Functional elements in the minimal promoter of the human proton-coupled folate transporter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G., E-mail: assaraf@tx.technion.ac.il
2009-10-09
The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 andmore » AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.« less
Lloyd, G S; Busby, S J; Savery, N J
1998-01-01
During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching
2015-01-01
Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda
2012-09-01
Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.
Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R
1988-01-01
We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343
Cloning and functional analysis of 5'-upstream region of the Pokemon gene.
Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang
2008-04-01
Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.
Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I
1990-03-25
The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.
1988-01-01
Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less
Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L
1999-09-24
To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.
Mavrothalassitis, G J; Watson, D K; Papas, T S
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393
Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S
1997-01-01
GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313
Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.
Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R
2008-09-15
Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.
Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László
2005-01-01
DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291
Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László
2005-01-01
DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.
Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U
1999-11-19
As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.
Alphavirus replicon approach to promoterless analysis of IRES elements.
Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F
2007-04-10
Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.
Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements
Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.
2007-01-01
Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813
Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta
2008-07-01
Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.
Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W
1989-12-01
A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.
Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.
Lo, W Y; Ting, L P
1994-01-01
Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237
Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh
2012-09-01
The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henderson, S.L.; Ryan, K.; Sollner-Webb, B.
1989-02-01
We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less
Mutations That Stimulate flhDC Expression in Escherichia coli K-12.
Fahrner, Karen A; Berg, Howard C
2015-10-01
Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L
1993-01-01
The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364
Strategies for enhancing bioluminescent bacterial sensor performance by promoter region manipulation
Bilic, Benny; Belkin, Shimshon
2010-01-01
Genetically engineered microbial reporter strains are based upon the fusion of an inducible sensing element upstream of a reporting element, so that the construct emits a dose-dependent signal when exposed to the inducing compound(s) or stress factor(s). In this communication1 we described several general approaches undertaken in order to enhance the sensing performance of such promoter::reporter fusions. Significant improvements in detection sensitivity, response kinetics and signal intensity were achieved by modi fication of the length of the promoter-containing DNA fragment, by random or site-directed mutagenesis and by promoter duplication. The general nature of these genetics manipulations makes them applicable to other types of promoter::reporter fusions. PMID:21326942
Modulation of tissue repair by regeneration enhancer elements.
Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D
2016-04-14
How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.
Link, Gerhard
1984-01-01
A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540
Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.
Stone, D E; Craig, E A
1990-01-01
To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281
Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization
Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue
2010-01-01
Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873
Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho
2014-01-01
The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877
Means, A L; Farnham, P J
1990-02-01
We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).
Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A
2013-03-01
Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.
Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef
2012-01-01
The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559
Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P
1984-01-01
We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950
Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.
Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A
1999-08-01
Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.
Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B
1995-01-01
Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.
Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH
1990-01-01
We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968
D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W
1995-09-01
Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.
Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M
2015-12-01
Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.
Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P
1992-01-01
Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166
Isolation and characterization of a novel pollen-specific promoter in maize (Zea mays L.).
Wang, He; Fan, Mingxia; Wang, Guohong; Zhang, Chunyu; Shi, Lei; Wei, Zhengyi; Ma, Wenjuan; Chang, Jing; Huang, Senxin; Lin, Feng
2017-06-01
ZmSTK2_USP, located on the long arm of chromosome 4, belongs to the serine/threonine kinase gene in maize. The sequence analysis of 2100 bp upstream from the start codon ATG has shown that it contains cis-element motifs and two types of anther/pollen-specific promoter elements (GTGA and AGAAA), suggesting that it is the pollen-specific promoter. To investigate the function of ZmSTK2_USP promoter, the GUS gene fusion system was employed. In proZmSTK2_USP-GUS genetically modified plants, GUS activity was detected in mature pollen grains and pollen tubes but not found in other floral and vegetative tissues. These results show that proZmSTK2_USP is the pollen-specific promoter and drives pollen-specific activity during the middle stage of pollen development until pollen maturation.
Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong
2017-03-01
To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi
Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less
Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude
2005-01-01
Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058
Gaji, Rajshekhar Y; Howe, Daniel K
2009-07-01
The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.
Lazennec, G; Kern, L; Valotaire, Y; Salbert, G
1997-01-01
The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383
Calonge, María Julia; Seoane, Joan; Massagué, Joan
2004-05-28
A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.
Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133
2009-01-01
Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581
Wang, F; Samudio, I; Safe, S
2001-01-01
The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Kim, K H; Hemenway, C
1997-05-26
The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.
Genome-wide mapping of autonomous promoter activity in human cells
van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas
2017-01-01
Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146
Song, Shun; Xu, Yi; Huang, Dongmei; Miao, Hongxia; Liu, Juhua; Jia, Caihong; Hu, Wei; Valarezo, Ana Valeria; Xu, Biyu; Jin, Zhiqiang
2018-07-01
Drought and salt stresses often affect plant growth and crop yields. Identification of promoters involved in drought and salt stress responses is of great significance for genetic improvement of crop resistance. Our previous studies showed that aquaporin can respond to drought and salt stresses, but its promoter has not yet been reported in plants. In the present study, cis-acting elements of MaAQP family member promoters were systematically analyzed in banana. Expression of MaTIP1; 2 was induced by drought and salt stresses but not sensitive to cold stress, waterlogging stress, or mechanical damage, and its promoter contained five stress-related cis-acting elements. The MaTIP1; 2 promoter (841 bp upstream of translation initiation site) from banana (Musa acuminata L. AAA group cv. Brazilian) was isolated through genome walking polymerase chain reaction, and found to contain a TATA Box, CAAT box, ABRE element, CCGTCC box, CGTCA motif, and TCA element. Transformation of the MaTIP1; 2 promoter into Arabidopsis to assess its function indicated that it responds to both drought and salt stress treatments. These results suggest that MaTIP1; 2 utilization may improve drought and salt stresses resistance of the transgenic plants by promoting banana aquaporin expression. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R
1997-09-05
To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.
Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T
1993-12-22
The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.
Fisher, R P; Topper, J N; Clayton, D A
1987-07-17
Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.
Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A
2008-12-01
Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.
Perros, M; Deleu, L; Vanacker, J M; Kherrouche, Z; Spruyt, N; Faisst, S; Rommelaere, J
1995-01-01
The activity of the P4 promoter of the parvovirus minute virus of mice (prototype strain MVMp) is stimulated in ras-transformed FREJ4 cells compared with the parental FR3T3 line. This activation may participate in the oncolytic effect of parvoviruses, given that P4 drives a transcriptional unit encoding cytotoxic nonstructural proteins. Our results suggest that the higher transcriptional activity of promoter P4 in FREJ4 cells is mediated at least in part by upstream CRE elements. Accordingly, mutations in the CRE motifs impair P4 function more strongly in the FREJ4 derivative than in its FR3T3 parent. Further evidence that these elements contribute to hyperactivity of the P4 promoter in the ras transformant is the fact that they form distinct complexes with proteins from FREJ4 and FR3T3 cell extracts. This difference can be abolished by treating the FREJ4 cell extracts with cyclic AMP-dependent protein kinase (PKA) or treating original cultures with a PKA activator. These findings can be linked with two previously reported features of ras-transformed cells: the activation of a PKA-inhibited protein kinase cascade and the reduction of PKA-induced protein phosphorylation. In keeping with these facts, P4-directed gene expression can be up- or downmodulated in vivo by exposing cells to known inhibitors or activators of PKA, respectively. PMID:7636996
Grichnik, J M; French, B A; Schwartz, R J
1988-01-01
The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124
E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.
Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie
2008-08-01
Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.
Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*
Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.
2011-01-01
Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829
Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.
2014-01-01
The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924
Schörg, Alexandra; Santambrogio, Sara; Platt, James L.; Schödel, Johannes; Lindenmeyer, Maja T.; Cohen, Clemens D.; Schrödter, Katrin; Mole, David R.; Wenger, Roland H.; Hoogewijs, David
2015-01-01
A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the −82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the −82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the −82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. PMID:26007655
Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R
1996-03-01
In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.
Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi
2014-08-01
Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.
Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F
1999-01-01
In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.
2010-01-01
Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545
Ho, Margaret C. W.; Schiller, Benjamin J.; Akbari, Omar S.; Bae, Esther; Drewell, Robert A.
2011-01-01
There are many examples within gene complexes of transcriptional enhancers interacting with only a subset of target promoters. A number of molecular mechanisms including promoter competition, insulators and chromatin looping are thought to play a role in regulating these interactions. At the Drosophila bithorax complex (BX-C), the IAB5 enhancer specifically drives gene expression only from the Abdominal-B (Abd-B) promoter, even though the enhancer and promoter are 55 kb apart and are separated by at least three insulators. In previous studies, we discovered that a 255 bp cis-regulatory module, the promoter tethering element (PTE), located 5′ of the Abd-B transcriptional start site is able to tether IAB5 to the Abd-B promoter in transgenic embryo assays. In this study we examine the functional role of the PTE at the endogenous BX-C using transposon-mediated mutagenesis. Disruption of the PTE by P element insertion results in a loss of enhancer-directed Abd-B expression during embryonic development and a homeotic transformation of abdominal segments. A partial deletion of the PTE and neighboring upstream genomic sequences by imprecise excision of the P element also results in a similar loss of Abd-B expression in embryos. These results demonstrate that the PTE is an essential component of the regulatory network at the BX-C and is required in vivo to mediate specific long-range enhancer-promoter interactions. PMID:21283702
Functional Architecture of T7 RNA Polymerase Transcription Complexes
Nayak, Dhananjaya; Guo, Qing; Sousa, Rui
2007-01-01
Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086
FAT1 cadherin acts upstream of Hippo signalling through TAZ to regulate neuronal differentiation.
Ahmed, Abdulrzag F; de Bock, Charles E; Lincz, Lisa F; Pundavela, Jay; Zouikr, Ihssane; Sontag, Estelle; Hondermarck, Hubert; Thorne, Rick F
2015-12-01
The Hippo pathway is emerging as a critical nexus that balances self-renewal of progenitors against differentiation; however, upstream elements in vertebrate Hippo signalling are poorly understood. High expression of Fat1 cadherin within the developing neuroepithelium and the manifestation of severe neurological phenotypes in Fat1-knockout mice suggest roles in neurogenesis. Using the SH-SY5Y model of neuronal differentiation and employing gene silencing techniques, we show that FAT1 acts to control neurite outgrowth, also driving cells towards terminal differentiation via inhibitory effects on proliferation. FAT1 actions were shown to be mediated through Hippo signalling where it activated core Hippo kinase components and antagonised functions of the Hippo effector TAZ. Suppression of FAT1 promoted the nucleocytoplasmic shuttling of TAZ leading to enhanced transcription of the Hippo target gene CTGF together with accompanying increases in nuclear levels of Smad3. Silencing of TAZ reversed the effects of FAT1 depletion thus connecting inactivation of TAZ-TGFbeta signalling with Hippo signalling mediated through FAT1. These findings establish FAT1 as a new upstream Hippo element regulating early stages of differentiation in neuronal cells.
Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E
2007-10-01
Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-01-01
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934
Qiao, Huan; May, James M.
2013-01-01
SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893
Promoter and Terminator Discovery and Engineering.
Deaner, Matthew; Alper, Hal S
Control of gene expression is crucial to optimize metabolic pathways and synthetic gene networks. Promoters and terminators are stretches of DNA upstream and downstream (respectively) of genes that control both the rate at which the gene is transcribed and the rate at which mRNA is degraded. As a result, both of these elements control net protein expression from a synthetic construct. Thus, it is highly important to discover and engineer promoters and terminators with desired characteristics. This chapter highlights various approaches taken to catalogue these important synthetic elements. Specifically, early strategies have focused largely on semi-rational techniques such as saturation mutagenesis to diversify native promoters and terminators. Next, in an effort to reduce the length of the synthetic biology design cycle, efforts in the field have turned towards the rational design of synthetic promoters and terminators. In this vein, we cover recently developed methods such as hybrid engineering, high throughput characterization, and thermodynamic modeling which allow finer control in the rational design of novel promoters and terminators. Emphasis is placed on the methodologies used and this chapter showcases the utility of these methods across multiple host organisms.
Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J
1996-01-01
The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664
Cogoi, Susanna; Paramasivam, Manikandan; Membrino, Alexandro; Yokoyama, Kazunari K.; Xodo, Luigi E.
2010-01-01
The murine KRAS promoter contains a G-rich nuclease hypersensitive element (GA-element) upstream of the transcription start site that is essential for transcription. Pulldown and chromatin immunoprecipitation assays demonstrate that this GA-element is bound by the Myc-associated zinc finger (MAZ) and poly(ADP-ribose) polymerase 1 (PARP-1) proteins. These proteins are crucial for transcription, because when they are knocked down by short hairpin RNA, transcription is down-regulated. This is also the case when the poly(ADP-ribosyl)ation activity of PARP-1 is inhibited by 3,4-dihydro-5-[4-(1-piperidinyl) butoxyl]-1(2H) isoquinolinone. We found that MAZ specifically binds to the duplex and quadruplex conformations of the GA-element, whereas PARP-1 shows specificity only for the G-quadruplex. On the basis of fluorescence resonance energy transfer melting and polymerase stop assays we saw that MAZ stabilizes the KRAS quadruplex. When the capacity of folding in the GA-element is abrogated by specific G → T or G → A point mutations, KRAS transcription is down-regulated. Conversely, guanidine-modified phthalocyanines, which specifically interact with and stabilize the KRAS G-quadruplex, push the promoter activity up to more than double. Collectively, our data support a transcription mechanism for murine KRAS that involves MAZ, PARP-1 and duplex-quadruplex conformational changes in the promoter GA-element. PMID:20457603
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less
Negi, Sanjana; Tak, Himanshu; Ganapathi, T R
2018-01-01
Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.
2018-01-01
Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404
Insulators form gene loops by interacting with promoters in Drosophila.
Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2011-09-01
Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.
Control of asgE Expression during Growth and Development of Myxococcus xanthus
Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell
2000-01-01
One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904
Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.
Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A
2016-03-18
Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.
1987-11-01
To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less
Buckbinder, L; Miralles, V J; Reinberg, D
1989-01-01
We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661
Schörg, Alexandra; Santambrogio, Sara; Platt, James L; Schödel, Johannes; Lindenmeyer, Maja T; Cohen, Clemens D; Schrödter, Katrin; Mole, David R; Wenger, Roland H; Hoogewijs, David
2015-07-13
A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the -82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the -82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the -82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy
2018-05-09
Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.
Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh
2011-04-29
Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.
A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.
Clos, J; Buttgereit, D; Grummt, I
1986-01-01
A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157
Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U
2000-09-22
Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.
Zaide, Galia; Grosfeld, Haim; Ehrlich, Sharon; Zvi, Anat; Cohen, Ofer; Shafferman, Avigdor
2011-03-01
Two alternative promoter trap libraries, based on the green fluorescence protein (gfp) reporter and on the chloramphenicol acetyltransferase (cat) cassette, were constructed for isolation of potent Francisella tularensis promoters. Of the 26,000 F. tularensis strain LVS gfp library clones, only 3 exhibited visible fluorescence following UV illumination and all appeared to carry the bacterioferritin promoter (Pbfr). Out of a total of 2,000 chloramphenicol-resistant LVS clones isolated from the cat promoter library, we arbitrarily selected 40 for further analysis. Over 80% of these clones carry unique F. tularensis DNA sequences which appear to drive a wide range of protein expression, as determined by specific chloramphenicol acetyltransferase (CAT) Western dot blot and enzymatic assays. The DNA sequence information for the 33 unique and novel F. tularensis promoters reported here, along with the results of in silico and primer extension analyses, suggest that F. tularensis possesses classical Escherichia coli σ(70)-related promoter motifs. These motifs include the -10 (TATAAT) and -35 [TTGA(C/T)A] domains and an AT-rich region upstream from -35, reminiscent of but distinct from the E. coli upstream region that is termed the UP element. The most efficient promoter identified (Pbfr) appears to be about 10 times more potent than the F. tularensis groEL promoter and is probably among the strongest promoters in F. tularensis. The battery of promoters identified in this work will be useful, among other things, for genetic manipulation in the background of F. tularensis intended to gain better understanding of the mechanisms involved in pathogenesis and virulence, as well as for vaccine development studies.
Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.
Joshee, N; Kisaka, H; Kitagawa, Y
1998-01-01
One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.
Widespread promoter-mediated coordination of transcription and mRNA degradation
2012-01-01
Background Previous work showed that mRNA degradation is coordinated with transcription in yeast, and in several genes the control of mRNA degradation was linked to promoter elements through two different mechanisms. Here we show at the genomic scale that the coordination of transcription and mRNA degradation is promoter-dependent in yeast and is also observed in humans. Results We first demonstrate that swapping upstream cis-regulatory sequences between two yeast species affects both transcription and mRNA degradation and suggest that while some cis-regulatory elements control either transcription or degradation, multiple other elements enhance both processes. Second, we show that adjacent yeast genes that share a promoter (through divergent orientation) have increased similarity in their patterns of mRNA degradation, providing independent evidence for the promoter-mediated coupling of transcription to mRNA degradation. Finally, analysis of the differences in mRNA degradation rates between mammalian cell types or mammalian species suggests a similar coordination between transcription and mRNA degradation in humans. Conclusions Our results extend previous studies and suggest a pervasive promoter-mediated coordination between transcription and mRNA degradation in yeast. The diverse genes and regulatory elements associated with this coordination suggest that it is generated by a global mechanism of gene regulation and modulated by gene-specific mechanisms. The observation of a similar coupling in mammals raises the possibility that coupling of transcription and mRNA degradation may reflect an evolutionarily conserved phenomenon in gene regulation. PMID:23237624
2013-01-01
Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Control site location and transcriptional regulation in Escherichia coli.
Collado-Vides, J; Magasanik, B; Gralla, J D
1991-01-01
The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993
Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E
2012-01-01
Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.
Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E
2012-01-01
Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895
Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.
Kageyama, R; Merlino, G T; Pastan, I
1989-09-15
Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.
cis- and trans-acting elements of the estrogen-regulated vitellogenin gene B1 of Xenopus laevis.
Wahli, W; Martinez, E; Corthésy, B; Cardinaux, J R
1989-01-01
Vitellogenin genes are expressed under strict estrogen control in the liver of female oviparous vertebrates. Gene transfer experiments using estrogen-responsive cells have shown that the 13 bp perfect palindromic element GGTCACTGTGACC found upstream of the Xenopus laevis vitellogenin gene A2 promoter mediates hormonal stimulation and thus, was called the estrogen-responsive element (ERE). In the Xenopus vitellogenin genes B1 and B2 there are two closely adjacent EREs with one or more base substitutions when compared to the consensus ERE GGTCANNNTGACC. On their own, these degenerated elements have only a low or no regulatory capacity at all but act together synergistically to form an estrogen-responsive unit (ERU) with the same strength as the perfect palindromic 13 bp element. Analysis of estrogen receptor binding to the gene B1 ERU revealed a cooperative interaction of receptor dimers to the two adjacent imperfect EREs which most likely explains the synergistic stimulation observed in vivo. Furthermore, a promoter activator element located between positions --113 and --42 of the gene B1 and functional in the human MCF-7 and the Xenopus B3.2 cells has been identified and shown to be involved in the high level of induced transcription activity when the ERE is placed at a distance from the promoter. Finally, a hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to characterize two additional novel cis-acting elements within the vitellogenin gene B1 promoter. One of them, a negative regulatory element (NRE), is responsible for repression of promoter activity in the absence of hormone. The second is related to the NF-I binding site and is required, together with the ERE, to mediate hormonal induction. Moreover, we detected three trans-acting activities in Xenopus liver nuclear extracts that interact with these regions and demonstrated that they participate in the regulation of the expression of the vitellogenin promoter in vitro.
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-07-27
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook
2002-07-26
The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.
Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.
2003-01-01
In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432
Transcriptional activation of Mina by Sp1/3 factors.
Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark
2013-01-01
Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.
Transcriptional Activation of Mina by Sp1/3 Factors
Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark
2013-01-01
Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617
The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster
Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.
1993-01-01
A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong
2010-09-01
As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.
Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei
2015-01-01
LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444
Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R
1995-11-11
The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.
Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R
1995-01-01
The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455
Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...
2016-03-26
Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less
Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1988-01-01
Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031
Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.
Schreiber, T; Tissier, A
2016-01-01
The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.
Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S
2000-06-01
17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.
Robinett, C C; O'Connor, A; Dunaway, M
1997-01-01
We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta
2016-01-15
Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R
1994-05-01
Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.
Plant, Ewan P; Rakauskaite, Rasa; Taylor, Deborah R; Dinman, Jonathan D
2010-05-01
In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed -1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the -1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a "golden mean" model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins.
Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L
1998-07-01
Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.
Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V
2016-01-01
In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less
Liu, Mary Y.; Khachigian, Levon M.
