made of some of these in an attempt to establish criteria that productive employment programs for rural youth…

Financing EU Student Mobility: A Proposed Credit Union Scheme for Europe. Research & Occasional Paper Series: CSHE.17.10

ERIC Educational Resources Information Center

Hoareau, Cecile

2010-01-01

Governments worldwide face the challenge of financing a growing student population with limited resources, especially in the current context of difficult economic recovery. Student loan schemes, because they appear as cost-efficient and are defendable on the lines of social equity (students invest in their future), are increasingly politically…

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

A CLS-based survivable and energy-saving WDM-PON architecture

NASA Astrophysics Data System (ADS)

Zhu, Min; Zhong, Wen-De; Zhang, Zhenrong; Luan, Feng

2013-11-01

We propose and demonstrate an improved survivable and energy-saving WDM-PON with colorless ONUs. It incorporates both energy-saving and self-healing operations. A simple effective energy-saving scheme is proposed by including an energy-saving control unit in the OLT and a control unit at each ONU. The energy-saving scheme realizes both dozing and sleep (offline) modes, which greatly improves the energy-saving efficiency for WDM-PONs. An intelligent protection switching scheme is designed in the OLT, which can distinguish if an ONU is in dozing/sleep (offline) state or a fiber is faulty. Moreover, by monitoring the optical power of each channel on both working and protection paths, the OLT can know the connection status of every fiber path, thus facilitating an effective protection switching and a faster failure recovery. The improved WDM-PON architecture not only significantly reduces energy consumption, but also performs self-healing operation in practical operation scenarios. The scheme feasibility is experimentally verified with 10 Gbit/s downstream and 1.25 Gbit/s upstream transmissions. We also examine the energy-saving efficiency of our proposed energy-saving scheme by simulation, which reveals that energy saving mainly arises from the dozing mode, not from the sleep mode when the ONU is in the online state.

A long-reach WDM passive optical network enabling broadcasting service with centralized light source

NASA Astrophysics Data System (ADS)

Liu, D.; Tang, M.; Fu, S.; Liu, D.; Shum, P.

2012-02-01

We propose a long-reach wavelength-division-multiplexed (WDM) passive optical network (PON) to provide conventional point-to-point (P2P) data and downstream broadcasting service simultaneously by superimposing, for each WDM channel, the differential-phase-shift-keying (DPSK) broadcasting signal with the subcarrier multiplexing (SCM) modulated downstream P2P signal, at the optical line terminal (OLT). In the optical network units (ONUs), by re-modulating part of the downstream signal with a reflective semiconductor optical amplifier (RSOA), we realize color-less ONUs for upstream data transmission. The proposed scheme is numerically verified with a 5 Gb/s downstream P2P signal and broadcasting services, as well as 2.5 Gb/s upstream data through a 60 km bidirectional fiber link. In particular, the influence of the downstream lightwave's optical carrier-subcarrier ratio (OCSR) on the system performance is also investigated.

Whistler mode waves observed by MGF search coil magnetometer -Polarization and wave normal features of upstream waves near the bow-shock

NASA Astrophysics Data System (ADS)

Hayashi, K.; Matsui, H.; Kawano, H.; Yamamoto, T.; Kokubun, S.

1994-12-01

Whistler mode waves observed in the upstream region very close to the bow-shock is focused from the initial survey for magnetic fed data in a frequency range between 1Hz and 50Hz observed by the search coil magnetometer on board the Geotail satellite. Based on the three component wave form data polarization and wave-normal characteristics of foreshock waves is first shown as dynamic spectra for the whole Fourier components of the 50 Hz band width. Intense whistler mode waves generated in the foot region of the bow-shock are found strongly controlled in the observed polarization dependent on the angle between directions of the wave propagation and the solar wind flow but not very dependent on frequency. Our simple scheme to derive the ware characteristics which is effective to survey large amount of data continuously growing is also introduced.

Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

PubMed

Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

2001-06-01

Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

A user anonymity preserving three-factor authentication scheme for telecare medicine information systems.

PubMed

Tan, Zuowen

2014-03-01

The telecare medicine information system enables the patients gain health monitoring at home and access medical services over internet or mobile networks. In recent years, the schemes based on cryptography have been proposed to address the security and privacy issues in the telecare medicine information systems. However, many schemes are insecure or they have low efficiency. Recently, Awasthi and Srivastava proposed a three-factor authentication scheme for telecare medicine information systems. In this paper, we show that their scheme is vulnerable to the reflection attacks. Furthermore, it fails to provide three-factor security and the user anonymity. We propose a new three-factor authentication scheme for the telecare medicine information systems. Detailed analysis demonstrates that the proposed scheme provides mutual authentication, server not knowing password and freedom of password, biometric update and three-factor security. Moreover, the new scheme provides the user anonymity. As compared with the previous three-factor authentication schemes, the proposed scheme is more secure and practical.

Maintenance of an obstruction-forced pool in a gravel-bed channel: streamflow, channel morphology, and sediment transport.

Treesearch

Richard D. Woodsmith; Marwan A. Hassan

2005-01-01

Maintenance of pool morphology in a stream channel with a mobile bed requires hydraulic conditions at moderate to high flows that route bed load through the pool as it is delivered from upstream. Through field measurements of discharge, vertical velocity profiles, bed load transport, and streambed scour, fill, and grain-size distribution, we found that maintenance of a...

Adverse Selection in Community Based Health Insurance among Informal Workers in Bangladesh: An EQ-5D Assessment

PubMed Central

Sarker, Abdur Razzaque; Sultana, Marufa; Chakrovorty, Sanchita; Khan, Jahangir A. M.

2018-01-01

Community-based Health Insurance (CBHI) schemes are recommended for providing financial risk protection to low-income informal workers in Bangladesh. We assessed the problem of adverse selection in a pilot CBHI scheme in this context. In total, 1292 (646 insured and 646 uninsured) respondents were surveyed using the Bengali version of the EuroQuol-5 dimensions (EQ-5D) questionnaire for assessing their health status. The EQ-5D scores were estimated using available regional tariffs. Multiple logistic regression was applied for predicting the association between health status and CBHI scheme enrolment. A higher number of insured reported problems in mobility (7.3%; p = 0.002); self-care (7.1%; p = 0.000) and pain and discomfort (7.7%; p = 0.005) than uninsured. The average EQ-5D score was significantly lower among the insured (0.704) compared to the uninsured (0.749). The regression analysis showed that those who had a problem in mobility (OR = 1.65; 95% CI: 1.25–2.17); self-care (OR = 2.29; 95% CI: 1.62–3.25) and pain and discomfort (OR = 1.43; 95% CI: 1.13–1.81) were more likely to join the scheme. Individuals with higher EQ-5D scores (OR = 0.46; 95% CI: 0.31–0.69) were less likely to enroll in the scheme. Given that adverse selection was evident in the pilot CBHI scheme, there should be consideration of this problem when planning scale-up of these kind of schemes. PMID:29385072

Scheduling with hop-by-hop priority increasing in meshed optical burst-switched network

NASA Astrophysics Data System (ADS)

Chang, Hao; Luo, Jiangtao; Zhang, Zhizhong; Xia, Da; Gong, Jue

2006-09-01

In OBS, JET (Just-Enough-Time) is the classical wavelength reservation scheme. But there is a phenomenon that the burst priority decreasing hop-by-hop in multi-hop networks that will waste the bandwidth that was used in the upstream. Based on the HPI (Hop-by-hop Priority Increasing) proposed in the former research, this paper will do an unprecedented simulation in 4×4 meshed topology, which is closer to the real network environment with the help of a NS2-based OBSN simulation platform constructed by ourselves. By contrasting, the drop probability and throughput on one of the longest end-to-end path lengths in the whole networks, it shows that the HPI scheme can improve the utilance of bandwidth better.

Bedload entrainment in low-gradient paraglacial coastal rivers of Maine, U.S.A.: Implications for habitat restoration

NASA Astrophysics Data System (ADS)

Snyder, Noah P.; Castele, Michael R.; Wright, Jed R.

2009-02-01

The rivers of coastal Maine flow through mainstem lakes and long low-gradient reaches that break the continuum of bedload transport expected in nonparaglacial landscapes. Stream erosion of glacial deposits supplies coarse sediment to these systems. The land use history includes intensive timber harvest and associated dam construction, which may have altered the frequency of substrate-mobilizing events. These watersheds are vital habitat for the last remaining wild anadromous Atlantic salmon in the United States. Future adjustments in channel morphology and habitat quality (via natural stream processes or restoration projects) depend on erosion, transport, and deposition of coarse sediment. These factors motivate our study of competence at four sites in the Sheepscot and Narraguagus watersheds. Three of the four sites behaved roughly similarly, with particle entrainment during intervals that include winter ice and spring flood conditions, and relatively minor bed mobilization during moderate floods in the summer and fall (with a recurrence interval of 2-3 years). The fourth site, on the Sheepscot River mainstem, exhibits more vigorous entrainment of marked particles and more complex three-dimensional channel morphology. This contrast is partially due to local geomorphic conditions that favor high shear stresses (particularly relatively steep gradient), but also likely to nourishment of the bedload saltation system by recruitment from an eroding glacial deposit upstream. Our results suggest that the frequency and magnitude of bedload transport are reach specific, depending on factors including local channel geometry, upstream sediment supply and transport, and formation of anchor ice. This presents a challenge for stream practitioners in this region: different reaches may require contrasting management strategies. Our results underscore the importance of understanding channel processes at a given site and assessing conditions upstream and downstream as a prerequisite for conducting habitat restoration projects.

On High-Order Upwind Methods for Advection

NASA Technical Reports Server (NTRS)

Huynh, H. T.

2017-01-01

In the fourth installment of the celebrated series of five papers entitled "Towards the ultimate conservative difference scheme", Van Leer (1977) introduced five schemes for advection, the first three are piecewise linear, and the last two, piecewise parabolic. Among the five, scheme I, which is the least accurate, extends with relative ease to systems of equations in multiple dimensions. As a result, it became the most popular and is widely known as the MUSCL scheme (monotone upstream-centered schemes for conservation laws). Schemes III and V have the same accuracy, are the most accurate, and are closely related to current high-order methods. Scheme III uses a piecewise linear approximation that is discontinuous across cells, and can be considered as a precursor of the discontinuous Galerkin methods. Scheme V employs a piecewise quadratic approximation that is, as opposed to the case of scheme III, continuous across cells. This method is the basis for the on-going "active flux scheme" developed by Roe and collaborators. Here, schemes III and V are shown to be equivalent in the sense that they yield identical (reconstructed) solutions, provided the initial condition for scheme III is defined from that of scheme V in a manner dependent on the CFL number. This equivalence is counter intuitive since it is generally believed that piecewise linear and piecewise parabolic methods cannot produce the same solutions due to their different degrees of approximation. The finding also shows a key connection between the approaches of discontinuous and continuous polynomial approximations. In addition to the discussed equivalence, a framework using both projection and interpolation that extends schemes III and V into a single family of high-order schemes is introduced. For these high-order extensions, it is demonstrated via Fourier analysis that schemes with the same number of degrees of freedom ?? per cell, in spite of the different piecewise polynomial degrees, share the same sets of eigenvalues and thus, have the same stability and accuracy. Moreover, these schemes are accurate to order 2??-1, which is higher than the expected order of ??.

Implementation of the high-order schemes QUICK and LECUSSO in the COMMIX-1C Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakai, K.; Sun, J.G.; Sha, W.T.

Multidimensional analysis computer programs based on the finite volume method, such as COMMIX-1C, have been commonly used to simulate thermal-hydraulic phenomena in engineering systems such as nuclear reactors. In COMMIX-1C, the first-order schemes with respect to both space and time are used. In many situations such as flow recirculations and stratifications with steep gradient of velocity and temperature fields, however, high-order difference schemes are necessary for an accurate prediction of the fields. For these reasons, two second-order finite difference numerical schemes, QUICK (Quadratic Upstream Interpolation for Convective Kinematics) and LECUSSO (Local Exact Consistent Upwind Scheme of Second Order), have beenmore » implemented in the COMMIX-1C computer code. The formulations were derived for general three-dimensional flows with nonuniform grid sizes. Numerical oscillation analyses for QUICK and LECUSSO were performed. To damp the unphysical oscillations which occur in calculations with high-order schemes at high mesh Reynolds numbers, a new FRAM (Filtering Remedy and Methodology) scheme was developed and implemented. To be consistent with the high-order schemes, the pressure equation and the boundary conditions for all the conservation equations were also modified to be of second order. The new capabilities in the code are listed. Test calculations were performed to validate the implementation of the high-order schemes. They include the test of the one-dimensional nonlinear Burgers equation, two-dimensional scalar transport in two impinging streams, von Karmann vortex shedding, shear driven cavity flow, Couette flow, and circular pipe flow. The calculated results were compared with available data; the agreement is good.« less

A Comparative Study on Two Typical Schemes for Securing Spatial-Temporal Top-k Queries in Two-Tiered Mobile Wireless Sensor Networks.

PubMed

Ma, Xingpo; Liu, Xingjian; Liang, Junbin; Li, Yin; Li, Ran; Ma, Wenpeng; Qi, Chuanda

2018-03-15

A novel network paradigm of mobile edge computing, namely TMWSNs (two-tiered mobile wireless sensor networks), has just been proposed by researchers in recent years for its high scalability and robustness. However, only a few works have considered the security of TMWSNs. In fact, the storage nodes, which are located at the upper layer of TMWSNs, are prone to being attacked by the adversaries because they play a key role in bridging both the sensor nodes and the sink, which may lead to the disclosure of all data stored on them as well as some other potentially devastating results. In this paper, we make a comparative study on two typical schemes, EVTopk and VTMSN, which have been proposed recently for securing Top- k queries in TMWSNs, through both theoretical analysis and extensive simulations, aiming at finding out their disadvantages and advancements. We find that both schemes unsatisfactorily raise communication costs. Specifically, the extra communication cost brought about by transmitting the proof information uses up more than 40% of the total communication cost between the sensor nodes and the storage nodes, and 80% of that between the storage nodes and the sink. We discuss the corresponding reasons and present our suggestions, hoping that it will inspire the researchers researching this subject.

A comparative signaling cost analysis of Macro Mobility scheme in NEMO (MM-NEMO) with mobility management protocol

NASA Astrophysics Data System (ADS)

Islam, Shayla; Abdalla, Aisha H.; Habaebi, Mohamed H.; Latif, Suhaimi A.; Hassan, Wan H.; Hasan, Mohammad K.; Ramli, H. A. M.; Khalifa, Othman O.

2013-12-01

NEMO BSP is an upgraded addition to Mobile IPv6 (MIPv6). As MIPv6 and its enhancements (i.e. HMIPv6) possess some limitations like higher handoff latency, packet loss, NEMO BSP also faces all these shortcomings by inheritance. Network Mobility (NEMO) is involved to handle the movement of Mobile Router (MR) and it's Mobile Network Nodes (MNNs) during handoff. Hence it is essential to upgrade the performance of mobility management protocol to obtain continuous session connectivity with lower delay and packet loss in NEMO environment. The completion of handoff process in NEMO BSP usually takes longer period since MR needs to register its single primary care of address (CoA) with home network that may cause performance degradation of the applications running on Mobile Network Nodes. Moreover, when a change in point of attachment of the mobile network is accompanied by a sudden burst of signaling messages, "Signaling Storm" occurs which eventually results in temporary congestion, packet delays or even packet loss. This effect is particularly significant for wireless environment where a wireless link is not as steady as a wired link since bandwidth is relatively limited in wireless link. Hence, providing continuous Internet connection without any interruption through applying multihoming technique and route optimization mechanism in NEMO are becoming the center of attention to the current researchers. In this paper, we propose a handoff cost model to compare the signaling cost of MM-NEMO with NEMO Basic Support Protocol (NEMO BSP) and HMIPv6.The numerical results shows that the signaling cost for the MM-NEMO scheme is about 69.6 % less than the NEMO-BSP and HMIPv6.

Delay-Aware Energy-Efficient Routing towards a Path-Fixed Mobile Sink in Industrial Wireless Sensor Networks.

PubMed

Wu, Shaobo; Chou, Wusheng; Niu, Jianwei; Guizani, Mohsen

2018-03-18

Wireless sensor networks (WSNs) involve more mobile elements with their widespread development in industries. Exploiting mobility present in WSNs for data collection can effectively improve the network performance. However, when the sink (i.e., data collector) path is fixed and the movement is uncontrollable, existing schemes fail to guarantee delay requirements while achieving high energy efficiency. This paper proposes a delay-aware energy-efficient routing algorithm for WSNs with a path-fixed mobile sink, named DERM, which can strike a desirable balance between the delivery latency and energy conservation. We characterize the object of DERM as realizing the energy-optimal anycast to time-varying destination regions, and introduce a location-based forwarding technique tailored for this problem. To reduce the control overhead, a lightweight sink location calibration method is devised, which cooperates with the rough estimation based on the mobility pattern to determine the sink location. We also design a fault-tolerant mechanism called track routing to tackle location errors for ensuring reliable and on-time data delivery. We comprehensively evaluate DERM by comparing it with two canonical routing schemes and a baseline solution presented in this work. Extensive evaluation results demonstrate that DERM can provide considerable energy savings while meeting the delay constraint and maintaining a high delivery ratio.

LiteNet: Lightweight Neural Network for Detecting Arrhythmias at Resource-Constrained Mobile Devices.

PubMed

He, Ziyang; Zhang, Xiaoqing; Cao, Yangjie; Liu, Zhi; Zhang, Bo; Wang, Xiaoyan

2018-04-17

By running applications and services closer to the user, edge processing provides many advantages, such as short response time and reduced network traffic. Deep-learning based algorithms provide significantly better performances than traditional algorithms in many fields but demand more resources, such as higher computational power and more memory. Hence, designing deep learning algorithms that are more suitable for resource-constrained mobile devices is vital. In this paper, we build a lightweight neural network, termed LiteNet which uses a deep learning algorithm design to diagnose arrhythmias, as an example to show how we design deep learning schemes for resource-constrained mobile devices. Compare to other deep learning models with an equivalent accuracy, LiteNet has several advantages. It requires less memory, incurs lower computational cost, and is more feasible for deployment on resource-constrained mobile devices. It can be trained faster than other neural network algorithms and requires less communication across different processing units during distributed training. It uses filters of heterogeneous size in a convolutional layer, which contributes to the generation of various feature maps. The algorithm was tested using the MIT-BIH electrocardiogram (ECG) arrhythmia database; the results showed that LiteNet outperforms comparable schemes in diagnosing arrhythmias, and in its feasibility for use at the mobile devices.

An Attention-Information-Based Spatial Adaptation Framework for Browsing Videos via Mobile Devices

NASA Astrophysics Data System (ADS)

Li, Houqiang; Wang, Yi; Chen, Chang Wen

2007-12-01

With the growing popularity of personal digital assistant devices and smart phones, more and more consumers are becoming quite enthusiastic to appreciate videos via mobile devices. However, limited display size of the mobile devices has been imposing significant barriers for users to enjoy browsing high-resolution videos. In this paper, we present an attention-information-based spatial adaptation framework to address this problem. The whole framework includes two major parts: video content generation and video adaptation system. During video compression, the attention information in video sequences will be detected using an attention model and embedded into bitstreams with proposed supplement-enhanced information (SEI) structure. Furthermore, we also develop an innovative scheme to adaptively adjust quantization parameters in order to simultaneously improve the quality of overall encoding and the quality of transcoding the attention areas. When the high-resolution bitstream is transmitted to mobile users, a fast transcoding algorithm we developed earlier will be applied to generate a new bitstream for attention areas in frames. The new low-resolution bitstream containing mostly attention information, instead of the high-resolution one, will be sent to users for display on the mobile devices. Experimental results show that the proposed spatial adaptation scheme is able to improve both subjective and objective video qualities.

Delay-Aware Energy-Efficient Routing towards a Path-Fixed Mobile Sink in Industrial Wireless Sensor Networks

PubMed Central

Wu, Shaobo; Chou, Wusheng; Niu, Jianwei; Guizani, Mohsen

2018-01-01

Wireless sensor networks (WSNs) involve more mobile elements with their widespread development in industries. Exploiting mobility present in WSNs for data collection can effectively improve the network performance. However, when the sink (i.e., data collector) path is fixed and the movement is uncontrollable, existing schemes fail to guarantee delay requirements while achieving high energy efficiency. This paper proposes a delay-aware energy-efficient routing algorithm for WSNs with a path-fixed mobile sink, named DERM, which can strike a desirable balance between the delivery latency and energy conservation. We characterize the object of DERM as realizing the energy-optimal anycast to time-varying destination regions, and introduce a location-based forwarding technique tailored for this problem. To reduce the control overhead, a lightweight sink location calibration method is devised, which cooperates with the rough estimation based on the mobility pattern to determine the sink location. We also design a fault-tolerant mechanism called track routing to tackle location errors for ensuring reliable and on-time data delivery. We comprehensively evaluate DERM by comparing it with two canonical routing schemes and a baseline solution presented in this work. Extensive evaluation results demonstrate that DERM can provide considerable energy savings while meeting the delay constraint and maintaining a high delivery ratio. PMID:29562628

LiteNet: Lightweight Neural Network for Detecting Arrhythmias at Resource-Constrained Mobile Devices

PubMed Central

Zhang, Xiaoqing; Cao, Yangjie; Liu, Zhi; Zhang, Bo; Wang, Xiaoyan

2018-01-01

By running applications and services closer to the user, edge processing provides many advantages, such as short response time and reduced network traffic. Deep-learning based algorithms provide significantly better performances than traditional algorithms in many fields but demand more resources, such as higher computational power and more memory. Hence, designing deep learning algorithms that are more suitable for resource-constrained mobile devices is vital. In this paper, we build a lightweight neural network, termed LiteNet which uses a deep learning algorithm design to diagnose arrhythmias, as an example to show how we design deep learning schemes for resource-constrained mobile devices. Compare to other deep learning models with an equivalent accuracy, LiteNet has several advantages. It requires less memory, incurs lower computational cost, and is more feasible for deployment on resource-constrained mobile devices. It can be trained faster than other neural network algorithms and requires less communication across different processing units during distributed training. It uses filters of heterogeneous size in a convolutional layer, which contributes to the generation of various feature maps. The algorithm was tested using the MIT-BIH electrocardiogram (ECG) arrhythmia database; the results showed that LiteNet outperforms comparable schemes in diagnosing arrhythmias, and in its feasibility for use at the mobile devices. PMID:29673171

The Impact of Vocational Education on Poverty Reduction, Quality Assurance and Mobility on Regional Labour Markets--Selected EU-Funded Schemes

ERIC Educational Resources Information Center

Wallenborn, Manfred

2009-01-01

Vocational education can serve to promote social stability and sustainable economic and social development. The European Union (EU) strategically employs a range of vocational educational schemes to attain these overriding goals. Topical points of focus are selected in line with requirements in the individual partner countries or regions. However,…

EPPS: Efficient and Privacy-Preserving Personal Health Information Sharing in Mobile Healthcare Social Networks

PubMed Central

Jiang, Shunrong; Zhu, Xiaoyan; Wang, Liangmin

2015-01-01

Mobile healthcare social networks (MHSNs) have emerged as a promising next-generation healthcare system, which will significantly improve the quality of life. However, there are many security and privacy concerns before personal health information (PHI) is shared with other parities. To ensure patients’ full control over their PHI, we propose a fine-grained and scalable data access control scheme based on attribute-based encryption (ABE). Besides, policies themselves for PHI sharing may be sensitive and may reveal information about underlying PHI or about data owners or recipients. In our scheme, we let each attribute contain an attribute name and its value and adopt the Bloom filter to efficiently check attributes before decryption. Thus, the data privacy and policy privacy can be preserved in our proposed scheme. Moreover, considering the fact that the computational cost grows with the complexity of the access policy and the limitation of the resource and energy in a smart phone, we outsource ABE decryption to the cloud while preventing the cloud from learning anything about the content and access policy. The security and performance analysis is carried out to demonstrate that our proposed scheme can achieve fine-grained access policies for PHI sharing in MHSNs. PMID:26404300

EPPS: Efficient and Privacy-Preserving Personal Health Information Sharing in Mobile Healthcare Social Networks.

PubMed

Jiang, Shunrong; Zhu, Xiaoyan; Wang, Liangmin

2015-09-03

Mobile healthcare social networks (MHSNs) have emerged as a promising next-generation healthcare system, which will significantly improve the quality of life. However, there are many security and privacy concerns before personal health information (PHI) is shared with other parities. To ensure patients' full control over their PHI, we propose a fine-grained and scalable data access control scheme based on attribute-based encryption (ABE). Besides, policies themselves for PHI sharing may be sensitive and may reveal information about underlying PHI or about data owners or recipients. In our scheme, we let each attribute contain an attribute name and its value and adopt the Bloom filter to efficiently check attributes before decryption. Thus, the data privacy and policy privacy can be preserved in our proposed scheme. Moreover, considering the fact that the computational cost grows with the complexity of the access policy and the limitation of the resource and energy in a smart phone, we outsource ABE decryption to the cloud while preventing the cloud from learning anything about the content and access policy. The security and performance analysis is carried out to demonstrate that our proposed scheme can achieve fine-grained access policies for PHI sharing in MHSNs.

Downlink Multihop Transmission Technique for Asymmetric Traffic Accommodation in DS-CDMA/FDD Cellular Communications

NASA Astrophysics Data System (ADS)

Mori, Kazuo; Naito, Katsuhiro; Kobayashi, Hideo

This paper proposes an asymmetric traffic accommodation scheme using a multihop transmission technique for CDMA/FDD cellular communication systems. The proposed scheme exploits the multihop transmission to downlink packet transmissions, which require the large transmission power at their single-hop transmissions, in order to increase the downlink capacity. In these multihop transmissions, vacant uplink band is used for the transmissions from relay stations to destination mobile stations, and this leads more capacity enhancement in the downlink communications. The relay route selection method and power control method for the multihop transmissions are also investigated in the proposed scheme. The proposed scheme is evaluated by computer simulation and the results show that the proposed scheme can achieve better system performance.

Securing electronic health records with novel mobile encryption schemes.

PubMed

Weerasinghe, Dasun; Elmufti, Kalid; Rajarajan, Muttukrishnan; Rakocevic, Veselin

2007-01-01

Mobile devices have penetrated the healthcare sector due to their increased functionality, low cost, high reliability and easy-to-use nature. However, in healthcare applications the privacy and security of the transmitted information must be preserved. Therefore applications require a concrete security framework based on long-term security keys, such as the security key that can be found in a mobile Subscriber Identity Module (SIM). The wireless nature of communication links in mobile networks presents a major challenge in this respect. This paper presents a novel protocol that will send the information securely while including the access privileges to the authorized recipient.

Robust Timing Synchronization in Aeronautical Mobile Communication Systems

NASA Technical Reports Server (NTRS)

Xiong, Fu-Qin; Pinchak, Stanley

2004-01-01

This work details a study of robust synchronization schemes suitable for satellite to mobile aeronautical applications. A new scheme, the Modified Sliding Window Synchronizer (MSWS), is devised and compared with existing schemes, including the traditional Early-Late Gate Synchronizer (ELGS), the Gardner Zero-Crossing Detector (GZCD), and the Sliding Window Synchronizer (SWS). Performance of the synchronization schemes is evaluated by a set of metrics that indicate performance in digital communications systems. The metrics are convergence time, mean square phase error (or root mean-square phase error), lowest SNR for locking, initial frequency offset performance, midstream frequency offset performance, and system complexity. The performance of the synchronizers is evaluated by means of Matlab simulation models. A simulation platform is devised to model the satellite to mobile aeronautical channel, consisting of a Quadrature Phase Shift Keying modulator, an additive white Gaussian noise channel, and a demodulator front end. Simulation results show that the MSWS provides the most robust performance at the cost of system complexity. The GZCD provides a good tradeoff between robustness and system complexity for communication systems that require high symbol rates or low overall system costs. The ELGS has a high system complexity despite its average performance. Overall, the SWS, originally designed for multi-carrier systems, performs very poorly in single-carrier communications systems. Table 5.1 in Section 5 provides a ranking of each of the synchronization schemes in terms of the metrics set forth in Section 4.1. Details of comparison are given in Section 5. Based on the results presented in Table 5, it is safe to say that the most robust synchronization scheme examined in this work is the high-sample-rate Modified Sliding Window Synchronizer. A close second is its low-sample-rate cousin. The tradeoff between complexity and lowest mean-square phase error determines the rankings of the Gardner Zero-Crossing Detector and both versions of the Early-Late Gate Synchronizer. The least robust models are the high and low-sample-rate Sliding Window Synchronizers. Consequently, the recommended replacement synchronizer for NASA's Advanced Air Transportation Technologies mobile aeronautical communications system is the high-sample-rate Modified Sliding Window Synchronizer. By incorporating this synchronizer into their system, NASA can be assured that their system will be operational in extremely adverse conditions. The quick convergence time of the MSWS should allow the use of high-level protocols. However, if NASA feels that reduced system complexity is the most important aspect of their replacement synchronizer, the Gardner Zero-Crossing Detector would be the best choice.

Stackable differential mobility analyzer for aerosol measurement

DOEpatents

Cheng, Meng-Dawn [Oak Ridge, TN; Chen, Da-Ren [Creve Coeur, MO

2007-05-08

A multi-stage differential mobility analyzer (MDMA) for aerosol measurements includes a first electrode or grid including at least one inlet or injection slit for receiving an aerosol including charged particles for analysis. A second electrode or grid is spaced apart from the first electrode. The second electrode has at least one sampling outlet disposed at a plurality different distances along its length. A volume between the first and the second electrode or grid between the inlet or injection slit and a distal one of the plurality of sampling outlets forms a classifying region, the first and second electrodes for charging to suitable potentials to create an electric field within the classifying region. At least one inlet or injection slit in the second electrode receives a sheath gas flow into an upstream end of the classifying region, wherein each sampling outlet functions as an independent DMA stage and classifies different size ranges of charged particles based on electric mobility simultaneously.

Internet Cognitive Failure and Fatigue Relevant to Learners' Self-Regulation and Learning Progress in English Vocabulary with a Calibration Scheme

ERIC Educational Resources Information Center

Hong, J.-C.; Hwang, M.-Y.; Chang, H.-W.; Tai, K.-H.; Kuo, Y.-C.; Tsai, Y.-H.

2015-01-01

To determine the factors of learning effectiveness in English vocabulary learning when using a calibration scheme, this study developed a freshman English mobile device application (for iPhone 4) for students with low levels of English proficiency to practise vocabulary in the beginning of their Freshman English course. Data were collected and…

Large-eddy simulation/Reynolds-averaged Navier-Stokes hybrid schemes for high speed flows

NASA Astrophysics Data System (ADS)

Xiao, Xudong

Three LES/RANS hybrid schemes have been proposed for the prediction of high speed separated flows. Each method couples the k-zeta (Enstrophy) BANS model with an LES subgrid scale one-equation model by using a blending function that is coordinate system independent. Two of these functions are based on turbulence dissipation length scale and grid size, while the third one has no explicit dependence on the grid. To implement the LES/RANS hybrid schemes, a new rescaling-reintroducing method is used to generate time-dependent turbulent inflow conditions. The hybrid schemes have been tested on a Mach 2.88 flow over 25 degree compression-expansion ramp and a Mach 2.79 flow over 20 degree compression ramp. A special computation procedure has been designed to prevent the separation zone from expanding upstream to the recycle-plane. The code is parallelized using Message Passing Interface (MPI) and is optimized for running on IBM-SP3 parallel machine. The scheme was validated first for a flat plate. It was shown that the blending function has to be monotonic to prevent the RANS region from appearing in the LES region. In the 25 deg ramp case, the hybrid schemes provided better agreement with experiment in the recovery region. Grid refinement studies demonstrated the importance of using a grid independent blend function and further improvement with experiment in the recovery region. In the 20 deg ramp case, with a relatively finer grid, the hybrid scheme characterized by grid independent blending function well predicted the flow field in both the separation region and the recovery region. Therefore, with "appropriately" fine grid, current hybrid schemes are promising for the simulation of shock wave/boundary layer interaction problems.

Enhanced noise tolerance for 10 Gb/s Bi-directional cross-wavelength reuse colorless WDM-PON by using spectrally shaped OFDM signals

NASA Astrophysics Data System (ADS)

Choudhury, Pallab K.

2018-05-01

Spectrally shaped orthogonal frequency division multiplexing (OFDM) signal for symmetric 10 Gb/s cross-wavelength reuse reflective semiconductor optical amplifier (RSOA) based colorless wavelength division multiplexed passive optical network (WDM-PON) is proposed and further analyzed to support broadband services of next generation high speed optical access networks. The generated OFDM signal has subcarriers in separate frequency ranges for downstream and upstream, such that the re-modulation noise can be effectively minimized in upstream data receiver. Moreover, the cross wavelength reuse approach improves the tolerance against Rayleigh backscattering noise due to the propagation of different wavelengths in the same feeder fiber. The proposed WDM-PON is successfully demonstrated for 25 km fiber with 16-QAM (quadrature amplitude modulation) OFDM signal having bandwidth of 2.5 GHz for 10 Gb/s operation and subcarrier frequencies in 3-5.5 GHz and DC-2.5 GHz for downstream (DS) and upstream (US) transmission respectively. The result shows that the proposed scheme maintains a good bit error rate (BER) performance below the forward error correction (FEC) limit of 3.8 × 10-3 at acceptable receiver sensitivity and provides a high resilience against re-modulation and Rayleigh backscattering noises as well as chromatic dispersion.