2009-01-01
Understanding the mechanisms governing cytokine control of growth factor expression in smooth muscle cells would provide invaluable insight into the molecular regulation of vascular phenotypes and create future opportunities for therapeutic intervention. Here, we report that the proinflammatory cytokine interleukin (IL)-1β suppresses platelet-derived growth factor (PDGF)-D promoter activity and mRNA and protein expression in smooth muscle cells. NF-κB p65, induced by IL-1β, interacts with a novel element in the PDGF-D promoter and inhibits PDGF-D transcription. Interferon regulatory factor-1 (IRF-1) is also induced by IL-1β and binds to a different element upstream in the promoter. Immunoprecipitation and chromatin immunoprecipitation experiments showed that IL-1β stimulates p65 interaction with IRF-1 and the accumulation of both factors at the PDGF-D promoter. Mutation of the IRF-1 and p65 DNA-binding elements relieved the promoter from IL-1β-mediated repression. PDGF-D repression by IL-1β involves histone deacetylation and interaction of HDAC-1 with IRF-1 and p65. HDAC-1 small interfering RNA ablates complex formation with IRF-1 and p65 and abrogates IRF-1 and p65 occupancy of the PDGF-D promoter. Thus, HDAC-1 is enriched at the PDGF-D promoter in cells exposed to IL-1β and forms a cytokine-inducible gene-silencing complex with p65 and IRF-1. PMID:19843519
Olsen, J; Lefebvre, O; Fritsch, C; Troelsen, J T; Orian-Rousseau, V; Kedinger, M; Simon-Assmann, P
2000-01-01
Laminin-5 is a trimer of laminin alpha3, beta3 and gamma2 chains that is found in the intestinal basement membrane. Deposition of the laminin gamma2 chain at the basement membrane is of great interest because it undergoes a developmental shift in its cellular expression. Here we study the regulatory elements that control basal and cytokine-activated transcriptional expression of the LAMC2 gene, which encodes the laminin gamma2 chain. By using transient transfection experiments we demonstrated the presence of constitutive and cytokine-responsive cis-elements. Comparison of the transcriptional activity of the LAMC2 promoter in the epithelial HT29mtx cells with that in small-intestinal fibroblastic cells (C20 cells) led us to conclude that two regions with constitutive epithelium-specific activity are present between positions -1.2 and -0.12 kb. This was further validated by transfections of primary foetal intestinal endoderm and mesenchyme. A 2.5 kb portion of the LAMC2 5' flanking region was equally responsive to PMA and hepatocyte growth factor (HGF), whereas it was less responsive to transforming growth factor beta1. A minimal promoter limited to the initial 120 bp upstream of the transcriptional start site maintained inducibility by PMA and HGF. This short promoter fragment contains two activator protein 1 (AP-1) elements and the 5'-most of these is a composite AP-1/Sp1 element. The 5'AP-1 element is crucial to the HGF-mediated activity of the promoter; analysis of interacting nuclear proteins demonstrated that AP-1 proteins containing JunD mediate the response to HGF. PMID:10749670
Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis
NASA Astrophysics Data System (ADS)
Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew
2015-09-01
An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.
Seal, S N; Davis, D L; Burch, J B
1991-05-01
The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.
Computational methods in sequence and structure prediction
NASA Astrophysics Data System (ADS)
Lang, Caiyi
This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed a software package which is capable of designing novel protein structures at the atomic resolution. This software package allows us to perform protein structure design with a flexible backbone. The backbone flexibility includes loop region relaxation as well as a secondary structure collective mode relaxation scheme. (Abstract shortened by UMI.)
Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.
Gilmartin, G M; Fleming, E S; Oetjen, J
1992-01-01
The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577
Plant, Ewan P.; Rakauskaitė, Rasa; Taylor, Deborah R.; Dinman, Jonathan D.
2010-01-01
In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed −1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the −1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a “golden mean” model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins. PMID:20164235
Efficient activation of transcription in yeast by the BPV1 E2 protein.
Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M
1989-01-01
The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584
Manavella, Pablo A; Dezar, Carlos A; Ariel, Federico D; Chan, Raquel L
2008-10-01
HAHB4 is a sunflower gene encoding a homeodomain-leucine zipper (HD-Zip) transcription factor. It was previously demonstrated that this gene is regulated at the transcriptional level by several abiotic factors and hormones. A previous analysis in the PLACE database revealed the presence of four putative ABREs. In this work these four elements and also one W-box and two root-specific expression elements were characterized as functional. Site-directed mutagenesis on the promoter, stable transformation of Arabidopis plants as well as transient transformation of sunflower leaves, were performed. The analysis of the transformants was carried out by histochemistry and real time RT-PCR. The results indicate that just one ABRE out of the four is responsible for ABA, NaCl and drought regulation. However, NaCl induction occurs also by an additional ABA-independent way involving another two overlapped ABREs. On the other hand, it was determined that the W-box located 5' upstream is responsive to ethylene and only two root-specific expression elements, among the several detected, are functional but redundant. Conservation of molecular mechanisms between sunflower and Arabidopsis is strongly supported by this experimental work.
Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.
2007-01-01
Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009
Buermeyer, A B; Thompson, N E; Strasheim, L A; Burgess, R R; Farnham, P J
1992-05-01
We examined the ability of purified RNA polymerase (RNAP) II lacking the carboxy-terminal heptapeptide repeat domain (CTD), called RNAP IIB, to transcribe a variety of promoters in HeLa extracts in which endogenous RNAP II activity was inhibited with anti-CTD monoclonal antibodies. Not all promoters were efficiently transcribed by RNAP IIB, and transcription did not correlate with the in vitro strength of the promoter or with the presence of a consensus TATA box. This was best illustrated by the GC-rich, non-TATA box promoters of the bidirectional dihydrofolate reductase (DHFR)-REP-encoding locus. Whereas the REP promoter was transcribed by RNAP IIB, the DHFR promoter remained inactive after addition of RNAP IIB to the antibody-inhibited reactions. However, both promoters were efficiently transcribed when purified RNAP with an intact CTD was added. We analyzed a series of promoter deletions to identify which cis elements determine the requirement for the CTD of RNAP II. All of the promoter deletions of both DHFR and REP retained the characteristics of their respective full-length promoters, suggesting that the information necessary to specify the requirement for the CTD is contained within approximately 65 bp near the initiation site. Furthermore, a synthetic minimal promoter of DHFR, consisting of a single binding site for Sp1 and a binding site for the HIP1 initiator cloned into a bacterial vector sequence, required RNAP II with an intact CTD for activity in vitro. Since the synthetic minimal promoter of DHFR and the smallest REP promoter deletion are both activated by Sp1, the differential response in this assay does not result from upstream activators. However, the sequences around the start sites of DHFR and REP are not similar and our data suggest that they bind different proteins. Therefore, we propose that specific initiator elements are important for determination of the requirement of some promoters for the CTD.
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Pavelitz, Thomas; Bailey, Arnold D.; Elco, Christopher P.; Weiner, Alan M.
2008-01-01
In mammals, small multigene families generate spliceosomal U snRNAs that are nearly as abundant as rRNA. Using the tandemly repeated human U2 genes as a model, we show by footprinting with DNase I and permanganate that nearly all sequences between the enhancer-like distal sequence element and the initiation site are protected during interphase whereas the upstream half of the U2 snRNA coding region is exposed. We also show by chromatin immunoprecipitation that the SNAPc complex, which binds the TATA-like proximal sequence element, is removed at metaphase but remains bound under conditions that induce locus-specific metaphase fragility of the U2 genes, such as loss of CSB, BRCA1, or BRCA2 function, treatment with actinomycin D, or overexpression of the tetrameric p53 C terminus. We propose that the U2 snRNA promoter establishes a persistently open state to facilitate rapid reinitiation and perhaps also to bypass TFIIH-dependent promoter melting; this open state would then be disassembled to allow metaphase chromatin condensation. PMID:18378697
Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.
2011-01-01
Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290
Ueki, Toshiyuki; Inouye, Sumiko
2003-01-01
Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461
Characterization of Rous sarcoma virus polyadenylation site use in vitro
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maciolek, Nicole L.; McNally, Mark T.
2008-05-10
Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less
Retrotransposon Tf1 is targeted to pol II promoters by transcription activators
Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.
2008-01-01
SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330
Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.
Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L
2008-04-11
The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.
Nadjar-Boger, Elisabeth; Hinits, Yaniv; Funkenstein, Bruria
2012-09-25
Myostatin (MSTN) is a negative regulator of skeletal muscle growth. In contrast to mammals, fish possess at least two paralogs of MSTN: MSTN-1 and MSTN-2. In this study, we analyzed the structural-functional features of the four variants of Sparus aurata MSTN-2 5'-flanking region: saMSTN-2a, saMSTN-2as, saMSTN-2b and saMSTN-2c. In silico analysis revealed numerous putative cis regulatory elements including several E-boxes known as binding sites to myogenic transcription factors. Transient transfection experiments using non-muscle and muscle cell lines showed surprisingly high transcriptional activity in muscle cells, suggesting the presence of regulatory elements unique to differentiated myotubes. These observations were confirmed by in situ intramuscular injections of promoter DNA followed by reporter gene assays. Moreover, high promoter activity was found in differentiated neural cell, in agreement with MSTN-2 expression in brain. Progressive 5'-deletion analysis, using reporter gene assays, showed that the core promoter is located within the first -127 bp upstream of the ATG, and suggested the presence of regulatory elements that either repress or induce transcriptional activity. Transient transgenic zebrafish provided evidence for saMSTN-2 promoter ability to direct GFP expression to myofibers. Finally, our data shows that although no mature saMSTN-2 mRNA is observed in muscle; unspliced forms accumulate, confirming high level of transcription. In conclusion, our study shows for the first time that MSTN-2 promoter is a very robust promoter, especially in muscle cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Nadjar-Boger, Elisabeth; Funkenstein, Bruria
2011-02-01
Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.
Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro
2011-01-01
Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884
Childers, Delma S; Kadosh, David
2015-01-01
Candida albicans is the most frequently isolated human fungal pathogen and can cause a range of mucosal and systemic infections in immunocompromised individuals. Morphogenesis, the ability to undergo a reversible transition from budding yeast to elongated filaments, is an essential virulence trait. The yeast-to-filament transition is associated with expression of genes specifically important for filamentation as well as other virulence-related processes, and is controlled, in part, by the key transcriptional regulators Nrg1 and Ume6. Both of these regulators are themselves controlled at the transcriptional level by filament-inducing environmental cues, although little is known about how this process occurs. In order to address this question and determine whether environmental signals regulate transcription of UME6 and NRG1 via distinct and/or common promoter elements, we performed promoter deletion analyses. Strains bearing promoter deletion constructs were induced to form filaments in YEPD plus 10% serum at 37°C, Spider medium (nitrogen and carbon starvation) and/or Lee's medium pH 6.8 (neutral pH) and reporter gene expression was measured. In the NRG1 promoter we identified several distinct condition-specific response elements for YEPD plus 10% serum at 37°C and Spider medium. In the UME6 promoter we also identified response elements for YEPD plus 10% serum at 37°C. While a few of these elements are distinct, others overlap with those which respond to Lee's pH 6.8 medium. Consistent with UME6 possessing a very long 5' UTR, many response elements in the UME6 promoter are located significantly upstream from the coding sequence. Our data indicate that certain distinct condition-specific elements can control expression of C. albicans UME6 and NRG1 in response to key filament-inducing environmental cues. Because C. albicans encounters a variety of host microenvironments during infection, our results suggest that UME6 and NRG1 expression can be differentially modulated by multiple signaling pathways to control filamentation and virulence in vivo.
Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni
2014-01-01
Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Tissue-specific expression of squirrel monkey chorionic gonadotropin
Vasauskas, Audrey A.; Hubler, Tina R.; Boston, Lori; Scammell, Jonathan G.
2010-01-01
Pituitary gonadotropins LH and FSH play central roles in reproductive function. In Old World primates, LH stimulates ovulation in females and testosterone production in males. Recent studies have found that squirrel monkeys and other New World primates lack expression of LH in the pituitary. Instead, chorionic gonadotropin (CG), which is normally only expressed in the placenta of Old World primates, is the active luteotropic pituitary hormone in these animals. The goal of this study was to investigate the tissue-specific regulation of squirrel monkey CG. We isolated the squirrel monkey CGβ gene and promoter from genomic DNA from squirrel monkey B-lymphoblasts and compared the promoter sequence to that of the common marmoset, another New World primate, and human CGβ and LHβ. Using reporter gene assays, we found that a squirrel monkey CGβ promoter fragment (−1898/+9) is active in both mouse pituitary LβT2 and human placenta JEG3 cells, but not in rat adrenal PC12 cells. Furthermore, within this construct separate cis-elements are responsible for pituitary- and placenta-specific expression. Pituitary-specific expression is governed by Egr-1 binding sites in the proximal 250 bp of the promoter, whereas placenta-specific expression is controlled by AP-2 sites further upstream. Thus, selective expression of the squirrel monkey CGβ promoter in pituitary and placental cells is governed by distinct cis-elements that exhibit homology with human LHβ and marmoset CGβ promoters, respectively. PMID:21130091
Characterization of a Maize Wip1 Promoter in Transgenic Plants
Zhang, Shengxue; Lian, Yun; Liu, Yan; Wang, Xiaoqing; Liu, Yunjun; Wang, Guoying
2013-01-01
The Maize Wip1 gene encodes a wound-induced Bowman-Birk inhibitor (BBI) protein which is a type of serine protease inhibitor, and its expression is induced by wounding or infection, conferring resistance against pathogens and pests. In this study, the maize Wip1 promoter was isolated and its function was analyzed. Different truncated Wip1 promoters were fused upstream of the GUS reporter gene and transformed into Arabidopsis, tobacco and rice plants. We found that (1) several truncated maize Wip1 promoters led to strong GUS activities in both transgenic Arabidopsis and tobacco leaves, whereas low GUS activity was detected in transgenic rice leaves; (2) the Wip1 promoter was not wound-induced in transgenic tobacco leaves, but was induced by wounding in transgenic rice leaves; (3) the truncated Wip1 promoter had different activity in different organs of transgenic tobacco plants; (4) the transgenic plant leaves containing different truncated Wip1 promoters had low GUS transcripts, even though high GUS protein level and GUS activities were observed; (5) there was one transcription start site of Wip1 gene in maize and two transcription start sites of GUS in Wip1::GUS transgenic lines; (6) the adjacent 35S promoter which is present in the transformation vectors enhanced the activity of the truncated Wip1 promoters in transgenic tobacco leaves, but did not influence the disability of truncated Wip1231 promoter to respond to wounding signals. We speculate that an ACAAAA hexamer, several CAA trimers and several elements similar to ACAATTAC octamer in the 5′-untranslated region might contribute to the strong GUS activity in Wip1231 transgenic lines, meanwhile, compared to the 5′-untranslated region from Wip1231 transgenic lines, the additional upstream open reading frames (uORFs) in the 5′-untranslated region from Wip1737 transgenic lines might contribute to the lower level of GUS transcript and GUS activity. PMID:24322445
He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun
2017-08-23
The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.
Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus
Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.
2001-01-01
Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505
Guzina, Jelena
2016-01-01
ABSTRACT Extracytoplasmic function (ECF) σ factors are the largest and the most diverse group of alternative σ factors, but their mechanisms of transcription are poorly studied. This subfamily is considered to exhibit a rigid promoter structure and an absence of mixing and matching; both −35 and −10 elements are considered necessary for initiating transcription. This paradigm, however, is based on very limited data, which bias the analysis of diverse ECF σ subgroups. Here we investigate DNA and protein recognition motifs involved in ECF σ factor transcription by a computational analysis of canonical ECF subfamily members, much less studied ECF σ subgroups, and the group outliers, obtained from recently sequenced bacteriophages. The analysis identifies an extended −10 element in promoters for phage ECF σ factors; a comparison with bacterial σ factors points to a putative 6-amino-acid motif just C-terminal of domain σ2, which is responsible for the interaction with the identified extension of the −10 element. Interestingly, a similar protein motif is found C-terminal of domain σ2 in canonical ECF σ factors, at a position where it is expected to interact with a conserved motif further upstream of the −10 element. Moreover, the phiEco32 ECF σ factor lacks a recognizable −35 element and σ4 domain, which we identify in a homologous phage, 7-11, indicating that the extended −10 element can compensate for the lack of −35 element interactions. Overall, the results reveal greater flexibility in promoter recognition by ECF σ factors than previously recognized and raise the possibility that mixing and matching also apply to this group, a notion that remains to be biochemically tested. IMPORTANCE ECF σ factors are the most numerous group of alternative σ factors but have been little studied. Their promoter recognition mechanisms are obscured by the large diversity within the ECF σ factor group and the limited similarity with the well-studied housekeeping σ factors. Here we extensively compare bacterial and bacteriophage ECF σ factors and their promoters in order to infer DNA and protein recognition motifs involved in transcription initiation. We predict a more flexible promoter structure than is recognized by the current paradigm, which assumes rigidness, and propose that ECF σ promoter elements may complement (mix and match with) each other's strengths. These results warrant the refocusing of research efforts from the well-studied housekeeping σ factors toward the physiologically highly important, but insufficiently understood, alternative σ factors. PMID:27137497
Weeda, G; Ma, L B; van Ham, R C; van der Eb, A J; Hoeijmakers, J H
1991-01-01
The human XPBC/ERCC-3 was cloned by virtue of its ability to correct the excision repair defect of UV-sensitive rodent mutants of complementation group 3. The gene appeared to be in addition implicated in the human, cancer prone repair disorder xeroderma pigmentosum group B, which is also associated with Cockayne's syndrome. Here we present the genomic architecture of the gene and its expression. The XPBC/ERCC-3 gene consists of at least 14 exons spread over approximately 45 kb. Notably, the donor splice site of the third exon contains a GC instead of the canonical GT dinucleotide. The promoter region, first exon and intron comprise a CpG island with several putative GC boxes. The promoter was confined to a region of 260 bp upstream of the presumed cap site and acts bidirectionally. Like the promoter of another excision repair gene, ERCC-1, it lacks classical promoter elements such as CAAT and TATA boxes, but it shares with ERCC-1 a hitherto unknown 12 nucleotide sequence element, preceding a polypyrimidine track. Despite the presence of (AU)-rich elements in the 3'-untranslated region, which are thought to be associated with short mRNA half-life actinomycin-D experiments indicate that the mRNA is very stable (t 1/2 greater than 3h). Southern blot analysis revealed the presence of XPBC/ERCC-3 cross-hybridizing fragments elsewhere in the genome, which may belong to a related gene. Images PMID:1956789
DOE Office of Scientific and Technical Information (OSTI.GOV)
Asaduzzaman, Md.; Kinoshita, Shigeharu, E-mail: akino@mail.ecc.u-tokyo.ac.jp; Bhuiyan, Sharmin Siddique
The myosin heavy chain gene, MYH{sub M86-2}, exhibited restricted expression in slow muscle fibers of torafugu embryos and larvae, suggesting its functional roles for embryonic and larval muscle development. However, the transcriptional mechanisms involved in its expression are still ambiguous. The present study is the first extensive analysis of slow muscle-specific MYH{sub M86-2} promoter in fish for identifying the cis-elements that are crucial for its expression. Combining both transient transfection and transgenic approaches, we demonstrated that the 2614 bp 5′-flanking sequences of MYH{sub M86-2} contain a sufficient promoter activity to drive gene expression specific to superficial slow muscle fibers. Bymore » cyclopamine treatment, we also demonstrated that the differentiation of such superficial slow muscle fibers depends on hedgehog signaling activity. The deletion analyses defined an upstream fragment necessary for repressing ectopic MYH{sub M86-2} expression in the fast muscle fibers. The transcriptional mechanism that prevents MYH{sub M86-2} expression in the fast muscle fibers is mediated through Sox6 binding elements. We also demonstrated that Sox6 may function as a transcriptional repressor of MYH{sub M86-2} expression. We further discovered that nuclear factor of activated T cells (NFAT) binding elements plays a key role and myocyte enhancer factor-2 (MEF2) binding elements participate in the transcriptional regulation of MYH{sub M86-2} expression. - Highlights: ► MYH{sub M86-2} is highly expressed in slow muscle fibers of torafugu embryos and larvae. ► MYH{sub M86-2} promoter activity depends on the hedgehog signaling. ► Sox6 binding elements inhibits MYH{sub M86-2} expression in fast muscle fibers. ► Sox6 elements function as transcriptional repressor of MYH{sub M86-2} promoter activity. ► NFAT and MEF2 binding elements play a key role for directing MYH{sub M86-2} expression.« less
Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2007-01-01
Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.
Apparatus for purifying exhaust gases of internal combustion engines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kakinuma, O.; Oya, H.
1980-06-03
Apparatus for purifying the exhaust gases of internal combustion engines is disclosed is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a shell having an inlet chamber, catalyst chamber, and an outlet chamber. The axial lines of the inlet ports are arranged to cross each other in the inlet chamber at a position near, but upstream of, the upstream facing end of said monolithic catalyst element, so that gas flow can diffuse to the entire plane of the element.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamaji, Takashi; Lopez, David; Pellegrini, Matteo
Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less
Mammalian monogamy is not controlled by a single gene
Fink, Sabine; Excoffier, Laurent; Heckel, Gerald
2006-01-01
Complex social behavior in Microtus voles and other mammals has been postulated to be under the direct genetic control of a single locus: the arginine vasopressin 1a receptor (avpr1a) gene. Using a phylogenetic approach, we show that a repetitive element in the promoter region of avpr1a, which reportedly causes social monogamy, is actually widespread in nonmonogamous Microtus and other rodents. There was no evidence for intraspecific polymorphism in regard to the presence or absence of the repetitive element. Among 25 rodent species studied, the element was absent in only two closely related nonmonogamous species, indicating that this absence is certainly the result of an evolutionarily recent loss. Our analyses further demonstrate that the repetitive structures upstream of the avpr1a gene in humans and primates, which have been associated with social bonding, are evolutionarily distinct from those in rodents. Our evolutionary approach reveals that monogamy in rodents is not controlled by a single polymorphism in the promoter region of the avpr1a gene. We thus resolve the contradiction between the claims for an evolutionarily conserved genetic programming of social behavior in mammals and the vast evidence for highly complex and flexible mating systems. PMID:16832060
Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G
2000-06-01
The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.
Clustering in large networks does not promote upstream reciprocity.
Masuda, Naoki
2011-01-01
Upstream reciprocity (also called generalized reciprocity) is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution.
Clustering in Large Networks Does Not Promote Upstream Reciprocity
Masuda, Naoki
2011-01-01
Upstream reciprocity (also called generalized reciprocity) is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution. PMID:21998641
Transcriptional regulation by retinoic acid of interleukin-2 alpha receptors in human B cells.
Bhatti, L; Sidell, N
1994-01-01
In this study, we demonstrated that retinoic acid (RA) up-regulated interleukin-2 receptor-alpha (IL-2R alpha) expression on two human B-cell lines, IE8.6 and SKW6.4. Deleted forms of the human IL-2R alpha promoter linked to the bacterial chloramphenicol acetyltransferase reporter gene were transfected into IE8.6 cells in order to define RA-responsive regulatory domains. Experiments using the -1.6 kb construct, which contains all known regulatory regions in the IL-2R alpha promoter, indicated that RA could induce IL-2R alpha promoter activity. The basal activity of the -471 construct was initially low, but was markedly enhanced by the addition of RA. Deletion of promoter sequences between -471 and -317 resulted in a significant augmentation of basal promoter activity and abolished promoter induction by RA. This finding revealed a requirement for sequences 5' of base -317 for RA-induced promoter activation, raising the possibility of the presence of both a RA response element and a negative regulatory element (NRE) upstream of base -317. Transfection studies with internal deletion mutants with the putative NRE removed resulted in increases in basal promoter activity and unresponsiveness to RA similar to the -317 construct. In contrast, an internal deletion mutant with the NRE intact had low basal activity and was inducible by RA similar to the -471 construct. Taken together, our results suggested that RA-induced activation of the IL-2R alpha promoter was through changes in the function of a NRE present between bases -400 and -368. This 31-base pair element may interact with an adjacent RA-responsive regulatory site as well as being responsible for down-regulation of basal IL-2R alpha expression under certain conditions. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8157276
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com
Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less
Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou
2012-07-01
The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
Rapid detection of biothreat agents based on cellular machinery.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lane, Todd W.; Gantt, Richard W.
This research addresses rapid and sensitive identification of biological agents in a complex background. We attempted to devise a method by which the specificity of the cellular transcriptional machinery could be used to detect and identify bacterial bio-terror agents in a background of other organisms. Bacterial cells contain RNA polymerases and transcription factors that transcribe genes into mRNA for translation into proteins. RNA polymerases in conjunction with transcription factors recognize regulatory elements (promoters) upstream of the gene. These promoters are, in many cases, recognized by the polymerase and transcription factor combinations of one species only. We have engineered a plasmid,more » for Escherichia coli, containing the virA promoter from the target species Shigella flexneri. This promoter was fused to a reporter gene Green Fluorescent Protein (GFP). In theory the indicator strain (carrying the plasmid) is mixed with the target strain and the two are lysed. The cellular machinery from both cells mixes and the GFP is produced. This report details the results of testing this system.« less
Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H
1999-10-28
We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.
Prieur, Xavier; Coste, Herve; Rodriguez, Joan C
2003-07-11
The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.
Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.
Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping
2017-04-01
The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.
2014-01-01
Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182
Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.
Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C
2010-05-01
Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.
Lens-Specific Gene Recruitment of ζ-Crystallin through Pax6, Nrl-Maf, and Brain Suppressor Sites
Sharon-Friling, Ronit; Richardson, Jill; Sperbeck, Sally; Lee, Douglas; Rauchman, Michael; Maas, Richard; Swaroop, Anand; Wistow, Graeme
1998-01-01
ζ-Crystallin is a taxon-specific crystallin, an enzyme which has undergone direct gene recruitment as a structural component of the guinea pig lens through a Pax6-dependent mechanism. Tissue specificity arises through a combination of effects involving three sites in the lens promoter. The Pax6 site (ZPE) itself shows specificity for an isoform of Pax6 preferentially expressed in lens cells. High-level expression of the promoter requires a second site, identical to an αCE2 site or half Maf response element (MARE), adjacent to the Pax6 site. A promoter fragment containing Pax6 and MARE sites gives lens-preferred induction of a heterologous promoter. Complexes binding the MARE in lens nuclear extracts are antigenically related to Nrl, and cotransfection with Nrl elevates ζ-crystallin promoter activity in lens cells. A truncated ζ promoter containing Nrl-MARE and Pax6 sites has a high level of expression in lens cells in transgenic mice but is also active in the brain. Suppression of the promoter in the brain requires sequences between −498 and −385, and a site in this region forms specific complexes in brain extract. A three-level model for lens-specific Pax6-dependent expression and gene recruitment is suggested: (i) binding of a specific isoform of Pax6; (ii) augmentation of expression through binding of Nrl or a related factor; and (iii) suppression of promoter activity in the central nervous system by an upstream negative element in the brain but not in the lens. PMID:9528779
Li, Yang; Lv, Zhaohui; Zhu, Jie; Lin, Jing; Ding, Lihua; Ye, Qinong
2016-01-01
The DEK oncogene is overexpressed in various cancers and overexpression of DEK correlates with poor clinical outcome. Vascular endothelial growth factor (VEGF) is the most important regulator of tumor angiogenesis, a process essential for tumor growth and metastasis. However, whether DEK enhances tumor angiogenesis remains unclear. Here, we show that DEK is a key regulator of VEGF expression and tumor angiogenesis. Using chromatin immunoprecipitation assay, we found that DEK promoted VEGF transcription in breast cancer cells (MCF7, ZR75-1 and MDA-MB-231) by directly binding to putative DEK-responsive element (DRE) of the VEGF promoter and indirectly binding to hypoxia response element (HRE) upstream of the DRE through its interaction with the transcription factor hypoxia-inducible factor 1α (HIF-1α), a master regulator of tumor angiogenesis and growth. DEK is responsible for recruitment of HIF-1α and the histone acetyltransferase p300 to the VEGF promoter. DEK-enhanced VEGF increases vascular endothelial cell proliferation, migration and tube formation as well as angiogenesis in the chick chorioallantoic membrane. DEK promotes tumor angiogenesis and growth in nude mice in HIF-1α-dependent and -independent manners. Immunohistochemical staining showed that DEK expression positively correlates with the expression of VEGF and microvessel number in 58 breast cancer patients. Our data establish DEK as a sequence-specific binding transcription factor, a novel coactivator for HIF-1α in regulation of VEGF transcription and a novel promoter of angiogenesis. PMID:26988756
Qiao, Huan; May, James M.
2011-01-01
The sodium-dependent vitamin C transporter (SVCT) 2 is crucial for ascorbate uptake in metabolically active and specialized tissues. The present study focused on the gene regulation of the SVCT2 exon 1b, which is ubiquitously expressed in human and mouse tissues. Although the human SVCT2 exon 1b promoter doesn’t contain a classical TATA-box, we found that it does contain a functional initiator (Inr) that binds YY1 and interacts with upstream Sp1/Sp3 elements in the proximal promoter region. These elements in turn play a critical role in regulating YY1-mediated transcription of the exon 1b gene. Formation of YY1/Sp complexes on the promoter is required for its optional function. YY1 with Sp1 or Sp3 synergistically enhanced exon 1b promoter activity as well as the endogenous SVCT2 protein expression. Further, in addition to Sp1/Sp3 both EGR-1 and -2 were detected in the protein complexes that bound the three GC boxes bearing overlapping binding sites for EGR/WT1 and Sp1/3. The EGR family factors, WT1 and MAZ were found to differentially regulate exon 1b promoter activity. These results show that differential occupancy of transcription factors on the GC-rich consensus sequences in SVCT2 exon 1b promoter contributes to the regulation of cell and tissue expression of SVCT2. PMID:21335086
Tissue-specific expression of squirrel monkey chorionic gonadotropin.
Vasauskas, Audrey A; Hubler, Tina R; Boston, Lori; Scammell, Jonathan G
2011-02-01
Pituitary gonadotropins LH and FSH play central roles in reproductive function. In Old World primates, LH stimulates ovulation in females and testosterone production in males. Recent studies have found that squirrel monkeys and other New World primates lack expression of LH in the pituitary. Instead, chorionic gonadotropin (CG), which is normally only expressed in the placenta of Old World primates, is the active luteotropic pituitary hormone in these animals. The goal of this study was to investigate the tissue-specific regulation of squirrel monkey CG. We isolated the squirrel monkey CGβ gene and promoter from genomic DNA from squirrel monkey B-lymphoblasts and compared the promoter sequence to that of the common marmoset, another New World primate, and human and rhesus macaque CGβ and LHβ. Using reporter gene assays, we found that a squirrel monkey CGβ promoter fragment (-1898/+9) is active in both mouse pituitary LβT2 and human placenta JEG3 cells, but not in rat adrenal PC12 cells. Furthermore, within this construct separate cis-elements are responsible for pituitary- and placenta-specific expression. Pituitary-specific expression is governed by Egr-1 binding sites in the proximal 250 bp of the promoter, whereas placenta-specific expression is controlled by AP-2 sites further upstream. Thus, selective expression of the squirrel monkey CGβ promoter in pituitary and placental cells is governed by distinct cis-elements that exhibit homology with human LHβ and marmoset CGβ promoters, respectively. Copyright © 2010 Elsevier Inc. All rights reserved.
Qin, Yu-Xiang; Qin, Fangyuan
2016-02-01
Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Walsh, Mary F; Ampasala, Dinakar R; Rishi, Arun K; Basson, Marc D
2009-02-01
TGF-beta and FAK modulate cell migration, differentiation, proliferation and apoptosis, and TGF-beta promotes FAK transcription in intestinal epithelial cells via Smad-dependent and independent pathways. We utilized a 1320 bp FAK promoter-luciferase construct to characterize basal and TGF-beta-mediated FAK gene transcription in IEC-6 cells. Inhibiting JNK or Akt negated TGF-beta-stimulated promoter activity; ERK inhibition did not block the TGF-beta effect but increased basal activity. Co-transfection with Co-Smad4 enhanced the TGF-beta response while the inhibitory Smad7 abolished it. Serial deletions sequentially removing the four Smad binding elements (SBE) in the 5' untranslated region of the promoter revealed that the two most distal SBE's are positive regulators while SBE3 exerts a negative influence. Mutational deletion of two upstream p53 sites enhanced basal but did not affect TGF-beta-stimulated increases in promoter activity. TGF-beta increased DNA binding of Smad4, phospho-Smad2/3 and Runx1/AML1a to the most distal 435 bp containing 3 SBE and 2 AML1a sites by ChIP assay. However, although point mutation of SBE1 ablated the TGF-beta-mediated rise in SV40-promoter activity, mutation of AML1a sites did not. TGF-beta regulation of FAK transcription reflects a complex interplay between positive and negative non-Smad signals and SBE's, the last independent of p53 or AML1a.
Enhancer elements upstream of the SHOX gene are active in the developing limb.
Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun
2010-05-01
Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.
Enhancer elements upstream of the SHOX gene are active in the developing limb
Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun
2010-01-01
Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128
Prazak, Lisa; Fujioka, Miki; Gergen, J. Peter
2010-01-01
The relatively simple combinatorial rules responsible for establishing the initial metameric expression of sloppy-paired-1 (slp1) in the Drosophila blastoderm embryo make this system an attractive model for investigating the mechanism of regulation by pair rule transcription factors. This investigation of slp1 cis-regulatory architecture identifies two distinct elements, a proximal early stripe element (PESE) and a distal early stripe element (DESE) located from −3.1 kb to −2.5 kb and from −8.1 kb to −7.1 kb upstream of the slp1 promoter, respectively, that mediate this early regulation. The proximal element expresses only even-numbered stripes and mediates repression by Even-skipped (Eve) as well as by the combination of Runt and Fushi-tarazu (Ftz). A 272 basepair sub-element of PESE retains Eve-dependent repression, but is expressed throughout the even-numbered parasegments due to the loss of repression by Runt and Ftz. In contrast, the distal element expresses both odd and even-numbered stripes and also drives inappropriate expression in the anterior half of the odd-numbered parasegments due to an inability to respond to repression by Eve. Importantly, a composite reporter gene containing both early stripe elements recapitulates pair-rule gene-dependent regulation in a manner beyond what is expected from combining their individual patterns. These results indicate interactions involving distinct cis-elements contribute to the proper integration of pair-rule regulatory information. A model fully accounting for these results proposes that metameric slp1 expression is achieved through the Runt-dependent regulation of interactions between these two pair-rule response elements and the slp1 promoter. PMID:20435028
COUP-TF1 antagonizes Nkx2.5-mediated activation of the calreticulin gene during cardiac development.
Guo, L; Lynch, J; Nakamura, K; Fliegel, L; Kasahara, H; Izumo, S; Komuro, I; Agellon, L B; Michalak, M
2001-01-26
Calreticulin, a Ca(2+) binding chaperone of the endoplasmic reticulum, is also highly expressed in the embryonic heart, and knockout of the calreticulin gene is lethal during embryogenesis because of impaired cardiac development. The protein is down-regulated after birth, and elevated expression of calreticulin in newborn hearts is associated with severe cardiac pathology and death. Here we show that the transcription factor Nkx2.5 activates expression of the calreticulin gene in the heart. Binding of chicken ovalbumin upstream promoter-transcription factor 1 to the Nkx2.5 binding site suppresses transcription from the calreticulin promoter. Nkx2.5 and chicken ovalbumin upstream promoter-transcription factor 1 play antagonistic roles in regulating the expression of calreticulin during cardiac development. These studies indicate that cardiac-specific transcription factor Nkx2.5 plays a central role in activating calreticulin expression and that there is a cooperation between chicken ovalbumin upstream promoter-transcription factor 1 and Nkx2.5 at the calreticulin promoter.
NASA Astrophysics Data System (ADS)
Pasten, P.; Guerra, P. A.; Simonson, K.; Bonilla, C.; Pizarro, G. E.; Escauriaza, C. R.; González, C.
2014-12-01
The importance of hydrologic-geochemical interactions in arid environments is a controlling factor in quality and quantity of water available for human consumption and agriculture. When acid drainage affects these watersheds, water quality is gravely degraded. Despite its effect on watersheds, the relationship between time changes in hydrological variables and water quality in arid regions has not been studied thoroughly. Temporal variations in acid drainage can control when the transport of toxic elements is increased. We performed field work at the Azufre River (pH 2, E.C~10.9 mS/cm) and Caracarani River (pH 8.7, E.C~1.2 mS/cm) confluence, located in the Northern Chilean Altiplano (at 4000 m asl). We registered stream flowrates (total flowrate~430 L/s), temperature and electric conductivity (E.C) hourly using in-stream data loggers during one year. We also measured turbidity and pH during one field survey at different distances from the junction, as a proxy of the formation of iron-aluminum particles that cycle trace elements in these environments. We found turbidity-pH diurnal cycles were caused by upstream hourly changes in upstream flowrate: when the Caracarani River flowrate reached its daily peak, particle formation occurred, while the dissolution of particles occurred when the Azufre River reached its maximum value. This last process occurred due to upstream freeze-thaw cycles. This study shows how the dynamics of natural confluences determines chemical transport. The formation of particles enriched in toxic elements can promote settling as a natural attenuation process, while their dissolution will produce their release and transport long distances downstream. It is important to consider time as an important variable in water quality monitoring and in water management infrastructure where pulses of contamination can have potentially negative effects in its use. Acknowledgements: Funding was provided by "Proyecto Fondecyt 1130936" and "CONICYT/FONDAP 15110020".
Cerveau, Nicolas; Gilbert, Clément; Liu, Chao; Garrett, Roger A; Grève, Pierre; Bouchon, Didier; Cordaux, Richard
2015-06-10
Transposable elements (TEs) are DNA pieces that are present in almost all the living world at variable genomic density. Due to their mobility and density, TEs are involved in a large array of genomic modifications. In eukaryotes, TE expression has been studied in detail in several species. In prokaryotes, studies of IS expression are generally linked to particular copies that induce a modification of neighboring gene expression. Here we investigated global patterns of IS transcription in the Alphaproteobacterial endosymbiont Wolbachia wVulC, using both RT-PCR and bioinformatic analyses. We detected several transcriptional promoters in all IS groups. Nevertheless, only one of the potentially functional IS groups possesses a promoter located upstream of the transposase gene, that could lead up to the production of a functional protein. We found that the majority of IS groups are expressed whatever their functional status. RT-PCR analyses indicate that the transcription of two IS groups lacking internal promoters upstream of the transposase start codon may be driven by the genomic environment. We confirmed this observation with the transcription analysis of individual copies of one IS group. These results suggest that the genomic environment is important for IS expression and it could explain, at least partly, copy number variability of the various IS groups present in the wVulC genome and, more generally, in bacterial genomes. Copyright © 2015 Elsevier B.V. All rights reserved.
Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni
2014-01-01
Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183
Murthy, S C; Bhat, G P; Thimmappaya, B
1985-01-01
A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577
Tetramethylpyrazine-Inducible Promoter Region from Rhodococcus jostii TMP1.
Stanislauskienė, Rūta; Kutanovas, Simonas; Kalinienė, Laura; Bratchikov, Maksim; Meškys, Rolandas
2018-06-25
An inducible promoter region, P TTMP (tetramethylpyrazine [TTMP]), has been identified upstream of the tpdABC operon, which contains the genes required for the initial degradation of 2,3,5,6-tetramethylpyrazine in Rhodococcus jostii TMP1 bacteria. In this work, the promoter region was fused with the gene for the enhanced green fluorescent protein (EGFP) to investigate the activity of P TTMP by measuring the fluorescence of bacteria. The highest promoter activity was observed when bacteria were grown in a nutrient broth (NB) medium supplemented with 5 mM 2,3,5,6-tetramethylpyrazine for 48 h. Using a primer extension reaction, two transcriptional start sites for tpdA were identified, and the putative −35 and −10 promoter motifs were determined. The minimal promoter along with two 15 bp long direct repeats and two 7 bp inverted sequences were identified. Also, the influence of the promoter elements on the activity of P TTMP were determined using site-directed mutagenesis. Furthermore, P TTMP was shown to be induced by pyrazine derivatives containing methyl groups in the 2- and 5-positions of the heterocyclic ring, in the presence of the LuxR family transcriptional activator TpdR.
Hepatocyte nuclear factor-4alpha is a central transactivator of the mouse Ntcp gene.
Geier, Andreas; Martin, Ina V; Dietrich, Christoph G; Balasubramaniyan, Natarajan; Strauch, Sonja; Suchy, Frederick J; Gartung, Carsten; Trautwein, Christian; Ananthanarayanan, Meenakshisundaram
2008-08-01
Sodium taurocholate cotransporting polypeptide (Ntcp) is the major uptake system for conjugated bile acids. Deletions of hepatocyte nuclear factor (HNF)-1alpha and retinoid X receptor-alpha:retinoic acid receptor-alpha binding sites in the mouse 5'-flanking region corresponding to putatively central regulatory elements of rat Ntcp do not significantly reduce promoter activity. We hypothesized that HNF-4alpha, which is increasingly recognized as a central regulator of hepatocyte function, may directly transactivate mouse (mNtcp). A 1.1-kb 5'-upstream region including the mouse Ntcp promoter was cloned and compared with the rat promoter. In contrast to a moderate 3.5-fold activation of mNtcp by HNF-1alpha, HNF-4alpha cotransfection led to a robust 20-fold activation. Deletion analysis of mouse and rat Ntcp promoters mapped a conserved HNF-4alpha consensus site at -345/-326 and -335/-316 bp, respectively. p-475bpmNtcpLUC is not transactivated by HNF-1alpha but shows a 50-fold enhanced activity upon cotransfection with HNF-4alpha. Gel mobility shift assays demonstrated a complex of the HNF-4alpha-element formed with liver nuclear extracts that was blocked by an HNF-4alpha specific antibody. HNF-4alpha binding was confirmed by chromatin immunoprecipitation. Using Hepa 1-6 cells, HNF-4alpha-knockdown resulted in a significant 95% reduction in NTCP mRNA. In conclusion, mouse Ntcp is regulated by HNF-4alpha via a conserved distal cis-element independently of HNF-1alpha.