Survivable architectures for time and wavelength division multiplexed passive optical networks

NASA Astrophysics Data System (ADS)

Wong, Elaine

2014-08-01

The increased network reach and customer base of next-generation time and wavelength division multiplexed PON (TWDM-PONs) have necessitated rapid fault detection and subsequent restoration of services to its users. However, direct application of existing solutions for conventional PONs to TWDM-PONs is unsuitable as these schemes rely on the loss of signal (LOS) of upstream transmissions to trigger protection switching. As TWDM-PONs are required to potentially use sleep/doze mode optical network units (ONU), the loss of upstream transmission from a sleeping or dozing ONU could erroneously trigger protection switching. Further, TWDM-PONs require its monitoring modules for fiber/device fault detection to be more sensitive than those typically deployed in conventional PONs. To address the above issues, three survivable architectures that are compliant with TWDM-PON specifications are presented in this work. These architectures combine rapid detection and protection switching against multipoint failure, and most importantly do not rely on upstream transmissions for LOS activation. Survivability analyses as well as evaluations of the additional costs incurred to achieve survivability are performed and compared to the unprotected TWDM-PON. Network parameters that impact the maximum achievable network reach, maximum split ratio, connection availability, fault impact, and the incremental reliability costs for each proposed survivable architecture are highlighted.

Upstream Passage, Spawning, and Stock Identification of Fall Chinook in the Snake River, 1992 and 1993 : Final Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, H. Lee; Mendel, Glen W.

This final report of the 3-year study summarizes activities and results for 1993. Study objectives were to: (1) determine the source of losses (or accounting errors) for adult chinook salmon between Ice Harbor Dam (IHR) and Lower Granite Dam (LGR), and upstream of LGR in the Snake River; (2) identify spawning locations upstream of LGR for calibration of aerial redd surveys, redd habitat mapping, carcass recovery for genetic stock profile analysis, and correction of estimated adult/redd ratios; and (3) estimate passage and migration times at Snake River. 200 fall chinook salmon were radio tagged and tracked with aerial, fixed-site, andmore » ground mobile tracking. Fish were released upstream of IHR at Charbonneau Park (CHAR). 190 of the fish were tracked or relocated away from CHAR. 59 fish descended to below IHR without crossing Lower Monumental Dam (LMO). Another 128 salmon passed upstream of LMO without falling back at IHR. Only 80 salmon passed Little Goose Dam (LGO) without falling back at a downstream dam; 66 of these fish passed LGR. Many fish that fell back reascended the dams. A total of 72 salmon released at CHAR passed upstream of LGR, including fish that had fallen back and reascended a dam. Over 80 percent of the salmon that entered Lyons Ferry Hatchery each year had reached LGO before descending to the hatchery. Extensive wandering was documented between LMO and upstream of LGR before salmon entered Lyons Ferry Hatchery or the Tucannon River. In 1993, 41 salmon were found to be of hatchery origin when recovered. These fish entered Lyons Ferry Hatchery with similar movements to unmarked salmon. Each year a few salmon have remained near the hatchery without entering, which suggests the hatchery may have inadequate attraction flows. Fall chinook passed lower Snake River dams in 2-5 days each on average. Median travel times through LMO and LGO were 1.0-1.3 days each, which was slower than for spring chinook or steelhead in 1993. 5 refs., 21 figs., 20 tabs.« less

Ultra-high capacity WDM-SDM optical access network with self-homodyne detection downstream and 32QAM-FBMC upstream.

PubMed

Feng, Zhenhua; Xu, Liang; Wu, Qiong; Tang, Ming; Fu, Songnian; Tong, Weijun; Shum, Perry Ping; Liu, Deming

2017-03-20

Towards 100G beyond large-capacity optical access networks, wavelength division multiplexing (WDM) techniques incorporating with space division multiplexing (SDM) and affordable spectrally efficient advanced modulation formats are indispensable. In this paper, we proposed and experimentally demonstrated a cost-efficient multicore fiber (MCF) based hybrid WDM-SDM optical access network with self-homodyne coherent detection (SHCD) based downstream (DS) and direct detection optical filter bank multi carrier (DDO-FBMC) based upstream (US). In the DS experiments, the inner core of the 7-core fiber is used as a dedicated channel to deliver the local oscillator (LO) lights while the other 6 outer cores are used to transmit 4 channels of wavelength multiplexed 200-Gb/s PDM-16QAM-OFDM signals. For US transmission, 4 wavelengths with channel spacing of 100 GHz are intensity modulated with 30 Gb/s 32-QAM-FBMC and directly detected by a ~7 GHz bandwidth receiver after transmission along one of the outer core. The results show that a 4 × 6 × 200-Gb/s DS transmission can be realized over 37 km 7-core fiber without carrier frequency offset (CFO) and phase noise (PN) compensation even using 10 MHz linewidth DFB lasers. The SHCD based on MCF provides a compromise and cost efficient scheme between conventional intradyne coherent detection and intensity modulation and direct detection (IM/DD) schemes. Both US and DS have acceptable BER performance and high spectral efficiency.

Modification of suburban carbon and nitrogen fluxes by a coupled channel/floodplain system assessed using in situ sensors

NASA Astrophysics Data System (ADS)

Wollheim, W. M.; Pellerin, B. A.; Saraceno, J.; Hopkinson, C.; Hope, A.; Morse, N.

2010-12-01

Biogeochemical fluxes in human dominated streams and rivers are highly impacted, but effects can be attenuated downstream through natural ecosystem processes. We deployed in situ nitrate, fdom, and chlorophyll sensors to characterize biogeochemical fluxes draining a suburban catchment, and modifications by a channel-floodplain system located immediately downstream. The upstream site reflects the suburban signal; the downstream site reflects the influence of the channel/floodplain on the suburban signal. FDOM showed a diurnal signal at both sites, but was stronger downstream, likely indicating new DOC production within the channel-floodplain system, which contained a small pond. In situ chlorophyll concentrations were also highly correlated with FDOM. FDOM showed a stronger storm response upstream than downstream, indicating terrestrial sources are mobilized by storms and subsequent dampening of the pulse by the floodplain. Nitrate concentrations consistently dropped from 0.6 to 0.7 mg/l upstream to less than 0.4 mg/l downstream, indicating likely nitrogen retention or removal over a relatively short distance (~500m). Use of in situ sensors is likely to greatly advance our understanding of biogeochemical processes in aquatic systems.

A Comparative Study on Two Typical Schemes for Securing Spatial-Temporal Top-k Queries in Two-Tiered Mobile Wireless Sensor Networks

PubMed Central

Liu, Xingjian; Liang, Junbin; Li, Ran; Ma, Wenpeng; Qi, Chuanda

2018-01-01

A novel network paradigm of mobile edge computing, namely TMWSNs (two-tiered mobile wireless sensor networks), has just been proposed by researchers in recent years for its high scalability and robustness. However, only a few works have considered the security of TMWSNs. In fact, the storage nodes, which are located at the upper layer of TMWSNs, are prone to being attacked by the adversaries because they play a key role in bridging both the sensor nodes and the sink, which may lead to the disclosure of all data stored on them as well as some other potentially devastating results. In this paper, we make a comparative study on two typical schemes, EVTopk and VTMSN, which have been proposed recently for securing Top-k queries in TMWSNs, through both theoretical analysis and extensive simulations, aiming at finding out their disadvantages and advancements. We find that both schemes unsatisfactorily raise communication costs. Specifically, the extra communication cost brought about by transmitting the proof information uses up more than 40% of the total communication cost between the sensor nodes and the storage nodes, and 80% of that between the storage nodes and the sink. We discuss the corresponding reasons and present our suggestions, hoping that it will inspire the researchers researching this subject. PMID:29543745

An efficient and secure dynamic ID-based authentication scheme for telecare medical information systems.

PubMed

Chen, Hung-Ming; Lo, Jung-Wen; Yeh, Chang-Kuo

2012-12-01

The rapidly increased availability of always-on broadband telecommunication environments and lower-cost vital signs monitoring devices bring the advantages of telemedicine directly into the patient's home. Hence, the control of access to remote medical servers' resources has become a crucial challenge. A secure authentication scheme between the medical server and remote users is therefore needed to safeguard data integrity, confidentiality and to ensure availability. Recently, many authentication schemes that use low-cost mobile devices have been proposed to meet these requirements. In contrast to previous schemes, Khan et al. proposed a dynamic ID-based remote user authentication scheme that reduces computational complexity and includes features such as a provision for the revocation of lost or stolen smart cards and a time expiry check for the authentication process. However, Khan et al.'s scheme has some security drawbacks. To remedy theses, this study proposes an enhanced authentication scheme that overcomes the weaknesses inherent in Khan et al.'s scheme and demonstrated this scheme is more secure and robust for use in a telecare medical information system.

Trust recovery model of Ad Hoc network based on identity authentication scheme

NASA Astrophysics Data System (ADS)

Liu, Jie; Huan, Shuiyuan

2017-05-01

Mobile Ad Hoc network trust model is widely used to solve mobile Ad Hoc network security issues. Aiming at the problem of reducing the network availability caused by the processing of malicious nodes and selfish nodes in mobile Ad Hoc network routing based on trust model, an authentication mechanism based on identity authentication mobile Ad Hoc network is proposed, which uses identity authentication to identify malicious nodes, And trust the recovery of selfish nodes in order to achieve the purpose of reducing network congestion and improving network quality. The simulation results show that the implementation of the mechanism can effectively improve the network availability and security.

Real-time video streaming using H.264 scalable video coding (SVC) in multihomed mobile networks: a testbed approach

NASA Astrophysics Data System (ADS)

Nightingale, James; Wang, Qi; Grecos, Christos

2011-03-01

Users of the next generation wireless paradigm known as multihomed mobile networks expect satisfactory quality of service (QoS) when accessing streamed multimedia content. The recent H.264 Scalable Video Coding (SVC) extension to the Advanced Video Coding standard (AVC), offers the facility to adapt real-time video streams in response to the dynamic conditions of multiple network paths encountered in multihomed wireless mobile networks. Nevertheless, preexisting streaming algorithms were mainly proposed for AVC delivery over multipath wired networks and were evaluated by software simulation. This paper introduces a practical, hardware-based testbed upon which we implement and evaluate real-time H.264 SVC streaming algorithms in a realistic multihomed wireless mobile networks environment. We propose an optimised streaming algorithm with multi-fold technical contributions. Firstly, we extended the AVC packet prioritisation schemes to reflect the three-dimensional granularity of SVC. Secondly, we designed a mechanism for evaluating the effects of different streamer 'read ahead window' sizes on real-time performance. Thirdly, we took account of the previously unconsidered path switching and mobile networks tunnelling overheads encountered in real-world deployments. Finally, we implemented a path condition monitoring and reporting scheme to facilitate the intelligent path switching. The proposed system has been experimentally shown to offer a significant improvement in PSNR of the received stream compared with representative existing algorithms.

Energy-saving framework for passive optical networks with ONU sleep/doze mode.

PubMed

Van, Dung Pham; Valcarenghi, Luca; Dias, Maluge Pubuduni Imali; Kondepu, Koteswararao; Castoldi, Piero; Wong, Elaine

2015-02-09

This paper proposes an energy-saving passive optical network framework (ESPON) that aims to incorporate optical network unit (ONU) sleep/doze mode into dynamic bandwidth allocation (DBA) algorithms to reduce ONU energy consumption. In the ESPON, the optical line terminal (OLT) schedules both downstream (DS) and upstream (US) transmissions in the same slot in an online and dynamic fashion whereas the ONU enters sleep mode outside the slot. The ONU sleep time is maximized based on both DS and US traffic. Moreover, during the slot, the ONU might enter doze mode when only its transmitter is idle to further improve energy efficiency. The scheduling order of data transmission, control message exchange, sleep period, and doze period defines an energy-efficient scheme under the ESPON. Three schemes are designed and evaluated in an extensive FPGA-based evaluation. Results show that whilst all the schemes significantly save ONU energy for different evaluation scenarios, the scheduling order has great impact on their performance. In addition, the ESPON allows for a scheduling order that saves ONU energy independently of the network reach.

Generation of a composite grid for turbine flows and consideration of a numerical scheme

NASA Technical Reports Server (NTRS)

Choo, Y.; Yoon, S.; Reno, C.

1986-01-01

A composite grid was generated for flows in turbines. It consisted of the C-grid (or O-grid) in the immediate vicinity of the blade and the H-grid in the middle of the blade passage between the C-grids and in the upstream region. This new composite grid provides better smoothness, resolution, and orthogonality than any single grid for a typical turbine blade with a large camber and rounded leading and trailing edges. The C-H (or O-H) composite grid has an unusual grid point that is connected to more than four neighboring nodes in two dimensions (more than six neighboring nodes in three dimensions). A finite-volume lower-upper (LU) implicit scheme to be used on this grid poses no problem and requires no special treatment because each interior cell of this composite grid has only four neighboring cells in two dimensions (six cells in three dimensions). The LU implicit scheme was demonstrated to be efficient and robust for external flows in a broad flow regime and can be easily applied to internal flows and extended from two to three dimensions.

Simulation of a Wall-Bounded Flow using a Hybrid LES/RAS Approach with Turbulence Recycling

NASA Technical Reports Server (NTRS)

Quinlan, Jesse R.; Mcdaniel, James; Baurle, Robert A.

2012-01-01

Simulations of a supersonic recessed-cavity flow are performed using a hybrid large-eddy/ Reynolds-averaged simulation approach utilizing an inflow turbulence recycling procedure and hybridized inviscid flux scheme. Calorically perfect air enters the three-dimensional domain at a free stream Mach number of 2.92. Simulations are performed to assess grid sensitivity of the solution, efficacy of the turbulence recycling, and effect of the shock sensor used with the hybridized inviscid flux scheme. Analysis of the turbulent boundary layer upstream of the rearward-facing step for each case indicates excellent agreement with theoretical predictions. Mean velocity and pressure results are compared to Reynolds-averaged simulations and experimental data for each case, and these comparisons indicate good agreement on the finest grid. Simulations are repeated on a coarsened grid, and results indicate strong grid density sensitivity. The effect of turbulence recycling on the solution is illustrated by performing coarse grid simulations with and without inflow turbulence recycling. Two shock sensors, one of Ducros and one of Larsson, are assessed for use with the hybridized inviscid flux reconstruction scheme.

Short-Term Study Tours as a Driver for Increasing Domestic Student Mobility in Order to Generate Global Work-Ready Students and Cultural Exchange in Asia Pacific

ERIC Educational Resources Information Center

Scharoun, Lisa

2016-01-01

Recent federal government programmes in Australia have seen a shift in focus from the international student towards increasing the possibilities for domestic mobility through short- and long-term exchange opportunities. The current New Colombo Plan funding scheme encourages Australian students, who have traditionally undertaken semester-long…

Dynamic Key Management Schemes for Secure Group Access Control Using Hierarchical Clustering in Mobile Ad Hoc Networks

NASA Astrophysics Data System (ADS)

Tsaur, Woei-Jiunn; Pai, Haw-Tyng

2008-11-01

The applications of group computing and communication motivate the requirement to provide group access control in mobile ad hoc networks (MANETs). The operation in MANETs' groups performs a decentralized manner and accommodated membership dynamically. Moreover, due to lack of centralized control, MANETs' groups are inherently insecure and vulnerable to attacks from both within and outside the groups. Such features make access control more challenging in MANETs. Recently, several researchers have proposed group access control mechanisms in MANETs based on a variety of threshold signatures. However, these mechanisms cannot actually satisfy MANETs' dynamic environments. This is because the threshold-based mechanisms cannot be achieved when the number of members is not up to the threshold value. Hence, by combining the efficient elliptic curve cryptosystem, self-certified public key cryptosystem and secure filter technique, we construct dynamic key management schemes based on hierarchical clustering for securing group access control in MANETs. Specifically, the proposed schemes can constantly accomplish secure group access control only by renewing the secure filters of few cluster heads, when a cluster head joins or leaves a cross-cluster. In such a new way, we can find that the proposed group access control scheme can be very effective for securing practical applications in MANETs.

Spatiotemporal distribution of nitrogen dioxide within and around a large-scale wind farm - a numerical case study

NASA Astrophysics Data System (ADS)

Mo, Jingyue; Huang, Tao; Zhang, Xiaodong; Zhao, Yuan; Liu, Xiao; Li, Jixiang; Gao, Hong; Ma, Jianmin

2017-12-01

As a renewable and clean energy source, wind power has become the most rapidly growing energy resource worldwide in the past decades. Wind power has been thought not to exert any negative impacts on the environment. However, since a wind farm can alter the local meteorological conditions and increase the surface roughness lengths, it may affect air pollutants passing through and over the wind farm after released from their sources and delivered to the wind farm. In the present study, we simulated the nitrogen dioxide (NO2) air concentration within and around the world's largest wind farm (Jiuquan wind farm in Gansu Province, China) using a coupled meteorology and atmospheric chemistry model WRF-Chem. The results revealed an edge effect, which featured higher NO2 levels at the immediate upwind and border region of the wind farm and lower NO2 concentration within the wind farm and the immediate downwind transition area of the wind farm. A surface roughness length scheme and a wind turbine drag force scheme were employed to parameterize the wind farm in this model investigation. Modeling results show that both parameterization schemes yield higher concentration in the immediate upstream of the wind farm and lower concentration within the wind farm compared to the case without the wind farm. We infer this edge effect and the spatial distribution of air pollutants to be the result of the internal boundary layer induced by the changes in wind speed and turbulence intensity driven by the rotation of the wind turbine rotor blades and the enhancement of surface roughness length over the wind farm. The step change in the roughness length from the smooth to rough surfaces (overshooting) in the upstream of the wind farm decelerates the atmospheric transport of air pollutants, leading to their accumulation. The rough to the smooth surface (undershooting) in the downstream of the wind farm accelerates the atmospheric transport of air pollutants, resulting in lower concentration level.

A priori discretization error metrics for distributed hydrologic modeling applications

NASA Astrophysics Data System (ADS)

Liu, Hongli; Tolson, Bryan A.; Craig, James R.; Shafii, Mahyar

2016-12-01

Watershed spatial discretization is an important step in developing a distributed hydrologic model. A key difficulty in the spatial discretization process is maintaining a balance between the aggregation-induced information loss and the increase in computational burden caused by the inclusion of additional computational units. Objective identification of an appropriate discretization scheme still remains a challenge, in part because of the lack of quantitative measures for assessing discretization quality, particularly prior to simulation. This study proposes a priori discretization error metrics to quantify the information loss of any candidate discretization scheme without having to run and calibrate a hydrologic model. These error metrics are applicable to multi-variable and multi-site discretization evaluation and provide directly interpretable information to the hydrologic modeler about discretization quality. The first metric, a subbasin error metric, quantifies the routing information loss from discretization, and the second, a hydrological response unit (HRU) error metric, improves upon existing a priori metrics by quantifying the information loss due to changes in land cover or soil type property aggregation. The metrics are straightforward to understand and easy to recode. Informed by the error metrics, a two-step discretization decision-making approach is proposed with the advantage of reducing extreme errors and meeting the user-specified discretization error targets. The metrics and decision-making approach are applied to the discretization of the Grand River watershed in Ontario, Canada. Results show that information loss increases as discretization gets coarser. Moreover, results help to explain the modeling difficulties associated with smaller upstream subbasins since the worst discretization errors and highest error variability appear in smaller upstream areas instead of larger downstream drainage areas. Hydrologic modeling experiments under candidate discretization schemes validate the strong correlation between the proposed discretization error metrics and hydrologic simulation responses. Discretization decision-making results show that the common and convenient approach of making uniform discretization decisions across the watershed performs worse than the proposed non-uniform discretization approach in terms of preserving spatial heterogeneity under the same computational cost.

A Multimetric Approach for Handoff Decision in Heterogeneous Wireless Networks

NASA Astrophysics Data System (ADS)

Kustiawan, I.; Purnama, W.

2018-02-01

Seamless mobility and service continuity anywhere at any time are an important issue in the wireless Internet. This research proposes a scheme to make handoff decisions effectively in heterogeneous wireless networks using a fuzzy system. Our design lies in an inference engine which takes RSS (received signal strength), data rate, network latency, and user preference as strategic determinants. The logic of our engine is realized on a UE (user equipment) side in faster reaction to network dynamics while roaming across different radio access technologies. The fuzzy system handles four metrics jointly to deduce a moderate decision about when to initiate handoff. The performance of our design is evaluated by simulating move-out mobility scenarios. Simulation results show that our scheme outperforms other approaches in terms of reducing unnecessary handoff.

Increasing cellular coverage within integrated terrestrial/satellite mobile networks

NASA Technical Reports Server (NTRS)

Castro, Jonathan P.

1995-01-01

When applying the hierarchical cellular concept, the satellite acts as giant umbrella cell covering a region with some terrestrial cells. If a mobile terminal traversing the region arrives to the border-line or limits of a regular cellular ground service, network transition occurs and the satellite system continues the mobile coverage. To adequately assess the boundaries of service of a mobile satellite system an a cellular network within an integrated environment, this paper provides an optimized scheme to predict when a network transition may be necessary. Under the assumption of a classified propagation phenomenon and Lognormal shadowing, the study applies an analytical approach to estimate the location of a mobile terminal based on a reception of the signal strength emitted by a base station.

Suppression of Rayleigh backscattering noise using cascaded-SOA and microwave photonic filter for 10 Gb/s loop-back WDM-PON.

PubMed

Feng, Hanlin; Ge, Jia; Xiao, Shilin; Fok, Mable P

2014-05-19

In this paper, we present a novel Rayleigh backscattering (RB) noise mitigation scheme based on central carrier suppression for 10 Gb/s loop-back wavelength division multiplexing passive optical network (WDM-PON). Microwave modulated multi-subcarrier optical signal is used as downstream seeding light, while cascaded semiconductor optical amplifier (SOA) are used in the optical network unit (ONU) for suppressing the central carrier of the multi-subcarrier upstream signal. With central carrier suppression, interference generated by carrier RB noise at low frequency region is eliminated successfully. Transmission performance over 45 km single mode fiber (SMF) is studied experimentally, and the optical-signal-to-Rayleigh-noise-ratio (OSRNR) can be reduced to 15 dB with central carrier suppression ratio (CCSR) of 21 dB. Receiver sensitivity is further improved by 6 dB with the use of microwave photonic filter (MPF) for suppressing residual upstream microwave signal and residual carrier RB at high frequency region.

Investigation of Convection and Pressure Treatment with Splitting Techniques

NASA Technical Reports Server (NTRS)

Thakur, Siddharth; Shyy, Wei; Liou, Meng-Sing

1995-01-01

Treatment of convective and pressure fluxes in the Euler and Navier-Stokes equations using splitting formulas for convective velocity and pressure is investigated. Two schemes - controlled variation scheme (CVS) and advection upstream splitting method (AUSM) - are explored for their accuracy in resolving sharp gradients in flows involving moving or reflecting shock waves as well as a one-dimensional combusting flow with a strong heat release source term. For two-dimensional compressible flow computations, these two schemes are implemented in one of the pressure-based algorithms, whose very basis is the separate treatment of convective and pressure fluxes. For the convective fluxes in the momentum equations as well as the estimation of mass fluxes in the pressure correction equation (which is derived from the momentum and continuity equations) of the present algorithm, both first- and second-order (with minmod limiter) flux estimations are employed. Some issues resulting from the conventional use in pressure-based methods of a staggered grid, for the location of velocity components and pressure, are also addressed. Using the second-order fluxes, both CVS and AUSM type schemes exhibit sharp resolution. Overall, the combination of upwinding and splitting for the convective and pressure fluxes separately exhibits robust performance for a variety of flows and is particularly amenable for adoption in pressure-based methods.

Searching for the Source of Salt Marsh Buried Mercury.

NASA Astrophysics Data System (ADS)

Brooke, C. G.; Nelson, D. C.; Fleming, E. J.

2016-12-01

Salt marshes provide a barrier between upstream mercury contamination and coastal ecosystems. Mercury is sorbed, transported, and deposited in estuarine systems. Once the upstream mercury source has been remediated, the downstream mercury contaminated salt marsh sediments should become "capped" or buried by uncontaminated sediments preventing further ecosystem contamination. Downstream from a remediated mercury mine, an estuarine intertidal marsh in Tomales Bay, CA, USA, scavengers/predators (e.g. Pachygrapsus crassipes, Lined Shore Crab) have leg mercury concentrations as high as 5.5 ppm (dry wt./dry wt.), which increase significantly with crab size, a surrogate for trophic level. These elevated mercury concentrations suggests that "buried" mercury is rereleased into the environment. To locate possible sources of mercury release in Walker Marsh, we sampled a transect across the marsh that included diverse micro-environments (e.g. rhizoshere, stratified sediments, faunal burrows). From each location we determined the sediment structure, sediment color, total sediment mercury, total sediment iron, and microbial composition (n = 28). Where flora or fauna had perturbed the sediment, mercury concentrations were 10% less than undisturbed stratified sediments (1025 ppb vs. 1164 ppb, respectively). High-throughput SSU rRNA gene sequencing and subsequent co-occurrence network analysis genera indicated that in flora- or fauna- perturbed sediments there was an increased likelihood that microbial genera contained mercury mobilizing genes (94% vs 57%; in perturbed vs stratified sediments, respectively). Our observations are consistent with findings by others that in perturbed sites mercury mobility increased. We did however identify a microbial and geochemical profile with increased mercury mobility. For future work we plan to quantify the role these micro-environments have on mercury-efflux from salt marshes.

Secure and Cost-Effective Distributed Aggregation for Mobile Sensor Networks

PubMed Central

Guo, Kehua; Zhang, Ping; Ma, Jianhua

2016-01-01

Secure data aggregation (SDA) schemes are widely used in distributed applications, such as mobile sensor networks, to reduce communication cost, prolong the network life cycle and provide security. However, most SDA are only suited for a single type of statistics (i.e., summation-based or comparison-based statistics) and are not applicable to obtaining multiple statistic results. Most SDA are also inefficient for dynamic networks. This paper presents multi-functional secure data aggregation (MFSDA), in which the mapping step and coding step are introduced to provide value-preserving and order-preserving and, later, to enable arbitrary statistics support in the same query. MFSDA is suited for dynamic networks because these active nodes can be counted directly from aggregation data. The proposed scheme is tolerant to many types of attacks. The network load of the proposed scheme is balanced, and no significant bottleneck exists. The MFSDA includes two versions: MFSDA-I and MFSDA-II. The first one can obtain accurate results, while the second one is a more generalized version that can significantly reduce network traffic at the expense of less accuracy loss. PMID:27120599

All-IP wireless sensor networks for real-time patient monitoring.

PubMed

Wang, Xiaonan; Le, Deguang; Cheng, Hongbin; Xie, Conghua

2014-12-01

This paper proposes the all-IP WSNs (wireless sensor networks) for real-time patient monitoring. In this paper, the all-IP WSN architecture based on gateway trees is proposed and the hierarchical address structure is presented. Based on this architecture, the all-IP WSN can perform routing without route discovery. Moreover, a mobile node is always identified by a home address and it does not need to be configured with a care-of address during the mobility process, so the communication disruption caused by the address change is avoided. Through the proposed scheme, a physician can monitor the vital signs of a patient at any time and at any places, and according to the IPv6 address he can also obtain the location information of the patient in order to perform effective and timely treatment. Finally, the proposed scheme is evaluated based on the simulation, and the simulation data indicate that the proposed scheme might effectively reduce the communication delay and control cost, and lower the packet loss rate. Copyright © 2014 Elsevier Inc. All rights reserved.

Pten Cell Autonomously Modulates the Hematopoietic Stem Cell Response to Inflammatory Cytokines.

PubMed

Porter, Shaina N; Cluster, Andrew S; Signer, Robert A J; Voigtmann, Jenna; Monlish, Darlene A; Schuettpelz, Laura G; Magee, Jeffrey A

2016-06-14

Pten negatively regulates the phosphatidylinositol 3-kinase (PI3K) pathway and is required to maintain quiescent adult hematopoietic stem cells (HSCs). Pten has been proposed to regulate HSCs cell autonomously and non-cell autonomously, but the relative importance of each mechanism has not been directly tested. Furthermore, the cytokines that activate the PI3K pathway upstream of Pten are not well defined. We sought to clarify whether Pten cell autonomously or non-cell autonomously regulates HSC mobilization. We also tested whether Pten deficiency affects the HSC response to granulocyte colony-stimulating factor (G-CSF) and interferon-α (IFNα) since these cytokines induce HSC mobilization or proliferation, respectively. We show that Pten regulates HSC mobilization and expansion in the spleen primarily via cell-autonomous mechanisms. Pten-deficient HSCs do not require G-CSF to mobilize, although they are hyper-sensitized to even low doses of exogenous G-CSF. Pten-deficient HSCs are similarly sensitized to IFNα. Pten therefore modulates the HSC response to inflammatory cytokines. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Robust and efficient biometrics based password authentication scheme for telecare medicine information systems using extended chaotic maps.

PubMed

Lu, Yanrong; Li, Lixiang; Peng, Haipeng; Xie, Dong; Yang, Yixian

2015-06-01

The Telecare Medicine Information Systems (TMISs) provide an efficient communicating platform supporting the patients access health-care delivery services via internet or mobile networks. Authentication becomes an essential need when a remote patient logins into the telecare server. Recently, many extended chaotic maps based authentication schemes using smart cards for TMISs have been proposed. Li et al. proposed a secure smart cards based authentication scheme for TMISs using extended chaotic maps based on Lee's and Jiang et al.'s scheme. In this study, we show that Li et al.'s scheme has still some weaknesses such as violation the session key security, vulnerability to user impersonation attack and lack of local verification. To conquer these flaws, we propose a chaotic maps and smart cards based password authentication scheme by applying biometrics technique and hash function operations. Through the informal and formal security analyses, we demonstrate that our scheme is resilient possible known attacks including the attacks found in Li et al.'s scheme. As compared with the previous authentication schemes, the proposed scheme is more secure and efficient and hence more practical for telemedical environments.

A privacy authentication scheme based on cloud for medical environment.

PubMed

Chen, Chin-Ling; Yang, Tsai-Tung; Chiang, Mao-Lun; Shih, Tzay-Farn

2014-11-01

With the rapid development of the information technology, the health care technologies already became matured. Such as electronic medical records that can be easily stored. However, how to get medical resources more convenient is currently concerning issue. In spite of many literatures discussed about medical systems, these literatures should face many security challenges. The most important issue is patients' privacy. Therefore, we propose a privacy authentication scheme based on cloud environment. In our scheme, we use mobile device's characteristics, allowing peoples to use medical resources on the cloud environment to find medical advice conveniently. The digital signature is used to ensure the security of the medical information that is certified by the medical department in our proposed scheme.

Efficient High-Order Accurate Methods using Unstructured Grids for Hydrodynamics and Acoustics

DTIC Science & Technology

2007-08-31

Leer. On upstream differencing and godunov-type schemes for hyperbolic conservation laws. SIAM Review, 25(1):35-61, 1983. [46] F . Eleuterio Toro ...early stage [4-61. The basic idea can be surmised from simple approximation theory. If a continuous function f is to be approximated over a set of...a2f 4h4 a4ff(x+eh) = f (x)+-- + _ •-+• e +0 +... (1) where 0 < e < 1 for approximations inside the interval of width h. For a second-order approximation

A novel WDM passive optical network architecture supporting two independent multicast data streams

NASA Astrophysics Data System (ADS)

Qiu, Yang; Chan, Chun-Kit

2012-01-01

We propose a novel scheme to perform optical multicast overlay of two independent multicast data streams on a wavelength-division-multiplexed (WDM) passive optical network. By controlling a sinusoidal clock signal and shifting the wavelength at the optical line terminal (OLT), the delivery of the two multicast data, being carried by the generated optical tones, can be independently and flexibly controlled. Simultaneous transmission of 10-Gb/s unicast downstream and upstream data as well as two independent 10-Gb/s multicast data was successfully demonstrated.

Investigation of transient ignition process in a cavity based scramjet combustor using combined ethylene injectors

NASA Astrophysics Data System (ADS)

Liu, Xiao; Cai, Zun; Tong, Yiheng; Zheng, Hongtao

2017-08-01

Large Eddy Simulation (LES) and experiment were employed to investigate the transient ignition and flame propagation process in a rearwall-expansion cavity scramjet combustor using combined fuel injection schemes. The compressible supersonic solver and three ethylene combustion mechanisms were first validated against experimental data and results show in reasonably good agreement. Fuel injection scheme combining transverse and direct injectors in the cavity provides a benefit mixture distribution and could achieve a successful ignition. Four stages are illustrated in detail from both experiment and LES. After forced ignition in the cavity, initial flame kernel propagates upstream towards the cavity front edge and ignites the mixture, which acts as a continuous pilot flame, and then propagates downstream along the cavity shear layer rapidly to the combustor exit. Cavity shear layer flame stabilization mode can be concluded from the heat release rate and local high temperature distribution during the combustion process.

Operationalizing Mobile Applications for Humanitarian Assistance/Disaster Relief Missions

DTIC Science & Technology

2014-03-01

FLAK, equipped with BGAN, WiMAX and meshed Wi-Fi gear. The group also brought power solutions such as solar cells, fuel cells, and wind turbines as...Open data kit sensors : Mobile data collection with wired and wireless sensors . Seattle, WA: Department of Computer Science and Engineering. Retrieved...activities taking place in the society. Over the years, communication has been modified from basic landlines to wireless schemes prevalent today, and

Exception handling for sensor fusion

NASA Astrophysics Data System (ADS)

Chavez, G. T.; Murphy, Robin R.

1993-08-01

This paper presents a control scheme for handling sensing failures (sensor malfunctions, significant degradations in performance due to changes in the environment, and errant expectations) in sensor fusion for autonomous mobile robots. The advantages of the exception handling mechanism are that it emphasizes a fast response to sensing failures, is able to use only a partial causal model of sensing failure, and leads to a graceful degradation of sensing if the sensing failure cannot be compensated for. The exception handling mechanism consists of two modules: error classification and error recovery. The error classification module in the exception handler attempts to classify the type and source(s) of the error using a modified generate-and-test procedure. If the source of the error is isolated, the error recovery module examines its cache of recovery schemes, which either repair or replace the current sensing configuration. If the failure is due to an error in expectation or cannot be identified, the planner is alerted. Experiments using actual sensor data collected by the CSM Mobile Robotics/Machine Perception Laboratory's Denning mobile robot demonstrate the operation of the exception handling mechanism.

Coherent versus noncoherent signaling for satellite-aided mobile communications

NASA Technical Reports Server (NTRS)

Davarian, F.; Sumida, J.

1986-01-01

The use of coherent versus noncoherent communications is an unresolved issue for the mobile satellite community. Should one select the more robust but less efficient noncoherent strategy for communications over satellite-aided mobile channels, or does the introduction of a space platform in the mobile link improve signal stability (both amplitude and phase) such that conventional coherent schemes become attractive? This publication tries to answer some of the questions by discussing the results from experiments using a coherent QPSK receiver. The issues discussed include items such as the measured performance in Rician fading, the link error floor in a fading environment, etc. The results are compared and contrasted with that of a noncoherent limiter/discriminator FM receiver.

Broadband Noise of Fans - With Unsteady Coupling Theory to Account for Rotor and Stator Reflection/Transmission Effects

NASA Technical Reports Server (NTRS)

Hanson, Donald B.

2001-01-01

This report examines the effects on broadband noise generation of unsteady coupling between a rotor and stator in the fan stage of a turbofan engine. Whereas previous acoustic analyses treated the blade rows as isolated cascades, the present work accounts for reflection and transmission effects at both blade rows by tracking the mode and frequency scattering of pressure and vortical waves. The fan stage is modeled in rectilinear geometry to take advantage of a previously existing unsteady cascade theory for 3D perturbation waves and thereby use a realistic 3D turbulence spectrum. In the analysis, it was found that the set of participating modes divides itself naturally into "independent mode subsets" that couple only among themselves and not to the other such subsets. This principle is the basis for the analysis and considerably reduces computational effort. It also provides a simple, accurate scheme for modal averaging for further efficiency. Computed results for a coupled fan stage are compared with calculations for isolated blade rows. It is found that coupling increases downstream noise by 2 to 4 dB. Upstream noise is lower for isolated cascades and is further reduced by including coupling effects. In comparison with test data, the increase in the upstream/downstream differential indicates that broadband noise from turbulent inflow at the stator dominates downstream noise but is not a significant contributor to upstream noise.

Hysteresis of mode transition in a dual-struts based scramjet

NASA Astrophysics Data System (ADS)

Yan, Zhang; Shaohua, Zhu; Bing, Chen; Xu, Xu

2016-11-01

Tests and numerical simulations were performed to investigate the combustion performance of a dual-staged scramjet combustor. High enthalpy vitiated inflow at a total temperature of 1231 K was supplied using a hydrogen-combustion heater. The inlet Mach number was 2.0. Liquid kerosene was injected into the combustor using the dual crossed struts. Three-dimensional Reynolds averaged reacting flow was solved using a two-equation k-ω SST turbulence model to calculate the effect of turbulent stress, and a partial-premixed flamelet model to model the effects of turbulence-chemistry interactions. The discrete phase model was utilized to simulate the fuel atomization and vaporization. For simplicity, the n-decane was chosen as the surrogate fuel with a reaction mechanism of 40 species and 141 steps. The predicted wall pressure profiles at three fuel injection schemes basically captured the axial varying trend of the experimental data. With the downstream equivalence ratio held constant, the upstream equivalence ratio was numerically increased from 0.1 to 0.4 until a steady combustion was obtained. Subsequently, the upstream equivalence ratio was decreased from 0.4 to 0.1 once again. Two ramjet modes with different wall pressure profiles and corresponding flow structures were captured under the identical upstream equivalence ratio of 0.1, illustrating an obvious hysteresis phenomenon. The mechanism of this hysteresis was explained by the transition hysteresis of the pre-combustion shock train in the isolator.

A splitting scheme based on the space-time CE/SE method for solving multi-dimensional hydrodynamical models of semiconductor devices

NASA Astrophysics Data System (ADS)

Nisar, Ubaid Ahmed; Ashraf, Waqas; Qamar, Shamsul

2016-08-01

Numerical solutions of the hydrodynamical model of semiconductor devices are presented in one and two-space dimension. The model describes the charge transport in semiconductor devices. Mathematically, the models can be written as a convection-diffusion type system with a right hand side describing the relaxation effects and interaction with a self consistent electric field. The proposed numerical scheme is a splitting scheme based on the conservation element and solution element (CE/SE) method for hyperbolic step, and a semi-implicit scheme for the relaxation step. The numerical results of the suggested scheme are compared with the splitting scheme based on Nessyahu-Tadmor (NT) central scheme for convection step and the same semi-implicit scheme for the relaxation step. The effects of various parameters such as low field mobility, device length, lattice temperature and voltages for one-space dimensional hydrodynamic model are explored to further validate the generic applicability of the CE/SE method for the current model equations. A two dimensional simulation is also performed by CE/SE method for a MESFET device, producing results in good agreement with those obtained by NT-central scheme.

A novel wavelength reused bidirectional RoF-WDM-PON architecture to mitigate reflection and Rayleigh backscattered noise in multi-Gb/s m-QAM OFDM SSB upstream and downstream transmission over a single fiber

NASA Astrophysics Data System (ADS)

Patel, Dhananjay; Dalal, U. D.

2017-05-01

A novel m-QAM Orthogonal Frequency Division Multiplexing (OFDM) Single Sideband (SSB) architecture is proposed for centralized light source (CLS) bidirectional Radio over Fiber (RoF) - Wavelength Division Multiplexing (WDM) - Passive Optical Network (PON). In bidirectional transmission with carrier reuse over the single fiber, the Rayleigh Backscattering (RB) noise and reflection (RE) interferences from optical components can seriously deteriorate the transmission performance of the fiber optic systems. These interferometric noises can be mitigated by utilizing the optical modulation schemes at the Optical Line Terminal (OLT) and Optical Network Unit (ONU) such that the spectral overlap between the optical data spectrum and the RB and RE noise is minimum. A mathematical model is developed for the proposed architecture to accurately measure the performance of the transmission system and also to analyze the effect of interferometric noise caused by the RB and RE. The model takes into the account the different modulation schemes employed at the OLT and the ONU using a Mach Zehnder Modulator (MZM), the optical launch power and the bit-rates of the downstream and upstream signals, the gain of the amplifiers at the OLT and the ONU, the RB-RE noise, chromatic dispersion of the single mode fiber and optical filter responses. In addition, the model analyzes all the components of the RB-RE noise such as carrier RB, signal RB, carrier RE and signal RE, thus providing the complete representation of all the physical phenomena involved. An optical m-QAM OFDM SSB signal acts as a test signal to validate the model which provides excellent agreement with simulation results. The SSB modulation technique using the MZM at the OLT and the ONU differs in the data transmission technique that takes place through the first-order higher and the lower optical sideband respectively. This spectral gap between the downstream and upstream signals reduces the effect of Rayleigh backscattering and discrete reflections.

A bilinear pairing based anonymous authentication scheme in wireless body area networks for mHealth.

PubMed

Jiang, Qi; Lian, Xinxin; Yang, Chao; Ma, Jianfeng; Tian, Youliang; Yang, Yuanyuan

2016-11-01

Wireless body area networks (WBANs) have become one of the key components of mobile health (mHealth) which provides 24/7 health monitoring service and greatly improves the quality and efficiency of healthcare. However, users' concern about the security and privacy of their health information has become one of the major obstacles that impede the wide adoption of WBANs. Anonymous and unlinkable authentication is critical to protect the security and privacy of sensitive physiological information in transit from the client to the application provider. We first show that the anonymous authentication scheme of Wang and Zhang based on bilinear pairing is prone to client impersonation attack. Then, we propose an enhanced anonymous authentication scheme to remedy the flaw in Wang and Zhang's scheme. We give the security analysis to demonstrate that the enhanced scheme achieves the desired security features and withstands various known attacks.

Prediction-based association control scheme in dense femtocell networks.

PubMed

Sung, Nak Woon; Pham, Ngoc-Thai; Huynh, Thong; Hwang, Won-Joo; You, Ilsun; Choo, Kim-Kwang Raymond

2017-01-01

The deployment of large number of femtocell base stations allows us to extend the coverage and efficiently utilize resources in a low cost manner. However, the small cell size of femtocell networks can result in frequent handovers to the mobile user, and consequently throughput degradation. Thus, in this paper, we propose predictive association control schemes to improve the system's effective throughput. Our design focuses on reducing handover frequency without impacting on throughput. The proposed schemes determine handover decisions that contribute most to the network throughput and are proper for distributed implementations. The simulation results show significant gains compared with existing methods in terms of handover frequency and network throughput perspective.

Optimal powering schemes for legged robotics

NASA Astrophysics Data System (ADS)

Muench, Paul; Bednarz, David; Czerniak, Gregory P.; Cheok, Ka C.

2010-04-01

Legged Robots have tremendous mobility, but they can also be very inefficient. These inefficiencies can be due to suboptimal control schemes, among other things. If your goal is to get from point A to point B in the least amount of time, your control scheme will be different from if your goal is to get there using the least amount of energy. In this paper, we seek a balance between these extremes by looking at both efficiency and speed. We model a walking robot as a rimless wheel, and, using Pontryagin's Maximum Principle (PMP), we find an "on-off" control for the model, and describe the switching curve between these control extremes.

The AMSC mobile satellite system

NASA Technical Reports Server (NTRS)

Agnew, Carson E.; Bhagat, Jai; Hopper, Edwin A.; Kiesling, John D.; Exner, Michael L.; Melillo, Lawrence; Noreen, Gary K.; Parrott, Billy J.

1988-01-01

The American Mobile Satellite Consortium (AMSC) Mobile Satellite Service (MSS) system is described. AMSC will use three multi-beam satellites to provide L-band MSS coverage to the United States, Canada and Mexico. The AMSC MSS system will have several noteworthy features, including a priority assignment processor that will ensure preemptive access to emergency services, a flexible SCPC channel scheme that will support a wide diversity of services, enlarged system capacity through frequency and orbit reuse, and high effective satellite transmitted power. Each AMSC satellite will make use of 14 MHz (bi-directional) of L-band spectrum. The Ku-band will be used for feeder links.

Experimental validation of convection-diffusion discretisation scheme employed for computational modelling of biological mass transport

PubMed Central

2010-01-01

Background The finite volume solver Fluent (Lebanon, NH, USA) is a computational fluid dynamics software employed to analyse biological mass-transport in the vasculature. A principal consideration for computational modelling of blood-side mass-transport is convection-diffusion discretisation scheme selection. Due to numerous discretisation schemes available when developing a mass-transport numerical model, the results obtained should either be validated against benchmark theoretical solutions or experimentally obtained results. Methods An idealised aneurysm model was selected for the experimental and computational mass-transport analysis of species concentration due to its well-defined recirculation region within the aneurysmal sac, allowing species concentration to vary slowly with time. The experimental results were obtained from fluid samples extracted from a glass aneurysm model, using the direct spectrophometric concentration measurement technique. The computational analysis was conducted using the four convection-diffusion discretisation schemes available to the Fluent user, including the First-Order Upwind, the Power Law, the Second-Order Upwind and the Quadratic Upstream Interpolation for Convective Kinetics (QUICK) schemes. The fluid has a diffusivity of 3.125 × 10-10 m2/s in water, resulting in a Peclet number of 2,560,000, indicating strongly convection-dominated flow. Results The discretisation scheme applied to the solution of the convection-diffusion equation, for blood-side mass-transport within the vasculature, has a significant influence on the resultant species concentration field. The First-Order Upwind and the Power Law schemes produce similar results. The Second-Order Upwind and QUICK schemes also correlate well but differ considerably from the concentration contour plots of the First-Order Upwind and Power Law schemes. The computational results were then compared to the experimental findings. An average error of 140% and 116% was demonstrated between the experimental results and those obtained from the First-Order Upwind and Power Law schemes, respectively. However, both the Second-Order upwind and QUICK schemes accurately predict species concentration under high Peclet number, convection-dominated flow conditions. Conclusion Convection-diffusion discretisation scheme selection has a strong influence on resultant species concentration fields, as determined by CFD. Furthermore, either the Second-Order or QUICK discretisation schemes should be implemented when numerically modelling convection-dominated mass-transport conditions. Finally, care should be taken not to utilize computationally inexpensive discretisation schemes at the cost of accuracy in resultant species concentration. PMID:20642816

Performance Optimization of Priority Assisted CSMA/CA Mechanism of 802.15.6 under Saturation Regime

PubMed Central

Shakir, Mustafa; Rehman, Obaid Ur; Rahim, Mudassir; Alrajeh, Nabil; Khan, Zahoor Ali; Khan, Mahmood Ashraf; Niaz, Iftikhar Azim; Javaid, Nadeem

2016-01-01

Due to the recent development in the field of Wireless Sensor Networks (WSNs), the Wireless Body Area Networks (WBANs) have become a major area of interest for the developers and researchers. Human body exhibits postural mobility due to which distance variation occurs and the status of connections amongst sensors change time to time. One of the major requirements of WBAN is to prolong the network lifetime without compromising on other performance measures, i.e., delay, throughput and bandwidth efficiency. Node prioritization is one of the possible solutions to obtain optimum performance in WBAN. IEEE 802.15.6 CSMA/CA standard splits the nodes with different user priorities based on Contention Window (CW) size. Smaller CW size is assigned to higher priority nodes. This standard helps to reduce delay, however, it is not energy efficient. In this paper, we propose a hybrid node prioritization scheme based on IEEE 802.15.6 CSMA/CA to reduce energy consumption and maximize network lifetime. In this scheme, optimum performance is achieved by node prioritization based on CW size as well as power in respective user priority. Our proposed scheme reduces the average back off time for channel access due to CW based prioritization. Additionally, power based prioritization for a respective user priority helps to minimize required number of retransmissions. Furthermore, we also compare our scheme with IEEE 802.15.6 CSMA/CA standard (CW assisted node prioritization) and power assisted node prioritization under postural mobility in WBAN. Mathematical expressions are derived to determine the accurate analytical model for throughput, delay, bandwidth efficiency, energy consumption and life time for each node prioritization scheme. With the intention of analytical model validation, we have performed the simulations in OMNET++/MIXIM framework. Analytical and simulation results show that our proposed hybrid node prioritization scheme outperforms other node prioritization schemes in terms of average network delay, average throughput, average bandwidth efficiency and network lifetime. PMID:27598167

Modeling and Analysis of Hybrid Cellular/WLAN Systems with Integrated Service-Based Vertical Handoff Schemes

NASA Astrophysics Data System (ADS)

Xia, Weiwei; Shen, Lianfeng

We propose two vertical handoff schemes for cellular network and wireless local area network (WLAN) integration: integrated service-based handoff (ISH) and integrated service-based handoff with queue capabilities (ISHQ). Compared with existing handoff schemes in integrated cellular/WLAN networks, the proposed schemes consider a more comprehensive set of system characteristics such as different features of voice and data services, dynamic information about the admitted calls, user mobility and vertical handoffs in two directions. The code division multiple access (CDMA) cellular network and IEEE 802.11e WLAN are taken into account in the proposed schemes. We model the integrated networks by using multi-dimensional Markov chains and the major performance measures are derived for voice and data services. The important system parameters such as thresholds to prioritize handoff voice calls and queue sizes are optimized. Numerical results demonstrate that the proposed ISHQ scheme can maximize the utilization of overall bandwidth resources with the best quality of service (QoS) provisioning for voice and data services.

Design and Smartphone-Based Implementation of a Chaotic Video Communication Scheme via WAN Remote Transmission

NASA Astrophysics Data System (ADS)

Lin, Zhuosheng; Yu, Simin; Li, Chengqing; Lü, Jinhu; Wang, Qianxue

This paper proposes a chaotic secure video remote communication scheme that can perform on real WAN networks, and implements it on a smartphone hardware platform. First, a joint encryption and compression scheme is designed by embedding a chaotic encryption scheme into the MJPG-Streamer source codes. Then, multiuser smartphone communications between the sender and the receiver are implemented via WAN remote transmission. Finally, the transmitted video data are received with the given IP address and port in an Android smartphone. It should be noted that, this is the first time that chaotic video encryption schemes are implemented on such a hardware platform. The experimental results demonstrate that the technical challenges on hardware implementation of secure video communication are successfully solved, reaching a balance amongst sufficient security level, real-time processing of massive video data, and utilization of available resources in the hardware environment. The proposed scheme can serve as a good application example of chaotic secure communications for smartphone and other mobile facilities in the future.

An Integrated Mobile Application to Improve the Watershed Management in Taiwan

NASA Astrophysics Data System (ADS)

Chou, T. Y.; Chen, M. H.; Lee, C. Y.

2015-12-01

This study aims to focus on the application of information technology on the reservoir watershed management. For the civil and commercial water usage, reservoirs and its upstream plays a significant role due to water scarcity and inequality, especially in Taiwan. Due to the progress of information technology, apply it can improve the efficiency and accuracy of daily affairs significantly which already proved by previous researches. Taipei Water Resource District (TWRD) is selected as study area for this study, it is the first reservoir watershed which authorized as special protection district by urban planning act. This study has designed a framework of mobile application, which addressed three types of public affairs relate to watershed management, includes building management, illegal land-use investigation, and a dashboard of real time stream information. This mobile application integrated a dis-connected map and interactive interface to collect, record and calculate field information which helps the authority manage the public affairs more efficiency.

Stackable differential mobility analyzer for aerosol measurement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Meng-Dawn; Chen, Da-Ren

2007-05-08

A multi-stage differential mobility analyzer (MDMA) for aerosol measurements includes a first electrode or grid including at least one inlet or injection slit for receiving an aerosol including charged particles for analysis. A second electrode or grid is spaced apart from the first electrode. The second electrode has at least one sampling outlet disposed at a plurality different distances along its length. A volume between the first and the second electrode or grid between the inlet or injection slit and a distal one of the plurality of sampling outlets forms a classifying region, the first and second electrodes for chargingmore » to suitable potentials to create an electric field within the classifying region. At least one inlet or injection slit in the second electrode receives a sheath gas flow into an upstream end of the classifying region, wherein each sampling outlet functions as an independent DMA stage and classifies different size ranges of charged particles based on electric mobility simultaneously.« less

Sharing Resources In Mobile/Satellite Communications

NASA Technical Reports Server (NTRS)

Yan, Tsun-Yee; Sue, Miles K.

1992-01-01

Report presents preliminary theoretical analysis of several alternative schemes for allocation of satellite resource among terrestrial subscribers of landmobile/satellite communication system. Demand-access and random-access approaches under code-division and frequency-division concepts compared.

Physical and chemical constraints limit the habitat window for an endangered mussel

USGS Publications Warehouse

Campbell, Cara; Prestegaard, Karen L.

2016-01-01

Development of effective conservation and restoration strategies for freshwater pearly mussels requires identification of environmental constraints on the distributions of individual mussel species. We examined whether the spatial distribution of the endangered Alasmidonta heterodon in Flat Brook, a tributary of the upper Delaware River, was constrained by water chemistry (i.e., calcium availability), bed mobility, or both. Alasmidonta heterodon populations were bracketed between upstream reaches that were under-saturated with respect to aragonite and downstream reaches that were saturated for aragonite during summer baseflow but had steep channels with high bed mobility. Variability in bed mobility and water chemistry along the length of Flat Brook create a “habitat window” for A. heterodon defined by bed stability (mobility index ≤1) and aragonite saturation (saturation index ≥1). We suggest the species may exist in a narrow biogeochemical window that is seasonally near saturation. Alasmidonta heterodon populations may be susceptible to climate change or anthropogenic disturbances that increase discharge, decrease groundwater inflow or chemistry, and thus affect either bed mobility or aragonite saturation. Identifying the biogeochemical microhabitats and requirements of individual mussel species and incorporating this knowledge into management decisions should enhance the conservation and restoration of endangered mussel species.

Microbial Sulfate Reduction Enhances Arsenic Mobility Downstream of Zerovalent-Iron-Based Permeable Reactive Barrier.

PubMed

Kumar, Naresh; Couture, Raoul-Marie; Millot, Romain; Battaglia-Brunet, Fabienne; Rose, Jérôme

2016-07-19

We assessed the potential of zerovalent-iron- (Fe(0)) based permeable reactive barrier (PRB) systems for arsenic (As) remediation in the presence or absence of microbial sulfate reduction. We conducted long-term (200 day) flow-through column experiments to investigate the mechanisms of As transformation and mobility in aquifer sediment (in particular, the PRB downstream linkage). Changes in As speciation in the aqueous phase were monitored continuously. Speciation in the solid phase was determined at the end of the experiment using X-ray absorption near-edge structure (XANES) spectroscopy analysis. We identified thio-As species in solution and AsS in solid phase, which suggests that the As(V) was reduced to As(III) and precipitated as AsS under sulfate-reducing conditions and remained as As(V) under abiotic conditions, even with low redox potential and high Fe(II) content (4.5 mM). Our results suggest that the microbial sulfate reduction plays a key role in the mobilization of As from Fe-rich aquifer sediment under anoxic conditions. Furthermore, they illustrate that the upstream-downstream linkage of PRB affects the speciation and mobility of As in downstream aquifer sediment, where up to 47% of total As initially present in the sediment was leached out in the form of mobile thio-As species.

A study and experiment plan for digital mobile communication via satellite

NASA Technical Reports Server (NTRS)

Jones, J. J.; Craighill, E. J.; Evans, R. G.; Vincze, A. D.; Tom, N. N.

1978-01-01

The viability of mobile communications is examined within the context of a frequency division multiple access, single channel per carrier satellite system emphasizing digital techniques to serve a large population of users. The intent is to provide the mobile users with a grade of service consistant with the requirements for remote, rural (perhaps emergency) voice communications, but which approaches toll quality speech. A traffic model is derived on which to base the determination of the required maximum number of satellite channels to provide the anticipated level of service. Various voice digitalization and digital modulation schemes are reviewed along with a general link analysis of the mobile system. Demand assignment multiple access considerations and analysis tradeoffs are presented. Finally, a completed configuration is described.

Mobile satellite communications - Vehicle antenna technology update

NASA Technical Reports Server (NTRS)

Bell, D.; Naderi, F. M.

1986-01-01

This paper discusses options for vehicle antennas to be used in mobile satellite communications systems. Two types of antennas are identified. A non-steerable, azimuthally omnidirectional antenna with a modest gain of 3 to 5 dBi is suggested when a low cost is desired. Alternatively, mechanically or electronically steerable antennas with a higher gain of 10 to 12 dBi are suggested to alleviate power and spectrum scarcity associated with mobile satellite communications. For steerable antennas, both open-loop and closed-loop pointing schemes are discussed. Monopulse and sequential lobing are proposed for the mechanically steered and electronically steered antennas, respectively. This paper suggests a hybrid open-loop/closed-loop pointing technique as the best performer in the mobile satellite environment.

An Efficient Method for Detecting Misbehaving Zone Manager in MANET

NASA Astrophysics Data System (ADS)

Rafsanjani, Marjan Kuchaki; Pakzad, Farzaneh; Asadinia, Sanaz

In recent years, one of the wireless technologies increased tremendously is mobile ad hoc networks (MANETs) in which mobile nodes organize themselves without the help of any predefined infrastructure. MANETs are highly vulnerable to attack due to the open medium, dynamically changing network topology, cooperative algorithms, lack of centralized monitoring, management point and lack of a clear defense line. In this paper, we report our progress in developing intrusion detection (ID) capabilities for MANET. In our proposed scheme, the network with distributed hierarchical architecture is partitioned into zones, so that in each of them there is one zone manager. The zone manager is responsible for monitoring the cluster heads in its zone and cluster heads are in charge of monitoring their members. However, the most important problem is how the trustworthiness of the zone manager can be recognized. So, we propose a scheme in which "honest neighbors" of zone manager specify the validation of their zone manager. These honest neighbors prevent false accusations and also allow manager if it is wrongly misbehaving. However, if the manger repeats its misbehavior, then it will lose its management degree. Therefore, our scheme will be improved intrusion detection and also provide a more reliable network.

Energy Efficient Probabilistic Broadcasting for Mobile Ad-Hoc Network

NASA Astrophysics Data System (ADS)

Kumar, Sumit; Mehfuz, Shabana

2017-06-01

In mobile ad-hoc network (MANETs) flooding method is used for broadcasting route request (RREQ) packet from one node to another node for route discovery. This is the simplest method of broadcasting of RREQ packets but it often results in broadcast storm problem, originating collisions and congestion of packets in the network. A probabilistic broadcasting is one of the widely used broadcasting scheme for route discovery in MANETs and provides solution for broadcasting storm problem. But it does not consider limited energy of the battery of the nodes. In this paper, a new energy efficient probabilistic broadcasting (EEPB) is proposed in which probability of broadcasting RREQs is calculated with respect to remaining energy of nodes. The analysis of simulation results clearly indicate that an EEPB route discovery scheme in ad-hoc on demand distance vector (AODV) can increase the network lifetime with a decrease in the average power consumption and RREQ packet overhead. It also decreases the number of dropped packets in the network, in comparison to other EEPB schemes like energy constraint gossip (ECG), energy aware gossip (EAG), energy based gossip (EBG) and network lifetime through energy efficient broadcast gossip (NEBG).

ENERGETIC PARTICLE PRESSURE AT INTERPLANETARY SHOCKS: STEREO-A OBSERVATIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lario, D.; Decker, R. B.; Roelof, E. C.

2015-11-10

We study periods of elevated energetic particle intensities observed by STEREO-A when the partial pressure exerted by energetic (≥83 keV) protons (P{sub EP}) is larger than the pressure exerted by the interplanetary magnetic field (P{sub B}). In the majority of cases, these periods are associated with the passage of interplanetary shocks. Periods when P{sub EP} exceeds P{sub B} by more than one order of magnitude are observed in the upstream region of fast interplanetary shocks where depressed magnetic field regions coincide with increases of energetic particle intensities. When solar wind parameters are available, P{sub EP} also exceeds the pressure exertedmore » by the solar wind thermal population (P{sub TH}). Prolonged periods (>12 hr) with both P{sub EP} > P{sub B} and P{sub EP} > P{sub TH} may also occur when energetic particles accelerated by an approaching shock encounter a region well upstream of the shock characterized by low magnetic field magnitude and tenuous solar wind density. Quasi-exponential increases of the sum P{sub SUM} = P{sub B} + P{sub TH} + P{sub EP} are observed in the immediate upstream region of the shocks regardless of individual changes in P{sub EP}, P{sub B}, and P{sub TH}, indicating a coupling between P{sub EP} and the pressure of the background medium characterized by P{sub B} and P{sub TH}. The quasi-exponential increase of P{sub SUM} implies a radial gradient ∂P{sub SUM}/∂r > 0 that is quasi-stationary in the shock frame and results in an outward force applied to the plasma upstream of the shock. This force can be maintained by the mobile energetic particles streaming upstream of the shocks that, in the most intense events, drive electric currents able to generate diamagnetic cavities and depressed solar wind density regions.« less

A novel method for trajectory planning of cooperative mobile manipulators.

PubMed

Bolandi, Hossein; Ehyaei, Amir Farhad

2011-01-01

We have designed a two-stage scheme to consider the trajectory planning problem of two mobile manipulators for cooperative transportation of a rigid body in the presence of static obstacles. In the first stage, with regard to the static obstacles, we develop a method that searches the workspace for the shortest possible path between the start and goal configurations, by constructing a graph on a portion of the configuration space that satisfies the collision and closure constraints. The final stage is to calculate a sequence of time-optimal trajectories to go between the consecutive points of the path, with regard to the nonholonomic constraints and the maximum allowed joint accelerations. This approach allows geometric constraints such as joint limits and closed-chain constraints, along with differential constraints such as nonholonomic velocity constraints and acceleration limits, to be incorporated into the planning scheme. The simulation results illustrate the effectiveness of the proposed method.

A Novel Method for Trajectory Planning of Cooperative Mobile Manipulators

PubMed Central

Bolandi, Hossein; Ehyaei, Amir Farhad

2011-01-01

We have designed a two-stage scheme to consider the trajectory planning problem of two mobile manipulators for cooperative transportation of a rigid body in the presence of static obstacles. In the first stage, with regard to the static obstacles, we develop a method that searches the workspace for the shortest possible path between the start and goal configurations, by constructing a graph on a portion of the configuration space that satisfies the collision and closure constraints. The final stage is to calculate a sequence of time-optimal trajectories to go between the consecutive points of the path, with regard to the nonholonomic constraints and the maximum allowed joint accelerations. This approach allows geometric constraints such as joint limits and closed-chain constraints, along with differential constraints such as nonholonomic velocity constraints and acceleration limits, to be incorporated into the planning scheme. The simulation results illustrate the effectiveness of the proposed method. PMID:22606656

Airborne Network Data Availability Using Peer to Peer Database Replication on a Distributed Hash Table

DTIC Science & Technology

2013-03-01

DSR Dynamic Source Routing DSSS Direct -sequence spread spectrum GUID Globally Unique ID MANET Mobile Ad-hoc Network NS3 Network Simulator 3 OLSR...networking schemes for safe maneuvering and data communication. Imagine needing to maintain an operational picture of an overall environment using a...as simple as O(n) where every node is sequentially queried to O log(n), or O(1). These schemes will be discussed with each individual DHT. Four of the

[PROtocol-based MObilizaTION on intensive care units : Design of a cluster randomized pilot study].

PubMed

Nydahl, P; Diers, A; Günther, U; Haastert, B; Hesse, S; Kerschensteiner, C; Klarmann, S; Köpke, S

2017-10-12

Despite convincing evidence for early mobilization of patients on intensive care units (ICU), implementation in practice is limited. Protocols for early mobilization, including in- and exclusion criteria, assessments, safety criteria, and step schemes may increase the rate of implementation and mobilization. Patients (population) on ICUs with a protocol for early mobilization (intervention), compared to patients on ICUs without protocol (control), will be more frequently mobilized (outcome). A multicenter, stepped-wedge, cluster-randomized pilot study is presented. Five ICUs will receive an adapted, interprofessional protocol for early mobilization in randomized order. Before and after implementation, mobilization of ICU patients will be evaluated by randomized monthly one-day point prevalence surveys. Primary outcome is the percentage of patients mobilized out of bed, operationalized as a score of ≥3 on the ICU Mobility Scale. Secondary outcome parameters will be presence and/or length of mechanical ventilation, delirium, stay on ICU and in hospital, barriers to early mobilization, adverse events, and process parameters as identified barriers, used strategies, and adaptions to local conditions. Exploratory evaluation of study feasibility and estimation of effect sizes as the basis for a future explanatory study.

MELOC - Memory and Location Optimized Caching for Mobile Ad Hoc Networks

DTIC Science & Technology

2011-01-01

required for such environments. Moreover, nodes located at centre have to be chosen as cache location, since it reduces the chance of being attacked...Figure 1.1. MANET Formed by Armed Forces 47 Example 3: Sharing of music and videos are famous among mobile users. Instead of downloading...The two tier caching scheme discussed in this paper is acoustic . The characteristics of two-tier caching are as follows, the content of data to be

Analogue and digital linear modulation techniques for mobile satellite

NASA Technical Reports Server (NTRS)

Whitmarsh, W. J.; Bateman, A.; Mcgeehan, J. P.

1990-01-01

The choice of modulation format for a mobile satellite service is complex. The subjective performance is summarized of candidate schemes and voice coder technologies. It is shown that good performance can be achieved with both analogue and digital voice systems, although the analogue system gives superior performance in fading. The results highlight the need for flexibility in the choice of signaling format. Linear transceiver technology capable of using many forms of narrowband modulation is described.