Sorkina, Alina; Bardosh, Gabriel; Liu, Yong-Zhong; Fridman, Ifat; Schlizerman, Ludmila; Zur, Naftali; Or, Etti; Goldschmidt, Eliezer E; Blumwald, Eduardo; Sadka, Avi
2011-09-01
While searching for genes expressed in acid lemon but not in acidless lime pulp, we isolated clone Cl111 which showed the following expression phenotypes: (1) while it was expressed in the ovaries in both varieties, its mRNA was detected only in the pulp of the acid fruit, (2) no or very low expression of the gene was detected in vegetative organs. These expression patterns suggested that Cl111 is an ovary- and pulp-specific gene. The ability of ~2-kb fragments upstream of the transcription start site of the lemon and lime genes to confer reporter-gene activity was investigated by transient expression in isolated juice vesicles of both varieties. Whereas Cl111 promoter from lemon showed faint activity in lemon and lime juice vesicles, no activity was evident with the lime promoter. The activities of the 2-kb fragments and their delimited fragments were further investigated in tomato. The results indicated that the promoters were active in a manner similar to that in acid lemon and acidless lime: the lemon promoter generated activity in the fruit endocarp, analogous to citrus fruit pulp. The delimitation analyses identified an expression-conferring region which, in the lemon promoter, contained a sequence homologous to a fruit-specific element of the melon cucumisin gene. Another region, which reduced promoter activity, contained an I-Box-like sequence, identified as a fruit-specific negative element. Taken together, Cl111 promoter was confirmed to be pulp- and flower-specific. Differences in the expression of Cl111 between the two varieties could be attributable to changes in the gene promoter region.
Yoshino, M; Tsutsumi, K; Kanazawa, A
2015-01-01
β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
Bottacini, Francesca; Zomer, Aldert; Milani, Christian; Ferrario, Chiara; Lugli, Gabriele Andrea; Egan, Muireann; Ventura, Marco; van Sinderen, Douwe
2017-12-28
Bifidobacterium breve represents a common member of the infant gut microbiota and its presence in the gut has been associated with host well being. For this reason it is relevant to investigate and understand the molecular mechanisms underlying the establishment, persistence and activities of this gut commensal in the host environment. The assessment of vegetative promoters in the bifidobacterial prototype Bifidobacterium breve UCC2003 was performed employing a combination of RNA tiling array analysis and cDNA sequencing. Canonical -10 (TATAAT) and -35 (TTGACA) sequences were identified upstream of transcribed genes or operons, where deviations from this consensus correspond to transcription level variations. A Random Forest analysis assigned the -10 region of B. breve promoters as the element most impacting on the level of transcription, followed by the spacer length and the 5'-UTR length of transcripts. Furthermore, our transcriptome study also identified rho-independent termination as the most common and effective termination signal of highly and moderately transcribed operons in B. breve. The present study allowed us to identify genes and operons that are actively transcribed in this organism during logarithmic growth, and link promoter elements with levels of transcription of essential genes in this organism. As homologs of many of our identified genes are present across the whole genus Bifidobacterium, our dataset constitutes a transcriptomic reference to be used for future investigations of gene expression in members of this genus.
HSF and Msn2/4p can exclusively or cooperatively activate the yeast HSP104 gene.
Grably, Melanie R; Stanhill, Ariel; Tell, Osnat; Engelberg, David
2002-04-01
In an effort to understand how an accurate level of stress-specific expression is obtained, we studied the promoter of the yeast HSP104 gene. Through 5' deletions, we defined a 334 bp fragment upstream of the first coding AUG as sufficient and essential for maximal basal activity and a 260 bp fragment as sufficient and essential for heat shock responsiveness. These sequences contain heat shock elements (HSEs) and stress response elements (STREs) that cooperate to achieve maximal inducible expression. However, in the absence of one set of factors (e.g. in msn2Deltamsn4Delta cells) proper induction is obtained exclusively through HSEs. We also show that HSP104 is constitutively derepressed in ras2Delta cells. This derepression is achieved exclusively through activation of STREs, with no role for HSEs. Strikingly, in ras2Deltamsn2Deltamsn4Delta cells the HSP104 promoter is also derepressed, but in this strain derepression is mediated through HSEs, showing the flexibility and adaptation of the promoter. Thus, appropriate transcription of HSP104 is usually obtained through cooperation between the Msn2/4/STRE and the HSF/ HSE systems, but each factor could activate the promoter alone, backing up the other. Transcription control of HSP104 is adaptive and robust, ensuring proper expression under extreme conditions and in various mutants.
The ygaVP Genes of Escherichia coli Form a Tributyltin-Inducible Operon▿ †
Gueuné, Hervé; Durand, Marie-José; Thouand, Gérald; DuBow, Michael S.
2008-01-01
A tributyltin (TBT) luxAB transcriptional fusion in Escherichia coli revealed that a TBT-activated promoter is located upstream of two cotranscribed orphan genes, ygaV and ygaP. We demonstrate that transcription from the promoter upstream of ygaVP is constitutive in a ygaVP mutant, suggesting that YgaV is an autoregulated, TBT-inducible repressor. PMID:18245262
Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel
2017-07-01
Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.
Improved Dual-Luciferase Reporter Assays for Nuclear Receptors
Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank
2010-01-01
Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560
Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.
1988-01-01
To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981
Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald
2015-08-15
Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. © 2015. Published by The Company of Biologists Ltd.
NASA Technical Reports Server (NTRS)
Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.
1999-01-01
Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.
van der Fits, L; Zhang, H; Menke, F L; Deneka, M; Memelink, J
2000-11-01
Plants respond to pathogen attack by induction of various defence responses, including the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the elicitor-induced expression of the terpenoid indole alkaloid biosynthetic gene Strictosidine synthase (Str) is mediated via the plant stress hormonejasmonate. In the promoters of several defence-related genes, cis-acting elements have been identified that are important for transcriptional regulation upon stress signals. Here we show that an upstream region in the Str promoter confers responsiveness to partially purified yeast elicitor and jasmonate. Yeast one-hybrid screening with this element as a bait identified a MYB-like protein, which shows high homology to parsley box P-binding factor-1 (PcBPF-1). In vitro analyses showed that the Str promoter fragment contained a novel binding site for BPF-1-like proteins with higher binding affinity than the previously described box P. CrBPF-1 mRNA accumulated rapidly in elicitor-treated C. roseus suspension cells, whereas no induction was observed with jasmonate. Inhibitor studies indicated that CrBPF-1 plays a role in an elicitor-responsive but jasmonate-independent signal transduction pathway, acting downstream of protein phosphorylation and calcium influx.
Long-range activation of Sox9 in Odd Sex (Ods) mice.
Qin, Yangjun; Kong, Ling-kun; Poirier, Christophe; Truong, Cavatina; Overbeek, Paul A; Bishop, Colin E
2004-06-15
The Odd Sex mouse mutation arose in a transgenic line of mice carrying a tyrosinase minigene driven by the dopachrome tautomerase (Dct) promoter region. The minigene integrated 0.98 Mb upstream of Sox9 and was accompanied by a deletion of 134 kb. This mutation causes female to male sex reversal in XX Ods/+ mice, and a characteristic eye phenotype of microphthalmia with cataracts in all mice carrying the transgene. Ods causes sex reversal in the absence of Sry by upregulating Sox9 expression and maintaining a male pattern of Sox9 expression in XX Ods/+ embryonic gonads. This expression, which begins at E11.5, triggers downstream events leading to the formation of a testis. We report here that the 134 kb deletion, in itself, is insufficient to cause sex reversal. We demonstrate that in Ods, the Dct promoter is capable of acting over a distance of 1 Mb to induce inappropriate expression of Sox9 in the retinal pigmented epithelium of the eye, causing the observed microphthalmia. In addition, it induces Sox9 expression in the melanocytes where it causes pigmentation defects. We propose that Ods sex reversal is due to the Dct promoter element interacting with gonad-specific enhancer elements to produce the observed male pattern expression of Sox9 in the embryonic gonads.
Argüello-Astorga, G R; Herrera-Estrella, L R
1996-01-01
Regulation of plant gene transcription by light is mediated by multipartite cis-regulatory units. Previous attempts to identify structural features that are common to all light-responsive elements (LREs) have been unsuccessful. To address the question of what is needed to confer photoresponsiveness to a promoter, the upstream sequences from more than 110 light-regulated plant genes were analyzed by a new, phylogenetic-structural method. As a result, 30 distinct conserved DNA module arrays (CMAs) associated with light-responsive promoter regions were identified. Several of these CMAs have remained invariant throughout the evolutionary radiation of angiosperms and are conserved between homologous genes as well as between members of different gene families. The identified CMAs share a gene superfamily-specific core that correlates with the particular phytochrome-dependent transduction pathway that controls their expression, i.e. ACCTA(A/C)C(A/C) for the cGMP-dependent phenylpropanoid metabolism-associated genes, and GATA(A/T)GR for the Ca2+/calmodulin-dependent photosynthesis-associated nuclear genes. In addition to suggesting a general model for the functional and structural organization of LREs, the data obtained in this study indicate that angiosperm LREs probably evolved from complex cis-acting elements involved in regulatory processes other than photoregulation in gymnosperms. PMID:8938415
Wang, Xiaohong; Liu, Haibin; Ge, Hui; Ajiro, Masahiko; Sharma, Nishi R; Meyers, Craig; Morozov, Pavel; Tuschl, Thomas; Klar, Amar; Court, Donald; Zheng, Zhi-Ming
2017-05-30
The life cycle of human papillomaviruses (HPVs) is tightly linked to keratinocyte differentiation. Although expression of viral early genes is initiated immediately upon virus infection of undifferentiated basal cells, viral DNA amplification and late gene expression occur only in the mid to upper strata of the keratinocytes undergoing terminal differentiation. In this report, we show that the relative activity of HPV18 TATA-less late promoter P 811 depends on its orientation relative to that of the origin (Ori) of viral DNA replication and is sensitive to the eukaryotic DNA polymerase inhibitor aphidicolin. Additionally, transfected 70-nucleotide (nt)-long single-strand DNA oligonucleotides that are homologous to the region near Ori induce late promoter activity. We also found that promoter activation in raft cultures leads to production of the late promoter-associated, sense-strand transcription initiation RNAs (tiRNAs) and splice-site small RNAs (spliRNAs). Finally, a cis -acting AAGTATGCA core element that functions as a repressor to the promoter was identified. This element interacts with hnRNP D0B and hnRNP A/B factors. Point mutations in the core prevented binding of hnRNPs and increased the promoter activity. Confirming this result, knocking down the expression of both hnRNPs in keratinocytes led to increased promoter activity. Taking the data together, our study revealed the mechanism of how the HPV18 late promoter is regulated by DNA replication and host factors. IMPORTANCE It has been known for decades that the activity of viral late promoters is associated with viral DNA replication among almost all DNA viruses. However, the mechanism of how DNA replication activates the viral late promoter and what components of the replication machinery are involved remain largely unknown. In this study, we characterized the P 811 promoter region of HPV18 and demonstrated that its activation depends on the orientation of DNA replication. Using single-stranded oligonucleotides targeting the replication fork on either leading or lagging strands, we showed that viral lagging-strand replication activates the promoter. We also identified a transcriptional repressor element located upstream of the promoter transcription start site which interacts with cellular proteins hnRNP D0B and hnRNP A/B and modulates the late promoter activity. This is the first report on how DNA replication activates a viral late promoter. Copyright © 2017 Wang et al.
Kumar, V; Wong, D T; Pasion, S G; Biswas, D K
1987-12-08
The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.
Human Promoters Are Intrinsically Directional
Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe
2015-01-01
Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
NASA Technical Reports Server (NTRS)
Giger, J. M.; Haddad, F.; Qin, A. X.; Baldwin, K. M.
2000-01-01
In the weight-bearing hindlimb soleus muscle of the rat, approximately 90% of muscle fibers express the beta-myosin heavy chain (beta-MHC) isoform protein. Hindlimb suspension (HS) causes the MHC isoform population to shift from beta toward the fast MHC isoforms. Our aim was to establish a model to test the hypothesis that this shift in expression is transcriptionally regulated through specific cis elements of the beta-MHC promoter. With the use of a direct gene transfer approach, we determined the activity of different length beta-MHC promoter fragments, linked to a firefly luciferase reporter gene, in soleus muscle of control and HS rats. In weight-bearing rats, the relative luciferase activity of the longest beta-promoter fragment (-3500 bp) was threefold higher than the shorter promoter constructs, which suggests that an enhancer sequence is present in the upstream promoter region. After 1 wk of HS, the reporter activities of the -3500-, -914-, and -408-bp promoter constructs were significantly reduced ( approximately 40%), compared with the control muscles. However, using the -215-bp construct, no differences in promoter activity were observed between HS and control muscles, which indicates that the response to HS in the rodent appears to be regulated within the -408 and -215 bp of the promoter.
Functional Intersection Area -- Oregon Department of Transportation
DOT National Transportation Integrated Search
1996-01-01
This discussion paper addresses the concepts involved in defining the functional area of an intersection. The elements which comprise the upstream functional area are identified; dimensions of the upstream area exclusive of queue storage, are given f...
2014-01-01
Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199
Karki, Pratap; Webb, Anton; Smith, Keisha; Lee, Kyuwon; Son, Deok-Soo; Aschner, Michael; Lee, Eunsook
2013-01-01
Tamoxifen (TX), a selective estrogen receptor modulator, exerts antagonistic effects on breast tissue and is used to treat breast cancer. Recent evidence also suggests that it may act as an agonist in brain tissue. We reported previously that TX enhanced the expression and function of glutamate transporter 1 (GLT-1) in rat astrocytes, an effect that was mediated by TGF-α. To gain further insight into the mechanisms that mediate TX-induced up-regulation of GLT-1 (EAAT2 in humans), we investigated its effect on GLT-1 at the transcriptional level. TX phosphorylated the cAMP response element-binding protein (CREB) and recruited CREB to the GLT-1 promoter consensus site. The effect of TX on astrocytic GLT-1 was attenuated by the inhibition of PKA, the upstream activator of the CREB pathway. In addition, the effect of TX on GLT-1 promoter activity was abolished by the inhibition of the NF-κB pathway. Furthermore, TX recruited the NF-κB subunits p65 and p50 to the NF-κB binding domain of the GLT-1 promoter. Mutation of NF-κB (triple, −583/-282/-251) or CRE (-308) sites on the GLT-1 promoter led to significant repression of the promoter activity, but neither mutant completely abolished the TX-induced GLT-1 promoter activity. Mutation of both the NF-κB (-583/-282/-251) and CRE (-308) sites led to a complete abrogation of the effect of TX on GLT-1 promoter activity. Taken together, our findings establish that TX regulates GLT-1 via the CREB and NF-κB pathways. PMID:23955341
Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.
1988-08-01
The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less
Eves-van den Akker, Sebastian; Laetsch, Dominik R; Thorpe, Peter; Lilley, Catherine J; Danchin, Etienne G J; Da Rocha, Martine; Rancurel, Corinne; Holroyd, Nancy E; Cotton, James A; Szitenberg, Amir; Grenier, Eric; Montarry, Josselin; Mimee, Benjamin; Duceppe, Marc-Olivier; Boyes, Ian; Marvin, Jessica M C; Jones, Laura M; Yusup, Hazijah B; Lafond-Lapalme, Joël; Esquibet, Magali; Sabeh, Michael; Rott, Michael; Overmars, Hein; Finkers-Tomczak, Anna; Smant, Geert; Koutsovoulos, Georgios; Blok, Vivian; Mantelin, Sophie; Cock, Peter J A; Phillips, Wendy; Henrissat, Bernard; Urwin, Peter E; Blaxter, Mark; Jones, John T
2016-06-10
The yellow potato cyst nematode, Globodera rostochiensis, is a devastating plant pathogen of global economic importance. This biotrophic parasite secretes effectors from pharyngeal glands, some of which were acquired by horizontal gene transfer, to manipulate host processes and promote parasitism. G. rostochiensis is classified into pathotypes with different plant resistance-breaking phenotypes. We generate a high quality genome assembly for G. rostochiensis pathotype Ro1, identify putative effectors and horizontal gene transfer events, map gene expression through the life cycle focusing on key parasitic transitions and sequence the genomes of eight populations including four additional pathotypes to identify variation. Horizontal gene transfer contributes 3.5 % of the predicted genes, of which approximately 8.5 % are deployed as effectors. Over one-third of all effector genes are clustered in 21 putative 'effector islands' in the genome. We identify a dorsal gland promoter element motif (termed DOG Box) present upstream in representatives from 26 out of 28 dorsal gland effector families, and predict a putative effector superset associated with this motif. We validate gland cell expression in two novel genes by in situ hybridisation and catalogue dorsal gland promoter element-containing effectors from available cyst nematode genomes. Comparison of effector diversity between pathotypes highlights correlation with plant resistance-breaking. These G. rostochiensis genome resources will facilitate major advances in understanding nematode plant-parasitism. Dorsal gland promoter element-containing effectors are at the front line of the evolutionary arms race between plant and parasite and the ability to predict gland cell expression a priori promises rapid advances in understanding their roles and mechanisms of action.
Etsrp/etv2 is directly regulated by foxc1a/b in the zebrafish angioblast
Veldman, Matthew B.; Lin, Shuo
2012-01-01
Rationale Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. Objective We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. Methods and Results To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all three regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative RT-PCR and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed while pronephric gene pax2a was relatively normal in expression level and pattern. Conclusions These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast. PMID:22135404
Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.
Veldman, Matthew B; Lin, Shuo
2012-01-20
Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.
Kin28 regulates the transient association of Mediator with core promoters.
Jeronimo, Célia; Robert, François
2014-05-01
Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.
NASA Astrophysics Data System (ADS)
Suja, S.; Kessarkar, Pratima M.; Fernandes, Lina L.; Kurian, Siby; Tomer, Arti
2017-09-01
Major (Al, Fe, Mn, Ti, Mg) and trace (Cu, Zn, Pb, Cr, Ni, Co, Zr, Rb, Sr, Ba, Li, Be, Sc, V, Ga, Nb, Mo, Sn, Sb, Cs, Hf, Ta, Bi, Th, U) elements and particulate organic carbon (POC) concentrations in surface suspended particulate matter (SPM) of the Kali estuary, (central west coast of India) were studied during the pre-monsoon, monsoon and post monsoon seasons to infer estuarine processes, source of SPM and Geoaccumulation Index (Igeo) assigned pollutionIgeo levels. Distribution of SPM indicates the presence of the estuarine turbidity maximum (ETM) during all three seasons near the river mouth and a second ETM during the post monsoon time in the upstream associated with salinities gradient. The SPM during the monsoon is finer grained (avg. 53 μm), characterized by uniformly low normalized elemental concentration, whereas the post and pre monsoon are characterized by high normalized elemental concentration with coarser grain size (avg. 202 μm and 173 μm respectively) with highest ratios in the upstream estuary. The elemental composition and principal component analysis for the upstream estuary SPM support more contribution from the upstream catchment area rocks during the monsoon season; there is additional contribution from the downstream catchment area during the pre and post monsoon period due to the tidal effect. The Kali estuarine SPM has higher Al, Fe, Mn, Ti, Mg, Ni, Co, Ba, Li and V with respect to Average World River SPM (WRSPM). Igeo values for the SPM indicate Kali Estuary to be severely enriched with Mn and moderately enriched with Cu, Zn, Ni, Co, U and Mo in the upstream estuary during pre and post monsoon seasons. Seasonal changes in salinity gradient (reduced freshwater flow due to closing of the dam gates), reduced velocity at meandering region of the estuary and POC of 1.6-2.3% resulted in co-precipitation of trace elements that were further fortified by flocculation and coagulation throughout the water column resulting in metal trapping in the upstream region.
Fleckenstein, E C; Dirks, W G; Drexler, H G
2000-02-01
The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.
Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R
2011-03-01
Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.
Ran, Kun; Yang, Hongqiang; Sun, Xiaoli; Li, Qiang; Jiang, Qianqian; Zhang, Weiwei; Shen, Wei
2014-05-01
Vacuolar processing enzymes (VPEs) have received considerable attention recently, as they exhibit caspase-1-like cleavage activity and regulate the process of PCD. However, knowledge about their detailed characteristics and structures is relatively limited. In this study, a gamma vacuolar processing enzyme gene, MhVPEγ, has been isolated from the leaves of Malus hupehensis (Ramp) Rehd. var pinyiensis Jiang. MhVPEγ coded-translated protein sequence comprised of 494 amino acids with a signal peptide and a transmembrane helix structure at N-terminal, peptidase_C13 domain, and vacuolar sorting signal at C-terminal. Consequently, genomic walking approach was performed for the isolation of its upstream sequence. Computational analysis demonstrated several motifs of the promoter exhibiting hypothetic MeJA, ABA, and light-induced characteristics, as well as some typical domains universally discovered in promoter, such as TATA-box and CAAT-box. MhVPEγ transcript level was enhanced during wounding treatment, and WUN-motif, as one of the cis-acting regulatory elements existing in the upstream sequence perhaps regulates its expression. In silico-constructed 3D models revealed that MhCPYL successively interacts with MhVPEγ like that of "Induced Fit-Lock and Key" model, providing molecular conformation evidence that CPY is a direct substrate of VPEγ. This study is the first stride to understand the molecular mechanism of VPEγ and CPYL interactions.
Nafissi, Maryam; Chau, Jeannette; Xu, Jimin
2012-01-01
Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479
Chatterjee, Aniruddha; Stockwell, Peter A.; Rodger, Euan J.; Duncan, Elizabeth J.; Parry, Matthew F.; Weeks, Robert J.; Morison, Ian M.