The Use of Non-Standard Devices in Finite Element Analysis

NASA Technical Reports Server (NTRS)

Schur, Willi W.; Broduer, Steve (Technical Monitor)

2001-01-01

A general mathematical description of the response behavior of thin-skin pneumatic envelopes and many other membrane and cable structures produces under-constrained systems that pose severe difficulties to analysis. These systems are mobile, and the general mathematical description exposes the mobility. Yet the response behavior of special under-constrained structures under special loadings can be accurately predicted using a constrained mathematical description. The static response behavior of systems that are infinitesimally mobile, such as a non-slack membrane subtended from a rigid or elastic boundary frame, can be easily analyzed using such general mathematical description as afforded by the non-linear, finite element method using an implicit solution scheme if the incremental uploading is guided through a suitable path. Similarly, if such structures are assembled with structural lack of fit that provides suitable self-stress, then dynamic response behavior can be predicted by the non-linear, finite element method and an implicit solution scheme. An explicit solution scheme is available for evolution problems. Such scheme can be used via the method of dynamic relaxation to obtain the solution to a static problem. In some sense, pneumatic envelopes and many other compliant structures can be said to have destiny under a specified loading system. What that means to the analyst is that what happens on the evolution path of the solution is irrelevant as long as equilibrium is achieved at destiny under full load and that the equilibrium is stable in the vicinity of that load. The purpose of this paper is to alert practitioners to the fact that non-standard procedures in finite element analysis are useful and can be legitimate although they burden their users with the requirement to use special caution. Some interesting findings that are useful to the US Scientific Balloon Program and that could not be obtained without non-standard techniques are presented.

Transient NOE enhancement in solid-state MAS NMR of mobile systems

NASA Astrophysics Data System (ADS)

Cui, Jiangyu; Li, Jun; Peng, Xinhua; Fu, Riqiang

2017-11-01

It has been known that the heteronuclear cross-relaxation affects the dilute S spin magnetization along the longitudinal direction, causing an overshoot phenomenon for those mobile systems in spin-lattice relaxation rate measurements. Here, we analyze the Solomon equations for an I-S system and derive the transient cross relaxation effect as to when an overshoot phenomenon would take place and what the maximum enhancement could be at the time of the overshoot. In order to utilize such a transient nuclear Overhauser effect (NOE), we first time apply it to dynamic solid samples by inverting the 1H magnetization prior to the excitation of the S spin. It is found that the overshoot depends on the ratio of the I and S spin-lattice relaxation rates, i.e. RSS /RII . When RSS /RII ≫ 1 , the maximum enhancement factor for transient NOE could be larger than that obtained in steady-state NOE experiments. Furthermore, transient NOE appears to be more efficient in terms of sensitivity enhancement of dilute spins in solid-state NMR of mobile systems than the traditional cross polarization scheme whose efficiency is greatly compromised by molecular mobility. A sample of natural abundance L-isoleucine amino acid, in which the spin-lattice relaxation rates for the four methyl carbons are different, has been used to demonstrate sensitivity enhancement factors under various experimental schemes.

Broadband and scalable mobile satellite communication system for future access networks

NASA Astrophysics Data System (ADS)

Ohata, Kohei; Kobayashi, Kiyoshi; Nakahira, Katsuya; Ueba, Masazumi

2005-07-01

Due to the recent market trends, NTT has begun research into next generation satellite communication systems, such as broadband and scalable mobile communication systems. One service application objective is to provide broadband Internet access for transportation systems, temporal broadband access networks and telemetries to remote areas. While these are niche markets the total amount of capacity should be significant. We set a 1-Gb/s total transmission capacity as our goal. Our key concern is the system cost, which means that the system should be unified system with diversified services and not tailored for each application. As satellites account for a large portion of the total system cost, we set the target satellite size as a small, one-ton class dry mass with a 2-kW class payload power. In addition to the payload power and weight, the mobile satellite's frequency band is extremely limited. Therefore, we need to develop innovative technologies that will reduce the weight and maximize spectrum and power efficiency. Another challenge is the need for the system to handle up to 50 dB and a wide data rate range of other applications. This paper describes the key communication system technologies; the frequency reuse strategy, multiplexing scheme, resource allocation scheme, and QoS management algorithm to ensure excellent spectrum efficiency and support a variety of services and quality requirements in the mobile environment.

Smartphone-based secure authenticated session sharing in Internet of Personal Things

NASA Astrophysics Data System (ADS)

Krishnan, Ram; Ninglekhu, Jiwan

2015-03-01

In the context of password-based authentication, a user can only memorize limited number of usernames and passwords. They are generally referred to as user-credentials. Longer character length of passwords further adds complication in mastering them. The expansion of the Internet and our growing dependency on it, has made it almost impossible for us to handle the big pool of user-credentials. Using simple, same or similar passwords is considered a poor practice, as it can easily be compromised by password cracking tools and social engineering attacks. Therefore, a robust and painless technique to manage personal credentials for websites is desirable. In this paper, a novel technique for user-credentials management via a smart mobile device such as a smartphone in a local network is proposed. We present a secure user-credential management scheme in which user's account login (username) and password associated with websites domain name is saved into the mobile device's database using a mobile application. We develop a custom browser extension application for client and use it to import user's credentials linked with the corresponding website from the mobile device via the local Wi-Fi network connection. The browser extension imports and identifies the authentication credentials and pushes them into the target TextBox locations in the webpage, ready for the user to execute. This scheme is suitably demonstrated between two personal devices in a local network.

Prediction-based association control scheme in dense femtocell networks

PubMed Central

Pham, Ngoc-Thai; Huynh, Thong; Hwang, Won-Joo; You, Ilsun; Choo, Kim-Kwang Raymond

2017-01-01

The deployment of large number of femtocell base stations allows us to extend the coverage and efficiently utilize resources in a low cost manner. However, the small cell size of femtocell networks can result in frequent handovers to the mobile user, and consequently throughput degradation. Thus, in this paper, we propose predictive association control schemes to improve the system’s effective throughput. Our design focuses on reducing handover frequency without impacting on throughput. The proposed schemes determine handover decisions that contribute most to the network throughput and are proper for distributed implementations. The simulation results show significant gains compared with existing methods in terms of handover frequency and network throughput perspective. PMID:28328992

Access Scheme for Controlling Mobile Agents and its Application to Share Medical Information.

PubMed

Liao, Yu-Ting; Chen, Tzer-Shyong; Chen, Tzer-Long; Chung, Yu-Fang; Chen, Yu- Xin; Hwang, Jen-Hung; Wang, Huihui; Wei, Wei

2016-05-01

This study is showing the advantage of mobile agents to conquer heterogeneous system environments and contribute to a virtual integrated sharing system. Mobile agents will collect medical information from each medical institution as a method to achieve the medical purpose of data sharing. Besides, this research also provides an access control and key management mechanism by adopting Public key cryptography and Lagrange interpolation. The safety analysis of the system is based on a network attacker's perspective. The achievement of this study tries to improve the medical quality, prevent wasting medical resources and make medical resources access to appropriate configuration.

Enabling technologies for millimeter-wave radio-over-fiber systems in next generation heterogeneous mobile access networks

NASA Astrophysics Data System (ADS)

Zhang, Junwen; Yu, Jianjun; Wang, Jing; Xu, Mu; Cheng, Lin; Lu, Feng; Shen, Shuyi; Yan, Yan; Cho, Hyunwoo; Guidotti, Daniel; Chang, Gee-kung

2017-01-01

Fifth-generation (5G) wireless access network promises to support higher access data rate with more than 1,000 times capacity with respect to current long-term evolution (LTE) systems. New radio-access-technologies (RATs) based on higher carrier frequencies to millimeter-wave (MMW) radio-over-fiber, and carrier-aggregation (CA) using multi-band resources are intensively studied to support the high data rate access and effectively use of frequency resources in heterogeneous mobile network (Het-Net). In this paper, we investigate several enabling technologies for MMW RoF systems in 5G Het-Net. Efficient mobile fronthaul (MFH) solutions for 5G centralized radio access network (C-RAN) and beyond are proposed, analyzed and experimentally demonstrated based on the analog scheme. Digital predistortion based on memory polynomial for analog MFH linearization are presented with improved EVM performances and receiver sensitivity. We also propose and experimentally demonstrate a novel inter-/intra- RAT CA scheme for 5G Het- Net. The real-time standard 4G-LTE signal is carrier-aggregated with three broadband 60GHz MMW signals based on proposed optical-domain band-mapping method. RATs based on new waveforms have also been studied here to achieve higher spectral-efficiency (SE) in asynchronous environments. Full-duplex asynchronous quasi-gapless carrier aggregation scheme for MMW ROF inter-/intra-RAT based on the FBMC is also presented with 4G-LTE signals. Compared with OFDM-based signals with large guard-bands, FBMC achieves higher spectral-efficiency with better EVM performance at less received power and smaller guard-bands.

An extended smart utilization medium access control (ESU-MAC) protocol for ad hoc wireless systems

NASA Astrophysics Data System (ADS)

Vashishtha, Jyoti; Sinha, Aakash

2006-05-01

The demand for spontaneous setup of a wireless communication system has increased in recent years for areas like battlefield, disaster relief operations etc., where a pre-deployment of network infrastructure is difficult or unavailable. A mobile ad-hoc network (MANET) is a promising solution, but poses a lot of challenges for all the design layers, specifically medium access control (MAC) layer. Recent existing works have used the concepts of multi-channel and power control in designing MAC layer protocols. SU-MAC developed by the same authors, efficiently uses the 'available' data and control bandwidth to send control information and results in increased throughput via decreasing contention on the control channel. However, SU-MAC protocol was limited for static ad-hoc network and also faced the busy-receiver node problem. We present the Extended SU-MAC (ESU-MAC) protocol which works mobile nodes. Also, we significantly improve the scheme of control information exchange in ESU-MAC to overcome the busy-receiver node problem and thus, further avoid the blockage of control channel for longer periods of time. A power control scheme is used as before to reduce interference and to effectively re-use the available bandwidth. Simulation results show that ESU-MAC protocol is promising for mobile, ad-hoc network in terms of reduced contention at the control channel and improved throughput because of channel re-use. Results show a considerable increase in throughput compared to SU-MAC which could be attributed to increased accessibility of control channel and improved utilization of data channels due to superior control information exchange scheme.

Ensemble Manifold Rank Preserving for Acceleration-Based Human Activity Recognition.

PubMed

Tao, Dapeng; Jin, Lianwen; Yuan, Yuan; Xue, Yang

2016-06-01

With the rapid development of mobile devices and pervasive computing technologies, acceleration-based human activity recognition, a difficult yet essential problem in mobile apps, has received intensive attention recently. Different acceleration signals for representing different activities or even a same activity have different attributes, which causes troubles in normalizing the signals. We thus cannot directly compare these signals with each other, because they are embedded in a nonmetric space. Therefore, we present a nonmetric scheme that retains discriminative and robust frequency domain information by developing a novel ensemble manifold rank preserving (EMRP) algorithm. EMRP simultaneously considers three aspects: 1) it encodes the local geometry using the ranking order information of intraclass samples distributed on local patches; 2) it keeps the discriminative information by maximizing the margin between samples of different classes; and 3) it finds the optimal linear combination of the alignment matrices to approximate the intrinsic manifold lied in the data. Experiments are conducted on the South China University of Technology naturalistic 3-D acceleration-based activity dataset and the naturalistic mobile-devices based human activity dataset to demonstrate the robustness and effectiveness of the new nonmetric scheme for acceleration-based human activity recognition.

An improved pi/4-QPSK with nonredundant error correction for satellite mobile broadcasting

NASA Technical Reports Server (NTRS)

Feher, Kamilo; Yang, Jiashi

1991-01-01

An improved pi/4-quadrature phase-shift keying (QPSK) receiver that incorporates a simple nonredundant error correction (NEC) structure is proposed for satellite and land-mobile digital broadcasting. The bit-error-rate (BER) performance of the pi/4-QPSK with NEC is analyzed and evaluated in a fast Rician fading and additive white Gaussian noise (AWGN) environment using computer simulation. It is demonstrated that with simple electronics the performance of a noncoherently detected pi/4-QPSK signal in both AWGN and fast Rician fading can be improved. When the K-factor (a ratio of average power of multipath signal to direct path power) of the Rician channel decreases, the improvement increases. An improvement of 1.2 dB could be obtained at a BER of 0.0001 in the AWGN channel. This performance gain is achieved without requiring any signal redundancy and additional bandwidth. Three types of noncoherent detection schemes of pi/4-QPSK with NEC structure, such as IF band differential detection, baseband differential detection, and FM discriminator, are discussed. It is concluded that the pi/4-QPSK with NEC is an attractive scheme for power-limited satellite land-mobile broadcasting systems.

BlueDetect: An iBeacon-Enabled Scheme for Accurate and Energy-Efficient Indoor-Outdoor Detection and Seamless Location-Based Service

PubMed Central

Zou, Han; Jiang, Hao; Luo, Yiwen; Zhu, Jianjie; Lu, Xiaoxuan; Xie, Lihua

2016-01-01

The location and contextual status (indoor or outdoor) is fundamental and critical information for upper-layer applications, such as activity recognition and location-based services (LBS) for individuals. In addition, optimizations of building management systems (BMS), such as the pre-cooling or heating process of the air-conditioning system according to the human traffic entering or exiting a building, can utilize the information, as well. The emerging mobile devices, which are equipped with various sensors, become a feasible and flexible platform to perform indoor-outdoor (IO) detection. However, power-hungry sensors, such as GPS and WiFi, should be used with caution due to the constrained battery storage on mobile device. We propose BlueDetect: an accurate, fast response and energy-efficient scheme for IO detection and seamless LBS running on the mobile device based on the emerging low-power iBeacon technology. By leveraging the on-broad Bluetooth module and our proposed algorithms, BlueDetect provides a precise IO detection service that can turn on/off on-board power-hungry sensors smartly and automatically, optimize their performances and reduce the power consumption of mobile devices simultaneously. Moreover, seamless positioning and navigation services can be realized by it, especially in a semi-outdoor environment, which cannot be achieved by GPS or an indoor positioning system (IPS) easily. We prototype BlueDetect on Android mobile devices and evaluate its performance comprehensively. The experimental results have validated the superiority of BlueDetect in terms of IO detection accuracy, localization accuracy and energy consumption. PMID:26907295

Online Variational Bayesian Filtering-Based Mobile Target Tracking in Wireless Sensor Networks

PubMed Central

Zhou, Bingpeng; Chen, Qingchun; Li, Tiffany Jing; Xiao, Pei

2014-01-01

The received signal strength (RSS)-based online tracking for a mobile node in wireless sensor networks (WSNs) is investigated in this paper. Firstly, a multi-layer dynamic Bayesian network (MDBN) is introduced to characterize the target mobility with either directional or undirected movement. In particular, it is proposed to employ the Wishart distribution to approximate the time-varying RSS measurement precision's randomness due to the target movement. It is shown that the proposed MDBN offers a more general analysis model via incorporating the underlying statistical information of both the target movement and observations, which can be utilized to improve the online tracking capability by exploiting the Bayesian statistics. Secondly, based on the MDBN model, a mean-field variational Bayesian filtering (VBF) algorithm is developed to realize the online tracking of a mobile target in the presence of nonlinear observations and time-varying RSS precision, wherein the traditional Bayesian filtering scheme cannot be directly employed. Thirdly, a joint optimization between the real-time velocity and its prior expectation is proposed to enable online velocity tracking in the proposed online tacking scheme. Finally, the associated Bayesian Cramer–Rao Lower Bound (BCRLB) analysis and numerical simulations are conducted. Our analysis unveils that, by exploiting the potential state information via the general MDBN model, the proposed VBF algorithm provides a promising solution to the online tracking of a mobile node in WSNs. In addition, it is shown that the final tracking accuracy linearly scales with its expectation when the RSS measurement precision is time-varying. PMID:25393784

Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation.

PubMed

Vedantam, Gayatri; Knopf, Sarah; Hecht, David W

2006-01-01

Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.

Distribution and speciation of metals (Cu, Zn, Cd, and Pb) in agricultural and non-agricultural soils near a stream upriver from the Pearl River, China.

PubMed

Yang, Silin; Zhou, Dequn; Yu, Huayong; Wei, Rong; Pan, Bo

2013-06-01

The distribution and chemical speciation of typical metals (Cu, Zn, Cd and Pb) in agricultural and non-agricultural soils were investigated in the area of Nanpan River, upstream of the Pearl River. The investigated four metals showed higher concentrations in agricultural soils than in non-agricultural soils, and the site located in factory district contained metals much higher than the other sampling sites. These observations suggested that human activities, such as water irrigation, fertilizer and pesticide applications might have a major impact on the distribution of metals. Metal speciation analysis presented that Cu, Zn and Cd were dominated by the residual fraction, while Pb was dominated by the reducible fraction. Because of the low mobility of the metals in the investigated area, no remarkable difference could be observed between upstream and downstream separated by the factory site. Copyright © 2013 Elsevier Ltd. All rights reserved.

Application-oriented offloading in heterogeneous networks for mobile cloud computing

NASA Astrophysics Data System (ADS)

Tseng, Fan-Hsun; Cho, Hsin-Hung; Chang, Kai-Di; Li, Jheng-Cong; Shih, Timothy K.

2018-04-01

Nowadays Internet applications have become more complicated that mobile device needs more computing resources for shorter execution time but it is restricted to limited battery capacity. Mobile cloud computing (MCC) is emerged to tackle the finite resource problem of mobile device. MCC offloads the tasks and jobs of mobile devices to cloud and fog environments by using offloading scheme. It is vital to MCC that which task should be offloaded and how to offload efficiently. In the paper, we formulate the offloading problem between mobile device and cloud data center and propose two algorithms based on application-oriented for minimum execution time, i.e. the Minimum Offloading Time for Mobile device (MOTM) algorithm and the Minimum Execution Time for Cloud data center (METC) algorithm. The MOTM algorithm minimizes offloading time by selecting appropriate offloading links based on application categories. The METC algorithm minimizes execution time in cloud data center by selecting virtual and physical machines with corresponding resource requirements of applications. Simulation results show that the proposed mechanism not only minimizes total execution time for mobile devices but also decreases their energy consumption.

Capacity of Heterogeneous Mobile Wireless Networks with D-Delay Transmission Strategy.

PubMed

Wu, Feng; Zhu, Jiang; Xi, Zhipeng; Gao, Kai

2016-03-25

This paper investigates the capacity problem of heterogeneous wireless networks in mobility scenarios. A heterogeneous network model which consists of n normal nodes and m helping nodes is proposed. Moreover, we propose a D-delay transmission strategy to ensure that every packet can be delivered to its destination nodes with limited delay. Different from most existing network schemes, our network model has a novel two-tier architecture. The existence of helping nodes greatly improves the network capacity. Four types of mobile networks are studied in this paper: i.i.d. fast mobility model and slow mobility model in two-dimensional space, i.i.d. fast mobility model and slow mobility model in three-dimensional space. Using the virtual channel model, we present an intuitive analysis of the capacity of two-dimensional mobile networks and three-dimensional mobile networks, respectively. Given a delay constraint D, we derive the asymptotic expressions for the capacity of the four types of mobile networks. Furthermore, the impact of D and m to the capacity of the whole network is analyzed. Our findings provide great guidance for the future design of the next generation of networks.

One-dimensional high-order compact method for solving Euler's equations

NASA Astrophysics Data System (ADS)

Mohamad, M. A. H.; Basri, S.; Basuno, B.

2012-06-01

In the field of computational fluid dynamics, many numerical algorithms have been developed to simulate inviscid, compressible flows problems. Among those most famous and relevant are based on flux vector splitting and Godunov-type schemes. Previously, this system was developed through computational studies by Mawlood [1]. However the new test cases for compressible flows, the shock tube problems namely the receding flow and shock waves were not investigated before by Mawlood [1]. Thus, the objective of this study is to develop a high-order compact (HOC) finite difference solver for onedimensional Euler equation. Before developing the solver, a detailed investigation was conducted to assess the performance of the basic third-order compact central discretization schemes. Spatial discretization of the Euler equation is based on flux-vector splitting. From this observation, discretization of the convective flux terms of the Euler equation is based on a hybrid flux-vector splitting, known as the advection upstream splitting method (AUSM) scheme which combines the accuracy of flux-difference splitting and the robustness of flux-vector splitting. The AUSM scheme is based on the third-order compact scheme to the approximate finite difference equation was completely analyzed consequently. In one-dimensional problem for the first order schemes, an explicit method is adopted by using time integration method. In addition to that, development and modification of source code for the one-dimensional flow is validated with four test cases namely, unsteady shock tube, quasi-one-dimensional supersonic-subsonic nozzle flow, receding flow and shock waves in shock tubes. From these results, it was also carried out to ensure that the definition of Riemann problem can be identified. Further analysis had also been done in comparing the characteristic of AUSM scheme against experimental results, obtained from previous works and also comparative analysis with computational results generated by van Leer, KFVS and AUSMPW schemes. Furthermore, there is a remarkable improvement with the extension of the AUSM scheme from first-order to third-order accuracy in terms of shocks, contact discontinuities and rarefaction waves.

Analytically based forward and inverse models of fluvial landscape evolution during temporally continuous climatic and tectonic variations

NASA Astrophysics Data System (ADS)

Goren, Liran; Petit, Carole

2017-04-01

Fluvial channels respond to changing tectonic and climatic conditions by adjusting their patterns of erosion and relief. It is therefore expected that by examining these patterns, we can infer the tectonic and climatic conditions that shaped the channels. However, the potential interference between climatic and tectonic signals complicates this inference. Within the framework of the stream power model that describes incision rate of mountainous bedrock rivers, climate variability has two effects: it influences the erosive power of the river, causing local slope change, and it changes the fluvial response time that controls the rate at which tectonically and climatically induced slope breaks are communicated upstream. Because of this dual role, the fluvial response time during continuous climate change has so far been elusive, which hinders our understanding of environmental signal propagation and preservation in the fluvial topography. An analytic solution of the stream power model during general tectonic and climatic histories gives rise to a new definition of the fluvial response time. The analytic solution offers accurate predictions for landscape evolution that are hard to achieve with classical numerical schemes and thus can be used to validate and evaluate the accuracy of numerical landscape evolution models. The analytic solution together with the new definition of the fluvial response time allow inferring either the tectonic history or the climatic history from river long profiles by using simple linear inversion schemes. Analytic study of landscape evolution during periodic climate change reveals that high frequency (10-100 kyr) climatic oscillations with respect to the response time, such as Milankovitch cycles, are not expected to leave significant fingerprints in the upstream reaches of fluvial channels. Linear inversion schemes are applied to the Tinee river tributaries in the southern French Alps, where tributary long profiles are used to recover the incision rate history of the Tinee main trunk. Inversion results show periodic, high incision rate pulses, which are correlated with interglacial episodes. Similar incision rate histories are recovered for the past 100 kyr when assuming constant climatic conditions or periodic climatic oscillations, in agreement with theoretical predictions.

A Distributed Data-Gathering Protocol Using AUV in Underwater Sensor Networks.

PubMed

Khan, Jawaad Ullah; Cho, Ho-Shin

2015-08-06

In this paper, we propose a distributed data-gathering scheme using an autonomous underwater vehicle (AUV) working as a mobile sink to gather data from a randomly distributed underwater sensor network where sensor nodes are clustered around several cluster headers. Unlike conventional data-gathering schemes where the AUV visits either every node or every cluster header, the proposed scheme allows the AUV to visit some selected nodes named path-nodes in a way that reduces the overall transmission power of the sensor nodes. Monte Carlo simulations are performed to investigate the performance of the proposed scheme compared with several preexisting techniques employing the AUV in terms of total amount of energy consumption, standard deviation of each node's energy consumption, latency to gather data at a sink, and controlling overhead. Simulation results show that the proposed scheme not only reduces the total energy consumption but also distributes the energy consumption more uniformly over the network, thereby increasing the lifetime of the network.

A Distributed Data-Gathering Protocol Using AUV in Underwater Sensor Networks

PubMed Central

Khan, Jawaad Ullah; Cho, Ho-Shin

2015-01-01

In this paper, we propose a distributed data-gathering scheme using an autonomous underwater vehicle (AUV) working as a mobile sink to gather data from a randomly distributed underwater sensor network where sensor nodes are clustered around several cluster headers. Unlike conventional data-gathering schemes where the AUV visits either every node or every cluster header, the proposed scheme allows the AUV to visit some selected nodes named path-nodes in a way that reduces the overall transmission power of the sensor nodes. Monte Carlo simulations are performed to investigate the performance of the proposed scheme compared with several preexisting techniques employing the AUV in terms of total amount of energy consumption, standard deviation of each node’s energy consumption, latency to gather data at a sink, and controlling overhead. Simulation results show that the proposed scheme not only reduces the total energy consumption but also distributes the energy consumption more uniformly over the network, thereby increasing the lifetime of the network. PMID:26287189

A Hybrid Key Management Scheme for WSNs Based on PPBR and a Tree-Based Path Key Establishment Method

PubMed Central

Zhang, Ying; Liang, Jixing; Zheng, Bingxin; Chen, Wei

2016-01-01

With the development of wireless sensor networks (WSNs), in most application scenarios traditional WSNs with static sink nodes will be gradually replaced by Mobile Sinks (MSs), and the corresponding application requires a secure communication environment. Current key management researches pay less attention to the security of sensor networks with MS. This paper proposes a hybrid key management schemes based on a Polynomial Pool-based key pre-distribution and Basic Random key pre-distribution (PPBR) to be used in WSNs with MS. The scheme takes full advantages of these two kinds of methods to improve the cracking difficulty of the key system. The storage effectiveness and the network resilience can be significantly enhanced as well. The tree-based path key establishment method is introduced to effectively solve the problem of communication link connectivity. Simulation clearly shows that the proposed scheme performs better in terms of network resilience, connectivity and storage effectiveness compared to other widely used schemes. PMID:27070624

An integrated collision prediction and avoidance scheme for mobile robots in non-stationary environments

NASA Technical Reports Server (NTRS)

Kyriakopoulos, K. J.; Saridis, G. N.

1993-01-01

A formulation that makes possible the integration of collision prediction and avoidance stages for mobile robots moving in general terrains containing moving obstacles is presented. A dynamic model of the mobile robot and the dynamic constraints are derived. Collision avoidance is guaranteed if the distance between the robot and a moving obstacle is nonzero. A nominal trajectory is assumed to be known from off-line planning. The main idea is to change the velocity along the nominal trajectory so that collisions are avoided. A feedback control is developed and local asymptotic stability is proved if the velocity of the moving obstacle is bounded. Furthermore, a solution to the problem of inverse dynamics for the mobile robot is given. Simulation results verify the value of the proposed strategy.

Problem solving in magnetic field: Animation in mobile application

NASA Astrophysics Data System (ADS)

Najib, A. S. M.; Othman, A. P.; Ibarahim, Z.

2014-09-01

This paper is focused on the development of mobile application for smart phone, Android, tablet, iPhone, and iPad as a problem solving tool in magnetic field. Mobile application designs consist of animations that were created by using Flash8 software which could be imported and compiled to prezi.com software slide. The Prezi slide then had been duplicated in Power Point format and instead question bank with complete answer scheme was also additionally generated as a menu in the application. Results of the published mobile application can be viewed and downloaded at Infinite Monkey website or at Google Play Store from your gadgets. Statistics of the application from Google Play Developer Console shows the high impact of the application usage in all over the world.

Satellite sound broadcasting system study: Mobile considerations

NASA Technical Reports Server (NTRS)

Golshan, Nasser

1990-01-01

Discussed here is the mobile reception part of a study to investigate a satellite sound broadcast system in the UHF or L bands. Existing propagation and reception measurements are used with proper interpretation to evaluate the signaling, coding, and diversity alternatives suitable for the system. Signal attenuation in streets shadowed by buildings appear to be around 29 db, considerably higher than the 10 db adopted by CCIR. With the marriage of proper technologies, an LMSS class satellite can provide substantial direct satellite audio broadcast capability in UHF or L bands for high quality mobile and portable indoor reception by low cost radio receivers. This scheme requires terrestrial repeaters for satisfactory mobile reception in urban areas. A specialized bandwidth efficient spread spectrum signalling technique is particularly suitable for the terrestrial repeaters.

Volume 2: Explicit, multistage upwind schemes for Euler and Navier-Stokes equations

NASA Technical Reports Server (NTRS)

Elmiligui, Alaa; Ash, Robert L.

1992-01-01

The objective of this study was to develop a high-resolution-explicit-multi-block numerical algorithm, suitable for efficient computation of the three-dimensional, time-dependent Euler and Navier-Stokes equations. The resulting algorithm has employed a finite volume approach, using monotonic upstream schemes for conservation laws (MUSCL)-type differencing to obtain state variables at cell interface. Variable interpolations were written in the k-scheme formulation. Inviscid fluxes were calculated via Roe's flux-difference splitting, and van Leer's flux-vector splitting techniques, which are considered state of the art. The viscous terms were discretized using a second-order, central-difference operator. Two classes of explicit time integration has been investigated for solving the compressible inviscid/viscous flow problems--two-state predictor-corrector schemes, and multistage time-stepping schemes. The coefficients of the multistage time-stepping schemes have been modified successfully to achieve better performance with upwind differencing. A technique was developed to optimize the coefficients for good high-frequency damping at relatively high CFL numbers. Local time-stepping, implicit residual smoothing, and multigrid procedure were added to the explicit time stepping scheme to accelerate convergence to steady-state. The developed algorithm was implemented successfully in a multi-block code, which provides complete topological and geometric flexibility. The only requirement is C degree continuity of the grid across the block interface. The algorithm has been validated on a diverse set of three-dimensional test cases of increasing complexity. The cases studied were: (1) supersonic corner flow; (2) supersonic plume flow; (3) laminar and turbulent flow over a flat plate; (4) transonic flow over an ONERA M6 wing; and (5) unsteady flow of a compressible jet impinging on a ground plane (with and without cross flow). The emphasis of the test cases was validation of code, and assessment of performance, as well as demonstration of flexibility.

Numerical simulation of the interaction between a flowfield and chemical reaction on premixed pulsed jet combustion

NASA Astrophysics Data System (ADS)

Hishida, Manabu; Hayashi, A. Koichi

1992-12-01

Pulsed Jet Combustion (PJC) is numerically simulated using time-dependent, axisymmetric, full Navier-Stokes equations with the mass, momentum, energy, and species conservation equations for a hydrogen-air mixture. A hydrogen-air reaction mechanism is modeled by nine species and nineteen elementary forward and backward reactions to evaluate the effect of the chemical reactions accurately. A point implicit method with the Harten and Yee's non-MUSCL (Monotone Upstream-centerd Schemes for Conservation Laws) modified-flux type TVD (Total Variation Diminishing) scheme is applied to deal with the stiff partial differential equations. Furthermore, a zonal method making use of the Fortified Solution Algorithm (FSA) is applied to simulate the phenomena in the complicated shape of the sub-chamber. The numerical result shows that flames propagating in the sub-chamber interact with pressure waves and are deformed to be wrinkled like a 'tulip' flame and a jet passed through the orifice changes its mass flux quasi-periodically.

Input filter compensation for switching regulators

NASA Technical Reports Server (NTRS)

Kelkar, S. S.; Lee, F. C.

1983-01-01

A novel input filter compensation scheme for a buck regulator that eliminates the interaction between the input filter output impedance and the regulator control loop is presented. The scheme is implemented using a feedforward loop that senses the input filter state variables and uses this information to modulate the duty cycle signal. The feedforward design process presented is seen to be straightforward and the feedforward easy to implement. Extensive experimental data supported by analytical results show that significant performance improvement is achieved with the use of feedforward in the following performance categories: loop stability, audiosusceptibility, output impedance and transient response. The use of feedforward results in isolating the switching regulator from its power source thus eliminating all interaction between the regulator and equipment upstream. In addition the use of feedforward removes some of the input filter design constraints and makes the input filter design process simpler thus making it possible to optimize the input filter. The concept of feedforward compensation can also be extended to other types of switching regulators.

Rising Intragenerational Occupational Mobility in the United States, 1969 to 2011

PubMed Central

Jarvis, Benjamin F.; Song, Xi

2017-01-01

Despite the theoretical importance of intragenerational mobility and its connection to intergenerational mobility, no study since the 1970s has documented trends in intragenerational occupational mobility. The present article fills this intellectual gap by presenting evidence of an increasing trend in intragenerational mobility in the United States from 1969 to 2011. We decompose the trend using a nested occupational classification scheme that distinguishes between disaggregated micro-classes and progressively more aggregated meso-classes, macro-classes, and manual and nonmanual sectors. Log-linear analysis reveals that mobility increased across the occupational structure at nearly all levels of aggregation, especially after the early 1990s. Controlling for structural changes in occupational distributions modifies, but does not substantially alter, these findings. Trends are qualitatively similar for men and women. We connect increasing mobility to other macro-economic trends dating back to the 1970s, including changing labor force composition, technologies, employment relations, and industrial structures. We reassert the sociological significance of intragenerational mobility and discuss how increasing variability in occupational transitions within careers may counteract or mask trends in intergenerational mobility, across occupations and across more broadly construed social classes. PMID:28966346

Random access to mobile networks with advanced error correction

NASA Technical Reports Server (NTRS)

Dippold, Michael

1990-01-01

A random access scheme for unreliable data channels is investigated in conjunction with an adaptive Hybrid-II Automatic Repeat Request (ARQ) scheme using Rate Compatible Punctured Codes (RCPC) Forward Error Correction (FEC). A simple scheme with fixed frame length and equal slot sizes is chosen and reservation is implicit by the first packet transmitted randomly in a free slot, similar to Reservation Aloha. This allows the further transmission of redundancy if the last decoding attempt failed. Results show that a high channel utilization and superior throughput can be achieved with this scheme that shows a quite low implementation complexity. For the example of an interleaved Rayleigh channel and soft decision utilization and mean delay are calculated. A utilization of 40 percent may be achieved for a frame with the number of slots being equal to half the station number under high traffic load. The effects of feedback channel errors and some countermeasures are discussed.

Analysis and performance assessment of a fragment retransmission scheme for energy efficient IEEE 802.11 WLANs.

PubMed

Mafole, Prosper; Aritsugi, Masayoshi

2016-01-01

Backoff-free fragment retransmission (BFFR) scheme enhances the performance of legacy MAC layer fragmentation by eliminating contention overhead. The eliminated overhead is the result of backoff executed before a retransmission attempt is made when fragment transmission failure occurs within a fragment burst. This paper provides a mathematical analysis of BFFR energy efficiency and further assesses, by means of simulations, the energy efficiency, throughput and delay obtained when BFFR is used. The validity of the new scheme is evaluated in different scenarios namely, constant bit rate traffic, realistic bursty internet traffic, node mobility, rigid and elastic flows and their combinations at different traffic loads. We also evaluate and discuss the impact of BFFR on MAC fairness when the number of nodes is varied from 4 to 10. It is shown that BFFR has advantages over legacy MAC fragmentation scheme in all the scenarios.

Ultra-precision fabrication of high density micro-optical backbone interconnections for data center and mobile application

NASA Astrophysics Data System (ADS)

Lohmann, U.; Jahns, J.; Wagner, T.; Werner, C.

2012-10-01

A microoptical 3D interconnection scheme and fabricated samples of this fiberoptical multi-channel interconnec- tion with an actual capacity of 144 channels were shown. Additionally the aspects of micrometer-fabrication of such microoptical interconnection modules in the view of alignment-tolerances were considered. For the realiza- tion of the interconnection schemes, the approach of planar-integrated free space optics (PIFSO) is used with its well known advantages. This approach offers the potential for complex interconnectivity, and yet compact size.

A Latency and Coverage Optimized Data Collection Scheme for Smart Cities Based on Vehicular Ad-Hoc Networks

PubMed Central

Xu, Yixuan; Chen, Xi; Liu, Anfeng; Hu, Chunhua

2017-01-01

Using mobile vehicles as “data mules” to collect data generated by a huge number of sensing devices that are widely spread across smart city is considered to be an economical and effective way of obtaining data about smart cities. However, currently most research focuses on the feasibility of the proposed methods instead of their final performance. In this paper, a latency and coverage optimized data collection (LCODC) scheme is proposed to collect data on smart cities through opportunistic routing. Compared with other schemes, the efficiency of data collection is improved since the data flow in LCODC scheme consists of not only vehicle to device transmission (V2D), but also vehicle to vehicle transmission (V2V). Besides, through data mining on patterns hidden in the smart city, waste and redundancy in the utilization of public resources are mitigated, leading to the easy implementation of our scheme. In detail, no extra supporting device is needed in the LCODC scheme to facilitate data transmission. A large-scale and real-world dataset on Beijing is used to evaluate the LCODC scheme. Results indicate that with very limited costs, the LCODC scheme enables the average latency to decrease from several hours to around 12 min with respect to schemes where V2V transmission is disabled while the coverage rate is able to reach over 30%. PMID:28420218

A Latency and Coverage Optimized Data Collection Scheme for Smart Cities Based on Vehicular Ad-hoc Networks.

PubMed

Xu, Yixuan; Chen, Xi; Liu, Anfeng; Hu, Chunhua

2017-04-18

Using mobile vehicles as "data mules" to collect data generated by a huge number of sensing devices that are widely spread across smart city is considered to be an economical and effective way of obtaining data about smart cities. However, currently most research focuses on the feasibility of the proposed methods instead of their final performance. In this paper, a latency and coverage optimized data collection (LCODC) scheme is proposed to collect data on smart cities through opportunistic routing. Compared with other schemes, the efficiency of data collection is improved since the data flow in LCODC scheme consists of not only vehicle to device transmission (V2D), but also vehicle to vehicle transmission (V2V). Besides, through data mining on patterns hidden in the smart city, waste and redundancy in the utilization of public resources are mitigated, leading to the easy implementation of our scheme. In detail, no extra supporting device is needed in the LCODC scheme to facilitate data transmission. A large-scale and real-world dataset on Beijing is used to evaluate the LCODC scheme. Results indicate that with very limited costs, the LCODC scheme enables the average latency to decrease from several hours to around 12 min with respect to schemes where V2V transmission is disabled while the coverage rate is able to reach over 30%.

Many-Body Localization and Quantum Nonergodicity in a Model with a Single-Particle Mobility Edge.

PubMed

Li, Xiaopeng; Ganeshan, Sriram; Pixley, J H; Das Sarma, S

2015-10-30

We investigate many-body localization in the presence of a single-particle mobility edge. By considering an interacting deterministic model with an incommensurate potential in one dimension we find that the single-particle mobility edge in the noninteracting system leads to a many-body mobility edge in the corresponding interacting system for certain parameter regimes. Using exact diagonalization, we probe the mobility edge via energy resolved entanglement entropy (EE) and study the energy resolved applicability (or failure) of the eigenstate thermalization hypothesis (ETH). Our numerical results indicate that the transition separating area and volume law scaling of the EE does not coincide with the nonthermal to thermal transition. Consequently, there exists an extended nonergodic phase for an intermediate energy window where the many-body eigenstates violate the ETH while manifesting volume law EE scaling. We also establish that the model possesses an infinite temperature many-body localization transition despite the existence of a single-particle mobility edge. We propose a practical scheme to test our predictions in atomic optical lattice experiments which can directly probe the effects of the mobility edge.

An Improved Cross-Layering Design for IPv6 Fast Handover with IEEE 802.16m Entry Before Break Handover

NASA Astrophysics Data System (ADS)

Kim, Ronny Yongho; Jung, Inuk; Kim, Young Yong

IEEE 802.16m is an advanced air interface standard which is under development for IMT-Advanced systems, known as 4G systems. IEEE 802.16m is designed to provide a high data rate and a Quality of Service (QoS) level in order to meet user service requirements, and is especially suitable for mobilized environments. There are several factors that have great impact on such requirements. As one of the major factors, we mainly focus on latency issues. In IEEE 802.16m, an enhanced layer 2 handover scheme, described as Entry Before Break (EBB) was proposed and adopted to reduce handover latency. EBB provides significant handover interruption time reduction with respect to the legacy IEEE 802.16 handover scheme. Fast handovers for mobile IPv6 (FMIPv6) was standardized by Internet Engineering Task Force (IETF) in order to provide reduced handover interruption time from IP layer perspective. Since FMIPv6 utilizes link layer triggers to reduce handover latency, it is very critical to jointly design FMIPv6 with its underlying link layer protocol. However, FMIPv6 based on new handover scheme, EBB has not been proposed. In this paper, we propose an improved cross-layering design for FMIPv6 based on the IEEE 802.16m EBB handover. In comparison with the conventional FMIPv6 based on the legacy IEEE 802.16 network, the overall handover interruption time can be significantly reduced by employing the proposed design. Benefits of this improvement on latency reduction for mobile user applications are thoroughly investigated with both numerical analysis and simulation on various IP applications.

Untreated urban waste contaminates Indian river sediments with resistance genes to last resort antibiotics.

PubMed

Marathe, Nachiket P; Pal, Chandan; Gaikwad, Swapnil S; Jonsson, Viktor; Kristiansson, Erik; Larsson, D G Joakim

2017-11-01

Efficient sewage treatment is critical for limiting environmental transmission of antibiotic-resistant bacteria. In many low and middle income countries, however, large proportions of sewage are still released untreated into receiving water bodies. In-depth knowledge of how such discharges of untreated urban waste influences the environmental resistome is largely lacking. Here, we highlight the impact of uncontrolled discharge of partially treated and/or untreated wastewater on the structure of bacterial communities and resistome of sediments collected from Mutha river flowing through Pune city in India. Using shotgun metagenomics, we found a wide array (n = 175) of horizontally transferable antibiotic resistance genes (ARGs) including carbapenemases such as NDM, VIM, KPC, OXA-48 and IMP types. The relative abundance of total ARGs was 30-fold higher in river sediments within the city compared to upstream sites. Forty four ARGs, including the tet(X) gene conferring resistance to tigecycline, OXA-58 and GES type carbapenemases, were significantly more abundant in city sediments, while two ARGs were more common at upstream sites. The recently identified mobile colistin resistance gene mcr-1 was detected only in one of the upstream samples, but not in city samples. In addition to ARGs, higher abundances of various mobile genetic elements were found in city samples, including integron-associated integrases and ISCR transposases, as well as some biocide/metal resistance genes. Virulence toxin genes as well as bacterial genera comprising many pathogens were more abundant here; the genus Acinetobacter, which is often associated with multidrug resistance and nosocomial infections, comprised up to 29% of the 16S rRNA reads, which to our best knowledge is unmatched in any other deeply sequenced metagenome. There was a strong correlation between the abundance of Acinetobacter and the OXA-58 carbapenemase gene. Our study shows that uncontrolled discharge of untreated urban waste can contribute to an overall increase of the abundance and diversity of ARGs in the environment, including those conferring resistance to last-resort antibiotics. Copyright © 2017 Elsevier Ltd. All rights reserved.

Modeling the Effect of Wetlands, Flooding, and Irrigation on River Flow: Application to the Aral Sea

NASA Technical Reports Server (NTRS)

Ferrari, Michael R.; Miller, James R.; Russell, Gary L.

1999-01-01

As the world's population continues to increase, additional stress is placed on water resources. This stress, coupled with future uncertainties regarding climate change, makes arid and semi-arid regions particularly vulnerable. One example is the Aral Sea where the freshwater inflow, which is dominated by snowmelt runoff, has decreased significantly since the expansion of intensive irrigation in the 1960s. The purpose of this paper is to use a river routing scheme from a global climate model to examine the flow of the Amu Dar'ya River into the Aral Sea. The river routing scheme is modified to include groundwater flow, flooding, and evaporative losses in the river's wetlands and floodplain, and anthropogenic withdrawals for irrigation. A set of scenarios is designed to test the sensitivity of river flow to the inclusion of these modifications into the river routing scheme. When riverine wetlands and floodplains are present, the river flow is reduced significantly and is similar to the observed flow. In addition the model results show that it is essential to incorporate human diversions to accurately represent the inflow to the Aral Sea, and they also indicate potential management strategies that might be appropriate to maintain a balance between inflow to the Sea and upstream diversions for irrigation.

Two-dimensional CFD modeling of wave rotor flow dynamics

NASA Technical Reports Server (NTRS)

Welch, Gerard E.; Chima, Rodrick V.

1994-01-01

A two-dimensional Navier-Stokes solver developed for detailed study of wave rotor flow dynamics is described. The CFD model is helping characterize important loss mechanisms within the wave rotor. The wave rotor stationary ports and the moving rotor passages are resolved on multiple computational grid blocks. The finite-volume form of the thin-layer Navier-Stokes equations with laminar viscosity are integrated in time using a four-stage Runge-Kutta scheme. Roe's approximate Riemann solution scheme or the computationally less expensive advection upstream splitting method (AUSM) flux-splitting scheme is used to effect upwind-differencing of the inviscid flux terms, using cell interface primitive variables set by MUSCL-type interpolation. The diffusion terms are central-differenced. The solver is validated using a steady shock/laminar boundary layer interaction problem and an unsteady, inviscid wave rotor passage gradual opening problem. A model inlet port/passage charging problem is simulated and key features of the unsteady wave rotor flow field are identified. Lastly, the medium pressure inlet port and high pressure outlet port portion of the NASA Lewis Research Center experimental divider cycle is simulated and computed results are compared with experimental measurements. The model accurately predicts the wave timing within the rotor passages and the distribution of flow variables in the stationary inlet port region.

Two-dimensional CFD modeling of wave rotor flow dynamics

NASA Technical Reports Server (NTRS)

Welch, Gerard E.; Chima, Rodrick V.

1993-01-01

A two-dimensional Navier-Stokes solver developed for detailed study of wave rotor flow dynamics is described. The CFD model is helping characterize important loss mechanisms within the wave rotor. The wave rotor stationary ports and the moving rotor passages are resolved on multiple computational grid blocks. The finite-volume form of the thin-layer Navier-Stokes equations with laminar viscosity are integrated in time using a four-stage Runge-Kutta scheme. The Roe approximate Riemann solution scheme or the computationally less expensive Advection Upstream Splitting Method (AUSM) flux-splitting scheme are used to effect upwind-differencing of the inviscid flux terms, using cell interface primitive variables set by MUSCL-type interpolation. The diffusion terms are central-differenced. The solver is validated using a steady shock/laminar boundary layer interaction problem and an unsteady, inviscid wave rotor passage gradual opening problem. A model inlet port/passage charging problem is simulated and key features of the unsteady wave rotor flow field are identified. Lastly, the medium pressure inlet port and high pressure outlet port portion of the NASA Lewis Research Center experimental divider cycle is simulated and computed results are compared with experimental measurements. The model accurately predicts the wave timing within the rotor passage and the distribution of flow variables in the stationary inlet port region.

Modeling the effect of wetlands, flooding, and irrigation on river flow: Application to the Aral Sea

NASA Astrophysics Data System (ADS)

Ferrari, Michael R.; Miller, James R.; Russell, Gary L.

1999-06-01

As the world's population continues to increase, additional stress is placed on water resources. This stress, coupled with future uncertainties regarding climate change, makes arid and semiarid regions particularly vulnerable. One example is the Aral Sea where the freshwater inflow, which is dominated by snowmelt runoff, has decreased significantly since the expansion of intensive irrigation in the 1960s. The purpose of this paper is to use a river routing scheme from a global climate model to examine the flow of the Amu Dar'ya River into the Aral Sea. The river routing scheme is modified to include groundwater flow, flooding, and evaporative losses in the river's wetlands and floodplain and anthropogenic withdrawals for irrigation. A set of scenarios is designed to test the sensitivity of river flow to the inclusion of these modifications into the river routing scheme. When riverine wetlands and floodplains are present, the river flow is reduced significantly and is similar to the observed flow. In addition, the model results show that it is essential to incorporate human diversions to represent accurately the inflow to the Aral Sea, and they also indicate potential management strategies that might be appropriate to maintain a balance between inflow to the sea and upstream diversions for irrigation.

Traverse Focusing of Intense Charged Particle Beams with Chromatic Effects for Heavy Ion Fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

James M. Mitrani, Igor D. Kaganovich, Ronald C. Davidson

A fi nal focusing scheme designed to minimize chromatic effects is discussed. The Neutralized Drift Compression Experiment-II (NDCX-II) will apply a velocity tilt for longitudinal bunch compression, and a fi nal focusing solenoid (FFS) for transverse bunch compression. In the beam frame, neutralized drift compression causes a suffi ciently large spread in axial momentum, pz , resulting in chromatic effects to the fi nal focal spot during transverse bunch compression. Placing a weaker solenoid upstream of a stronger fi nal focusing solenoid (FFS) mitigates chromatic effects and improves transverse focusing by a factor of approximately 2-4 for appropriate NDCX-II parameters.

A Comprehensive Ubiquitous Healthcare Solution on an Android™ Mobile Device

PubMed Central

Hii, Pei-Cheng; Chung, Wan-Young

2011-01-01

Provision of ubiquitous healthcare solutions which provide healthcare services at anytime anywhere has become more favorable nowadays due to the emphasis on healthcare awareness and also the growth of mobile wireless technologies. Following this approach, an Android™ smart phone device is proposed as a mobile monitoring terminal to observe and analyze ECG (electrocardiography) waveforms from wearable ECG devices in real time under the coverage of a wireless sensor network (WSN). The exploitation of WSN in healthcare is able to substitute the complicated wired technology, moving healthcare away from a fixed location setting. As an extension to the monitoring scheme, medicine care is taken into consideration by utilizing the mobile phone as a barcode decoder, to verify and assist out-patients in the medication administration process, providing a better and more comprehensive healthcare service. PMID:22163986

Localization with a mobile beacon in underwater acoustic sensor networks.

PubMed

Lee, Sangho; Kim, Kiseon

2012-01-01

Localization is one of the most important issues associated with underwater acoustic sensor networks, especially when sensor nodes are randomly deployed. Given that it is difficult to deploy beacon nodes at predetermined locations, localization schemes with a mobile beacon on the sea surface or along the planned path are inherently convenient, accurate, and energy-efficient. In this paper, we propose a new range-free Localization with a Mobile Beacon (LoMoB). The mobile beacon periodically broadcasts a beacon message containing its location. Sensor nodes are individually localized by passively receiving the beacon messages without inter-node communications. For location estimation, a set of potential locations are obtained as candidates for a node's location and then the node's location is determined through the weighted mean of all the potential locations with the weights computed based on residuals.

Localization with a Mobile Beacon in Underwater Acoustic Sensor Networks

PubMed Central

Lee, Sangho; Kim, Kiseon

2012-01-01

Localization is one of the most important issues associated with underwater acoustic sensor networks, especially when sensor nodes are randomly deployed. Given that it is difficult to deploy beacon nodes at predetermined locations, localization schemes with a mobile beacon on the sea surface or along the planned path are inherently convenient, accurate, and energy-efficient. In this paper, we propose a new range-free Localization with a Mobile Beacon (LoMoB). The mobile beacon periodically broadcasts a beacon message containing its location. Sensor nodes are individually localized by passively receiving the beacon messages without inter-node communications. For location estimation, a set of potential locations are obtained as candidates for a node's location and then the node's location is determined through the weighted mean of all the potential locations with the weights computed based on residuals. PMID:22778597

Community mobilization and empowerment for health.

PubMed

Saludung, D

1997-01-01

The present article traces the history of "dana sehat", a scheme of social funding devised in Indonesia three decades ago which has proved to be of particular significance as a means of inducing communities to accept responsibility for decision-making on the development of health care.

DE-Sync: A Doppler-Enhanced Time Synchronization for Mobile Underwater Sensor Networks.

PubMed

Zhou, Feng; Wang, Qi; Nie, DongHu; Qiao, Gang

2018-05-25

Time synchronization is the foundation of cooperative work among nodes of underwater sensor networks; it takes a critical role in the research and application of underwater sensor networks. Although numerous time synchronization protocols have been proposed for terrestrial wireless sensor networks, they cannot be directly applied to underwater sensor networks. This is because most of them typically assume that the propagation delay among sensor nodes is negligible, which is not the case in underwater sensor networks. Time synchronization is mainly affected by a long propagation delay among sensor nodes due to the low propagation speed of acoustic signals. Furthermore, sensor nodes in underwater tend to experience some degree of mobility due to wind or ocean current, or some other nodes are on self-propelled vehicles, such as autonomous underwater vehicles (AUVs). In this paper, we propose a Doppler-enhanced time synchronization scheme for mobile underwater sensor networks, called DE-Sync. Our new scheme considers the effect of the clock skew during the process of estimating the Doppler scale factor and directly substitutes the Doppler scale factor into linear regression to achieve the estimation of the clock skew and offset. Simulation results show that DE-Sync outperforms existing time synchronization protocols in both accuracy and energy efficiency.

A Computer Clone of Human Expert for Mobility Management Scheme (E-MMS): Step toward Green Transportation

NASA Astrophysics Data System (ADS)

Resdiansyah; O. K Rahmat, R. A.; Ismail, A.

2018-03-01

Green transportation refers to a sustainable transport that gives the least impact in terms of social and environmental but at the same time is able to supply energy sources globally that includes non-motorized transport strategies deployment to promote healthy lifestyles, also known as Mobility Management Scheme (MMS). As construction of road infrastructure cannot help solve the problem of congestion, past research has shown that MMS is an effective measure to mitigate congestion and to achieve green transportation. MMS consists of different strategies and policies that subdivided into categories according to how they are able to influence travel behaviour. Appropriate selection of mobility strategies will ensure its effectiveness in mitigating congestion problems. Nevertheless, determining appropriate strategies requires human expert and depends on a number of success factors. This research has successfully developed a computer clone system based on human expert, called E-MMS. The process of knowledge acquisition for MMS strategies and the next following process to selection of strategy has been encode in a knowledge-based system using a shell expert system. The newly developed computer cloning system was successfully verified, validated and evaluated (VV&E) by comparing the result output with the real transportation expert recommendation in which the findings suggested Introduction

Patients’ Data Management System Protected by Identity-Based Authentication and Key Exchange

PubMed Central

Rivero-García, Alexandra; Santos-González, Iván; Hernández-Goya, Candelaria; Caballero-Gil, Pino; Yung, Moti

2017-01-01

A secure and distributed framework for the management of patients’ information in emergency and hospitalization services is proposed here in order to seek improvements in efficiency and security in this important area. In particular, confidentiality protection, mutual authentication, and automatic identification of patients are provided. The proposed system is based on two types of devices: Near Field Communication (NFC) wristbands assigned to patients, and mobile devices assigned to medical staff. Two other main elements of the system are an intermediate server to manage the involved data, and a second server with a private key generator to define the information required to protect communications. An identity-based authentication and key exchange scheme is essential to provide confidential communication and mutual authentication between the medical staff and the private key generator through an intermediate server. The identification of patients is carried out through a keyed-hash message authentication code. Thanks to the combination of the aforementioned tools, a secure alternative mobile health (mHealth) scheme for managing patients’ data is defined for emergency and hospitalization services. Different parts of the proposed system have been implemented, including mobile application, intermediate server, private key generator and communication channels. Apart from that, several simulations have been performed, and, compared with the current system, significant improvements in efficiency have been observed. PMID:28362328

Patients' Data Management System Protected by Identity-Based Authentication and Key Exchange.

PubMed

Rivero-García, Alexandra; Santos-González, Iván; Hernández-Goya, Candelaria; Caballero-Gil, Pino; Yung, Moti

2017-03-31

A secure and distributed framework for the management of patients' information in emergency and hospitalization services is proposed here in order to seek improvements in efficiency and security in this important area. In particular, confidentiality protection, mutual authentication, and automatic identification of patients are provided. The proposed system is based on two types of devices: Near Field Communication (NFC) wristbands assigned to patients, and mobile devices assigned to medical staff. Two other main elements of the system are an intermediate server to manage the involved data, and a second server with a private key generator to define the information required to protect communications. An identity-based authentication and key exchange scheme is essential to provide confidential communication and mutual authentication between the medical staff and the private key generator through an intermediate server. The identification of patients is carried out through a keyed-hash message authentication code. Thanks to the combination of the aforementioned tools, a secure alternative mobile health (mHealth) scheme for managing patients' data is defined for emergency and hospitalization services. Different parts of the proposed system have been implemented, including mobile application, intermediate server, private key generator and communication channels. Apart from that, several simulations have been performed, and, compared with the current system, significant improvements in efficiency have been observed.

An Obstacle-Tolerant Path Planning Algorithm for Mobile-Anchor-Node-Assisted Localization

PubMed Central

Tsai, Rong-Guei

2018-01-01

The location information obtained using a sensor is a critical requirement in wireless sensor networks. Numerous localization schemes have been proposed, among which mobile-anchor-node-assisted localization (MANAL) can reduce costs and overcome environmental constraints. A mobile anchor node (MAN) provides its own location information to assist the localization of sensor nodes. Numerous path planning schemes have been proposed for MANAL, but most scenarios assume the absence of obstacles in the environment. However, in a realistic environment, sensor nodes cannot be located because the obstacles block the path traversed by the MAN, thereby rendering the sensor incapable of receiving sufficient three location information from the MAN. This study proposes the obstacle-tolerant path planning (OTPP) approach to solve the sensor location problem owing to obstacle blockage. OTPP can approximate the optimum beacon point number and path planning, thereby ensuring that all the unknown nodes can receive the three location information from the MAN and reduce the number of MAN broadcast packet times. Experimental results demonstrate that OTPP performs better than Z-curves because it reduces the total number of beacon points utilized and is thus more suitable in an obstacle-present environment. Compared to the Z-curve, OTPP can reduce localization error and improve localization coverage. PMID:29547582

Terahertz cyclotron resonance spectroscopy of an AlGaN/GaN heterostructure using a high-field pulsed magnet and an asynchronous optical sampling technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spencer, B. F., E-mail: Ben.Spencer@manchester.ac.uk; Smith, W. F.; Hibberd, M. T.

2016-05-23

The effective mass, sheet carrier concentration, and mobility of electrons within a two-dimensional electron gas in an AlGaN/GaN heterostructure were determined using a laboratory-based terahertz cyclotron resonance spectrometer. The ability to perform terahertz cyclotron resonance spectroscopy with magnetic fields of up to 31 T was enabled by combining a high-field pulsed magnet with a modified asynchronous optical sampling terahertz detection scheme. This scheme allowed around 100 transmitted terahertz waveforms to be recorded over the 14 ms magnetic field pulse duration. The sheet density and mobility were measured to be 8.0 × 10{sup 12 }cm{sup −2} and 9000 cm{sup 2} V{sup −1} s{sup −1} at 77 K. The in-planemore » electron effective mass at the band edge was determined to be 0.228 ± 0.002m{sub 0}.« less

Metal-interconnection-free integration of InGaN/GaN light emitting diodes with AlGaN/GaN high electron mobility transistors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Chao; Cai, Yuefei; Liu, Zhaojun

2015-05-04

We report a metal-interconnection-free integration scheme for InGaN/GaN light emitting diodes (LEDs) and AlGaN/GaN high electron mobility transistors (HEMTs) by combining selective epi removal (SER) and selective epitaxial growth (SEG) techniques. SER of HEMT epi was carried out first to expose the bottom unintentionally doped GaN buffer and the sidewall GaN channel. A LED structure was regrown in the SER region with the bottom n-type GaN layer (n-electrode of the LED) connected to the HEMTs laterally, enabling monolithic integration of the HEMTs and LEDs (HEMT-LED) without metal-interconnection. In addition to saving substrate real estate, minimal interface resistance between the regrownmore » n-type GaN and the HEMT channel is a significant improvement over metal-interconnection. Furthermore, excellent off-state leakage characteristics of the driving transistor can also be guaranteed in such an integration scheme.« less

Decentralized reinforcement-learning control and emergence of motion patterns

NASA Astrophysics Data System (ADS)

Svinin, Mikhail; Yamada, Kazuyaki; Okhura, Kazuhiro; Ueda, Kanji

1998-10-01

In this paper we propose a system for studying emergence of motion patterns in autonomous mobile robotic systems. The system implements an instance-based reinforcement learning control. Three spaces are of importance in formulation of the control scheme. They are the work space, the sensor space, and the action space. Important feature of our system is that all these spaces are assumed to be continuous. The core part of the system is a classifier system. Based on the sensory state space analysis, the control is decentralized and is specified at the lowest level of the control system. However, the local controllers are implicitly connected through the perceived environment information. Therefore, they constitute a dynamic environment with respect to each other. The proposed control scheme is tested under simulation for a mobile robot in a navigation task. It is shown that some patterns of global behavior--such as collision avoidance, wall-following, light-seeking--can emerge from the local controllers.

[Wound information management system: a standardized scheme for acquisition, storage and management of wound information].

PubMed

Liu, Hu; Su, Rong-jia; Wu, Min-jie; Zhang, Yi; Qiu, Xiang-jun; Feng, Jian-gang; Xie, Ting; Lu, Shu-liang

2012-06-01

To form a wound information management scheme with objectivity, standardization, and convenience by means of wound information management system. A wound information management system was set up with the acquisition terminal, the defined wound description, the data bank, and related softwares. The efficacy of this system was evaluated in clinical practice. The acquisition terminal was composed of the third generation mobile phone and the software. It was feasible to get access to the wound information, including description, image, and therapeutic plan from the data bank by mobile phone. During 4 months, a collection of a total of 232 wound treatment information was entered, and accordingly standardized data of 38 patients were formed automatically. This system can provide standardized wound information management by standardized techniques of acquisition, transmission, and storage of wound information. It can be used widely in hospitals, especially primary medical institutions. Data resource of the system makes it possible for epidemiological study with large sample size in future.

A distributed scheme to manage the dynamic coexistence of IEEE 802.15.4-based health-monitoring WBANs.

PubMed

Deylami, Mohammad N; Jovanov, Emil

2014-01-01

The overlap of transmission ranges between wireless networks as a result of mobility is referred to as dynamic coexistence. The interference caused by coexistence may significantly affect the performance of wireless body area networks (WBANs) where reliability is particularly critical for health monitoring applications. In this paper, we analytically study the effects of dynamic coexistence on the operation of IEEE 802.15.4-based health monitoring WBANs. The current IEEE 802.15.4 standard lacks mechanisms for effectively managing the coexistence of mobile WBANs. Considering the specific characteristics and requirements of health monitoring WBANs, we propose the dynamic coexistence management (DCM) mechanism to make IEEE 802.15.4-based WBANs able to detect and mitigate the harmful effects of coexistence. We assess the effectiveness of this scheme using extensive OPNET simulations. Our results indicate that DCM improves the successful transmission rates of dynamically coexisting WBANs by 20%-25% for typical medical monitoring applications.

A new coherent demodulation technique for land-mobile satellite communications

NASA Technical Reports Server (NTRS)

Yoshida, Shousei; Tomita, Hideho

1990-01-01

An advanced coherent demodulation technique is described for land mobile satellite (LMS) communications. The proposed technique features a combined narrow/wind band dual open loop carrier phase estimator, which is effectively able to compensate the fast carrier phase fluctuation by fading with sacrificing a phase slip rate. Also included is the realization of quick carrier and clock reacquisition after shadowing by taking open loop structure. Its bit error rate (BER) performance is superior to that of existing detection schemes, showing a BER of 1 x 10(exp -2) at 6.3 dB E sub b/N sub o over the Rician channel with 10 dB C/M and 200 Hz (1/16 modulation rate) fading pitch f sub d for QPSK. The proposed scheme consists of a fast response carrier recovery and a quick bit timing recovery with an interpolation. An experimental terminal model was developed to evaluate its performance at fading conditions. The results are quite satisfactory, giving prospects for future LMS applications.

A Secure Mobile-Based Authentication System for e-Banking

NASA Astrophysics Data System (ADS)

Rifà-Pous, Helena

Financial information is extremely sensitive. Hence, electronic banking must provide a robust system to authenticate its customers and let them access their data remotely. On the other hand, such system must be usable, affordable, and portable. We propose a challenge-response based one-time password (OTP) scheme that uses symmetric cryptography in combination with a hardware security module. The proposed protocol safeguards passwords from keyloggers and phishing attacks. Besides, this solution provides convenient mobility for users who want to bank online anytime and anywhere, not just from their own trusted computers.

On-board multicarrier demodulator for mobile applications using DSP implementation

NASA Astrophysics Data System (ADS)

Yim, W. H.; Kwan, C. C. D.; Coakley, F. P.; Evans, B. G.

1990-11-01

This paper describes the design and implementation of an on-board multicarrier demodulator using commercial digital signal processors. This is for use in a mobile satellite communication system employing an up-link SCPC/FDMA scheme. Channels are separated by a flexible multistage digital filter bank followed by a channel multiplexed digital demodulator array. The cross/dot product design approach of error detector leads to a new QPSK frequency control algorithm that allows fast acquisition without special preamble pattern. Timing correction is performed digitally using an extended stack of polyphase sub-filters.