2015-01-01
The extent of variation in DNA methylation patterns in healthy individuals is not yet well documented. Identification of inter-individual epigenetic variation is important for understanding phenotypic variation and disease susceptibility. Using neutrophils from a cohort of healthy individuals, we generated base-resolution DNA methylation maps to document inter-individual epigenetic variation. We identified 12851 autosomal inter-individual variably methylated fragments (iVMFs). Gene promoters were the least variable, whereas gene body and upstream regions showed higher variation in DNA methylation. The iVMFs were relatively enriched in repetitive elements compared to non-iVMFs, and were associated with genome regulation and chromatin function elements. Further, variably methylated genes were disproportionately associated with regulation of transcription, responsive function and signal transduction pathways. Transcriptome analysis indicates that iVMF methylation at differentially expressed exons has a positive correlation and local effect on the inclusion of that exon in the mRNA transcript. PMID:26612583
Lu, X; Welsh, T M; Peterlin, B M
1993-01-01
The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708
Li, Cong; Yue, Jing; Wu, Xiaowei; Xu, Cong; Yu, Jingjuan
2014-10-01
The DREB (dehydration-responsive element binding)-type transcription factors regulate the expression of stress-inducible genes by binding the DRE/CRT cis-elements in promoter regions. The upstream transcription factors that regulate the transcription of DREB transcription factors have not been clearly defined, although the function of DREB transcription factors in abiotic stress is known. In this study, an abscisic acid (ABA)-responsive DREB-binding protein gene (SiARDP) was cloned from foxtail millet (Setaria italica). The transcript level of SiARDP increased not only after drought, high salt, and low temperature stresses, but also after an ABA treatment in foxtail millet seedlings. Two ABA-responsive elements (ABRE1: ACGTGTC; ABRE2: ACGTGGC) exist in the promoter of SiARDP. Further analyses showed that two ABA-responsive element binding (AREB)-type transcription factors, SiAREB1 and SiAREB2, could physically bind to the ABRE core element in vitro and in vivo. The constitutive expression of SiARDP in Arabidopsis thaliana enhanced drought and salt tolerance during seed germination and seedling development, and overexpression of SiARDP in foxtail millet improved drought tolerance. The expression levels of target genes of SiARDP were upregulated in transgenic Arabidopsis and foxtail millet. These results reveal that SiARDP, one of the target genes of SiAREB, is involved in ABA-dependent signal pathways and plays a critical role in the abiotic stress response in plants. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Zhang, Chun; Feng, Li; Tian, Xing-Shan
2018-04-26
The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.
Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.
Abedini, Davar; Rashidi Monfared, Sajad
2018-06-01
A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.
Human hnRNP protein A1 gene expression. Structural and functional characterization of the promoter.
Biamonti, G; Bassi, M T; Cartegni, L; Mechta, F; Buvoli, M; Cobianchi, F; Riva, S
1993-03-05
hnRNP protein A1 (34 kDa, pl 9.5) is a prominent member of the family of proteins (hnRNP proteins) that associate with the nascent transcripts of RNA polymerase II and that accompany the hnRNA through the maturation process and the export to the cytoplasm. New evidence suggests an active and specific role for some of these proteins, including protein A1, in splicing and transport. Contrary to the other hnRNP proteins, the intracellular level of protein A1 was reported to change as a function of proliferation state and cell type. In this work we analyse the A1 gene expression in different cells under different growth and differentiation conditions. Proliferation dependent expression was observed in lymphocytes and fibroblasts while purified neurons express high A1 mRNA levels both in the proliferative (before birth) and in the quiescent (after birth) state. Transformed cell lines exhibit very high (proliferation independent) A1 mRNA levels compared to differentiated tissues. A structural and functional characterization of the A1 gene promoter was carried out by means of DNase I footprinting and CAT assays. The observed promoter features can account for both elevated and regulated mRNA transcription. At least 12 control elements are contained in the 734 nucleotides upstream of the transcription start site. Assays with the deleted and/or mutated promoter indicate a co-operation of multiple transcriptional elements, distributed over the entire promoter, in determining the overall activity and the response to proliferative stimuli (serum).
Man, Michal; Epel, Bernard L
2004-06-01
A replicon based on Tobacco mosaic virus that was engineered to express the open reading frame (ORF) of the green fluorescent protein (GFP) gene in place of the native coat protein (CP) gene from a minimal CP subgenomic (sg) RNA promoter was found to accumulate very low levels of GFP. Regulatory regions within the CP ORF were identified that, when presented as untranslated regions flanking the GFP ORF, enhanced or inhibited sg transcription and GFP expression. Full GFP expression from the CP sgRNA promoter required more than the first 20 nt of the CP ORF but not beyond the first 56 nt. Further analysis indicated the presence of an enhancer element between nt +25 and +55 with respect to the CP translation start site. The inclusion of this enhancer sequence upstream of the GFP ORF led to elevated sg transcription and to a 50-fold increase in GFP accumulation in comparison with a minimal CP promoter in which the entire CP ORF was displaced by the GFP ORF. Inclusion of the 3'-terminal 22 nt had a minor positive effect on GFP accumulation, but the addition of extended untranslated sequences from the 3' terminus of the CP ORF downstream of the GFP ORF was basically found to inhibit sg transcription. Secondary structure analysis programs predicted the CP sgRNA promoter to reside within two stable stem-loop structures, which are followed by an enhancer region.
Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn
2005-01-01
Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016
Jaeger, Emma; Leedham, Simon; Lewis, Annabelle; Segditsas, Stefania; Becker, Martin; Cuadrado, Pedro Rodenas; Davis, Hayley; Kaur, Kulvinder; Heinimann, Karl; Howarth, Kimberley; East, James; Taylor, Jenny; Thomas, Huw; Tomlinson, Ian
2012-05-06
Hereditary mixed polyposis syndrome (HMPS) is characterized by apparent autosomal dominant inheritance of multiple types of colorectal polyp, with colorectal carcinoma occurring in a high proportion of affected individuals. Here, we use genetic mapping, copy-number analysis, exclusion of mutations by high-throughput sequencing, gene expression analysis and functional assays to show that HMPS is caused by a duplication spanning the 3' end of the SCG5 gene and a region upstream of the GREM1 locus. This unusual mutation is associated with increased allele-specific GREM1 expression. Whereas GREM1 is expressed in intestinal subepithelial myofibroblasts in controls, GREM1 is predominantly expressed in the epithelium of the large bowel in individuals with HMPS. The HMPS duplication contains predicted enhancer elements; some of these interact with the GREM1 promoter and can drive gene expression in vitro. Increased GREM1 expression is predicted to cause reduced bone morphogenetic protein (BMP) pathway activity, a mechanism that also underlies tumorigenesis in juvenile polyposis of the large bowel.
Le, My-Tra; Kasprzak, Wojciech K; Kim, Taejin; Gao, Feng; Young, Megan YL; Yuan, Xuefeng; Shapiro, Bruce A; Seog, Joonil; Simon, Anne E
2017-01-01
Turnip crinkle virus contains a T-shaped, ribosome-binding, translation enhancer (TSS) in its 3’UTR that serves as a hub for interactions throughout the region. The viral RNA-dependent RNA polymerase (RdRp) causes the TSS/surrounding region to undergo a conformational shift postulated to inhibit translation. Using optical tweezers (OT) and steered molecular dynamic simulations (SMD), we found that the unusual stability of pseudoknotted element H4a/Ψ3 required five upstream adenylates, and H4a/Ψ3 was necessary for cooperative association of two other hairpins (H5/H4b) in Mg2+. SMD recapitulated the TSS unfolding order in the absence of Mg2+, showed dependence of the resistance to pulling on the 3D orientation and gave structural insights into the measured contour lengths of the TSS structure elements. Adenylate mutations eliminated one-site RdRp binding to the 3’UTR, suggesting that RdRp binding to the adenylates disrupts H4a/Ψ3, leading to loss of H5/H4b interaction and promoting a conformational switch interrupting translation and promoting replication. DOI: http://dx.doi.org/10.7554/eLife.22883.001 PMID:28186489
Gause, M; Hovhannisyan, H; Kan, T; Kuhfittig, S; Mogila, V; Georgiev, P
1998-01-01
The su(Hw) protein is responsible for the insulation mediated by the su(Hw)-binding region present in the gypsy retrotransposon. In the y2 mutant, su(Hw) protein partially inhibits yellow transcription by repressing the function of transcriptional enhancers located distally from the yellow promoter with respect to gypsy. y2 mutation derivatives have been induced by the insertion of two hobo copies on the both sides of gypsy: into the yellow intron and into the 5' regulatory region upstream of the wing and body enhancers. The hobo elements have the same structure and orientation, opposite to the direction of yellow transcription. In the sequence context, where two copies of hobo are separated by the su(Hw)-binding region, hobo-dependent rearrangements are frequently associated with duplications of the region between the hobo elements. Duplication of the su(Hw)-binding region strongly inhibits the insulation of the yellow promoter separated from the body and wing enhancers by gypsy. These results provide a better insight into mechanisms by which the su(Hw)-binding region affects the enhancer function. PMID:9649529
Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A
2002-01-01
κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628
Kin28 regulates the transient association of Mediator with core promoters
Jeronimo, Célia; Robert, François
2014-01-01
Mediator is an essential, broadly utilized eukaryotic transcriptional co-activator. How and what it communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence (UAS), upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity, or in cells where the RNAPII C-terminal domain (CTD) is mutated to replace Ser5 with alanines, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is quickly released from promoters upon Ser5 phosphorylation by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter. PMID:24704787
Molecular identification and transcriptional regulation of porcine IFIT2 gene.
Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di
2018-04-06
IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Tecalco-Cruz, Angeles C.; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina
2012-01-01
The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified. PMID:22674574
Tecalco-Cruz, Angeles C; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina
2012-08-03
The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified.
Ding, Zhihu; Gillespie, Laura L; Mercer, F Corinne; Paterno, Gary D
2004-07-02
To gain insight into the regulation of hmi-er1 expression, we cloned a human genomic DNA fragment containing one of the two hmi-er1 promoters and consisting of 1460 bp upstream of the translation initiation codon of hMI-ER1. Computer-assisted sequence analysis revealed that the hmi-er1 promoter region contains a CpG island but lacks an identifiable TATA element, initiator sequence and downstream promoter element. This genomic DNA was able to direct transcription of a luciferase reporter gene in a variety of human cell lines, and the minimal promoter was shown to be located within-68/+144 bp. Several putative Sp1 binding sites were identified, and we show that Sp1 can bind to the hmi-er1 minimal promoter and increase transcription, suggesting that the level of hmi-er1 expression may depend on the availability of Sp1 protein. Functional analysis revealed that hMI-ER1 represses Sp1-activated transcription from the minimal promoter by a histone deacetylase-independent mechanism. Chromatin immunoprecipitation analysis demonstrated that both Sp1 and hMI-ER1 are associated with the chromatin of the hmi-er1 promoter and that overexpression of hMI-ER1 in cell lines that allow Tet-On-inducible expression resulted in loss of detectable Sp1 from the endogenous hmi-er1 promoter. The mechanism by which this occurs does not involve binding of hMI-ER1 to cis-acting elements. Instead, we show that hMI-ER1 physically associates with Sp1 and that endogenous complexes containing the two proteins could be detected in vivo. Furthermore, hMI-ER1 specifically interferes with binding of Sp1 to the hmi-er1 minimal promoter as well as to an Sp1 consensus oligonucleotide. Deletion analysis revealed that this interaction occurs through a region containing the SANT domain of hMI-ER1. Together, these data reveal a functional role for the SANT domain in the action of co-repressor regulatory factors and suggest that the association of hMI-ER1 with Sp1 represents a novel mechanism for the negative regulation of Sp1 target promoters.
Shali, Abbas; Rigi, Garshasb; Pornour, Majid; Ahmadian, Gholamreza
2017-01-01
Background: Improved cyan fluorescent protein (ICFP) is a monochromic, green fluorescent protein (GFP) derivative produced by Aequorea macrodactyla in a process similar to GFP. This protein has strong absorption spectra at wavelengths 426-446 nm. ICFP can be used in cell, organelle or intracellular protein labeling, investigating the protein-protein interactions as well as assessing the promoter activities. Methods: In our previous study, the promoters of two chitinases (ChiS and ChiL) from Bacillus pumilus SG2 were assessed in B. subtilis and their regulatory elements were characterized. In the present study, icfp was cloned downstream of several truncated promoters obtained in the former study, and ICFP expression was evaluated in B. subtilis. Results: Extracellular expression and secretion of ICFP were analyzed under the control of different truncated versions of ChiSL promoters grown on different media. Results from SDS-PAGE and fluorimetric analyses showed that there were different expression rates of CFP; however, the UPChi-ICFP3 construct exhibited a higher level of expression and secretion in the culture medium. Conclusion: Our presented results revealed that inserting this truncated form of Chi promoter upstream of the ICFP, as a reporter gene, in B. subtilis led to an approximately ten fold increase in ICFP expression. PMID:28088132
Lee, M O; Liu, Y; Zhang, X K
1995-08-01
The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene expression.
Hao, Chenyang; Tang, Saijun; Zhang, Xueyong; Li, Tian
2014-01-01
To better understand the transcriptional regulation of high molecular weight glutenin subunit (HMW-GS) expression, we isolated four Glu-1Bx promoters from six wheat cultivars exhibiting diverse protein expression levels. The activities of the diverse Glu-1Bx promoters were tested and compared with β-glucuronidase (GUS) reporter fusions. Although all the full-length Glu-1Bx promoters showed endosperm-specific activities, the strongest GUS activity was observed with the 1Bx7OE promoter in both transient expression assays and stable transgenic rice lines. A 43 bp insertion in the 1Bx7OE promoter, which is absent in the 1Bx7 promoter, led to enhanced expression. Analysis of promoter deletion constructs confirmed that a 185 bp MITE (miniature inverted-repeat transposable element) in the 1Bx14 promoter had a weak positive effect on Glu-1Bx expression, and a 54 bp deletion in the 1Bx13 promoter reduced endosperm-specific activity. To investigate the effect of the 43 bp insertion in the 1Bx7OE promoter, a functional marker was developed to screen 505 Chinese varieties and 160 European varieties, and only 1Bx7-type varieties harboring the 43 bp insertion in their promoters showed similar overexpression patterns. Hence, the 1Bx7OE promoter should be important tool in crop genetic engineering as well as in molecular assisted breeding. PMID:25133580
Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria
Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen
2001-01-01
The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607
Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce
2004-07-01
The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.
NASA Astrophysics Data System (ADS)
Murugan, R.
2010-10-01
In this paper, we develop a theory on the mechanism of distal action of the transcription factors, which are bound at their respective cis-regulatory enhancer modules on the promoter-RNA polymerase II (PR) complexes to initiate the transcription event in eukaryotes. We consider both the looping and tracking modes of their distal communication and calculate the mean first passage time that is required for the distal interactions of the complex of enhancer and transcription factor with the PR via both these modes. We further investigate how this mean first passage time is dependent on the length of the DNA segment (L, base-pairs) that connects the cis-regulatory binding site and the respective promoter. When the radius of curvature of this connecting segment of DNA is R that was induced upon binding of the transcription factor at the cis-acting element and RNAPII at the promoter in cis-positions, our calculations indicate that the looping mode of distal action will dominate when L is such that L > 2πR and the tracking mode of distal action will be favored when L < 2πR. The time required for the distal action will be minimum when L = 2πR where the typical value of R for the binding of histones will be R ~ 16 bps and L ~ 102 bps. It seems that the free energy associated with the binding of the transcription factor with its cis-acting element and the distance of this cis-acting element from the corresponding promoter of the gene of interest is negatively correlated. Our results suggest that the looping and tracking modes of distal action are concurrently operating on the transcription activation and the physics that determines the timescales associated with the looping/tracking in the mechanism of action of these transcription factors on the initiation of the transcription event must put a selection pressure on the distribution of the distances of cis-regulatory modules from their respective promoters of the genes. The computational analysis of the upstream sequences of promoters of various genes in the human and mouse genomes for the presence of putative cis-regulatory elements for a set of known transcription factors using the position weight matrices available with the JASPAR database indicates the presence of cis-acting elements with maximum probability at a distance of ~102 bps from the promoters which substantiates our theoretical predictions.
Wang, Xiaolong; Zhou, PeiHua; Sun, XueJun; Wei, GuangBing; Zhang, Li; Wang, Hui; Yao, JianFeng; Jia, PengBo; Zheng, JianBao
2016-05-01
One of the current challenges facing cancer gene therapy is the tumour-specific targeting of therapeutic genes. Effective targeting in gene therapy requires accurate spatial and temporal control of gene expression. To develop a sufficient and accurate tumour-targeting method for cancer gene therapy, we have investigated the use of hyperthermia to control the expression of a transgene under the control of the human telomerase reverse transcriptase (hTERT) promoter and eight heat shock elements (8HSEs). Luciferase reporters were constructed by inserting eight HSEs and the hTERT promoter (8HSEs-hTERTp) upstream of the pGL4.20 vector luciferase gene. The luciferase activity of the hTERT promoter and 8HSEs-hTERT promoter were then compared in the presence and absence of heat. The differences in luciferase activity were analysed using dual luciferase assays in SW480 (high hTERT expression), MKN28 and MRC-5 cells (low hTERT expression). The luciferase activity of the Hsp70B promoter was also compared to the 8HSEs-hTERT promoter in the above listed cell lines. Lentiviral vector and heat-induced expression of EGFP expression under the control of the 8HSEs-hTERT promoter in cultured cells and mouse tumour xenografts was measured by reverse transcription polymerase (RT-PCR), Western blot and immunofluorescence assays. hTERT promoter activity was higher in SW480 cells than in MKN28 or MRC-5 cells. At 43 °C, the luciferase activity of the 8HSEs-hTERT promoter was significantly increased in SW480 cells, but not in MKN28 or MRC-5 cells. Importantly, the differences in luciferase activity were much more obvious in both high (SW480) and low (MKN28 and MRC-5) hTERT expressing cells when the activity of the 8HSEs-hTERT promoter was compared to the Hsp70B promoter. Moreover, under the control of 8HSEs-hTERT promoter in vitro and in vivo, EGFP expression was obviously increased by heat treatment in SW480 cells but not in MKN28 or MRC-5 cells, nor was expression increased under normal temperature conditions. The hTERT promoter is a potentially powerful tumour-specific promoter and gene therapy tool for cancer treatment. Incorporating heat-inducible therapeutic elements (8HSEs) into the hTERT promoter may enhance the efficiency and specificity of cancer targeting gene therapy under hyperthermic clinical conditions.
Levy, Nitzan; Tatomer, Dierdre; Herber, Candice B.; Zhao, Xiaoyue; Tang, Hui; Sargeant, Toby; Ball, Lonnele J.; Summers, Jonathan; Speed, Terence P.; Leitman, Dale C.
2008-01-01
Estrogen receptors (ERs) regulate gene transcription by interacting with regulatory elements. Most information regarding how ER activates genes has come from studies using a small set of target genes or simple consensus sequences such as estrogen response element, activator protein 1, and Sp1 elements. However, these elements cannot explain the differences in gene regulation patterns and clinical effects observed with estradiol (E2) and selective estrogen receptor modulators. To obtain a greater understanding of how E2 and selective estrogen receptor modulators differentially regulate genes, it is necessary to investigate their action on a more comprehensive set of native regulatory elements derived from ER target genes. Here we used chromatin immunoprecipitation-cloning and sequencing to isolate 173 regulatory elements associated with ERα. Most elements were found in the introns (38%) and regions greater than 10 kb upstream of the transcription initiation site (38%); 24% of the elements were found in the proximal promoter region (<10 kb). Only 11% of the elements contained a classical estrogen response element; 23% of the elements did not have any known response elements, including one derived from the naked cuticle homolog gene, which was associated with the recruitment of p160 coactivators. Transfection studies found that 80% of the 173 elements were regulated by E2, raloxifene, or tamoxifen with ERα or ERβ. Tamoxifen was more effective than raloxifene at activating the elements with ERα, whereas raloxifene was superior with ERβ. Our findings demonstrate that E2, tamoxifen, and raloxifene differentially regulate native ER-regulatory elements isolated by chromatin immunoprecipitation with ERα and ERβ. PMID:17962382
Stelman, David
1989-01-01
A contactor/filter arrangement for removing particulate contaminants from a gaseous stream includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. The housing further includes a gas inlet means, a gas outlet means, and means for moving a body of granular material through the zone. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. Disposed on the upstream face of the filter element is a cover screen which isolates the filter element from contact with the moving granular bed and collects a portion of the particulates so as to form a dust cake having openings small enough to exclude the granular material, yet large enough to receive the dust particles. In one embodiment, the granular material is comprised of prous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses.
Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas
2015-01-01
Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel
2008-06-01
The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
Uchida, Akira; Murugesapillai, Divakaran; Kastner, Markus; Wang, Yao; Lodeiro, Maria F; Prabhakar, Shaan; Oliver, Guinevere V; Arnold, Jamie J; Maher, L James; Williams, Mark C; Cameron, Craig E
2017-01-01
Human mtDNA contains three promoters, suggesting a need for differential expression of the mitochondrial genome. Studies of mitochondrial transcription have used a reductionist approach, perhaps masking differential regulation. Here we evaluate transcription from light-strand (LSP) and heavy-strand (HSP1) promoters using templates that mimic their natural context. These studies reveal sequences upstream, hypervariable in the human population (HVR3), and downstream of the HSP1 transcription start site required for maximal yield. The carboxy-terminal tail of TFAM is essential for activation of HSP1 but not LSP. Images of the template obtained by atomic force microscopy show that TFAM creates loops in a discrete region, the formation of which correlates with activation of HSP1; looping is lost in tail-deleted TFAM. Identification of HVR3 as a transcriptional regulatory element may contribute to between-individual variability in mitochondrial gene expression. The unique requirement of HSP1 for the TFAM tail may enable its regulation by post-translational modifications. DOI: http://dx.doi.org/10.7554/eLife.27283.001 PMID:28745586
Amador, A; Papaceit, M; Juan, E
2001-06-01
The Adh locus of Drosophilidae is organized as a single gene transcribed from two spatially and temporally regulated promoters except in species of the repleta group, which have two single promoter genes. Here we show that in Drosophila funebris the Adh gene is transcribed from a single promoter, in both larva and adult, with qualitative and quantitative species specific-differences in tissue distribution. The gene is expressed in larval fat body but in other tissues such as gastric caeca, midgut and Malpighian tubules its expression is reduced compared to most Drosophilidae species, and in adults it is almost limited to the fat body. The comparative analysis of gene expression of two strains, which differ by a duplication, indicates that the cis elements necessary for this pattern of expression in larvae are included in the region of 1.55 kb upstream of the transcription initiation site. This new organization reveals the evolution of a different regulatory strategy to express the Adh gene in the subgenus Drosophila.
Wang, Haijun; Song, Chunhua; Ding, Yali; Pan, Xiaokang; Ge, Zheng; Tan, Bi-Hua; Gowda, Chandrika; Sachdev, Mansi; Muthusami, Sunil; Ouyang, Hongsheng; Lai, Liangxue; Francis, Olivia L.; Morris, Christopher L.; Abdel-Azim, Hisham; Dorsam, Glenn; Xiang, Meixian; Payne, Kimberly J.; Dovat, Sinisa
2016-01-01
Impaired function of the Ikaros (IKZF1) protein is associated with the development of high-risk B-cell precursor acute lymphoblastic leukemia (B-ALL). The mechanisms of Ikaros tumor suppressor activity in leukemia are unknown. Ikaros binds to the upstream regulatory elements of its target genes and regulates their transcription via chromatin remodeling. Here, we report that Ikaros represses transcription of the histone H3K4 demethylase, JARID1B (KDM5B). Transcriptional repression of JARID1B is associated with increased global levels of H3K4 trimethylation. Ikaros-mediated repression of JARID1B is dependent on the activity of the histone deacetylase, HDAC1, which binds to the upstream regulatory element of JARID1B in complex with Ikaros. In leukemia, JARID1B is overexpressed, and its inhibition results in cellular growth arrest. Ikaros-mediated repression of JARID1B in leukemia is impaired by pro-oncogenic casein kinase 2 (CK2). Inhibition of CK2 results in increased binding of the Ikaros-HDAC1 complex to the promoter of JARID1B, with increased formation of trimethylated histone H3 lysine 27 and decreased histone H3 Lys-9 acetylation. In cases of high-risk B-ALL that carry deletion of one Ikaros (IKZF1) allele, targeted inhibition of CK2 restores Ikaros binding to the JARID1B promoter and repression of JARID1B. In summary, the presented data suggest a mechanism through which Ikaros and HDAC1 regulate the epigenetic signature in leukemia: via regulation of JARID1B transcription. The presented data identify JARID1B as a novel therapeutic target in B-ALL and provide a rationale for the use of CK2 inhibitors in the treatment of high-risk B-ALL. PMID:26655717
van der Ploeg, Jan R.
2005-01-01
In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160
Fungicide-induced transposon movement in Monilinia fructicola.
Chen, Fengping; Everhart, Sydney E; Bryson, P Karen; Luo, Chaoxi; Song, Xi; Liu, Xili; Schnabel, Guido
2015-12-01
Repeated applications of fungicides with a single mode of action are believed to select for pre-existing resistant strains in a pathogen population, while the impact of sub-lethal doses of such fungicides on sensitive members of the population is unknown. In this study, in vitro evidence is presented that continuous exposure of Monilinia fructicola mycelium to some fungicides can induce genetic change in form of transposon transposition. Three fungicide-sensitive M. fructicola isolates were exposed in 12 weekly transfers of mycelia to a dose gradient of demethylation inhibitor fungicide (DMI) SYP-Z048 and quinone outside inhibitor fungicide (QoI) azoxystrobin in solo or mixture treatments. Evidence of mutagenesis was assessed by monitoring Mftc1, a multicopy transposable element of M. fructicola, by PCR and Southern blot analysis. Movement of Mftc1 was observed following azoxystrobin and azoxystrobin plus SYP-Z048 treatments in two of the three isolates, but not in the non-fungicide-treated controls. Interestingly, the upstream promoter region of MfCYP51 was a prime target for Mftc1 transposition in these isolates. Transposition of Mftc1 was verified by Southern blot in two of three isolates from another, similar experiment following prolonged, sublethal azoxystrobin exposure, although in these isolates movement of Mftc1 in the upstream MfCYP51 promoter region was not observed. More research is warranted to determine whether fungicide-induced mutagenesis may also happen under field conditions. Copyright © 2015 Elsevier Inc. All rights reserved.
Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C
1992-01-01
Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867
Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution
Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.
2005-01-01
The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818
Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.
Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E
2001-06-01
Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.
Cox, S.E.; Bell, P.R.; Lowther, J.S.; Van Metre, P.C.
2005-01-01
Sediment cores were collected from six locations in Lake Roosevelt to determine the vertical distributions of trace-element concentrations in the accumulated sediments of Lake Roosevelt. Elevated concentrations of arsenic, cadmium, copper, lead, mercury, and zinc occurred throughout much of the accumulated sediments. Concentrations varied greatly within the sediment core profiles, often covering a range of 5 to 10 fold. Trace-element concentrations typically were largest below the surficial sediments in the lower one-half of each profile, with generally decreasing concentrations from the 1964 horizon to the surface of the core. The trace-element profiles reflect changes in historical discharges of trace elements to the Columbia River by an upstream smelter. All samples analyzed exceeded clean-up guidelines adopted by the Confederated Tribes of the Colville Reservation for cadmium, lead, and zinc and more than 70 percent of the samples exceeded cleanup guidelines for mercury, arsenic, and copper. Although 100 percent of the samples exceeded sediment guidelines for cadmium, lead, and zinc, surficial concentrations of arsenic, copper, and mercury in some cores were less than the sediment-quality guidelines. With the exception of copper, the trace-element profiles of the five cores collected along the pre-reservoir Columbia River channel typically showed trends of decreasing concentrations in sediments deposited after the 1964 time horizon. The decreasing concentrations of trace elements in the upper half of cores from along the pre-reservoir Columbia River showed a pattern of decreasing concentrations similar to reductions in trace-element loading in liquid effluent from an upstream smelter. Except for arsenic, trace-element concentrations typically were smaller at downstream reservoir locations along the pre-reservoir Columbia River. Trace-element concentration in sediments from the Spokane Arm of the reservoir showed distinct differences compared to the similarities observed in cores from along the pre-reservoir Columbia River. Particles of slag, which have physical and chemical characteristics of slag discharged to the Columbia River by a lead-zinc smelter upstream of the reservoir at Trail, British Columbia, were found in sediments of Lake Roosevelt. Slag particles are more common in the upstream reaches of the reservoir. The chemical composition of the interior matrix of slag collected from Lake Roosevelt closely approximated the reported elemental concentrations of fresh smelter slag, although evidence of slag weathering was observed. Exfoliation flakes were observed on the surface of weathered slag particles isolated from the core sediments. The concentrations of zinc on the exposed surface of slag grains were smaller than concentrations on interior surfaces. Weathering rinds also were observed in the cross section of weathered slag grains, indicating that the glassy slag material was undergoing hydration and chemical weathering. Trace elements observed in accumulated sediments in the middle and lower reaches of the reservoir are more likely due to the input from liquid effluent discharges compared to slag discharges from the upstream smelter.
Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli
2012-01-01
Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR – COUP-TF1 – which could possibly play a role in human prostate cancer. PMID:23056316
Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli
2012-01-01
Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR - COUP-TF1 - which could possibly play a role in human prostate cancer.
Functional imaging: monitoring heme oxygenase-1 gene expression in vivo
NASA Astrophysics Data System (ADS)
Zhang, Weisheng; Reilly-Contag, Pamela; Stevenson, David K.; Contag, Christopher H.
1999-07-01
The regulation of genetic elements can be monitored in living animals using photoproteins as reporters. Heme oxygenase (HO) is the key catabolic enzyme in the heme degradation pathway. Here, HO expression serves as a model for in vivo functional imaging of transcriptional regulation of a clinically relevant gene. HO enzymatic activity is inhibited by heme analogs, metalloporphyrins, but many members of this family of compounds also activate transcription of the HO-1 promoter. The degree of transcriptional activation by twelve metalloporphyrins, differing at the central metal and porphyrin ring substituents, was evaluated in both NIH 3T3 stable lines and transgenic animals containing HO-1 promoter-luciferase gene fusions. In the correlative cell culture assays, the metalloporphyrins increased transcription form the full length HO promoter fusion to varying degrees, but none increased transcription from a truncated HO-1 promoter. These results suggested that one or both of the two distal enhancer elements located at -4 and -10 Kb upstream from transcriptional start are required for HO-1 induction by heme and its analogs. The full-length HO-1-luc fusion was then evaluated as a transgene in mice. It was possible to monitor the effects of the metalloporphyrins, SnMP and ZnPP, in living animals over time. This spatiotemporal analyses of gene expression in vivo implied that alterations in porphyrin ring substituents and the central metal may affect the extent of gene activation. These data further indicate that using photoprotein reporters, subtle differences in gene expression can be monitored in living animals.
Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit
2000-01-01
The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286
Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C.; MacPherson, Laura; Ruan, Hai-Bin; Wu, Jing; Pedersen, Thomas Å.; Steffensen, Knut R.; Yang, Xiaoyong; Matthews, Jason; Mandrup, Susanne; Nebb, Hilde I.; Grønning-Wang, Line M.
2015-01-01
Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β+/+ and LXRα/β−/− mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose metabolic sensors upstream of ChREBP by modulating GK expression, nuclear O-GlcNAc signaling, and ChREBP expression and activity. PMID:25724563
[Bacteriophage λ: electrostatic properties of the genome and its elements].
Krutinina, G G; Krutinin, E A; Kamzolova, S G; Osypov, A A
2015-01-01
Bacteriophage λ is a classical model object in molecular biology, but little is still known on the physical properties of its DNA and regulatory elements. A study was made of the electrostatic properties of phage λ DNA and regulatory elements. A global electrostatic potential distribution along the phage genome was found to be nonuniform with main regulatory elements being located in a limited region with a high potential. The RNA polymerase binding frequency on the linearized phage chromosome directly correlates with its local potential. Strong promoters of the phage and its host Escherichia coli have distinct electrostatic upstream elements, which differ in nucleotide sequence. Attachment and recombination sites of phage λ and its host have a higher potential, which possibly facilitates their recognition by integrase. Phage λ and host Rho-independent terminators have a symmetrical M-shaped potential profile, which only slightly depends on the annotated terminator palindrome length, and occur in a region with a substantially higher potential, which may cause polymerase retention, facilitating the formation of a terminator hairpin in RNA. It was concluded that virtually all elements of phage λ genome have potential distribution specifics, which are related to their structural properties and may play a role in their biological function. The global potential distribution along the phage genome reflects the architecture of the regulation of its transcription and integration in the host genome.
Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto
2010-01-01
Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012
Rivers and reciprocity: perceptions and policy on international watercourses
NASA Astrophysics Data System (ADS)
Tian, Fuqiang
2017-04-01
The paper analyses geopolitical dimensions of the 1997 United Nations Convention on the Law of the NonNavigational Uses of International Watercourses (UNWC) using quantitative data on transboundary flows and qualitative data on basin State location within a watercourse. The UNWC has had a long and difficult history. A tendency for downstream support for, and upstream ambivalence/opposition to, the UNWC is identified. It appears not widely recognized that adverse effects can be caused by any State on other States, regardless of their upstream or downstream location. Thus downstream States consider that their actions cannot harm upstream States, and upstream States consider that the UNWC provides them with greater obligations than downstream States. Clarification of the UNWC with the principle of reciprocal obligations on all States, both upstream and downstream, will remove any ambiguity, correct misperceptions, have clear policy implications for all States, promote UNWC engagement of upstream States, and contribute to long-term global water security.
Mapping of Human FOXP2 Enhancers Reveals Complex Regulation.
Becker, Martin; Devanna, Paolo; Fisher, Simon E; Vernes, Sonja C
2018-01-01
Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators - FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2 . Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders.
Mapping of Human FOXP2 Enhancers Reveals Complex Regulation
Becker, Martin; Devanna, Paolo; Fisher, Simon E.; Vernes, Sonja C.
2018-01-01
Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators – FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2. Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders. PMID:29515369
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, C.H.; Wei, Li-Na; Copeland, N.G.
We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less
Schwank, S; Hoffmann, B; Sch-uller, H J
1997-06-01
Expression of structural genes of phospholipid biosynthesis in yeast is mediated by the inositol/choline-responsive element (ICRE). ICRE-dependent gene activation, requiring the regulatory genes INO2 and INO4, is repressed in the presence of the phospholipid precursors inositol and choline. INO2 and, to a less extent, INO4 are positively autoregulated by functional ICRE sequences in the respective upstream regions. However, an INO2 allele devoid of its ICRE functionally complemented an ino2 mutation and completely restored inositol/choline regulation of Ino2p-dependent reporter genes. Low-level expression of INO2 and INO4 genes, each under control of the heterologous MET25 promoter, did not alter the regulatory pattern of target genes. Thus, upstream regions of INO2 and INO4 are not crucial for transcriptional control of ICRE-dependent genes by inositol and choline. Interestingly, over-expression of INO2, but not of INO4, counteracted repression by phospholipid precursors. Possibly, a functional antagonism between INO2 and a negative regulator is the key event responsible for repression or de-repression.
Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V
2004-03-01
egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.
Lippok, Bernadette; Birkenbihl, Rainer P; Rivory, Gaelle; Brümmer, Janna; Schmelzer, Elmon; Logemann, Elke; Somssich, Imre E
2007-04-01
WRKY transcription factors regulate distinct parts of the plant defense transcriptome. Expression of many WRKY genes themselves is induced by pathogens or pathogen-mimicking molecules. Here, we demonstrate that Arabidopsis WRKY33 responds to various stimuli associated with plant defense as well as to different kinds of phytopathogens. Although rapid pathogen-induced AtWRKY33 expression does not require salicylic acid (SA) signaling, it is dependent on PAD4, a key regulator upstream of SA. Activation of AtWRKY33 is independent of de novo protein synthesis, suggesting that it is at least partly under negative regulatory control. We show that a set of three WRKY-specific cis-acting DNA elements (W boxes) within the AtWRKY33 promoter is required for efficient pathogen- or PAMP-triggered gene activation. This strongly indicates that WRKY transcription factors are major components of the regulatory machinery modulating immediate to early expression of this gene in response to pathogen attack.
Transcriptional regulation of hepatic lipogenesis.
Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook
2015-11-01
Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.
Landini, P; Bown, J A; Volkert, M R; Busby, S J
1998-05-22
The methylated form of the Ada protein (meAda) binds the ada and aidB promoters between 60 and 40 base pairs upstream from the transcription start and activates transcription of the Escherichia coli ada and aidB genes. This region is also a binding site for the alpha subunit of RNA polymerase and resembles the rrnB P1 UP element in A/T content and location relative to the core promoter. In this report, we show that deletion of the C-terminal domain of the alpha subunit severely decreases meAda-independent binding of RNA polymerase to ada and aidB, affecting transcription initiation at these promoters. We provide evidence that meAda activates transcription by direct interaction with the C-terminal domain of RNA polymerase sigma70 subunit (amino acids 574-613). Several negatively charged residues in the sigma70 C-terminal domain are important for transcription activation by meAda; in particular, a glutamic acid to valine substitution at position 575 has a dramatic effect on meAda-dependent transcription. Based on these observations, we propose that the role of the alpha subunit at ada and aidB is to allow initial binding of RNA polymerase to the promoters. However, transcription initiation is dependent on meAda-sigma70 interaction.
Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee
2017-02-21
The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be restricted to a subpopulation of OT neurons.
Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y
2013-11-01
Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.
Heyduk, E; Baichoo, N; Heyduk, T
2001-11-30
The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.
Armstrong, Brent D; Herfst, Christine A; Tonial, Nicholas C; Wakabayashi, Adrienne T; Zeppa, Joseph J; McCormick, John K
2016-11-03
Streptococcus pyogenes is a globally prominent bacterial pathogen that exhibits strict tropism for the human host, yet bacterial factors responsible for the ability of S. pyogenes to compete within this limited biological niche are not well understood. Using an engineered recombinase-based in vivo expression technology (RIVET) system, we identified an in vivo-induced promoter region upstream of a predicted Class IIb bacteriocin system in the M18 serotype S. pyogenes strain MGAS8232. This promoter element was not active under in vitro laboratory conditions, but was highly induced within the mouse nasopharynx. Recombinant expression of the predicted mature S. pyogenes bacteriocin peptides (designated SpbM and SpbN) revealed that both peptides were required for antimicrobial activity. Using a gain of function experiment in Lactococcus lactis, we further demonstrated S. pyogenes immunity function is encoded downstream of spbN. These data highlight the importance of bacterial gene regulation within appropriate environments to help understand mechanisms of niche adaptation by bacterial pathogens.
Armstrong, Brent D.; Herfst, Christine A.; Tonial, Nicholas C.; Wakabayashi, Adrienne T.; Zeppa, Joseph J.; McCormick, John K.
2016-01-01
Streptococcus pyogenes is a globally prominent bacterial pathogen that exhibits strict tropism for the human host, yet bacterial factors responsible for the ability of S. pyogenes to compete within this limited biological niche are not well understood. Using an engineered recombinase-based in vivo expression technology (RIVET) system, we identified an in vivo-induced promoter region upstream of a predicted Class IIb bacteriocin system in the M18 serotype S. pyogenes strain MGAS8232. This promoter element was not active under in vitro laboratory conditions, but was highly induced within the mouse nasopharynx. Recombinant expression of the predicted mature S. pyogenes bacteriocin peptides (designated SpbM and SpbN) revealed that both peptides were required for antimicrobial activity. Using a gain of function experiment in Lactococcus lactis, we further demonstrated S. pyogenes immunity function is encoded downstream of spbN. These data highlight the importance of bacterial gene regulation within appropriate environments to help understand mechanisms of niche adaptation by bacterial pathogens. PMID:27808235
LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).
Hobson, Neil; Deyholos, Michael K
2013-04-01
Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.
Carlier, Aurelien L.; von Bodman, S. B.
2006-01-01
The upstream region of the Pantoea stewartii rcsA gene features two promoters, one for constitutive basal-level expression and a second autoregulated promoter for induced expression. The EsaR quorum-sensing repressor binds to a site centered between the two promoters, blocking transcription elongation from the regulated promoter under noninducing conditions. PMID:16740966
Two distinct promoters drive transcription of the human D1A dopamine receptor gene.
Lee, S H; Minowa, M T; Mouradian, M M
1996-10-11
The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has two functional TATA-less promoters, both in D1A expressing cultured neuroblastoma cells and in the human striatum.
Stelman, D.
1988-06-30
A contactor/filter arrangement for removing particulate contaminants from a gaseous stream is described. The filter includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. A cover screen isolates the filter element from contact with the moving granular bed. In one embodiment, the granular material is comprised of porous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses. 6 figs.
Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio
2016-01-01
In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. PMID:27016735
Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin
2016-06-01
Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.
A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization
Vilaboa, Nuria; Bermejo, Rodrigo; Martinez, Pilar; Bornstein, Rafael; Calés, Carmela
2004-01-01
Cdc6 is a key regulator of the strict alternation of S and M phases during the mitotic cell cycle. In mammalian and plant cells that physiologically become polyploid, cdc6 is transcriptionally and post-translationally regulated. We have recently reported that Cdc6 levels are maintained in megakaryoblastic HEL cells, but severely downregulated by ectopic expression of transcriptional repressor Drosophila melanogaster escargot. Here, we show that cdc6 promoter activity is upregulated during megakaryocytic differentiation of HEL endoreplicating cells, and that Escargot interferes with such activation. Transactivation experiments showed that a 1.7 kb region located at 2800 upstream cdc6 transcription initiation site behaved as a potent enhancer in endoreplicating cells only. This activity was mainly dependent on a novel cis-regulatory element composed by an E2 box overlapping a GATA motif. Ectopic Escargot could bind this regulatory element in vitro and endogenous GATA-1 and E2A formed specific complexes in megakaryoblastic cells as well as in primary megakaryocytes. Chromatin Immunoprecipitation analysis revealed that both transcription factors were occupying the E2 box/GATA site in vivo. Altogether, these data suggest that cdc6 expression could be actively maintained during megakaryocytic differentiation through transcriptional mechanisms involving specific cis- and trans-regulatory elements. PMID:15590906
Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J
1989-01-01
Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene. Images PMID:2602141
Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J
1989-12-11
Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene.
Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya A; Mergny, Jean-Louis; Salgado, Gilmar F
2017-05-12
Non-canonical base pairing within guanine-rich DNA and RNA sequences can produce G-quartets, whose stacking leads to the formation of a G-quadruplex (G4). G4s can coexist with canonical duplex DNA in the human genome and have been suggested to suppress gene transcription, and much attention has therefore focused on studying G4s in promotor regions of disease-related genes. For example, the human KRAS proto-oncogene contains a nuclease-hypersensitive element located upstream of the major transcription start site. The KRAS nuclease-hypersensitive element (NHE) region contains a G-rich element (22RT; 5'-AGGGCGGTGTGGGAATAGGGAA-3') and encompasses a Myc-associated zinc finger-binding site that regulates KRAS transcription. The NEH region therefore has been proposed as a target for new drugs that control KRAS transcription, which requires detailed knowledge of the NHE structure. In this study, we report a high-resolution NMR structure of the G-rich element within the KRAS NHE. We found that the G-rich element forms a parallel structure with three G-quartets connected by a four-nucleotide loop and two short one-nucleotide double-chain reversal loops. In addition, a thymine bulge is found between G8 and G9. The loops of different lengths and the presence of a bulge between the G-quartets are structural elements that potentially can be targeted by small chemical ligands that would further stabilize the structure and interfere or block transcriptional regulators such as Myc-associated zinc finger from accessing their binding sites on the KRAS promoter. In conclusion, our work suggests a possible new route for the development of anticancer agents that could suppress KRAS expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark
2006-08-15
The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.
Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module
Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan
2015-01-01
Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873
Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.
Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E
2015-09-01
The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.
Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing
2014-01-01
Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein could mediate ABA signaling both in rose and in A. thaliana. PMID:25290154
Jiang, Guimei; Jiang, Xinqiang; Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing
2014-01-01
Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein could mediate ABA signaling both in rose and in A. thaliana.
Reducing DNA context dependence in bacterial promoters
Carr, Swati B.; Densmore, Douglas M.
2017-01-01
Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998
Kedzierska, Barbara; Lee, David J.; Węgrzyn, Grzegorz; Busby, Stephen J. W.; Thomas, Mark S.
2004-01-01
The bacteriophage λ CII protein stimulates the activity of three phage promoters, pE, pI and paQ, upon binding to a site overlapping the –35 element at each promoter. Here we used preparations of RNA polymerase carrying a DNA cleavage reagent attached to specific residues in the C-terminal domain of the RNA polymerase α subunit (αCTD) to demonstrate that one αCTD binds near position –41 at pE, whilst the other αCTD binds further upstream. The αCTD bound near position –41 is oriented such that its 261 determinant is in close proximity to σ70. The location of αCTD in CII-dependent complexes at the pE promoter is very similar to that found at many activator-independent promoters, and represents an alternative configuration for αCTD at promoters where activators bind sites overlapping the –35 region. We also used an in vivo alanine scan analysis to show that the DNA-binding determinant of αCTD is involved in stimulation of the pE promoter by CII, and this was confirmed by in vitro transcription assays. We also show that whereas the K271E substitution in αCTD results in a drastic decrease in CII-dependent activation of pE, the pI and paQ promoters are less sensitive to this substitution, suggesting that the role of αCTD at the three lysogenic promoters may be different. PMID:14762211
Exaptation of Bornavirus-Like Nucleoprotein Elements in Afrotherians
Kobayashi, Yuki; Horie, Masayuki; Nakano, Ayumi; Murata, Koichi; Itou, Takuya; Suzuki, Yoshiyuki
2016-01-01
Endogenous bornavirus-like nucleoprotein elements (EBLNs), the nucleotide sequence elements derived from the nucleoprotein gene of ancient bornavirus-like viruses, have been identified in many animal genomes. Here we show evidence that EBLNs encode functional proteins in their host. Some afrotherian EBLNs were observed to have been maintained for more than 83.3 million years under negative selection. Splice variants were expressed from the genomic loci of EBLNs in elephant, and some were translated into proteins. The EBLN proteins appeared to be localized to the rough endoplasmic reticulum in African elephant cells, in contrast to the nuclear localization of bornavirus N. These observations suggest that afrotherian EBLNs have acquired a novel function in their host. Interestingly, genomic sequences of the first exon and its flanking regions in these EBLN loci were homologous to those of transmembrane protein 106B (TMEM106B). The upstream region of the first exon in the EBLN loci exhibited a promoter activity, suggesting that the ability of these EBLNs to be transcribed in the host cell was gained through capturing a partial duplicate of TMEM106B. In conclusion, our results strongly support for exaptation of EBLNs to encode host proteins in afrotherians. PMID:27518265
Selfish DNA: a pharmaceutical perspective.
Winckler, T
2013-07-01
Almost 25 years ago, Theo Dingermann published the discovery of a new mobile genetic element in the unicellular microbe Dictyostelium discoideum in the journal Science. An interesting property of this new molecular parasite, the Dictyostelium Repetitive Element (DRE), was that all integrations were found approximately 50 base pairs (bp) upstream of transfer RNA (tRNA) genes in the D. discoideum genome, thus implying an active targeting mechanism to avoid the disruption of host cell genes by the retrotransposition process. Since then, the facultative multicellular "social amoeba" D. discoideum has become a popular model for analyzing complex cellular functions such as cell movement, chemotaxis, phagocytosis, and cell differentiation, important areas of biomedical research that are often hard to investigate in cells from "higher organisms" including humans. Therefore, progress in the development of methods to study Dictyostelium biology has also provoked research on transposable elements in this organism. Early work on the DRE element suggested that studying its molecular mechanism of site-specific integration might promote human gene therapy technology through the design of integrating gene transfer vectors with low intrinsic genotoxic potential. In this review article, I will briefly review the original research performed on the DRE transposable element in the Dingermann lab and report on how the emergence of genomics technologies and the development of tools to analyze de novo retrotransposition events in D. discoideum cells will expand our knowledge of DRE biology in the future.
Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells
Leddin, Mathias; Perrod, Chiara; Hoogenkamp, Maarten; Ghani, Saeed; Assi, Salam; Heinz, Sven; Wilson, Nicola K.; Follows, George; Schönheit, Jörg; Vockentanz, Lena; Mosammam, Ali M.; Chen, Wei; Tenen, Daniel G.; Westhead, David R.; Göttgens, Berthold
2011-01-01
The transcription factor PU.1 occupies a central role in controlling myeloid and early B-cell development, and its correct lineage-specific expression is critical for the differentiation choice of hematopoietic progenitors. However, little is known of how this tissue-specific pattern is established. We previously identified an upstream regulatory cis element whose targeted deletion in mice decreases PU.1 expression and causes leukemia. We show here that the upstream regulatory cis element alone is insufficient to confer physiologic PU.1 expression in mice but requires the cooperation with other, previously unidentified elements. Using a combination of transgenic studies, global chromatin assays, and detailed molecular analyses we present evidence that PU.1 is regulated by a novel mechanism involving cross talk between different cis elements together with lineage-restricted autoregulation. In this model, PU.1 regulates its expression in B cells and macrophages by differentially associating with cell type–specific transcription factors at one of its cis-regulatory elements to establish differential activity patterns at other elements. PMID:21239694
Naranjo, Silvia; Voesenek, Krysta; de la Calle-Mustienes, Elisa; Robert-Moreno, Alex; Kokotas, Haris; Grigoriadou, Maria; Economides, John; Van Camp, Guy; Hilgert, Nele; Moreno, Felipe; Alsina, Berta; Petersen, Michael B.; Kremer, Hannie
2010-01-01
POU3F4 encodes a POU-domain transcription factor required for inner ear development. Defects in POU3F4 function are associated with X-linked deafness type 3 (DFN3). Multiple deletions affecting up to ~900-kb upstream of POU3F4 are found in DFN3 patients, suggesting the presence of essential POU3F4 enhancers in this region. Recently, an inner ear enhancer was reported that is absent in most DFN3 patients with upstream deletions. However, two indications suggest that additional enhancers in the POU3F4 upstream region are required for POU3F4 function during inner ear development. First, there is at least one DFN3 deletion that does not eliminate the reported enhancer. Second, the expression pattern driven by this enhancer does not fully recapitulate Pou3f4 expression in the inner ear. Here, we screened a 1-Mb region upstream of the POU3F4 gene for additional cis-regulatory elements and searched for novel DFN3 mutations in the identified POU3F4 enhancers. We found several novel enhancers for otic vesicle expression. Some of these also drive expression in kidney, pancreas and brain, tissues that are known to express Pou3f4. In addition, we report a new and smallest deletion identified so far in a DFN3 family which eliminates 3.9 kb, comprising almost exclusively the previous reported inner ear enhancer. We suggest that multiple enhancers control the expression of Pou3f4 in the inner ear and these may contribute to the phenotype observed in DFN3 patients. In addition, the novel deletion demonstrates that the previous reported enhancer, although not sufficient, is essential for POU3F4 function during inner ear development. Electronic supplementary material The online version of this article (doi:10.1007/s00439-010-0864-x) contains supplementary material, which is available to authorized users. PMID:20668882
Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E
2016-01-01
Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.
LTR12 promoter activation in a broad range of human tumor cells by HDAC inhibition
Krönung, Sonja K.; Beyer, Ulrike; Chiaramonte, Maria Luisa; Dolfini, Diletta; Mantovani, Roberto; Dobbelstein, Matthias
2016-01-01
A considerable proportion of the human genome consists of transposable elements, including the long terminal repeats (LTRs) of endogenous retroviruses. During evolution, such LTRs were occasionally inserted upstream of protein-coding genes, contributing to their regulation. We previously identified the LTR12 from endogenous retrovirus 9 (ERV9) as a regulator of proapoptotic genes such as TP63 or TNFRSF10B. The promoter activity of LTR12 is largely confined to the testes, silenced in testicular carcinoma, but reactivated in testicular cancer cells by broad-range histone deacetylase (HDAC) inhibitors. Here we show that inhibition of HDAC1-3 is sufficient for LTR12 activation. Importantly, HDAC inhibitors induce LTR12 activity not only in testicular cancer cells, but also in cells derived from many additional tumor species. Finally, we characterize the transcription factor NF-Y as a mediator of LTR12 promoter activity and HDAC inhibitor-induced apoptosis, in the context of widespread genomic binding of NF-Y to specific LTR12 sequences. Thus, HDAC inhibitor-driven LTR12 activation represents a generally applicable means to induce proapoptotic genes in human cancer cells. PMID:27172897
Retinoid regulation of the zebrafish cyp26a1 promoter.
Hu, Ping; Tian, Miao; Bao, Jie; Xing, Guangdong; Gu, Xingxing; Gao, Xiang; Linney, Elwood; Zhao, Qingshun
2008-12-01
Cyp26A1 is a major enzyme that controls retinoic acid (RA) homeostasis by metabolizing RA into bio-inactive metabolites. Previous research revealed that the mouse Cyp26A1 promoter has two canonical RA response elements (RAREs) that underlie the regulation of the gene by RA. Analyzing the 2,533-base pairs (2.5 k) genomic sequence upstream of zebrafish cyp26a1 start codon, we report that the two RAREs are conserved in zebrafish cyp26a1 promoter. Mutagenesis demonstrated that the two RAREs work synergistically in RA inducibility of cyp26a1. Fusing the 2.5 k (kilobase pairs) fragment to the enhanced yellow fluorescent protein (eYFP) reporter gene, we have generated two transgenic lines of zebrafish [Tg(cyp26a1:eYFP)]. The transgenic zebrafish display expression patterns similar to that of cyp26a1 gene in vivo. Consistent with the in vitro results, the reporter activity is RA inducible in embryos. Taken together, our results demonstrate that the 2.5 k fragment underlies the regulation of the zebrafish cyp26a1 gene by RA. (c) 2008 Wiley-Liss, Inc.
Regulation of the scp Genes in the Cyanobacterium Synechocystis sp. PCC 6803--What is New?
Cheregi, Otilia; Funk, Christiane
2015-08-12
In the cyanobacterium Synechocystis sp. PCC 6803 there are five genes encoding small CAB-like (SCP) proteins, which have been shown to be up-regulated under stress. Analyses of the promoter sequences of the scp genes revealed the existence of an NtcA binding motif in two scp genes, scpB and scpE. Binding of NtcA, the key transcriptional regulator during nitrogen stress, to the promoter regions was shown by electrophoretic mobility shift assay. The metabolite 2-oxoglutarate did not increase the affinity of NtcA for binding to the promoters of scpB and scpE. A second motif, the HIP1 palindrome 5' GGCGATCGCC 3', was detected in the upstream regions of scpB and scpC. The transcription factor encoded by sll1130 has been suggested to recognize this motif to regulate heat-responsive genes. Our data suggest that HIP1 is not a regulatory element within the scp genes. Further, the presence of the high light regulatory (HLR1) motif was confirmed in scpB-E, in accordance to their induced transcriptions in cells exposed to high light. The HLR1 motif was newly discovered in eight additional genes.
Apparatus for purifying exhaust gases of internal combustion engines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kakinuma, A.; Oya, H.
1980-06-03
Apparatus for purifying the exhaust gases of internal combustion engines is disclosed that is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a cylindrical shell having an inlet chamber, a catalyst chamber, an outlet chamber, and a monolithic catalyst element in the catalyst chamber. The inlet chamber has inlet ports communicating with the upstream exhaust pipes respectively and axial lines of the inlet ports cross each other in the inlet chamber. In the inlet chamber, a diffusion means is provided to diffuse the exhaust gas for uniformly distributingmore » it to the catalyst element.« less
Grove, Arianna P; Liveris, Dionysios; Iyer, Radha; Petzke, Mary; Rudman, Joseph; Caimano, Melissa J; Radolf, Justin D; Schwartz, Ira
2017-08-22
The alternative sigma factor RpoS plays a key role modulating gene expression in Borrelia burgdorferi , the Lyme disease spirochete, by transcribing mammalian host-phase genes and repressing σ 70 -dependent genes required within the arthropod vector. To identify cis regulatory elements involved in RpoS-dependent repression, we analyzed green fluorescent protein (GFP) transcriptional reporters containing portions of the upstream regions of the prototypical tick-phase genes ospAB , the glp operon, and bba74 As RpoS-mediated repression occurs only following mammalian host adaptation, strains containing the reporters were grown in dialysis membrane chambers (DMCs) implanted into the peritoneal cavities of rats. Wild-type spirochetes harboring ospAB - and glp-gfp constructs containing only the minimal (-35/-10) σ 70 promoter elements had significantly lower expression in DMCs relative to growth in vitro at 37°C; no reduction in expression occurred in a DMC-cultivated RpoS mutant harboring these constructs. In contrast, RpoS-mediated repression of bba74 required a stretch of DNA located between -165 and -82 relative to its transcriptional start site. Electrophoretic mobility shift assays employing extracts of DMC-cultivated B. burgdorferi produced a gel shift, whereas extracts from RpoS mutant spirochetes did not. Collectively, these data demonstrate that RpoS-mediated repression of tick-phase borrelial genes occurs by at least two distinct mechanisms. One (e.g., ospAB and the glp operon) involves primarily sequence elements near the core promoter, while the other (e.g., bba74 ) involves an RpoS-induced transacting repressor. Our results provide a genetic framework for further dissection of the essential "gatekeeper" role of RpoS throughout the B. burgdorferi enzootic cycle. IMPORTANCE Borrelia burgdorferi , the Lyme disease spirochete, modulates gene expression to adapt to the distinctive environments of its mammalian host and arthropod vector during its enzootic cycle. The alternative sigma factor RpoS has been referred to as a "gatekeeper" due to its central role in regulating the reciprocal expression of mammalian host- and tick-phase genes. While RpoS-dependent transcription has been studied extensively, little is known regarding the mechanism(s) of RpoS-mediated repression. We employed a combination of green fluorescent protein transcriptional reporters along with an in vivo model to define cis regulatory sequences responsible for RpoS-mediated repression of prototypical tick-phase genes. Repression of ospAB and the glp operon requires only sequences near their core promoters, whereas modulation of bba74 expression involves a putative RpoS-dependent repressor that binds upstream of the core promoter. Thus, Lyme disease spirochetes employ at least two different RpoS-dependent mechanisms to repress tick-phase genes within the mammal. Copyright © 2017 Grove et al.
Two cis elements collaborate to spatially repress transcription from a sea urchin promoter
NASA Technical Reports Server (NTRS)
Frudakis, T. N.; Wilt, F.
1995-01-01
The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.
Observations on the Growth of Roughness Elements Into Icing Feathers
NASA Technical Reports Server (NTRS)
Vargas, Mario; Tsao, Jen, Ching
2007-01-01
This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Ying, Shibo; Dünnebier, Thomas; Si, Jing; Hamann, Ute
2013-01-01
UBC9 encodes a protein that conjugates small ubiquitin-related modifier (SUMO) to target proteins thereby changing their functions. Recently, it was noted that UBC9 expression and activity play a role in breast tumorigenesis and response to anticancer drugs. However, the underlying mechanism is poorly understood. To investigate the transcriptional regulation of the UBC9 gene, we identified and characterized its promoter and cis-elements. Promoter activity was tested using luciferase reporter assays. The binding of transcription factors to the promoter was detected by chromatin immunoprecipitation (ChIP), and their functional role was confirmed by siRNA knockdown. UBC9 mRNA and protein levels were measured by quantitative reverse transcription PCR and Western blot analysis, respectively. An increased expression of UBC9 mRNA and protein was found in MCF-7 breast cancer cells treated with 17β-estradiol (E2). Analysis of various deletion mutants revealed a 137 bp fragment upstream of the transcription initiation site to be sufficient for reporter gene transcription. Mutations of putative estrogen receptor α (ER-α) (one imperfect estrogen response element, ERE) and/or nuclear factor Y (NF-Y) binding sites (two CCAAT boxes) markedly reduced promoter activity. Similar results were obtained in ER-negative MDA-MB-231 cells except that the ERE mutation did not affect promoter activity. Additionally, promoter activity was stimulated upon E2 treatment and overexpression of ER-α or NF-YA in MCF-7 cells. ChIP confirmed direct binding of both transcription factors to the UBC9 promoter in vivo. Furthermore, UBC9 expression was diminished by ER-α and NF-Y siRNAs on the mRNA and protein levels. In conclusion, we identified the proximal UBC9 promoter and provided evidence that ER-α and NF-Y regulate UBC9 expression on the transcriptional level in response to E2 in MCF-7 cells. These findings may contribute to a better understanding of the regulation of UBC9 in ER-positive breast cancer and be useful for the development of cancer therapies targeting UBC9.
Inductively heated particulate matter filter regeneration control system
Gonze, Eugene V; Paratore Jr., Michael J; Kirby, Kevin W; Phelps, Amanda; Gregoire, Daniel J
2012-10-23
A system includes a particulate matter (PM) filter with an upstream end for receiving exhaust gas, a downstream end and zones. The system also includes a heating element. A control module selectively activates the heating element to inductively heat one of the zones.
Application of finite element approach to transonic flow problems
NASA Technical Reports Server (NTRS)
Hafez, M. M.; Murman, E. M.; Wellford, L. C., Jr.
1976-01-01
A variational finite element model for transonic small disturbance calculations is described. Different strategy is adopted in subsonic and supersonic regions, and blending elements are introduced between different regions. In the supersonic region, no upstream effect is allowed. If rectangular elements with linear shape functions are used, the model is similar to Murman's finite difference operators. Higher order shape functions, nonrectangular elements, and discontinuous approximation of shock waves are also discussed.
Park, Jin-Sup; Frost, Jennifer M.; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S.; Fischer, Robert L.; Choi, Yeonhee
2017-01-01
The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana. DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation. PMID:28130550
Mechanism of estrogen activation of c-myc oncogene expression.
Dubik, D; Shiu, R P
1992-08-01
The estrogen receptor complex is a known trans-acting factor that regulates transcription of specific genes through an interaction with a specific estrogen-responsive cis-acting element (ERE). In previous studies we have shown that in estrogen-responsive human breast cancer cells estrogen rapidly activates c-myc expression. This activated expression occurs through enhanced transcription and does not require the synthesis of new protein intermediates; therefore, an ERE is present in the human c-myc gene regulatory region. To localize the ERE, constructs containing varying lengths of the c-myc 5'-flanking region ranging from -2327 to +25 (relative to the P1 promoter) placed adjacent to the chloramphenicol acetyl transferase reporter gene (CAT) were prepared. They were used in transient transfection studies in MCF-7 and HeLa cells co-transfected with an estrogen receptor expression vector. These studies reveal that all constructs containing the P2 promoter region exhibited estrogen-regulated CAT expression and that a 116-bp region upstream and encompassing the P2 TATA box is necessary for this activity. Analysis of this 116-bp region failed to identify a cis-acting element with sequences resembling the consensus ERE; however, co-transfection studies with mutant estrogen receptor expression vectors showed that the DNA-binding domain of the receptor is essential for estrogen-regulated CAT gene expression. We have also observed that anti-estrogen receptor complexes can weakly trans-activate from this 116-bp region but fail to do so from the ERE-containing ApoVLDLII-CAT construct. To explain these results we propose a new mechanism of estrogen trans-activation in the c-myc gene promoter.
Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M
1989-10-05
We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.
Optimal frequency-response sensitivity of compressible flow over roughness elements
NASA Astrophysics Data System (ADS)
Fosas de Pando, Miguel; Schmid, Peter J.