Enhanced Handoff Scheme for Downlink-Uplink Asymmetric Channels in Cellular Systems

PubMed Central

2013-01-01

In the latest cellular networks, data services like SNS and UCC can create asymmetric packet generation rates over the downlink and uplink channels. This asymmetry can lead to a downlink-uplink asymmetric channel condition being experienced by cell edge users. This paper proposes a handoff scheme to cope effectively with downlink-uplink asymmetric channels. The proposed handoff scheme exploits the uplink channel quality as well as the downlink channel quality to determine the appropriate timing and direction of handoff. We first introduce downlink and uplink channel models that consider the intercell interference, to verify the downlink-uplink channel asymmetry. Based on these results, we propose an enhanced handoff scheme that exploits both the uplink and downlink channel qualities to reduce the handoff-call dropping probability and the service interruption time. The simulation results show that the proposed handoff scheme reduces the handoff-call dropping probability about 30% and increases the satisfaction of the service interruption time requirement about 7% under high-offered load, compared to conventional mobile-assisted handoff. Especially, the proposed handoff scheme is more efficient when the uplink QoS requirement is much stricter than the downlink QoS requirement or uplink channel quality is worse than downlink channel quality. PMID:24501576

Electrorecycling of Critical and Value Metals from Mobile Electronics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tedd E. Lister; Peming Wang; Andre Anderko

2014-09-01

Mobile electronic devices such as smart phones and tablets are a significant source of valuable metals that should be recycled. Each year over a billion devices are sold world-wide and the average life is only a couple years. Value metals in phones are gold, palladium, silver, copper, cobalt and nickel. Devices now contain increasing amounts of rare earth elements (REE). In recent years the supply chain for REE has moved almost exclusively to China. They are contained in displays, speakers and vibrators within the devices. By US Department of Energy (DOE) classification, specific REEs (Nd, Dy, Eu, Tb and Y)more » are considered critical while others (Ce, La and Pr) are deemed near critical. Effective recycling schemes should include the recovery of these critical materials. By including more value materials in a recovery scheme, more value can be obtained by product diversification and less waste metals remains to be disposed of. REEs are mined as a group such that when specific elements become critical significantly more ore must be processed to capture the dilute but valuable critical elements. Targeted recycling of items containing the more of the less available critical materials could address their future criticality. This presentation will describe work in developing aqueous electrochemistry-based schemes for recycling metals from scrap mobile electronics. The electrorecycling process generates oxidizing agents at an anode while reducing dissolved metals at the cathode. E vs pH diagrams and metals dissolution experiments are used to assess effectiveness of various solution chemistries. Although several schemes were envisioned, a two stages process has been the focus of work: 1) initial dissolution of Cu, Sn, Ag and magnet materials using Fe+3 generated in acidic sulfate and 2) final dissolution of Pd and Au using Cl2 generated in an HCl solution. Experiments were performed using simulated metal mixtures. Both Cu and Ag were recovered at ~ 97% using Fe+3 while leaving Au and Ag intact. REE were extracted from the dissolved mixture using conventional methods. A discussion of future research directions will be discussed.« less

A model of water and sediment balance as determinants of relative sea level rise in contemporary and future deltas

NASA Astrophysics Data System (ADS)

Tessler, Zachary D.; Vörösmarty, Charles J.; Overeem, Irina; Syvitski, James P. M.

2018-03-01

Modern deltas are dependent on human-mediated freshwater and sediment fluxes. Changes to these fluxes impact delta biogeophysical functioning and affect the long-term sustainability of these landscapes for human and for natural systems. Here we present contemporary estimates of long-term mean sediment balance and relative sea level rise across 46 global deltas. We model scenarios of contemporary and future water resource management schemes and hydropower infrastructure in upstream river basins to explore how changing sediment fluxes impact relative sea level rise in delta systems. Model results show that contemporary sediment fluxes, anthropogenic drivers of land subsidence, and sea level rise result in delta relative sea level rise rates that average 6.8 mm/y. Assessment of impacts of planned and under-construction dams on relative sea level rise rates suggests increases on the order of 1 mm/y in deltas with new upstream construction. Sediment fluxes are estimated to decrease by up to 60% in the Danube and 21% in the Ganges-Brahmaputra-Meghna if all currently planned dams are constructed. Reduced sediment retention on deltas caused by increased river channelization and management has a larger impact, increasing relative sea level rise on average by nearly 2 mm/y. Long-term delta sustainability requires a more complete understanding of how geophysical and anthropogenic change impact delta geomorphology. Local and regional strategies for sustainable delta management that focus on local and regional drivers of change, especially groundwater and hydrocarbon extraction and upstream dam construction, can be highly impactful even in the context of global climate-induced sea level rise.

Dynamic clustering scheme based on the coordination of management and control in multi-layer and multi-region intelligent optical network

NASA Astrophysics Data System (ADS)

Niu, Xiaoliang; Yuan, Fen; Huang, Shanguo; Guo, Bingli; Gu, Wanyi

2011-12-01

A Dynamic clustering scheme based on coordination of management and control is proposed to reduce network congestion rate and improve the blocking performance of hierarchical routing in Multi-layer and Multi-region intelligent optical network. Its implement relies on mobile agent (MA) technology, which has the advantages of efficiency, flexibility, functional and scalability. The paper's major contribution is to adjust dynamically domain when the performance of working network isn't in ideal status. And the incorporation of centralized NMS and distributed MA control technology migrate computing process to control plane node which releases the burden of NMS and improves process efficiently. Experiments are conducted on Multi-layer and multi-region Simulation Platform for Optical Network (MSPON) to assess the performance of the scheme.

A Proposed Change to ITU-R Recommendation 681

NASA Technical Reports Server (NTRS)

Davarian, F.

1996-01-01

Recommendation 681 of the International Telecommunications Union (ITU) provides five models for the prediction of propagation effects on land mobile satellite links: empirical roadside shadowing (ERS), attenuation frequency scaling, fade duration distribution, non-fade duration distribution, and fading due to multipath. Because the above prediction models have been empirically derived using a limited amount of data, these schemes work only for restricted ranges of link parameters. With the first two models, for example, the frequency and elevation angle parameters are restricted to 0.8 to 2.7 GHz and 20 to 60 degrees, respectively. Recently measured data have enabled us to enhance the range of the first two schemes. Moreover, for convenience, they have been combined into a single scheme named the extended empirical roadside shadowing (EERS) model.

Mobility-Enhanced Reliable Geographical Forwarding in Cognitive Radio Sensor Networks.

PubMed

Zubair, Suleiman; Syed Yusoff, Sharifah Kamilah; Fisal, Norsheila

2016-01-29

The emergence of the Internet of Things and the proliferation of mobile wireless devices has brought the area of mobile cognitive radio sensor networks (MCRSN) to the research spot light. Notwithstanding the potentials of CRSNs in terms of opportunistic channel usage for bursty traffic, the effect of the mobility of resource-constrained nodes to route stability, mobility-induced spatio-temporal spectral opportunities and primary user (PU) protection still remain open issues that need to be jointly addressed. To this effect, this paper proposes a mobile reliable geographical forwarding routing (MROR) protocol. MROR provides a robust mobile framework for geographical forwarding that is based on a mobility-induced channel availability model. It presents a comprehensive routing strategy that considers PU activity (to take care of routes that have to be built through PU coverage), PU signal protection (by the introduction of a mobility-induced guard (mguard) distance) and the random mobility-induced spatio-temporal spectrum opportunities (for enhancement of throughput). It also addresses the issue of frequent route maintenance that arises when speeds of the mobile nodes are considered as a routing metric. As a result, simulation has shown the ability of MROR to reduce the route failure rate by about 65% as against other schemes. In addition, further results show that MROR can improve both the throughput and goodput at the sink in an energy-efficient manner that is required in CRSNs as against compared works.

Molecular origin of differences in hole and electron mobility in amorphous Alq3--a multiscale simulation study.

PubMed

Fuchs, Andreas; Steinbrecher, Thomas; Mommer, Mario S; Nagata, Yuki; Elstner, Marcus; Lennartz, Christian

2012-03-28

In order to determine the molecular origin of the difference in electron and hole mobilities of amorphous thin films of Alq(3) (meridional Alq(3) (tris(8-hydroxyquinoline) aluminium)) we performed multiscale simulations covering quantum mechanics, molecular mechanics and lattice models. The study includes realistic disordered morphologies, polarized site energies to describe diagonal disorder, quantum chemically calculated transfer integrals for the off-diagonal disorder, inner sphere reorganization energies and an approximative scheme for outer sphere reorganization energies. Intermolecular transfer rates were calculated via Marcus-theory and mobilities were simulated via kinetic Monte Carlo simulations and by a Master Equation approach. The difference in electron and hole mobility originates from the different localization of charge density in the radical anion (more delocalized) compared to the radical cation (more confined). This results in higher diagonal disorder for holes and less favourable overlap properties for the hole transfer integrals leading to an overall higher electron mobility.

Multiphase mean curvature flows with high mobility contrasts: A phase-field approach, with applications to nanowires

NASA Astrophysics Data System (ADS)

Bretin, Elie; Danescu, Alexandre; Penuelas, José; Masnou, Simon

2018-07-01

The structure of many multiphase systems is governed by an energy that penalizes the area of interfaces between phases weighted by surface tension coefficients. However, interface evolution laws depend also on interface mobility coefficients. Having in mind some applications where highly contrasted or even degenerate mobilities are involved, for which classical phase field models are inapplicable, we propose a new effective phase field approach to approximate multiphase mean curvature flows with mobilities. The key aspect of our model is to incorporate the mobilities not in the phase field energy (which is conventionally the case) but in the metric which determines the gradient flow. We show the consistency of such an approach by a formal analysis of the sharp interface limit. We also propose an efficient numerical scheme which allows us to illustrate the advantages of the model on various examples, as the wetting of droplets on solid surfaces or the simulation of nanowires growth generated by the so-called vapor-liquid-solid method.

Layered Location-Based Security Mechanism for Mobile Sensor Networks: Moving Security Areas.

PubMed

Wang, Ze; Zhang, Haijuan; Wu, Luqiang; Zhou, Chang

2015-09-25

Network security is one of the most important issues in mobile sensor networks (MSNs). Networks are particularly vulnerable in hostile environments because of many factors, such as uncertain mobility, limitations on computation, and the need for storage in mobile nodes. Though some location-based security mechanisms can resist some malicious attacks, they are only suitable for static networks and may sometimes require large amounts of storage. To solve these problems, using location information, which is one of the most important properties in outdoor wireless networks, a security mechanism called a moving security area (MSA) is proposed to resist malicious attacks by using mobile nodes' dynamic location-based keys. The security mechanism is layered by performing different detection schemes inside or outside the MSA. The location-based private keys will be updated only at the appropriate moments, considering the balance of cost and security performance. By transferring parts of the detection tasks from ordinary nodes to the sink node, the memory requirements are distributed to different entities to save limited energy.

SSME Turbopump Turbine Computations

NASA Technical Reports Server (NTRS)

Jorgenson, P. G. E.

1985-01-01

A two-dimensional viscous code was developed to be used in the prediction of the flow in the SSME high-pressure turbopump blade passages. The rotor viscous code (RVC) employs a four-step Runge-Kutta scheme to solve the two-dimensional, thin-layer Navier-Stokes equations. The Baldwin-Lomax eddy-viscosity model is used for these turbulent flow calculations. A viable method was developed to use the relative exit conditions from an upstream blade row as the inlet conditions to the next blade row. The blade loading diagrams are compared with the meridional values obtained from an in-house quasithree-dimensional inviscid code. Periodic boundary conditions are imposed on a body-fitted C-grid computed by using the GRAPE GRids about Airfoils using Poisson's Equation (GRAPE) code. Total pressure, total temperature, and flow angle are specified at the inlet. The upstream-running Riemann invariant is extrapolated from the interior. Static pressure is specified at the exit such that mass flow is conserved from blade row to blade row, and the conservative variables are extrapolated from the interior. For viscous flows the noslip condition is imposed at the wall. The normal momentum equation gives the pressure at the wall. The density at the wall is obtained from the wall total temperature.

Loosely bound oxytetracycline in riverine sediments from two tributaries of the Chesapeake Bay

USGS Publications Warehouse

Simon, N.S.

2005-01-01

The fate of antibiotics that bind to riverine sediment is not well understood. A solution used in geochemical extraction schemes to determine loosely bound species in sediments, 1 M MgCl2 (pH 8), was chosen to determine loosely bound, and potentially bioavailable, tetracycline antibiotics (TCs), including oxytetracycline (5-OH tetracycline) (OTC) in sediment samples from two rivers on the eastern shore of the Chesapeake Bay. Bottom sediments were collected at sites upstream from, at, and downstream from municipal sewage-treatment plants (STPs) situated on two natural waterways, Yellow Bank Stream, MD, and the Pocomoke River, MD. Concentrations of easily desorbed OTC ranged from 0.6 to approximately 1.2 ??g g-1 dry wt sediment in Yellow Bank Stream and from 0.7 to approximately 3.3 ??g g-1 dry wt sediment in the Pocomoke River. Concentrations of easily desorbable OTC were generally smaller in sediment upstream than in sediment downstream from the STP in the Pocomoke River. STPs and poultry manure are both potential sources of OTC to these streams. OTC that is loosely bound to sediment is subject to desorption. Other researchers have found desorbed TCs to be biologically active compounds.

Combined utilization of partial-response coding and equalization for high-speed WDM-PON with centralized lightwaves.

PubMed

Guo, Qi; Tran, An V

2012-12-17

In this paper, we investigate the transmission impairments in a high-speed single-feeder wavelength-division-multiplexed passive optical network (WDM-PON) employing low-bandwidth upstream transmitter. A 1-GHz reflective semiconductor optical amplifier (RSOA) is operated at the rates of 10 Gb/s and 20 Gb/s in the proposed WDM-PON. Since the system performance is seriously limited by its uplink in both capacity and reach owing to inter-symbol interference and reflection noise, we present a novel technique with simultaneous capability of spectral efficiency enhancement and transmission distance extension in the uplink via coding and equalization that exploit the principles of partial-response (PR) signal. It is experimentally demonstrated that the proposed system supports the delivery of 10 Gb/s and 20 Gb/s upstream signals over 75-km and 25-km bidirectional fiber, respectively. The configuration of PR equalizer is optimized for its best performance-complexity trade-off. The reflection tolerance of 10 Gb/s and 20 Gb/s channels is improved by 8 dB and 6 dB, respectively, with PR coding. The proposed cost-effective signal processing scheme has great potential for the next-generation access networks.

A postscript to Circulation of the blood: men and ideas.

PubMed

Riley, R L

1982-10-01

Since 1964, when Fishman and Richards published Circulation of the Blood: Men and Ideas, Guyton's model of the circulation, in which mean circulatory pressure serves as the upstream pressure for venous return, has been extended, and the concept of vascular smooth muscle tone acting like the pressure surrounding a Starling resistor has been postulated. According to this scheme, the positive zero flow intercepts of rapidly determined arterial pressure-flow curves are the effective downstream pressures for arterial flow to different tissues. The arterioles, like Starling resistors, determine the downstream pressures and are followed by abrupt pressure drops, or "waterfalls." Capillary pressures are closely linked to those of the venules into which they flow. Capillary-venular pressures are the upstream pressures for venous return. In exercising muscles, reduced arteriolar tone lowers arteriolar pressure and increases arterial flow. This, in turn, raises capillary-venular pressure and increases venous flow. The arteriolar-capillary waterfall is decreased or eliminated. Total blood flow is increased by diversion of blood from tissues with slow venous drainage to muscles with fast venous drainage (low resistance X compliance). The heart pumps away the increased venous return by shifting to a new ventricular function curve.

Modeling surface trapped river plumes: A sensitivity study

USGS Publications Warehouse

Hyatt, Jason; Signell, Richard P.

2000-01-01

To better understand the requirements for realistic regional simulation of river plumes in the Gulf of Maine, we test the sensitivity of the Blumberg-Mellor hydrodynamic model to choice of advection scheme, grid resolution, and wind, using idealized geometry and forcing. The test case discharges 1500 m3/s of fresh water into a uniform 32 psu ocean along a straight shelf at 43?? north. The water depth is 15 m at the coast and increases linearly to 190 m at a distance 100 km offshore. Constant discharge runs are conducted in the presence of ambient alongshore current and with and without periodic alongshore wind forcing. Advection methods tested are CENTRAL, UPWIND, the standard Smolarkiewicz MPDATA and a recursive MPDATA scheme. For the no-wind runs, the UPWIND advection scheme performs poorly for grid resolutions typically used in regional simulations (grid spacing of 1-2 km, comparable to or slightly less than the internal Rossby radius, and vertical resolution of 10% of the water column), damping out much of the plume structure. The CENTRAL difference scheme also has problems when wind forcing is neglected, and generates too much structure, shedding eddies of numerical origin. When a weak 5 cm/s ambient current is present in the no-wind case, both the CENTRAL and standard MPDATA schemes produce a false fresh- and dense-water source just upstream of the river inflow due to a standing two-grid length oscillation in the salinity field. The recursive MPDATA scheme completely eliminates the false dense water source, and produces results closest to the grid-converged solution. The results are shown to be very sensitive to vertical grid resolution, and the presence of wind forcing dramatically changes the nature of the plume simulations. The implication of these idealized tests for realistic simulations is discussed, as well as ramifications on previous studies of idealized plume models.

An enhanced performance through agent-based secure approach for mobile ad hoc networks

NASA Astrophysics Data System (ADS)

Bisen, Dhananjay; Sharma, Sanjeev

2018-01-01

This paper proposes an agent-based secure enhanced performance approach (AB-SEP) for mobile ad hoc network. In this approach, agent nodes are selected through optimal node reliability as a factor. This factor is calculated on the basis of node performance features such as degree difference, normalised distance value, energy level, mobility and optimal hello interval of node. After selection of agent nodes, a procedure of malicious behaviour detection is performed using fuzzy-based secure architecture (FBSA). To evaluate the performance of the proposed approach, comparative analysis is done with conventional schemes using performance parameters such as packet delivery ratio, throughput, total packet forwarding, network overhead, end-to-end delay and percentage of malicious detection.

Application of kinetic flux vector splitting scheme for solving multi-dimensional hydrodynamical models of semiconductor devices

NASA Astrophysics Data System (ADS)

Nisar, Ubaid Ahmed; Ashraf, Waqas; Qamar, Shamsul

In this article, one and two-dimensional hydrodynamical models of semiconductor devices are numerically investigated. The models treat the propagation of electrons in a semiconductor device as the flow of a charged compressible fluid. It plays an important role in predicting the behavior of electron flow in semiconductor devices. Mathematically, the governing equations form a convection-diffusion type system with a right hand side describing the relaxation effects and interaction with a self consistent electric field. The proposed numerical scheme is a splitting scheme based on the kinetic flux-vector splitting (KFVS) method for the hyperbolic step, and a semi-implicit Runge-Kutta method for the relaxation step. The KFVS method is based on the direct splitting of macroscopic flux functions of the system on the cell interfaces. The second order accuracy of the scheme is achieved by using MUSCL-type initial reconstruction and Runge-Kutta time stepping method. Several case studies are considered. For validation, the results of current scheme are compared with those obtained from the splitting scheme based on the NT central scheme. The effects of various parameters such as low field mobility, device length, lattice temperature and voltage are analyzed. The accuracy, efficiency and simplicity of the proposed KFVS scheme validates its generic applicability to the given model equations. A two dimensional simulation is also performed by KFVS method for a MESFET device, producing results in good agreement with those obtained by NT-central scheme.

Mobile phone based SCADA for industrial automation.

PubMed

Ozdemir, Engin; Karacor, Mevlut

2006-01-01

SCADA is the acronym for "Supervisory Control And Data Acquisition." SCADA systems are widely used in industry for supervisory control and data acquisition of industrial processes. Conventional SCADA systems use PC, notebook, thin client, and PDA as a client. In this paper, a Java-enabled mobile phone has been used as a client in a sample SCADA application in order to display and supervise the position of a sample prototype crane. The paper presents an actual implementation of the on-line controlling of the prototype crane via mobile phone. The wireless communication between the mobile phone and the SCADA server is performed by means of a base station via general packet radio service (GPRS) and wireless application protocol (WAP). Test results have indicated that the mobile phone based SCADA integration using the GPRS or WAP transfer scheme could enhance the performance of the crane in a day without causing an increase in the response times of SCADA functions. The operator can visualize and modify the plant parameters using his mobile phone, without reaching the site. In this way maintenance costs are reduced and productivity is increased.

In-network Coding for Resilient Sensor Data Storage and Efficient Data Mule Collection

NASA Astrophysics Data System (ADS)

Albano, Michele; Gao, Jie

In a sensor network of n nodes in which k of them have sensed interesting data, we perform in-network erasure coding such that each node stores a linear combination of all the network data with random coefficients. This scheme greatly improves data resilience to node failures: as long as there are k nodes that survive an attack, all the data produced in the sensor network can be recovered with high probability. The in-network coding storage scheme also improves data collection rate by mobile mules and allows for easy scheduling of data mules.

Association of ADRB2 polymorphism with triglyceride levels in Tongans.

PubMed

Naka, Izumi; Ohashi, Jun; Kimura, Ryosuke; Inaoka, Tsukasa; Matsumura, Yasuhiro

2013-07-23

Our previous study demonstrated that the A-allele of the single nucleotide polymorphism (SNP) rs34623097 located in the upstream region of the β2 adrenergic receptor gene (ADRB2) is significantly associated with risk for obesity in Oceanic populations. To investigate whether the ADRB2 polymorphisms explain part of the individual differences in lipid mobilization, energy expenditure and glycogen breakdown, the associations of 10 ADRB2 SNPs with total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol and triglyceride levels were examined in 128 adults in Tonga. A multiple linear regression analysis adjusted for age, sex, and body mass index revealed that rs34623097 was significantly associated with triglyceride levels (P-value = 0.037). A copy of the rs34623097-A allele increased serum triglyceride levels by 70.1 mg/dL (0.791 mmol/L). None of the ADRB2 SNPs showed a significant association with total-cholesterol, high-density lipoprotein cholesterol, or low-density lipoprotein cholesterol. In a Tongan population, a SNP located in the upstream region of ADRB2 is associated with triglyceride levels independent of body mass index.

Metagenomic exploration reveals a marked change in the river resistome and mobilome after treated wastewater discharges.

PubMed

Lekunberri, Itziar; Balcázar, José Luis; Borrego, Carles M

2018-03-01

Mobile genetic elements (MGEs) are key agents in the spread of antibiotic resistance genes (ARGs) across environments. Here we used metagenomics to compare the river resistome (collection of all ARGs) and mobilome (e.g., integrases, transposases, integron integrases and insertion sequence common region "ISCR" elements) between samples collected upstream (n = 6) and downstream (n = 6) of an urban wastewater treatment plant (UWWTP). In comparison to upstream metagenomes, downstream metagenomes showed a drastic increase in the abundance of ARGs, as well as markers of MGEs, particularly integron integrases and ISCR elements. These changes were accompanied by a concomitant prevalence of 16S rRNA gene signatures of bacteria affiliated to families encompassing well-known human and animal pathogens. Our results confirm that chronic discharges of treated wastewater severely impact the river resistome affecting not only the abundance and diversity of ARGs but also their potential spread by enriching the river mobilome in a wide variety of MGEs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Connection adaption for control of networked mobile chaotic agents.

PubMed

Zhou, Jie; Zou, Yong; Guan, Shuguang; Liu, Zonghua; Xiao, Gaoxi; Boccaletti, S

2017-11-22

In this paper, we propose a strategy for the control of mobile chaotic oscillators by adaptively rewiring connections between nearby agents with local information. In contrast to the dominant adaptive control schemes where coupling strength is adjusted continuously according to the states of the oscillators, our method does not request adaption of coupling strength. As the resulting interaction structure generated by this proposed strategy is strongly related to unidirectional chains, by investigating synchronization property of unidirectional chains, we reveal that there exists a certain coupling range in which the agents could be controlled regardless of the length of the chain. This feature enables the adaptive strategy to control the mobile oscillators regardless of their moving speed. Compared with existing adaptive control strategies for networked mobile agents, our proposed strategy is simpler for implementation where the resulting interaction networks are kept unweighted at all time.

Vision-Based Real-Time Traversable Region Detection for Mobile Robot in the Outdoors.

PubMed

Deng, Fucheng; Zhu, Xiaorui; He, Chao

2017-09-13

Environment perception is essential for autonomous mobile robots in human-robot coexisting outdoor environments. One of the important tasks for such intelligent robots is to autonomously detect the traversable region in an unstructured 3D real world. The main drawback of most existing methods is that of high computational complexity. Hence, this paper proposes a binocular vision-based, real-time solution for detecting traversable region in the outdoors. In the proposed method, an appearance model based on multivariate Gaussian is quickly constructed from a sample region in the left image adaptively determined by the vanishing point and dominant borders. Then, a fast, self-supervised segmentation scheme is proposed to classify the traversable and non-traversable regions. The proposed method is evaluated on public datasets as well as a real mobile robot. Implementation on the mobile robot has shown its ability in the real-time navigation applications.

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Mobile devices for community-based REDD+ monitoring: a case study for Central Vietnam.

PubMed

Pratihast, Arun Kumar; Herold, Martin; Avitabile, Valerio; de Bruin, Sytze; Bartholomeus, Harm; Souza, Carlos M; Ribbe, Lars

2012-12-20

Monitoring tropical deforestation and forest degradation is one of the central elements for the Reduced Emissions from Deforestation and Forest Degradation in developing countries (REDD+) scheme. Current arrangements for monitoring are based on remote sensing and field measurements. Since monitoring is the periodic process of assessing forest stands properties with respect to reference data, adopting the current REDD+ requirements for implementing monitoring at national levels is a challenging task. Recently, the advancement in Information and Communications Technologies (ICT) and mobile devices has enabled local communities to monitor their forest in a basic resource setting such as no or slow internet connection link, limited power supply, etc. Despite the potential, the use of mobile device system for community based monitoring (CBM) is still exceptional and faces implementation challenges. This paper presents an integrated data collection system based on mobile devices that streamlines the community-based forest monitoring data collection, transmission and visualization process. This paper also assesses the accuracy and reliability of CBM data and proposes a way to fit them into national REDD+ Monitoring, Reporting and Verification (MRV) scheme. The system performance is evaluated at Tra Bui commune, Quang Nam province, Central Vietnam, where forest carbon and change activities were tracked. The results show that the local community is able to provide data with accuracy comparable to expert measurements (index of agreement greater than 0.88), but against lower costs. Furthermore, the results confirm that communities are more effective to monitor small scale forest degradation due to subsistence fuel wood collection and selective logging, than high resolution remote sensing SPOT imagery.

Mobile Devices for Community-Based REDD+ Monitoring: A Case Study for Central Vietnam

PubMed Central

Pratihast, Arun Kumar; Herold, Martin; Avitabile, Valerio; de Bruin, Sytze; Bartholomeus, Harm; Souza, Carlos M.; Ribbe, Lars

2013-01-01

Monitoring tropical deforestation and forest degradation is one of the central elements for the Reduced Emissions from Deforestation and Forest Degradation in developing countries (REDD+) scheme. Current arrangements for monitoring are based on remote sensing and field measurements. Since monitoring is the periodic process of assessing forest stands properties with respect to reference data, adopting the current REDD+ requirements for implementing monitoring at national levels is a challenging task. Recently, the advancement in Information and Communications Technologies (ICT) and mobile devices has enabled local communities to monitor their forest in a basic resource setting such as no or slow internet connection link, limited power supply, etc. Despite the potential, the use of mobile device system for community based monitoring (CBM) is still exceptional and faces implementation challenges. This paper presents an integrated data collection system based on mobile devices that streamlines the community-based forest monitoring data collection, transmission and visualization process. This paper also assesses the accuracy and reliability of CBM data and proposes a way to fit them into national REDD+ Monitoring, Reporting and Verification (MRV) scheme. The system performance is evaluated at Tra Bui commune, Quang Nam province, Central Vietnam, where forest carbon and change activities were tracked. The results show that the local community is able to provide data with accuracy comparable to expert measurements (index of agreement greater than 0.88), but against lower costs. Furthermore, the results confirm that communities are more effective to monitor small scale forest degradation due to subsistence fuel wood collection and selective logging, than high resolution remote sensing SPOT imagery. PMID:23344371

Regulation Scheme for Improved Innovation and Efficiency in Wireless Communications

DTIC Science & Technology

2009-03-01

that is reliable and available during all crises and emergencies. The last goal is the overall modernization of the FCC. “The FCC shall strive to...change. Qualcomm attempted to create a new video service to mobile subscribers. The service might have interfered with adjacent services. Qualcomm

Involvement of Tyrosine Phosphatases in Insulin Signaling and Apoptosis in Breast Cancer

DTIC Science & Technology

2002-06-01

translocation of PTP1B , a tyrosine phosphatase proposed to regulate signaling by insulin, IGF-1 and other cytokines. Cytoplasmic translocation of PTP1B results...signaling. In this scheme, calcium-mediated apoptosis and growth inhibition may be directed through mobilization of PTP1B .

Computer-Mediated Communications for Distance Education and Training: Literature Review and International Resources

DTIC Science & Technology

1991-01-01

in Part Two on Educational Aplications . 3 A basic issue when evaluating an institution’s dropout rate is whether non-starters are included in the...Association. Africa (Botswana, Lesotho, and Swaziland) ERASMUS: (European Community Action Scheme for the Mobility of University Students) Among its

Mobile 3D laser scanning technology application in the surveying of urban underground rail transit

NASA Astrophysics Data System (ADS)

Han, Youmei; Yang, Bogang; Zhen, Yinan

2016-11-01

Mobile 3D laser scanning technology is one hot kind of digital earth technology. 3D completion surveying is relative new concept in surveying and mapping. A kind of mobile 3D laser scanning system was developed for the urban underground rail 3D completion surveying. According to the characteristics of underground rail environment and the characters of the mobile laser scanning system, it designed a suitable test scheme to improving the accuracy of this kind of mobile laser scanning system when it worked under no GPS signal environment. Then it completed the application of this technology in the No.15 rail 3D completion surveying. Meanwhile a set of production process was made for the 3D completion surveying based on this kind of mobile 3D laser scanning technology. These products were also proved the efficiency of the new technology in the rail 3D completion surveying. Using mobile 3D laser scanning technology to complete underground rail completion surveying has been the first time in China until now. It can provide a reference for 3D measurement of rail completion surveying or the 3D completion surveying of other areas.

NASA's mobile satellite communications program; ground and space segment technologies

NASA Technical Reports Server (NTRS)

Naderi, F.; Weber, W. J.; Knouse, G. H.

1984-01-01

This paper describes the Mobile Satellite Communications Program of the United States National Aeronautics and Space Administration (NASA). The program's objectives are to facilitate the deployment of the first generation commercial mobile satellite by the private sector, and to technologically enable future generations by developing advanced and high risk ground and space segment technologies. These technologies are aimed at mitigating severe shortages of spectrum, orbital slot, and spacecraft EIRP which are expected to plague the high capacity mobile satellite systems of the future. After a brief introduction of the concept of mobile satellite systems and their expected evolution, this paper outlines the critical ground and space segment technologies. Next, the Mobile Satellite Experiment (MSAT-X) is described. MSAT-X is the framework through which NASA will develop advanced ground segment technologies. An approach is outlined for the development of conformal vehicle antennas, spectrum and power-efficient speech codecs, and modulation techniques for use in the non-linear faded channels and efficient multiple access schemes. Finally, the paper concludes with a description of the current and planned NASA activities aimed at developing complex large multibeam spacecraft antennas needed for future generation mobile satellite systems.

Mobile User Connectivity in Relay-Assisted Visible Light Communications.

PubMed

Pešek, Petr; Zvanovec, Stanislav; Chvojka, Petr; Bhatnagar, Manav R; Ghassemlooy, Zabih; Saxena, Prakriti

2018-04-07

In this paper, we investigate relay-assisted visible light communications (VLC) where a mobile user acts as a relay and forwards data from a transmitter to the end mobile user. We analyse the utilization of the amplify-and-forward (AF) and decode-and-forward (DF) relaying schemes. The focus of the paper is on analysis of the behavior of the mobile user acting as a relay while considering a realistic locations of the receivers and transmitters on a standard mobile phone, more specifically with two photodetectors on both sides of a mobile phone and a transmitting LED array located upright. We also investigate dependency of the bit error rate (BER) performance on the azimuth and elevation angles of the mobile relay device within a typical office environment. We provide a new analytical description of BER for AF and DF-based relays in VLC. In addition we compare AF and DF-based systems and show that DF offers a marginal improvement in the coverage area with a BER < 10 -3 and a data rate of 100 Mb/s. Numerical results also illustrate that relay-based systems offer a significant improvement in terms of the coverage compared to direct non-line of sight VLC links.

Mobile User Connectivity in Relay-Assisted Visible Light Communications

PubMed Central

Pešek, Petr; Zvanovec, Stanislav; Chvojka, Petr; Bhatnagar, Manav R.; Ghassemlooy, Zabih; Saxena, Prakriti

2018-01-01

In this paper, we investigate relay-assisted visible light communications (VLC) where a mobile user acts as a relay and forwards data from a transmitter to the end mobile user. We analyse the utilization of the amplify-and-forward (AF) and decode-and-forward (DF) relaying schemes. The focus of the paper is on analysis of the behavior of the mobile user acting as a relay while considering a realistic locations of the receivers and transmitters on a standard mobile phone, more specifically with two photodetectors on both sides of a mobile phone and a transmitting LED array located upright. We also investigate dependency of the bit error rate (BER) performance on the azimuth and elevation angles of the mobile relay device within a typical office environment. We provide a new analytical description of BER for AF and DF-based relays in VLC. In addition we compare AF and DF-based systems and show that DF offers a marginal improvement in the coverage area with a BER < 10–3 and a data rate of 100 Mb/s. Numerical results also illustrate that relay-based systems offer a significant improvement in terms of the coverage compared to direct non-line of sight VLC links. PMID:29642432

A secure user anonymity-preserving three-factor remote user authentication scheme for the telecare medicine information systems.

PubMed

Das, Ashok Kumar

2015-03-01

Recent advanced technology enables the telecare medicine information system (TMIS) for the patients to gain the health monitoring facility at home and also to access medical services over the Internet of mobile networks. Several remote user authentication schemes have been proposed in the literature for TMIS. However, most of them are either insecure against various known attacks or they are inefficient. Recently, Tan proposed an efficient user anonymity preserving three-factor authentication scheme for TMIS. In this paper, we show that though Tan's scheme is efficient, it has several security drawbacks such as (1) it fails to provide proper authentication during the login phase, (2) it fails to provide correct updation of password and biometric of a user during the password and biometric update phase, and (3) it fails to protect against replay attack. In addition, Tan's scheme lacks the formal security analysis and verification. Later, Arshad and Nikooghadam also pointed out some security flaws in Tan's scheme and then presented an improvement on Tan's s scheme. However, we show that Arshad and Nikooghadam's scheme is still insecure against the privileged-insider attack through the stolen smart-card attack, and it also lacks the formal security analysis and verification. In order to withstand those security loopholes found in both Tan's scheme, and Arshad and Nikooghadam's scheme, we aim to propose an effective and more secure three-factor remote user authentication scheme for TMIS. Our scheme provides the user anonymity property. Through the rigorous informal and formal security analysis using random oracle models and the widely-accepted AVISPA (Automated Validation of Internet Security Protocols and Applications) tool, we show that our scheme is secure against various known attacks, including the replay and man-in-the-middle attacks. Furthermore, our scheme is also efficient as compared to other related schemes.

Efficient security mechanisms for mHealth applications using wireless body sensor networks.

PubMed

Sahoo, Prasan Kumar

2012-01-01

Recent technological advances in wireless communications and physiological sensing allow miniature, lightweight, ultra-low power, intelligent monitoring devices, which can be integrated into a Wireless Body Sensor Network (WBSN) for health monitoring. Physiological signals of humans such as heartbeats, temperature and pulse can be monitored from a distant location using tiny biomedical wireless sensors. Hence, it is highly essential to combine the ubiquitous computing with mobile health technology using wireless sensors and smart phones to monitor the well-being of chronic patients such as cardiac, Parkinson and epilepsy patients. Since physiological data of a patient are highly sensitive, maintaining its confidentiality is highly essential. Hence, security is a vital research issue in mobile health (mHealth) applications, especially if a patient has an embarrassing disease. In this paper a three tier security architecture for the mHealth application is proposed, in which light weight data confidentiality and authentication protocols are proposed to maintain the privacy of a patient. Moreover, considering the energy and hardware constraints of the wireless body sensors, low complexity data confidential and authentication schemes are designed. Performance evaluation of the proposed architecture shows that they can satisfy the energy and hardware limitations of the sensors and still can maintain the secure fabrics of the wireless body sensor networks. Besides, the proposed schemes can outperform in terms of energy consumption, memory usage and computation time over standard key establishment security scheme.

An authentication scheme to healthcare security under wireless sensor networks.

PubMed

Hsiao, Tsung-Chih; Liao, Yu-Ting; Huang, Jen-Yan; Chen, Tzer-Shyong; Horng, Gwo-Boa

2012-12-01

In recent years, Taiwan has been seeing an extension of the average life expectancy and a drop in overall fertility rate, initiating our country into an aged society. Due to this phenomenon, how to provide the elderly and patients with chronic diseases a suitable healthcare environment has become a critical issue presently. Therefore, we propose a new scheme that integrates healthcare services with wireless sensor technology in which sensor nodes are employed to measure patients' vital signs. Data collected from these sensor nodes are then transmitted to mobile devices of the medical staff and system administrator, promptly enabling them to understand the patients' condition in real time, which will significantly improve patients' healthcare quality. As per the personal data protection act, patients' vital signs can only be accessed by authorized medical staff. In order to protect patients', the system administrator will verify the medical staff's identity through the mobile device using a smart card and password mechanism. Accordingly, only the verified medical staff can obtain patients' vital signs data such as their blood pressure, pulsation, and body temperature, etc.. Besides, the scheme includes a time-bounded characteristic that allows the verified staff access to data without having to have to re-authenticate and re-login into the system within a set period of time. Consequently, the time-bounded property also increases the work efficiency of the system administrator and user.

Efficient Security Mechanisms for mHealth Applications Using Wireless Body Sensor Networks

PubMed Central

Sahoo, Prasan Kumar

2012-01-01

Recent technological advances in wireless communications and physiological sensing allow miniature, lightweight, ultra-low power, intelligent monitoring devices, which can be integrated into a Wireless Body Sensor Network (WBSN) for health monitoring. Physiological signals of humans such as heartbeats, temperature and pulse can be monitored from a distant location using tiny biomedical wireless sensors. Hence, it is highly essential to combine the ubiquitous computing with mobile health technology using wireless sensors and smart phones to monitor the well-being of chronic patients such as cardiac, Parkinson and epilepsy patients. Since physiological data of a patient are highly sensitive, maintaining its confidentiality is highly essential. Hence, security is a vital research issue in mobile health (mHealth) applications, especially if a patient has an embarrassing disease. In this paper a three tier security architecture for the mHealth application is proposed, in which light weight data confidentiality and authentication protocols are proposed to maintain the privacy of a patient. Moreover, considering the energy and hardware constraints of the wireless body sensors, low complexity data confidential and authentication schemes are designed. Performance evaluation of the proposed architecture shows that they can satisfy the energy and hardware limitations of the sensors and still can maintain the secure fabrics of the wireless body sensor networks. Besides, the proposed schemes can outperform in terms of energy consumption, memory usage and computation time over standard key establishment security scheme. PMID:23112734

Towards Stochastic Optimization-Based Electric Vehicle Penetration in a Novel Archipelago Microgrid.

PubMed

Yang, Qingyu; An, Dou; Yu, Wei; Tan, Zhengan; Yang, Xinyu

2016-06-17

Due to the advantage of avoiding upstream disturbance and voltage fluctuation from a power transmission system, Islanded Micro-Grids (IMG) have attracted much attention. In this paper, we first propose a novel self-sufficient Cyber-Physical System (CPS) supported by Internet of Things (IoT) techniques, namely "archipelago micro-grid (MG)", which integrates the power grid and sensor networks to make the grid operation effective and is comprised of multiple MGs while disconnected with the utility grid. The Electric Vehicles (EVs) are used to replace a portion of Conventional Vehicles (CVs) to reduce CO 2 emission and operation cost. Nonetheless, the intermittent nature and uncertainty of Renewable Energy Sources (RESs) remain a challenging issue in managing energy resources in the system. To address these issues, we formalize the optimal EV penetration problem as a two-stage Stochastic Optimal Penetration (SOP) model, which aims to minimize the emission and operation cost in the system. Uncertainties coming from RESs (e.g., wind, solar, and load demand) are considered in the stochastic model and random parameters to represent those uncertainties are captured by the Monte Carlo-based method. To enable the reasonable deployment of EVs in each MGs, we develop two scheduling schemes, namely Unlimited Coordinated Scheme (UCS) and Limited Coordinated Scheme (LCS), respectively. An extensive simulation study based on a modified 9 bus system with three MGs has been carried out to show the effectiveness of our proposed schemes. The evaluation data indicates that our proposed strategy can reduce both the environmental pollution created by CO 2 emissions and operation costs in UCS and LCS.

Towards Stochastic Optimization-Based Electric Vehicle Penetration in a Novel Archipelago Microgrid

PubMed Central

Yang, Qingyu; An, Dou; Yu, Wei; Tan, Zhengan; Yang, Xinyu

2016-01-01

Due to the advantage of avoiding upstream disturbance and voltage fluctuation from a power transmission system, Islanded Micro-Grids (IMG) have attracted much attention. In this paper, we first propose a novel self-sufficient Cyber-Physical System (CPS) supported by Internet of Things (IoT) techniques, namely “archipelago micro-grid (MG)”, which integrates the power grid and sensor networks to make the grid operation effective and is comprised of multiple MGs while disconnected with the utility grid. The Electric Vehicles (EVs) are used to replace a portion of Conventional Vehicles (CVs) to reduce CO2 emission and operation cost. Nonetheless, the intermittent nature and uncertainty of Renewable Energy Sources (RESs) remain a challenging issue in managing energy resources in the system. To address these issues, we formalize the optimal EV penetration problem as a two-stage Stochastic Optimal Penetration (SOP) model, which aims to minimize the emission and operation cost in the system. Uncertainties coming from RESs (e.g., wind, solar, and load demand) are considered in the stochastic model and random parameters to represent those uncertainties are captured by the Monte Carlo-based method. To enable the reasonable deployment of EVs in each MGs, we develop two scheduling schemes, namely Unlimited Coordinated Scheme (UCS) and Limited Coordinated Scheme (LCS), respectively. An extensive simulation study based on a modified 9 bus system with three MGs has been carried out to show the effectiveness of our proposed schemes. The evaluation data indicates that our proposed strategy can reduce both the environmental pollution created by CO2 emissions and operation costs in UCS and LCS. PMID:27322281

Effects of Nose Bluntness on Hypersonic Boundary-Layer Receptivity and Stability Over Cones

NASA Technical Reports Server (NTRS)

Kara, Kursat; Balakumar, Ponnampalam; Kandil, Osama A.

2011-01-01

The receptivity to freestream acoustic disturbances and the stability properties of hypersonic boundary layers are numerically investigated for boundary-layer flows over a 5 straight cone at a freestream Mach number of 6.0. To compute the shock and the interaction of the shock with the instability waves, the Navier-Stokes equations in axisymmetric coordinates were solved. In the governing equations, inviscid and viscous flux vectors are discretized using a fifth-order accurate weighted-essentially-non-oscillatory scheme. A third-order accurate total-variation-diminishing Runge-Kutta scheme is employed for time integration. After the mean flow field is computed, disturbances are introduced at the upstream end of the computational domain. The appearance of instability waves near the nose region and the receptivity of the boundary layer with respect to slow mode acoustic waves are investigated. Computations confirm the stabilizing effect of nose bluntness and the role of the entropy layer in the delay of boundary-layer transition. The current solutions, compared with experimental observations and other computational results, exhibit good agreement.

Hybrid Large-Eddy/Reynolds-Averaged Simulation of a Supersonic Cavity Using VULCAN

NASA Technical Reports Server (NTRS)

Quinlan, Jesse; McDaniel, James; Baurle, Robert A.

2013-01-01

Simulations of a supersonic recessed-cavity flow are performed using a hybrid large-eddy/Reynolds-averaged simulation approach utilizing an inflow turbulence recycling procedure and hybridized inviscid flux scheme. Calorically perfect air enters a three-dimensional domain at a free stream Mach number of 2.92. Simulations are performed to assess grid sensitivity of the solution, efficacy of the turbulence recycling, and the effect of the shock sensor used with the hybridized inviscid flux scheme. Analysis of the turbulent boundary layer upstream of the rearward-facing step for each case indicates excellent agreement with theoretical predictions. Mean velocity and pressure results are compared to Reynolds-averaged simulations and experimental data for each case and indicate good agreement on the finest grid. Simulations are repeated on a coarsened grid, and results indicate strong grid density sensitivity. Simulations are performed with and without inflow turbulence recycling on the coarse grid to isolate the effect of the recycling procedure, which is demonstrably critical to capturing the relevant shear layer dynamics. Shock sensor formulations of Ducros and Larsson are found to predict mean flow statistics equally well.

Hydrogen injection scheme influence on flow structure in supersonic combustor of constant cross-section

NASA Astrophysics Data System (ADS)

Starov, A. V.; Goldfeld, M. A.

2017-10-01

The efficiency of using two variants of hydrogen injection (distributed and non-distributed injection from vertical pylons) is experimentally investigated. The tests are performed in the attached pipeline regime with the Mach number at the model combustor entrance M=2. The combustion chamber has a backward-facing step at the entrance and slotted channels for combustion stabilization. The tested variants of injection differ basically by the shapes of the fuel jets and, correspondingly, by the hydrogen distribution over the combustor. As a result, distributed injection is found to provide faster ignition, upstream displacement of the elevated pressure region, and more intense combustion over the entire combustor volume.

Pressure balanced drag turbine mass flow meter

DOEpatents

Dacus, M.W.; Cole, J.H.

1980-04-23

The density of the fluid flowing through a tubular member may be measured by a device comprising a rotor assembly suspended within the tubular member, a fluid bearing medium for the rotor assembly shaft, independent fluid flow lines to each bearing chamber, and a scheme for detection of any difference between the upstream and downstream bearing fluid pressures. The rotor assembly reacts to fluid flow both by rotation and axial displacement; therefore concurrent measurements may be made of the velocity of blade rotation and also bearing pressure changes, where the pressure changes may be equated to the fluid momentum flux imparted to the rotor blades. From these parameters the flow velocity and density of the fluid may be deduced.

Pressure balanced drag turbine mass flow meter

DOEpatents

Dacus, Michael W.; Cole, Jack H.

1982-01-01

The density of the fluid flowing through a tubular member may be measured by a device comprising a rotor assembly suspended within the tubular member, a fluid bearing medium for the rotor assembly shaft, independent fluid flow lines to each bearing chamber, and a scheme for detection of any difference between the upstream and downstream bearing fluid pressures. The rotor assembly reacts to fluid flow both by rotation and axial displacement; therefore concurrent measurements may be made of the velocity of blade rotation and also bearing pressure changes, where the pressure changes may be equated to the fluid momentum flux imparted to the rotor blades. From these parameters the flow velocity and density of the fluid may be deduced.

Thermodynamic Modeling of Gas Transport in Glassy Polymeric Membranes.

PubMed

Minelli, Matteo; Sarti, Giulio Cesare

2017-08-19

Solubility and permeability of gases in glassy polymers have been considered with the aim of illustrating the applicability of thermodynamically-based models for their description and prediction. The solubility isotherms are described by using the nonequilibrium lattice fluid (NELF) (model, already known to be appropriate for nonequilibrium glassy polymers, while the permeability isotherms are described through a general transport model in which diffusivity is the product of a purely kinetic factor, the mobility coefficient, and a thermodynamic factor. The latter is calculated from the NELF model and mobility is considered concentration-dependent through an exponential relationship containing two parameters only. The models are tested explicitly considering solubility and permeability data of various penetrants in three glassy polymers, PSf, PPh and 6FDA-6FpDA, selected as the reference for different behaviors. It is shown that the models are able to calculate the different behaviors observed, and in particular the permeability dependence on upstream pressure, both when it is decreasing as well as when it is increasing, with no need to invoke the onset of additional plasticization phenomena. The correlations found between polymer and penetrant properties with the two parameters of the mobility coefficient also lead to the predictive ability of the transport model.

Thermodynamic Modeling of Gas Transport in Glassy Polymeric Membranes

PubMed Central

Minelli, Matteo; Sarti, Giulio Cesare

2017-01-01

Solubility and permeability of gases in glassy polymers have been considered with the aim of illustrating the applicability of thermodynamically-based models for their description and prediction. The solubility isotherms are described by using the nonequilibrium lattice fluid (NELF) (model, already known to be appropriate for nonequilibrium glassy polymers, while the permeability isotherms are described through a general transport model in which diffusivity is the product of a purely kinetic factor, the mobility coefficient, and a thermodynamic factor. The latter is calculated from the NELF model and mobility is considered concentration-dependent through an exponential relationship containing two parameters only. The models are tested explicitly considering solubility and permeability data of various penetrants in three glassy polymers, PSf, PPh and 6FDA-6FpDA, selected as the reference for different behaviors. It is shown that the models are able to calculate the different behaviors observed, and in particular the permeability dependence on upstream pressure, both when it is decreasing as well as when it is increasing, with no need to invoke the onset of additional plasticization phenomena. The correlations found between polymer and penetrant properties with the two parameters of the mobility coefficient also lead to the predictive ability of the transport model. PMID:28825619

Compression performance comparison in low delay real-time video for mobile applications

NASA Astrophysics Data System (ADS)

Bivolarski, Lazar

2012-10-01

This article compares the performance of several current video coding standards in the conditions of low-delay real-time in a resource constrained environment. The comparison is performed using the same content and the metrics and mix of objective and perceptual quality metrics. The metrics results in different coding schemes are analyzed from a point of view of user perception and quality of service. Multiple standards are compared MPEG-2, MPEG4 and MPEG-AVC and well and H.263. The metrics used in the comparison include SSIM, VQM and DVQ. Subjective evaluation and quality of service are discussed from a point of view of perceptual metrics and their incorporation in the coding scheme development process. The performance and the correlation of results are presented as a predictor of the performance of video compression schemes.

How to Speak an Authentication Secret Securely from an Eavesdropper

NASA Astrophysics Data System (ADS)

O'Gorman, Lawrence; Brotman, Lynne; Sammon, Michael

When authenticating over the telephone or mobile headphone, the user cannot always assure that no eavesdropper hears the password or authentication secret. We describe an eavesdropper-resistant, challenge-response authentication scheme for spoken authentication where an attacker can hear the user’s voiced responses. This scheme entails the user to memorize a small number of plaintext-ciphertext pairs. At authentication, these are challenged in random order and interspersed with camouflage elements. It is shown that the response can be made to appear random so that no information on the memorized secret can be learned by eavesdroppers. We describe the method along with parameter value tradeoffs of security strength, authentication time, and memory effort. This scheme was designed for user authentication of wireless headsets used for hands-free communication by healthcare staff at a hospital.

Drive Control Scheme of Electric Power Assisted Wheelchair Based on Neural Network Learning of Human Wheelchair Operation Characteristics

NASA Astrophysics Data System (ADS)

Tanohata, Naoki; Seki, Hirokazu

This paper describes a novel drive control scheme of electric power assisted wheelchairs based on neural network learning of human wheelchair operation characteristics. “Electric power assisted wheelchair” which enhances the drive force of the operator by employing electric motors is expected to be widely used as a mobility support system for elderly and disabled people. However, some handicapped people with paralysis of the muscles of one side of the body cannot maneuver the wheelchair as desired because of the difference in the right and left input force. Therefore, this study proposes a neural network learning system of such human wheelchair operation characteristics and a drive control scheme with variable distribution and assistance ratios. Some driving experiments will be performed to confirm the effectiveness of the proposed control system.

Mobility-Enhanced Reliable Geographical Forwarding in Cognitive Radio Sensor Networks

PubMed Central

Zubair, Suleiman; Syed Yusoff, Sharifah Kamilah; Fisal, Norsheila

2016-01-01

The emergence of the Internet of Things and the proliferation of mobile wireless devices has brought the area of mobile cognitive radio sensor networks (MCRSN) to the research spot light. Notwithstanding the potentials of CRSNs in terms of opportunistic channel usage for bursty traffic, the effect of the mobility of resource-constrained nodes to route stability, mobility-induced spatio-temporal spectral opportunities and primary user (PU) protection still remain open issues that need to be jointly addressed. To this effect, this paper proposes a mobile reliable geographical forwarding routing (MROR) protocol. MROR provides a robust mobile framework for geographical forwarding that is based on a mobility-induced channel availability model. It presents a comprehensive routing strategy that considers PU activity (to take care of routes that have to be built through PU coverage), PU signal protection (by the introduction of a mobility-induced guard (mguard) distance) and the random mobility-induced spatio-temporal spectrum opportunities (for enhancement of throughput). It also addresses the issue of frequent route maintenance that arises when speeds of the mobile nodes are considered as a routing metric. As a result, simulation has shown the ability of MROR to reduce the route failure rate by about 65% as against other schemes. In addition, further results show that MROR can improve both the throughput and goodput at the sink in an energy-efficient manner that is required in CRSNs as against compared works. PMID:26840312

Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

PubMed Central

Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

2014-01-01

The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

OTACT: ONU Turning with Adaptive Cycle Times in Long-Reach PONs

NASA Astrophysics Data System (ADS)

Zare, Sajjad; Ghaffarpour Rahbar, Akbar

2015-01-01

With the expansion of PON networks as Long-Reach PON (LR-PON) networks, the problem of degrading the efficiency of centralized bandwidth allocation algorithms threatens this network due to high propagation delay. This is because these algorithms are based on bandwidth negotiation messages frequently exchanged between the optical line terminal (OLT) in the Central Office and optical network units (ONUs) near the users, which become seriously delayed when the network is extended. To solve this problem, some decentralized algorithms are proposed based on bandwidth negotiation messages frequently exchanged between the Remote Node (RN)/Local Exchange (LX) and ONUs near the users. The network has a relatively high delay since there are relatively large distances between RN/LX and ONUs, and therefore, control messages should travel twice between ONUs and RN/LX in order to go from one ONU to another ONU. In this paper, we propose a novel framework, called ONU Turning with Adaptive Cycle Times (OTACT), that uses Power Line Communication (PLC) to connect two adjacent ONUs. Since there is a large population density in urban areas, ONUs are closer to each other. Thus, the efficiency of the proposed method is high. We investigate the performance of the proposed scheme in contrast with other decentralized schemes under the worst case conditions. Simulation results show that the average upstream packet delay can be decreased under the proposed scheme.

Mobile robotic sensors for perimeter detection and tracking.

PubMed

Clark, Justin; Fierro, Rafael

2007-02-01

Mobile robot/sensor networks have emerged as tools for environmental monitoring, search and rescue, exploration and mapping, evaluation of civil infrastructure, and military operations. These networks consist of many sensors each equipped with embedded processors, wireless communication, and motion capabilities. This paper describes a cooperative mobile robot network capable of detecting and tracking a perimeter defined by a certain substance (e.g., a chemical spill) in the environment. Specifically, the contributions of this paper are twofold: (i) a library of simple reactive motion control algorithms and (ii) a coordination mechanism for effectively carrying out perimeter-sensing missions. The decentralized nature of the methodology implemented could potentially allow the network to scale to many sensors and to reconfigure when adding/deleting sensors. Extensive simulation results and experiments verify the validity of the proposed cooperative control scheme.

Equipment compatibility and logistics assessment for containment foam deployment.

DOE Office of Scientific and Technical Information (OSTI.GOV)

McRoberts, Vincent M.; Martell, Mary-Alena; Jones, Joseph A.

2005-09-01

The deployment of the Joint Technical Operations Team (JTOT) is evolving toward a lean and mobile response team. As a result, opportunities to support more rapid mobilization are being investigated. This study investigates three specific opportunities including: (1) the potential of using standard firefighting equipment to support deployment of the aqueous foam concentrate (AFC-380); (2) determining the feasibility and needs for regional staging of equipment to reduce the inventory currently mobilized during a JTOT response; and (3) determining the feasibility and needs for development of the next generation AFC-380 to reduce the volume of foam concentrate required for a response.more » This study supports the need to ensure that requirements for alternative deployment schemes are understood and in place to support improved response activities.« less

An Appraisal of the Importance of Graduates' Language Skills and ERASMUS Experiences

ERIC Educational Resources Information Center

Mattern, Delfina

2016-01-01

This article discusses the importance of graduates' language skills and their European Regional Action Scheme for the Mobility of University Students (ERASMUS) experiences. The purpose of the research is to establish whether the potential benefits of ERASMUS participation for employability, particularly with regard to language skills, mean that…

Integrated quantum key distribution sender unit for daily-life implementations

NASA Astrophysics Data System (ADS)

Mélen, Gwenaelle; Vogl, Tobias; Rau, Markus; Corrielli, Giacomo; Crespi, Andrea; Osellame, Roberto; Weinfurter, Harald

2016-03-01

Unlike currently implemented encryption schemes, Quantum Key Distribution provides a secure way of generating and distributing a key among two parties. Although a multitude of research platforms has been developed, the integration of QKD units within classical communication systems remains a tremendous challenge. The recently achieved maturity of integrated photonic technologies could be exploited to create miniature QKD add-ons that could extend the primary function of various existing systems such as mobile devices or optical stations. In this work we report on an integrated optics module enabling secure short-distance communication for, e.g., quantum access schemes. Using BB84-like protocols, Alice's mobile low-cost device can exchange secure key and information everywhere within a trusted node network. The new optics platform (35×20×8mm) compatible with current smartphone's technology generates NIR faint polarised laser pulses with 100MHz repetition rate. Fully automated beam tracking and live basis-alignment on Bob's side ensure user-friendly operation with a quantum link efficiency as high as 50% stable over a few seconds.

Data Delivery Method Based on Neighbor Nodes' Information in a Mobile Ad Hoc Network

PubMed Central

Hayashi, Takuma; Taenaka, Yuzo; Okuda, Takeshi; Yamaguchi, Suguru

2014-01-01

This paper proposes a data delivery method based on neighbor nodes' information to achieve reliable communication in a mobile ad hoc network (MANET). In a MANET, it is difficult to deliver data reliably due to instabilities in network topology and wireless network condition which result from node movement. To overcome such unstable communication, opportunistic routing and network coding schemes have lately attracted considerable attention. Although an existing method that employs such schemes, MAC-independent opportunistic routing and encoding (MORE), Chachulski et al. (2007), improves the efficiency of data delivery in an unstable wireless mesh network, it does not address node movement. To efficiently deliver data in a MANET, the method proposed in this paper thus first employs the same opportunistic routing and network coding used in MORE and also uses the location information and transmission probabilities of neighbor nodes to adapt to changeable network topology and wireless network condition. The simulation experiments showed that the proposed method can achieve efficient data delivery with low network load when the movement speed is relatively slow. PMID:24672371

Data delivery method based on neighbor nodes' information in a mobile ad hoc network.

PubMed

Kashihara, Shigeru; Hayashi, Takuma; Taenaka, Yuzo; Okuda, Takeshi; Yamaguchi, Suguru

2014-01-01

This paper proposes a data delivery method based on neighbor nodes' information to achieve reliable communication in a mobile ad hoc network (MANET). In a MANET, it is difficult to deliver data reliably due to instabilities in network topology and wireless network condition which result from node movement. To overcome such unstable communication, opportunistic routing and network coding schemes have lately attracted considerable attention. Although an existing method that employs such schemes, MAC-independent opportunistic routing and encoding (MORE), Chachulski et al. (2007), improves the efficiency of data delivery in an unstable wireless mesh network, it does not address node movement. To efficiently deliver data in a MANET, the method proposed in this paper thus first employs the same opportunistic routing and network coding used in MORE and also uses the location information and transmission probabilities of neighbor nodes to adapt to changeable network topology and wireless network condition. The simulation experiments showed that the proposed method can achieve efficient data delivery with low network load when the movement speed is relatively slow.

Development of the polarization tracking scheme for free-space quantum cryptography

NASA Astrophysics Data System (ADS)

Toyoshima, Morio; Takayama, Yoshihisa; Kunimori, Hiroo; Takeoka, Masahiro; Fujiwara, Mikio; Sasaki, Masahide

2008-04-01

Quantum cryptography is a new technique for transmitting quantum information. The information is securely transmitted due to the laws of physics. In such systems, the vehicle that transfers quantum information is a single photon. The problem with using photons is that the transmission distance is limited by the absorption of the photons by the optical fiber along which they pass. The maximum demonstrated range so far is approximately 100 km. Using free-space quantum cryptography between a ground station and a satellite is a possible way of sending quantum information farther than is possible with optical fibers. This is because there is no birefringence effect in the atmosphere. However, there is a complication in that the directions of the polarization basis between the transmitter and the receiver must coincide with each other. This polarization changes because the mobile terminals for free-space transmission continuously change their attitudes. If the transmission protocol is based on polarization, it is necessary to compensate for the change in attitude between the mobile terminals. We are developing a scheme to track the polarization basis between the transceivers. The preliminary result is presented.

Bidirectional QoS support for novelty detection applications based on hierarchical wireless sensor network model

NASA Astrophysics Data System (ADS)

Edwards, Mark; Hu, Fei; Kumar, Sunil

2004-10-01

The research on the Novelty Detection System (NDS) (called as VENUS) at the authors' universities has generated exciting results. For example, we can detect an abnormal behavior (such as cars thefts from the parking lot) from a series of video frames based on the cognitively motivated theory of habituation. In this paper, we would like to describe the implementation strategies of lower layer protocols for using large-scale Wireless Sensor Networks (WSN) to NDS with Quality-of-Service (QoS) support. Wireless data collection framework, consisting of small and low-power sensor nodes, provides an alternative mechanism to observe the physical world, by using various types of sensing capabilities that include images (and even videos using Panoptos), sound and basic physical measurements such as temperature. We do not want to lose any 'data query command' packets (in the downstream direction: sink-to-sensors) or have any bit-errors in them since they are so important to the whole sensor network. In the upstream direction (sensors-to-sink), we may tolerate the loss of some sensing data packets. But the 'interested' sensing flow should be assigned a higher priority in terms of multi-hop path choice, network bandwidth allocation, and sensing data packet generation frequency (we hope to generate more sensing data packet for that novel event in the specified network area). The focus of this paper is to investigate MAC-level Quality of Service (QoS) issue in Wireless Sensor Networks (WSN) for Novelty Detection applications. Although QoS has been widely studied in other types of networks including wired Internet, general ad hoc networks and mobile cellular networks, we argue that QoS in WSN has its own characteristics. In wired Internet, the main QoS parameters include delay, jitter and bandwidth. In mobile cellular networks, two most common QoS metrics are: handoff call dropping probability and new call blocking probability. Since the main task of WSN is to detect and report events, the most important QoS parameters should include sensing data packet transmission reliability, lifetime extension degree from sensor sleeping control, event detection latency, congestion reduction level through removal of redundant sensing data. In this paper, we will focus on the following bi-directional QoS topics: (1) Downstream (sink-to-sensor) QoS: Reliable data query command forwarding to particular sensor(s). In other words, we do not want to lose the query command packets; (2) Upstream (sensor-to-sink) QoS: transmission of sensed data with priority control. The more interested data that can help in novelty detection should be transmitted on an optimal path with higher reliability. We propose the use of Differentiated Data Collection. Due to the large-scale nature and resource constraints of typical wireless sensor networks, such as limited energy, small memory (typically RAM < 4K bytes) and short communication range, the above problems become even more challenging. Besides QoS support issue, we will also describe our low-energy Sensing Data Transmission network Architecture. Our research results show the scalability and energy-efficiency of our proposed WSN QoS schemes.

Direct trust-based security scheme for RREQ flooding attack in mobile ad hoc networks

NASA Astrophysics Data System (ADS)

Kumar, Sunil; Dutta, Kamlesh

2017-06-01

The routing algorithms in MANETs exhibit distributed and cooperative behaviour which makes them easy target for denial of service (DoS) attacks. RREQ flooding attack is a flooding-type DoS attack in context to Ad hoc On Demand Distance Vector (AODV) routing protocol, where the attacker broadcasts massive amount of bogus Route Request (RREQ) packets to set up the route with the non-existent or existent destination in the network. This paper presents direct trust-based security scheme to detect and mitigate the impact of RREQ flooding attack on the network, in which, every node evaluates the trust degree value of its neighbours through analysing the frequency of RREQ packets originated by them over a short period of time. Taking the node's trust degree value as the input, the proposed scheme is smoothly extended for suppressing the surplus RREQ and bogus RREQ flooding packets at one-hop neighbours during the route discovery process. This scheme distinguishes itself from existing techniques by not directly blocking the service of a normal node due to increased amount of RREQ packets in some unusual conditions. The results obtained throughout the simulation experiments clearly show the feasibility and effectiveness of the proposed defensive scheme.

Well-balanced high-order centered schemes on unstructured meshes for shallow water equations with fixed and mobile bed

NASA Astrophysics Data System (ADS)

Canestrelli, Alberto; Dumbser, Michael; Siviglia, Annunziato; Toro, Eleuterio F.

2010-03-01

In this paper, we study the numerical approximation of the two-dimensional morphodynamic model governed by the shallow water equations and bed-load transport following a coupled solution strategy. The resulting system of governing equations contains non-conservative products and it is solved simultaneously within each time step. The numerical solution is obtained using a new high-order accurate centered scheme of the finite volume type on unstructured meshes, which is an extension of the one-dimensional PRICE-C scheme recently proposed in Canestrelli et al. (2009) [5]. The resulting first-order accurate centered method is then extended to high order of accuracy in space via a high order WENO reconstruction technique and in time via a local continuous space-time Galerkin predictor method. The scheme is applied to the shallow water equations and the well-balanced properties of the method are investigated. Finally, we apply the new scheme to different test cases with both fixed and movable bed. An attractive future of the proposed method is that it is particularly suitable for engineering applications since it allows practitioners to adopt the most suitable sediment transport formula which better fits the field data.

Remote Energy Monitoring System via Cellular Network

NASA Astrophysics Data System (ADS)

Yunoki, Shoji; Tamaki, Satoshi; Takada, May; Iwaki, Takashi

Recently, improvement on power saving and cost efficiency by monitoring the operation status of various facilities over the network has gained attention. Wireless network, especially cellular network, has advantage in mobility, coverage, and scalability. On the other hand, it has disadvantage of low reliability, due to rapid changes in the available bandwidth. We propose a transmission control scheme based on data priority and instantaneous available bandwidth to realize a highly reliable remote monitoring system via cellular network. We have developed our proposed monitoring system and evaluated the effectiveness of our scheme, and proved it reduces the maximum transmission delay of sensor status to 1/10 compared to best effort transmission.

Simple Peer-to-Peer SIP Privacy

NASA Astrophysics Data System (ADS)

Koskela, Joakim; Tarkoma, Sasu

In this paper, we introduce a model for enhancing privacy in peer-to-peer communication systems. The model is based on data obfuscation, preventing intermediate nodes from tracking calls, while still utilizing the shared resources of the peer network. This increases security when moving between untrusted, limited and ad-hoc networks, when the user is forced to rely on peer-to-peer schemes. The model is evaluated using a Host Identity Protocol-based prototype on mobile devices, and is found to provide good privacy, especially when combined with a source address hiding scheme. The contribution of this paper is to present the model and results obtained from its use, including usability considerations.

An evaluation of climate change effects in estuarine salinity patterns: Application to Ria de Aveiro shallow water system

NASA Astrophysics Data System (ADS)

Vargas, Catarina I. C.; Vaz, Nuno; Dias, João M.

2017-04-01

It is of global interest, for the definition of effective adaptation strategies, to make an assessment of climate change impacts in coastal environments. In this study, the salinity patterns adjustments and the correspondent Venice System zonations adaptations are evaluated through numerical modelling for Ria de Aveiro, a mesotidal shallow water lagoon located in the Portuguese coast, for the end of the 21st century in a climate change context. A reference (equivalent to present conditions) and three future scenarios are defined and simulated, both for wet and dry conditions. The future scenarios are designed with the following changes to the reference: scenario 1) projected mean sea level (MSL) rise; scenario 2) projected river flow discharges; and scenario 3) projections for both MSL and river flow discharges. The projections imposed are: a MSL rise of 0.42 m; a freshwater flow reduction of ∼22% for the wet season and a reduction of ∼87% for the dry season. Modelling results are analyzed for different tidal ranges. Results indicate: a) a salinity upstream intrusion and a generalized salinity increase for sea level rise scenario, with higher significance in middle-to-upper lagoon zones; b) a maximum salinity increase of ∼12 in scenario 3 and wet conditions for Espinheiro channel, the one with higher freshwater contribution; c) an upstream displacement of the saline fronts occurring in wet conditions for all future scenarios, with stronger expression for scenario 3, of ∼2 km in Espinheiro channel; and d) a landward progression of the saltier physical zones established in the Venice System scheme. The adaptation of the ecosystem to the upstream relocation of physical zones may be blocked by human settlements and other artificial barriers surrounding the estuarine environment.

Patient mobility and health care quality when regions and patients differ in income.

PubMed

Brekke, Kurt R; Levaggi, Rosella; Siciliani, Luigi; Straume, Odd Rune

2016-12-01

We study the effects of cross-border patient mobility on health care quality and welfare when income varies across and within regions. We use a Salop model with a high-, middle-, and low-income region. In each region, a policy maker chooses health care quality to maximise the utility of its residents when health care costs are financed by general income taxation. In equilibrium, regions with higher income offer better quality, which creates an incentive for patient mobility from lower- to higher-income regions. Assuming a prospective payment scheme based on DRG-pricing, we find that lower non-monetary (administrative) mobility costs have (i) no effect on quality or welfare in the high-income region; (ii) a negative effect on quality but a positive effect on welfare for the middle-income region; and (iii) ambiguous effects on quality and welfare for the low-income region. Lower monetary mobility costs (copayments) might reduce welfare in both the middle- and low-income region. Thus, health policies that stimulate cross-border patient mobility can be counterproductive when regions differ in income. Copyright © 2016 Elsevier B.V. All rights reserved.

A Reliable Handoff Mechanism for Mobile Industrial Wireless Sensor Networks.

PubMed

Ma, Jian; Yang, Dong; Zhang, Hongke; Gidlund, Mikael

2017-08-04

With the prevalence of low-power wireless devices in industrial applications, concerns about timeliness and reliability are bound to continue despite the best efforts of researchers to design Industrial Wireless Sensor Networks (IWSNs) to improve the performance of monitoring and control systems. As mobile devices have a major role to play in industrial production, IWSNs should support mobility. However, research on mobile IWSNs and practical tests have been limited due to the complicated resource scheduling and rescheduling compared with traditional wireless sensor networks. This paper proposes an effective mechanism to guarantee the performance of handoff, including a mobility-aware scheme, temporary connection and quick registration. The main contribution of this paper is that the proposed mechanism is implemented not only in our testbed but in a real industrial environment. The results indicate that our mechanism not only improves the accuracy of handoff triggering, but also solves the problem of ping-pong effect during handoff. Compared with the WirelessHART standard and the RSSI-based approach, our mechanism facilitates real-time communication while being more reliable, which can help end-to-end packet delivery remain an average of 98.5% in the scenario of mobile IWSNs.

Correlation of mass spectrometry identified bacterial biomarkers from a fielded pyrolysis-gas chromatography-ion mobility spectrometry biodetector with the microbiological gram stain classification scheme.

PubMed

Snyder, A Peter; Dworzanski, Jacek P; Tripathi, Ashish; Maswadeh, Waleed M; Wick, Charles H

2004-11-01

A pyrolysis-gas chromatography-ion mobility spectrometry (Py-GC-IMS) briefcase system has been shown to detect and classify deliberately released bioaerosols in outdoor field scenarios. The bioaerosols included Gram-positive and Gram-negative bacteria, MS-2 coliphage virus, and ovalbumin protein species. However, the origin and structural identities of the pyrolysate peaks in the GC-IMS data space, their microbiological information content, and taxonomic importance with respect to biodetection have not been determined. The present work interrogates the identities of the peaks by inserting a time-of-flight mass spectrometry system in parallel with the IMS detector through a Tee connection in the GC module. Biological substances producing ion mobility peaks from the pyrolysis of microorganisms were identified by their GC retention time, matching of their electron ionization mass spectra with authentic standards, and the National Institutes for Standards and Technology mass spectral database. Strong signals from 2-pyridinecarboxamide were identified in Bacillus samples including Bacillus anthracis, and its origin was traced to the cell wall peptidoglycan macromolecule. 3-Hydroxymyristic acid is a component of lipopolysaccharides in the cell walls of Gram-negative organisms. The Gram-negative Escherichia coli organism showed significant amounts of 3-hydroxymyristic acid derivatives and degradation products in Py-GC-MS analyses. Some of the fatty acid derivatives were observed in very low abundance in the ion mobility spectra, and the higher boiling lipid species were absent. Evidence is presented that the Py-GC-ambient temperature and pressure-IMS system generates and detects bacterial biochemical information that can serve as components of a biological classification scheme directly correlated to the Gram stain reaction in microorganism taxonomy.

Effects of Wall Cooling on Hypersonic Boundary Layer Receptivity Over a Cone

NASA Technical Reports Server (NTRS)

Kara, K.; Balakumar, P.; Kandil, O. A.

2008-01-01

Effects of wall cooling on the receptivity process induced by the interaction of slow acoustic disturbances in the free-stream are numerically investigated for a boundary layer flow over a 5-degrees straight cone. The free-stream Mach number is 6.0 and the Reynolds number is 7.8x10(exp 6)/ft. Both the steady and unsteady solutions are obtained by solving the full Navier-Stokes equations using 5th-order accurate weighted essentially non-oscillatory (WENO) scheme for space discretization and using 3rd-order total variation diminishing (T VD) Runge-K utta scheme for time integration. Computations are performed for a cone with nose radius of 0.001 inch for adiabatic wall temperature (T(sub aw)), 0.75*T(sub aw), 0.5*T(sub aw), 0.40*T(sub aw), 0.30*T(sub aw), and 0.20*T(sub aw). Once the mean flow field is computed, disturbances are introduced at the upstream end of the computational domain. Generation of instability waves from leading edge region and receptivity of boundary layer to slow acoustic waves are investigated. Computations showed that wall cooling has strong stabilization effect on the first mode disturbances as was observed in the experiments. T ransition location moved to upstream when wall cooling was applied It is also found that the boundary layer is much more receptive to fast acoustic wave (by almost a factor of 50). When simulations performed using the same forcing frequency growth of the second mode disturbances are delayed with wall cooling and they attained values two times higher than that of adiabatic case. In 0.20*T(sub aw) case the transition Reynolds number is doubled compared to adiabatic conditions. The receptivity coefficient for adiabatic wall case (804 R) is 1.5225 and for highly cooled cones (241, and 161 R); they are in the order of 10(exp -3).

Positron transport studies at the Au - (InP:Fe) interface

NASA Astrophysics Data System (ADS)

Au, H. L.; Lee, T. C.; Beling, C. D.; Fung, S.

1996-03-01

Positron mobility and lifetime measurements have been carried out on semi-insulating Fe-doped InP samples with Au contacts used for electric field application. The lifetime measurements, with electric fields directed towards the Au - InP:Fe interface, reveal no component associated with interfacial open-volume sites and thus give no evidence of any positron mobility. The mobility measurements, made using the Doppler-shifted annihilation radiation technique, however, reveal a temperature independent positron mobility of about 0953-8984/8/10/012/img1 in the range 150 - 300 K. These observations, together with results from I - V analysis, are discussed with reference to two possible band-bending schemes. The first, which requires an ionized shallow donor region adjacent to the Au - InP interface, seems less plausible on a number of grounds. In the second, however, an 0953-8984/8/10/012/img2 negative space charge produces an adverse diffusion barrier for positrons approaching the interface together with a non-uniform electric field in the samples capable of explaining the observed mobility results.

Mobility-Aware Caching and Computation Offloading in 5G Ultra-Dense Cellular Networks

PubMed Central

Chen, Min; Hao, Yixue; Qiu, Meikang; Song, Jeungeun; Wu, Di; Humar, Iztok

2016-01-01

Recent trends show that Internet traffic is increasingly dominated by content, which is accompanied by the exponential growth of traffic. To cope with this phenomena, network caching is introduced to utilize the storage capacity of diverse network devices. In this paper, we first summarize four basic caching placement strategies, i.e., local caching, Device-to-Device (D2D) caching, Small cell Base Station (SBS) caching and Macrocell Base Station (MBS) caching. However, studies show that so far, much of the research has ignored the impact of user mobility. Therefore, taking the effect of the user mobility into consideration, we proposes a joint mobility-aware caching and SBS density placement scheme (MS caching). In addition, differences and relationships between caching and computation offloading are discussed. We present a design of a hybrid computation offloading and support it with experimental results, which demonstrate improved performance in terms of energy cost. Finally, we discuss the design of an incentive mechanism by considering network dynamics, differentiated user’s quality of experience (QoE) and the heterogeneity of mobile terminals in terms of caching and computing capabilities. PMID:27347975

Mobility-Aware Caching and Computation Offloading in 5G Ultra-Dense Cellular Networks.

PubMed

Chen, Min; Hao, Yixue; Qiu, Meikang; Song, Jeungeun; Wu, Di; Humar, Iztok

2016-06-25

Recent trends show that Internet traffic is increasingly dominated by content, which is accompanied by the exponential growth of traffic. To cope with this phenomena, network caching is introduced to utilize the storage capacity of diverse network devices. In this paper, we first summarize four basic caching placement strategies, i.e., local caching, Device-to-Device (D2D) caching, Small cell Base Station (SBS) caching and Macrocell Base Station (MBS) caching. However, studies show that so far, much of the research has ignored the impact of user mobility. Therefore, taking the effect of the user mobility into consideration, we proposes a joint mobility-aware caching and SBS density placement scheme (MS caching). In addition, differences and relationships between caching and computation offloading are discussed. We present a design of a hybrid computation offloading and support it with experimental results, which demonstrate improved performance in terms of energy cost. Finally, we discuss the design of an incentive mechanism by considering network dynamics, differentiated user's quality of experience (QoE) and the heterogeneity of mobile terminals in terms of caching and computing capabilities.

The impact of cost and network topology on urban mobility: a study of public bicycle usage in 2 U.S. cities.

PubMed

Jurdak, Raja

2013-01-01

Understanding the drivers of urban mobility is vital for epidemiology, urban planning, and communication networks. Human movements have so far been studied by observing people's positions in a given space and time, though most recent models only implicitly account for expected costs and returns for movements. This paper explores the explicit impact of cost and network topology on mobility dynamics, using data from 2 city-wide public bicycle share systems in the USA. User mobility is characterized through the distribution of trip durations, while network topology is characterized through the pairwise distances between stations and the popularity of stations and routes. Despite significant differences in station density and physical layout between the 2 cities, trip durations follow remarkably similar distributions that exhibit cost sensitive trends around pricing point boundaries, particularly with long-term users of the system. Based on the results, recommendations for dynamic pricing and incentive schemes are provided to positively influence mobility patterns and guide improved planning and management of public bicycle systems to increase uptake.

Explicit Content Caching at Mobile Edge Networks with Cross-Layer Sensing

PubMed Central

Chen, Lingyu; Su, Youxing; Luo, Wenbin; Hong, Xuemin; Shi, Jianghong

2018-01-01

The deployment density and computational power of small base stations (BSs) are expected to increase significantly in the next generation mobile communication networks. These BSs form the mobile edge network, which is a pervasive and distributed infrastructure that can empower a variety of edge/fog computing applications. This paper proposes a novel edge-computing application called explicit caching, which stores selective contents at BSs and exposes such contents to local users for interactive browsing and download. We formulate the explicit caching problem as a joint content recommendation, caching, and delivery problem, which aims to maximize the expected user quality-of-experience (QoE) with varying degrees of cross-layer sensing capability. Optimal and effective heuristic algorithms are presented to solve the problem. The theoretical performance bounds of the explicit caching system are derived in simplified scenarios. The impacts of cache storage space, BS backhaul capacity, cross-layer information, and user mobility on the system performance are simulated and discussed in realistic scenarios. Results suggest that, compared with conventional implicit caching schemes, explicit caching can better exploit the mobile edge network infrastructure for personalized content dissemination. PMID:29565313

Explicit Content Caching at Mobile Edge Networks with Cross-Layer Sensing.

PubMed

Chen, Lingyu; Su, Youxing; Luo, Wenbin; Hong, Xuemin; Shi, Jianghong

2018-03-22

The deployment density and computational power of small base stations (BSs) are expected to increase significantly in the next generation mobile communication networks. These BSs form the mobile edge network, which is a pervasive and distributed infrastructure that can empower a variety of edge/fog computing applications. This paper proposes a novel edge-computing application called explicit caching, which stores selective contents at BSs and exposes such contents to local users for interactive browsing and download. We formulate the explicit caching problem as a joint content recommendation, caching, and delivery problem, which aims to maximize the expected user quality-of-experience (QoE) with varying degrees of cross-layer sensing capability. Optimal and effective heuristic algorithms are presented to solve the problem. The theoretical performance bounds of the explicit caching system are derived in simplified scenarios. The impacts of cache storage space, BS backhaul capacity, cross-layer information, and user mobility on the system performance are simulated and discussed in realistic scenarios. Results suggest that, compared with conventional implicit caching schemes, explicit caching can better exploit the mobile edge network infrastructure for personalized content dissemination.

RACOON: a multiuser QoS design for mobile wireless body area networks.

PubMed

Cheng, Shihheng; Huang, Chingyao; Tu, Chun Chen

2011-10-01

In this study, Random Contention-based Resource Allocation (RACOON) medium access control (MAC) protocol is proposed to support the quality of service (QoS) for multi-user mobile wireless body area networks (WBANs). Different from existing QoS designs that focus on a single WBAN, a multiuser WBAN QoS should further consider both inter-WBAN interference and inter-WBAN priorities. Similar problems have been studied in both overlapped wireless local area networks (WLANs) and Bluetooth piconets that need QoS supports. However, these solutions are designed for non-medical transmissions that do not consider any priority scheme for medical applications. Most importantly, these studies focus on only static or low mobility networks. Network mobility of WBANs will introduce unnecessary inter-network collisions and energy waste, which are not considered by these solutions. The proposed multiuser-QoS protocol, RACOON, simultaneously satisfies the inter WBAN QoS requirements and overcomes the performance degradation caused by WBAN mobility. Simulation results verify that RACOON provides better latency and energy control, as compared with WBAN QoS protocols without considering the inter-WBAN requirements.

Improved surface-roughness scattering and mobility models for multi-gate FETs with arbitrary cross-section and biasing scheme

NASA Astrophysics Data System (ADS)

Lizzit, D.; Badami, O.; Specogna, R.; Esseni, D.

2017-06-01

We present a new model for surface roughness (SR) scattering in n-type multi-gate FETs (MuGFETs) and gate-all-around nanowire FETs with fairly arbitrary cross-sections, its implementation in a complete device simulator, and the validation against experimental electron mobility data. The model describes the SR scattering matrix elements as non-linear transformations of interface fluctuations, which strongly influences the root mean square value of the roughness required to reproduce experimental mobility data. Mobility simulations are performed via the deterministic solution of the Boltzmann transport equation for a 1D-electron gas and including the most relevant scattering mechanisms for electronic transport, such as acoustic, polar, and non-polar optical phonon scattering, Coulomb scattering, and SR scattering. Simulation results show the importance of accounting for arbitrary cross-sections and biasing conditions when compared to experimental data. We also discuss how mobility is affected by the shape of the cross-section as well as by its area in gate-all-around and tri-gate MuGFETs.

Retrogressive thaw slumps temper dissolved organic carbon delivery to streams of the Peel Plateau, NWT, Canada

NASA Astrophysics Data System (ADS)

Littlefair, Cara A.; Tank, Suzanne E.; Kokelj, Steven V.

2017-12-01

In Siberia and Alaska, permafrost thaw has been associated with significant increases in the delivery of dissolved organic carbon (DOC) to recipient stream ecosystems. Here, we examine the effect of retrogressive thaw slumps (RTSs) on DOC concentration and transport, using data from eight RTS features on the Peel Plateau, NWT, Canada. Like extensive regions of northwestern Canada, the Peel Plateau is comprised of thick, ice-rich tills that were deposited at the margins of the Laurentide Ice Sheet. RTS features are now widespread in this region, with headwall exposures up to 30 m high and total disturbed areas often exceeding 20 ha. We find that intensive slumping on the Peel Plateau is universally associated with decreasing DOC concentrations downstream of slumps, even though the composition of slump-derived dissolved organic matter (DOM; assessed using specific UV absorbance and slope ratios) is similar to permafrost-derived DOM from other regions. Comparisons of upstream and downstream DOC flux relative to fluxes of total suspended solids suggest that the substantial fine-grained sediments released by RTS features may sequester DOC. Runoff obtained directly from slump rill water, above entry into recipient streams, indicates that the deepest RTS features, which thaw the greatest extent of buried, Pleistocene-aged glacial tills, release low-concentration DOC when compared to paired upstream, undisturbed locations, while shallower features, with exposures that are more limited to a relict Holocene active layer, have within-slump DOC concentrations more similar to upstream sites. Finally, fine-scale work at a single RTS site indicates that temperature and precipitation serve as primary environmental controls on above-slump and below-slump DOC flux, but it also shows that the relationship between climatic parameters and DOC flux is complex for these dynamic thermokarst features. These results demonstrate that we should expect clear variation in thermokarst-associated DOC mobilization across Arctic regions. However, they also show that within-region variation in thermokarst intensity and landscape composition is critical for determining the biogeochemical response. Geological and climate legacy shape the physical and chemical composition of permafrost and thermokarst potential. As such, these factors must be considered in predictions of land-to-water carbon mobilization in a warming Arctic.

Power Dependence of the Electron Mobility Profile in a Hall Thruster

NASA Technical Reports Server (NTRS)

Jorns, Benjamin A.; Hofery, Richard H.; Mikellides, Ioannis G.

2014-01-01

The electron mobility profile is estimated in a 4.5 kW commercial Hall thruster as a function of discharge power. Internal measurements of plasma potential and electron temperature are made in the thruster channel with a high-speed translating probe. These measurements are presented for a range of throttling conditions from 150 - 400 V and 0.6 - 4.5 kW. The fluid-based solver, Hall2De, is used in conjunction with these internal plasma parameters to estimate the anomalous collision frequency profile at fixed voltage, 300 V, and three power levels. It is found that the anomalous collision frequency profile does not change significantly upstream of the location of the magnetic field peak but that the extent and magnitude of the anomalous collision frequency downstream of the magnetic peak does change with thruster power. These results are discussed in the context of developing phenomenological models for how the collision frequency profile depends on thruster operating conditions.

Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka

2016-08-29

Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-familymore » replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.« less

Open Mobile Alliance Secure Content Exchange: Introducing Key Management Constructs and Protocols for Compromise-Resilient Easing of DRM Restrictions

NASA Astrophysics Data System (ADS)

Kravitz, David William

This paper presents an insider's view of the rationale and the cryptographic mechanics of some principal elements of the Open Mobile Alliance (OMA) Secure Content Exchange (SCE) Technical Specifications. A primary goal is to enable implementation of a configurable methodology that quarantines the effects that unknown-compromised entities have on still-compliant entities in the system, while allowing import from upstream protection systems and multi-client reuse of Rights Objects that grant access to plaintext content. This has to be done without breaking compatibility with the underlying legacy OMA DRM v2.0/v2.1 Technical Specifications. It is also required that legacy devices can take at least partial advantage of the new import functionality, and can request the creation of SCE-compatible Rights Objects and utilize Rights Objects created upon request of SCE-conformant devices. This must be done in a way that the roles played by newly defined entities unrecognizable by legacy devices remain hidden.

Flexible Friction Stir Joining Technology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feng, Zhili; Lim, Yong Chae; Mahoney, Murray

2015-07-23

Reported herein is the final report on a U.S. Department of Energy (DOE) Advanced Manufacturing Office (AMO) project with industry cost-share that was jointly carried out by Oak Ridge National Laboratory (ORNL), ExxonMobil Upstream Research Company (ExxonMobil), and MegaStir Technologies (MegaStir). The project was aimed to advance the state of the art of friction stir welding (FSW) technology, a highly energy-efficient solid-state joining process, for field deployable, on-site fabrications of large, complex and thick-sectioned structures of high-performance and high-temperature materials. The technology innovations developed herein attempted to address two fundamental shortcomings of FSW: 1) the inability for on-site welding andmore » 2) the inability to weld thick section steels, both of which have impeded widespread use of FSW in manufacturing. Through this work, major advance has been made toward transforming FSW technology from a “specialty” process to a mainstream materials joining technology to realize its pervasive energy, environmental, and economic benefits across industry.« less

Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

PubMed Central

Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

2012-01-01

NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

New Driving Scheme to Improve Hysteresis Characteristics of Organic Thin Film Transistor-Driven Active-Matrix Organic Light Emitting Diode Display

NASA Astrophysics Data System (ADS)

Yamamoto, Toshihiro; Nakajima, Yoshiki; Takei, Tatsuya; Fujisaki, Yoshihide; Fukagawa, Hirohiko; Suzuki, Mitsunori; Motomura, Genichi; Sato, Hiroto; Tokito, Shizuo; Fujikake, Hideo

2011-02-01

A new driving scheme for an active-matrix organic light emitting diode (AMOLED) display was developed to prevent the picture quality degradation caused by the hysteresis characteristics of organic thin film transistors (OTFTs). In this driving scheme, the gate electrode voltage of a driving-OTFT is directly controlled through the storage capacitor so that the operating point for the driving-OTFT is on the same hysteresis curve for every pixel after signal data are stored in the storage capacitor. Although the number of OTFTs in each pixel for the AMOLED display is restricted because OTFT size should be large enough to drive organic light emitting diodes (OLEDs) due to their small carrier mobility, it can improve the picture quality for an OTFT-driven flexible OLED display with the basic two transistor-one capacitor circuitry.

Limits of social mobilization

PubMed Central

Rutherford, Alex; Cebrian, Manuel; Dsouza, Sohan; Moro, Esteban; Pentland, Alex; Rahwan, Iyad

2013-01-01

The Internet and social media have enabled the mobilization of large crowds to achieve time-critical feats, ranging from mapping crises in real time, to organizing mass rallies, to conducting search-and-rescue operations over large geographies. Despite significant success, selection bias may lead to inflated expectations of the efficacy of social mobilization for these tasks. What are the limits of social mobilization, and how reliable is it in operating at these limits? We build on recent results on the spatiotemporal structure of social and information networks to elucidate the constraints they pose on social mobilization. We use the DARPA Network Challenge as our working scenario, in which social media were used to locate 10 balloons across the United States. We conduct high-resolution simulations for referral-based crowdsourcing and obtain a statistical characterization of the population recruited, geography covered, and time to completion. Our results demonstrate that the outcome is plausible without the presence of mass media but lies at the limit of what time-critical social mobilization can achieve. Success relies critically on highly connected individuals willing to mobilize people in distant locations, overcoming the local trapping of diffusion in highly dense areas. However, even under these highly favorable conditions, the risk of unsuccessful search remains significant. These findings have implications for the design of better incentive schemes for social mobilization. They also call for caution in estimating the reliability of this capability. PMID:23576719

An overview on real-time control schemes for wheeled mobile robot

NASA Astrophysics Data System (ADS)

Radzak, M. S. A.; Ali, M. A. H.; Sha’amri, S.; Azwan, A. R.

2018-04-01

The purpose of this paper is to review real-time control motion algorithms for wheeled mobile robot (WMR) when navigating in environment such as road. Its need a good controller to avoid collision with any disturbance and maintain a track error at zero level. The controllers are used with other aiding sensors to measure the WMR’s velocities, posture, and interference to estimate the required torque to be applied on the wheels of mobile robot. Four main categories for wheeled mobile robot control systems have been found in literature which are namely: Kinematic based controller, Dynamic based controllers, artificial intelligence based control system, and Active Force control. A MATLAB/Simulink software is the main software to simulate and implement the control system. The real-time toolbox in MATLAB/SIMULINK are used to receive/send data from sensors/to actuator with presence of disturbances, however others software such C, C++ and visual basic are rare to be used.

A security scheme of SMS system

NASA Astrophysics Data System (ADS)

Zhang, Fangzhou; Yang, Hong-Wei; Song, Chuck

2005-02-01

With the prosperous development and the use of SMS, more and more important information need to be transferred through the wireless and mobile networks by the users. But in the GSM/GPRS network, the SMS messages are transferred in text mode through the signaling channel and there is no integrality for SMS messages. Because of the speciality of the mobile communications, the security of signaling channel is very weak. So we need to improve and enhance the security and integrality of SMS. At present, developed investigation based on SMS security is still incomplete. The key distribution and management is not perfect to meet the usability in a wide area. This paper introduces a high-level security method to solve this problem. We design the Secure SMS of GSM/GPRS in order to improve the security of the important information that need to be transferred by the mobile networks. Using this method, we can improve the usability of E-payment and other mobile electronic commerce.

High-resolution, low-delay, and error-resilient medical ultrasound video communication using H.264/AVC over mobile WiMAX networks.

PubMed

Panayides, Andreas; Antoniou, Zinonas C; Mylonas, Yiannos; Pattichis, Marios S; Pitsillides, Andreas; Pattichis, Constantinos S

2013-05-01

In this study, we describe an effective video communication framework for the wireless transmission of H.264/AVC medical ultrasound video over mobile WiMAX networks. Medical ultrasound video is encoded using diagnostically-driven, error resilient encoding, where quantization levels are varied as a function of the diagnostic significance of each image region. We demonstrate how our proposed system allows for the transmission of high-resolution clinical video that is encoded at the clinical acquisition resolution and can then be decoded with low-delay. To validate performance, we perform OPNET simulations of mobile WiMAX Medium Access Control (MAC) and Physical (PHY) layers characteristics that include service prioritization classes, different modulation and coding schemes, fading channels conditions, and mobility. We encode the medical ultrasound videos at the 4CIF (704 × 576) resolution that can accommodate clinical acquisition that is typically performed at lower resolutions. Video quality assessment is based on both clinical (subjective) and objective evaluations.

Separation of very hydrophobic analytes by micellar electrokinetic chromatography IV. Modeling of the effective electrophoretic mobility from carbon number equivalents and octanol-water partition coefficients.

PubMed

Huhn, Carolin; Pyell, Ute

2008-07-11

It is investigated whether those relationships derived within an optimization scheme developed previously to optimize separations in micellar electrokinetic chromatography can be used to model effective electrophoretic mobilities of analytes strongly differing in their properties (polarity and type of interaction with the pseudostationary phase). The modeling is based on two parameter sets: (i) carbon number equivalents or octanol-water partition coefficients as analyte descriptors and (ii) four coefficients describing properties of the separation electrolyte (based on retention data for a homologous series of alkyl phenyl ketones used as reference analytes). The applicability of the proposed model is validated comparing experimental and calculated effective electrophoretic mobilities. The results demonstrate that the model can effectively be used to predict effective electrophoretic mobilities of neutral analytes from the determined carbon number equivalents or from octanol-water partition coefficients provided that the solvation parameters of the analytes of interest are similar to those of the reference analytes.

Structured back gates for high-mobility two-dimensional electron systems using oxygen ion implantation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berl, M., E-mail: mberl@phys.ethz.ch; Tiemann, L.; Dietsche, W.

2016-03-28

We present a reliable method to obtain patterned back gates compatible with high mobility molecular beam epitaxy via local oxygen ion implantation that suppresses the conductivity of an 80 nm thick silicon doped GaAs epilayer. Our technique was optimized to circumvent several constraints of other gating and implantation methods. The ion-implanted surface remains atomically flat which allows unperturbed epitaxial overgrowth. We demonstrate the practical application of this gating technique by using magneto-transport spectroscopy on a two-dimensional electron system (2DES) with a mobility exceeding 20 × 10{sup 6} cm{sup 2}/V s. The back gate was spatially separated from the Ohmic contacts of the 2DES,more » thus minimizing the probability for electrical shorts or leakage and permitting simple contacting schemes.« less

Distributed Dynamic Host Configuration Protocol (D2HCP)

PubMed Central

Villalba, Luis Javier García; Matesanz, Julián García; Orozco, Ana Lucila Sandoval; Díaz, José Duván Márquez

2011-01-01

Mobile Ad Hoc Networks (MANETs) are multihop wireless networks of mobile nodes without any fixed or preexisting infrastructure. The topology of these networks can change randomly due to the unpredictable mobility of nodes and their propagation characteristics. In most networks, including MANETs, each node needs a unique identifier to communicate. This work presents a distributed protocol for dynamic node IP address assignment in MANETs. Nodes of a MANET synchronize from time to time to maintain a record of IP address assignments in the entire network and detect any IP address leaks. The proposed stateful autoconfiguration scheme uses the OLSR proactive routing protocol for synchronization and guarantees unique IP addresses under a variety of network conditions, including message losses and network partitioning. Simulation results show that the protocol incurs low latency and communication overhead for IP address assignment. PMID:22163856

Evolutionary programming-based univector field navigation method for past mobile robots.

PubMed

Kim, Y J; Kim, J H; Kwon, D S

2001-01-01

Most of navigation techniques with obstacle avoidance do not consider the robot orientation at the target position. These techniques deal with the robot position only and are independent of its orientation and velocity. To solve these problems this paper proposes a novel univector field method for fast mobile robot navigation which introduces a normalized two dimensional vector field. The method provides fast moving robots with the desired posture at the target position and obstacle avoidance. To obtain the sub-optimal vector field, a function approximator is used and trained by evolutionary programming. Two kinds of vector fields are trained, one for the final posture acquisition and the other for obstacle avoidance. Computer simulations and real experiments are carried out for a fast moving mobile robot to demonstrate the effectiveness of the proposed scheme.

Distributed Dynamic Host Configuration Protocol (D2HCP).

PubMed

Villalba, Luis Javier García; Matesanz, Julián García; Orozco, Ana Lucila Sandoval; Díaz, José Duván Márquez

2011-01-01

Mobile Ad Hoc Networks (MANETs) are multihop wireless networks of mobile nodes without any fixed or preexisting infrastructure. The topology of these networks can change randomly due to the unpredictable mobility of nodes and their propagation characteristics. In most networks, including MANETs, each node needs a unique identifier to communicate. This work presents a distributed protocol for dynamic node IP address assignment in MANETs. Nodes of a MANET synchronize from time to time to maintain a record of IP address assignments in the entire network and detect any IP address leaks. The proposed stateful autoconfiguration scheme uses the OLSR proactive routing protocol for synchronization and guarantees unique IP addresses under a variety of network conditions, including message losses and network partitioning. Simulation results show that the protocol incurs low latency and communication overhead for IP address assignment.

A CityGML extension for traffic-sign objects that guides the automatic processing of data collected using Mobile Mapping technology

NASA Astrophysics Data System (ADS)

Varela-González, M.; Riveiro, B.; Arias-Sánchez, P.; González-Jorge, H.; Martínez-Sánchez, J.

2014-11-01

The rapid evolution of integral schemes, accounting for geometric and semantic data, has been importantly motivated by the advances in the last decade in mobile laser scanning technology; automation in data processing has also recently influenced the expansion of the new model concepts. This paper reviews some important issues involved in the new paradigms of city 3D modelling: an interoperable schema for city 3D modelling (cityGML) and mobile mapping technology to provide the features that composing the city model. This paper focuses in traffic signs, discussing their characterization using cityGML in order to ease the implementation of LiDAR technology in road management software, as well as analysing some limitations of the current technology in the labour of automatic detection and classification.