2017-04-01
Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.
Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta
2010-01-01
POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840
Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression
Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang
2007-01-01
Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802
Wei, Yunxie; Liu, Guoyin; Bai, Yujing; Xia, Feiyu; He, Chaozu; Shi, Haitao; Foyer, Christine
2017-10-13
Similar to the situation in animals, melatonin biosynthesis is regulated by four sequential enzymatic steps in plants. Although the melatonin synthesis genes have been identified in various plants, the upstream transcription factors of them remain unknown. In this study on cassava (Manihot esculenta), we found that MeWRKY79 and heat-shock transcription factor 20 (MeHsf20) targeted the W-box and the heat-stress elements (HSEs) in the promoter of N-acetylserotonin O-methyltransferase 2 (MeASMT2), respectively. The interaction between MeWRKY79, MeHsf20, and the MeASMT2 promoter was evidenced by the activation of promoter activity and chromatin immunoprecipitation (ChIP) in cassava protoplasts, and by an in vitro electrophoretic mobility shift assay (EMSA). The transcripts of MeWRKY79, MeHsf20, and MeASMT2 were all regulated by a 22-amino acid flagellin peptide (flg22) and by Xanthomonas axonopodis pv manihotis (Xam). In common with the phenotype of MeASMT2, transient expression of MeWRKY79 and MeHsf20 in Nicotiana benthamiana leaves conferred improved disease resistance. Through virus-induced gene silencing (VIGS) in cassava, we found that MeWRKY79- and MeHsf20-silenced plants showed lower transcripts of MeASMT2 and less accumulation of melatonin, which resulted in disease sensitivity that could be reversed by exogenous melatonin. Taken together, these results indicate that MeASMT2 is a target of MeWRKY79 and MeHsf20 in plant disease resistance. This study identifies novel upstream transcription factors of melatonin synthesis genes in cassava, thus extending our knowledge of the complex modulation of melatonin synthesis in plant defense. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Liu, Yong; Mladinov, Domagoj; Pietrusz, Jennifer L.; Usa, Kristie; Liang, Mingyu
2009-01-01
Aims Hypertensive and other effects of excess glucocorticoids might be in part mediated by the suppression of endothelial nitric oxide synthase (eNOS) expression. We studied the transcriptional and biochemical mechanisms that mediate or modulate the suppression of eNOS expression by glucocorticoids. Methods and results We found that a mere three-fold increase in the concentration of the natural glucocorticoid cortisol (from 30 to 100 nmol/L) significantly decreased the expression level of eNOS in human endothelial cells. Deletion analysis of the eNOS promoter indicated that the segment within −119 bp upstream from the transcription start site was significantly involved in the effect of cortisol. Site-directed mutagenesis and chromatin immunoprecipitation analyses demonstrated the presence of a suppressive glucocorticoid response element (GRE) at −111 to −105 bp. 11β-hydroxysteroid dehydrogenases (11β-HSD) catalyse the interconversion of active and inactive glucocorticoids. The suppression of 11β-HSD2 using small interfering RNA markedly exacerbated the inhibition of eNOS by cortisol. The suppression of 11β-HSD1 abolished the inhibition of eNOS expression by cortisol. Conclusion We identified the first GRE in the eNOS promoter region and demonstrated that endogenous 11β-HSD1 and 11β-HSD2 play significant and distinct roles in modulating the effect of glucocorticoids on eNOS expression. PMID:18716005
Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio
2016-07-27
In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Javed, Muhammad Babar; Shotyk, William
2018-05-10
Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.
Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David
2001-01-01
Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681
Near-field flow structures about subcritical surface roughness
NASA Astrophysics Data System (ADS)
Doolittle, Charles J.; Drews, Scott D.; Goldstein, David B.
2014-12-01
Laminar flow over a periodic array of cylindrical surface roughness elements is simulated with an immersed boundary spectral method both to validate the method for subsequent studies and to examine how persistent streamwise vortices are introduced by a low Reynolds number roughness element. Direct comparisons are made with prior studies at a roughness-based Reynolds number Rek (=U(k) k/ν) of 205 and a diameter to spanwise spacing ratio d/λ of 1/3. Downstream velocity contours match present and past experiments very well. The shear layer developed over the top of the roughness element produces the downstream velocity deficit. Upstream of the roughness element, the vortex topology is found to be consistent with juncture flow experiments, creating three cores along the recirculation line. Streamtraces stemming from these upstream cores, however, have unexpectedly little effect on the downstream flowfield as lateral divergence of the boundary layer quickly dissipates their vorticity. Long physical relaxation time of the recirculating wake behind the roughness remains a prominent issue for simulating this type of flowfield.
Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E
1994-01-01
Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496
Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo
2013-07-01
The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Shielded regeneration heating element for a particulate filter
Gonze, Eugene V [Pinckney, MI; Ament, Frank [Troy, MI
2011-01-04
An exhaust system includes a particulate filter (PF) that is disposed downstream from an engine. The PF filters particulates within an exhaust from the engine. A heating element heats particulate matter in the PF. A catalyst substrate or a flow converter is disposed upstream from said heating element. The catalyst substrate oxidizes the exhaust prior to reception by the heating element. The flow converter converts turbulent exhaust flow to laminar exhaust flow prior to reception by the heating element.
Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu
2015-08-01
Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.
Prediction of Geomagnetic Activity and Key Parameters in High-latitude Ionosphere
NASA Technical Reports Server (NTRS)
Khazanov, George V.; Lyatsky, Wladislaw; Tan, Arjun; Ridley, Aaron
2007-01-01
Prediction of geomagnetic activity and related events in the Earth's magnetosphere and ionosphere are important tasks of US Space Weather Program. Prediction reliability is dependent on the prediction method, and elements included in the prediction scheme. Two of the main elements of such prediction scheme are: an appropriate geomagnetic activity index, and an appropriate coupling function (the combination of solar wind parameters providing the best correlation between upstream solar wind data and geomagnetic activity). We have developed a new index of geomagnetic activity, the Polar Magnetic (PM) index and an improved version of solar wind coupling function. PM index is similar to the existing polar cap PC index but it shows much better correlation with upstream solar wind/IMF data and other events in the magnetosphere and ionosphere. We investigate the correlation of PM index with upstream solar wind/IMF data for 10 years (1995-2004) that include both low and high solar activity. We also have introduced a new prediction function for the predicting of cross-polar-cap voltage and Joule heating based on using both PM index and upstream solar wind/IMF data. As we show such prediction function significantly increase the reliability of prediction of these important parameters. The correlation coefficients between the actual and predicted values of these parameters are approx. 0.9 and higher.
The genomic structure of the human UFO receptor.
Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W
1993-02-01
Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hubin, Elizabeth A.; Fay, Allison; Xu, Catherine
RbpA and CarD are essential transcription regulators in mycobacteria. Mechanistic analyses of promoter open complex (RPo) formation establish that RbpA and CarD cooperatively stimulate formation of an intermediate (RP2) leading to RPo; formation of RP2 is likely a bottleneck step at the majority of mycobacterial promoters. Once RPo forms, CarD also disfavors its isomerization back to RP2. We determined a 2.76 Å-resolution crystal structure of a mycobacterial transcription initiation complex (TIC) with RbpA as well as a CarD/RbpA/TIC model. Both CarD and RbpA bind near the upstream edge of the -10 element where they likely facilitate DNA bending and impedemore » transcription bubble collapse. In vivo studies demonstrate the essential role of RbpA, show the effects of RbpA truncations on transcription and cell physiology, and indicate additional functions for RbpA not evident in vitro. This work provides a framework to understand the control of mycobacterial transcription by RbpA and CarD.« less
Muro-Pastor, Alicia M.; Valladares, Ana; Flores, Enrique; Herrero, Antonia
1999-01-01
The heterocyst is the site of nitrogen fixation in aerobically grown cultures of some filamentous cyanobacteria. Heterocyst development in Anabaena sp. strain PCC 7120 is dependent on the global nitrogen regulator NtcA and requires, among others, the products of the hetR and hetC genes. Expression of hetC, tested by RNA- DNA hybridization, was impaired in an ntcA mutant. A nitrogen-regulated, NtcA-dependent putative transcription start point was localized at nucleotide −571 with respect to the hetC translational start. Sequences upstream from this transcription start point exhibit the structure of the canonical cyanobacterial promoter activated by NtcA, and purified NtcA protein specifically bound to a DNA fragment containing this promoter. Activation of expression of hetC during heterocyst development appears thus to be directly operated by NtcA. NtcA-mediated activation of hetR expression was not impaired in a hetC mutant, indicating that HetC is not an NtcA-dependent element required for hetR induction. PMID:10542167
Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne
2016-01-01
The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype. PMID:25782671
Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.
Boyer, S K; Mullet, J E
1988-07-01
The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.
Tao, Yan-Bin; He, Liang-Liang; Niu, Longjian; Xu, Zeng-Fu
2016-08-01
The 1.5 kb JcAP1 promoter from the biofuel plant Jatropha curcas is predominantly active in the inflorescence buds of transgenic plants, in which the -1313/-1057 region is essential for maintaining the activity. Arabidopsis thaliana APETALA1 (AP1) is a MADS-domain transcription factor gene that functions primarily in flower development. We isolated a homolog of AP1 from Jatropha curcas (designated JcAP1), which was shown to exhibit flower-specific expression in Jatropha. JcAP1 is first expressed in inflorescence buds and continues to be primarily expressed in the sepals. We isolated a 1.5 kb JcAP1 promoter and evaluated its activity in transgenic Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. In transgenic Arabidopsis and Jatropha, the inflorescence buds exhibited notable GUS activity, whereas the sepals did not. Against expectations, the JcAP1 promoter was active in the anthers of Arabidopsis and Jatropha and was highly expressed in Jatropha seeds. An analysis of promoter deletions in transgenic Arabidopsis revealed that deletion of the -1313/-1057 region resulted in loss of JcAP1 promoter activity in the inflorescence buds and increased activity in the anthers. These results suggested that some regulatory sequences in the -1313/-1057 region are essential for maintaining promoter activity in inflorescence buds and can partly suppress activity in the anthers. Based on these findings, we hypothesized that other elements located upstream of the 1.5 kb JcAP1 promoter may be required for flower-specific activation. The JcAP1 promoter characterized in this study can be used to drive transgene expression in both the inflorescence buds and seeds of Jatropha.
In vitro and ex vivo analysis of CHRNA3 and CHRNA5 haplotype expression.
Doyle, Glenn A; Wang, Min-Jung; Chou, Andrew D; Oleynick, John U; Arnold, Steven E; Buono, Russell J; Ferraro, Thomas N; Berrettini, Wade H
2011-01-01
Genome-wide association studies implicate variations in CHRNA5 and CHRNA3 as being associated with nicotine addiction (NA). Multiple common haplotypes ("risk", "mixed" and "protective") exist in Europeans; however, high linkage disequilibrium between variations in CHRNA5 and CHRNA3 makes assigning causative allele(s) for NA difficult through genotyping experiments alone. We investigated whether CHRNA5 or CHRNA3 promoter haplotypes, associated previously with NA, might influence allelic expression levels. For in vitro analyses, promoter haplotypes were sub-cloned into a luciferase reporter vector. When assessed in BE(2)-C cells, luciferase expression was equivalent among CHRNA3 haplotypes, but the combination of deletion at rs3841324 and variation at rs503464 decreased CHRNA5 promoter-derived luciferase activity, possibly due to loss of an SP-1 and other site(s). Variation within the CHRNA5 5'UTR at rs55853698 and rs55781567 also altered luciferase expression in BE(2)-C cells. Allelic expression imbalance (AEI) from the "risk" or "protective" haplotypes was assessed in post-mortem brain tissue from individuals heterozygous at coding polymorphisms in CHRNA3 (rs1051730) or CHRNA5 (rs16969968). In most cases, equivalent allelic expression was observed; however, one individual showed CHRNA5 AEI that favored the "protective" allele and that was concordant with heterozygosity at polymorphisms ∼13.5 kb upstream of the CHRNA5 transcription start site. Putative enhancer activity from these distal promoter elements was assessed using heterologous promoter constructs. We observed no differences in promoter activity from the two distal promoter haplotypes examined, but found that the distal promoter region strongly repressed transcription. We conclude that CHRNA5 promoter variants may affect relative risk for NA in some heterozygous individuals.
Negi, Sanjana; Tak, Himanshu; Ganapathi, T R
2018-03-01
MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.
Kim, Seon-Hee; Kong, Yoon; Bae, Young-An
2017-06-01
Autonomous retrotransposons, in which replication and transcription are coupled, encode the essential gag and pol genes as a fusion or separate overlapping form(s) that are expressed in single transcripts regulated by a common upstream promoter. The element-specific expression strategies have driven development of relevant translational recoding mechanisms including ribosomal frameshifting to satisfy the protein stoichiometry critical for the assembly of infectious virus-like particles. Retrotransposons with different recoding strategies exhibit a mosaic distribution pattern across the diverse families of reverse transcribing elements, even though their respective distributions are substantially skewed towards certain family groups. However, only a few investigations to date have focused on the emergence of retrotransposons evolving novel expression strategy and causal genetic drivers of the structural variants. In this study, the bulk of genomic and transcribed sequences of a Ty3/gypsy-like CsRn1 retrotransposon in Clonorchis sinensis were analyzed for the comprehensive examination of its expression strategy. Our results demonstrated that structural variants with single open reading frame (ORF) have recurrently emerged from precedential CsRn1 copies encoding overlapping gag-pol ORFs by a single-nucleotide insertion in an upstream region of gag stop codon. In the parasite genome, some of the newly evolved variants appeared to undergo proliferative burst as active master lineages together with their ancestral copies. The genetic event was similarly observed in Opisthorchis viverrini, the closest neighbor of C. sinensis, whereas the resulting structural variants might have failed to overcome purifying selection and comprised minor remnant copies in the Opisthorchis genome. Copyright © 2017 Elsevier B.V. All rights reserved.
Dziewit, Lukasz; Jazurek, Magdalena; Drewniak, Lukasz; Baj, Jadwiga; Bartosik, Dariusz
2007-03-01
A group of proteic toxin-antitoxin (TA) cassettes whose representatives are widely distributed among bacterial genomes has been identified. These cassettes occur in chromosomes, plasmids, bacteriophages, and noncomposite transposons, as well as in the SXT conjugative element of Vibrio cholerae. The following four homologous loci were subjected to detailed comparative studies: (i) tad-ata from plasmid pAMI2 of Paracoccus aminophilus (the prototype of this group), (ii) gp49-gp48 from the linear bacteriophage N15 of Escherichia coli, (iii) s045-s044 from SXT, and (iv) Z3230-Z3231 from the genomic island of enterohemorrhagic Escherichia coli O157:H7 strain EDL933. Functional analysis revealed that all but one of these loci (Z3230-Z3231) are able to stabilize heterologous replicons, although the host ranges varied. The TA cassettes analyzed have the following common features: (i) the toxins are encoded by the first gene of each operon; (ii) the antitoxins contain a predicted helix-turn-helix motif of the XRE family; and (iii) the cassettes have two promoters that are different strengths, one which is located upstream of the toxin gene and one which is located upstream of the antitoxin gene. All four toxins tested are functional in E. coli; overexpression of the toxins (in the absence of antitoxin) results in a bacteriostatic effect manifested by elongation of bacterial cells and growth arrest. The toxins have various effects on cell viability, which suggests that they may recognize different intracellular targets. Preliminary data suggest that different cellular proteases are involved in degradation of antitoxins encoded by the loci analyzed.
Src is a major signaling component for CTGF induction by TGF-β1 in osteoblasts
X, Zhang; JA, Arnott; S, Rehman; WG, DeLong; A, Sanjay; FF, Safadi; SN, Popoff
2010-01-01
Connective tissue growth factor (CTGF/CCN2) is induced by transforming growth factor beta 1(TGF-β1) where it acts as a downstream mediator of TGF-β1 induced matrix production in osteoblasts. We have shown the requirement of Src, Erk and Smad signaling for CTGF induction by TGF-β1 in osteoblasts, however the potential interaction among these signaling pathways remains undetermined. In this study we demonstrate that TGF-β1 activates Src kinase in ROS17/2.8 cells and that treatment with the Src family kinase inhibitor PP2 prevents Src activation and CTGF induction by TGF-β1. Additionally, inhibiting Src activation prevented Erk activation, Smad 2 & 3 activation and nuclear translocation by TGF-β1, demonstrating that Src is an essential upstream signaling partner of both Erk and Smads in osteoblasts. MAPKs such as Erk can modulate the Smad pathway through directly mediating the phosphorylation of Smads or indirectly through activation/inactivation of required nuclear co-activators that mediate Smad DNA binding. When we treated cells with the Erk inhibitor, PD98059 it inhibited TGF-β1-induced CTGF protein expression but had no effect on Src activation, Smad activation or Smad nuclear translocation. However PD98059 impaired transcriptional complex formation on the Smad binding element (SBE) on the CTGF promoter, demonstrating that Erk activation was required for SBE transactivation. This data demonstrates that Src is an essential upstream signaling transducer of Erk and Smad signaling with respect to TGF-β1 in osteoblasts and that Smads and Erk function independently but are both essential for forming a transcriptionally active complex on the CTGF promoter in osteoblasts. PMID:20432467
Nature-based flood risk management -challenges in implementing catchment-wide management concepts
NASA Astrophysics Data System (ADS)
Thaler, Thomas; Fuchs, Sven
2017-04-01
Traditionally, flood risk management focused on coping with the flow at a given point by, for example, building dikes or straightening the watercourse. Increasingly the emphasis has shifted to measures within the flood plain to delay the flow through storage. As such the fluent boundaries imposed by the behaviour of the catchment at a certain point are relocated upstream by the human intervention. Therefore, the implementation of flood storages and the use of natural retention areas are promoted as mitigation measures to support sustainable flood risk management. They aimed at reducing the effluent boundaries on the floodplain by increasing the effluent boundaries upstream. However, beyond the simple change of practices it is indeed often a question of land use change which is at stake in water management. As such, it poses the questions on how to govern both water and land to satisfy the different stakeholders. Nature-based strategies often follow with voluntary agreements, which are promoted as an alternative instrument to the traditional top-down command and control regulation. Voluntary agreements aim at bringing more efficiency, participatory and transparency in solving problems between different social groups. In natural hazard risk management voluntary agreements are now receiving high interests to complement the existing policy instruments in order to achieve the objectives the EU WFD and of the Floods Directive. This paper investigates the use of voluntary agreements as an alternative instrument to the traditional top-down command and control regulation in the implementation of flood storages in Austria. The paper provides a framework of analysis to reveal barriers and opportunities associated with such approach. The paper concludes that institution and power are the central elements to tackle for allowing the success of voluntary agreement.
Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.
Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng
2012-08-01
A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.
King, Rodney A.; Madsen, Peter L.; Weisberg, Robert A.
2000-01-01
Lysogens of phage HK022 are resistant to infection by phage λ. Lambda resistance is caused by the action of the HK022 Nun protein, which prematurely terminates early λ transcripts. We report here that transcription of the nun gene initiates at a constitutive prophage promoter, PNun, located just upstream of the protein coding sequence. The 5′ end of the transcript was determined by primer extension analysis of RNA isolated from HK022 lysogens or RNA made in vitro by transcribing a template containing the promoter with purified Escherichia coli RNA polymerase. Inactivation of PNun by mutation greatly reduced Nun activity and Nun antigen in an HK022 lysogen. However, a low level of residual activity was detected, suggesting that a secondary promoter also contributes to nun expression. We found one possible secondary promoter, PNun′, just upstream of PNun. Neither promoter is likely to increase the expression of other phage genes in a lysogen because their transcripts should be terminated downstream of nun. We estimate that HK022 lysogens in stationary phase contain several hundred molecules of Nun per cell and that cells in exponential phase probably contain fewer. PMID:10629193
Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.
Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling
2015-06-19
Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.
Cloning and characterization of the mouse XPAC gene.
van Oostrom, C T; de Vries, A; Verbeek, S J; van Kreijl, C F; van Steeg, H
1994-01-01
Xeroderma Pigmentosum is a human disease, which is, among others, characterized by a high incidence of (sunlight induced) skin cancer, due to a defect in nucleotide excision repair (NER). The human DNA repair gene XPAC corrects this defect in cells isolated from Xeroderma Pigmentosum complementation group A (XP-A) patients. To enable the development of a transgenic mouse model for XP-A by gene targeting in embryonic stem cells, we cloned and characterized the mouse homologue of the XPAC gene. The mouse XPAC gene was found to consist of 6 exons, spanning approximately 21 kb. The nucleotide sequence of the exons is identical to that of the also cloned the mouse XPAC cDNA. Furthermore, the deduced amino acid sequence of the XPAC protein is the same as the one published previously by Tanaka et al. From CAT assay analysis, the promoter of the XPAC gene appeared to be located within 313 bp upstream of the assumed transcriptional start site. Like the promoters of other eukaryotic DNA repair genes (i.e. ERCC-1 and XPBC/ERCC-3), the mouse XPAC promoter region lacks classical promoter elements like TATA-, GC- and CAAT boxes. However, it contains an unique polypyrimidine-rich box, which is so far only found in genes encoding DNA repair enzymes. The function of this box in the regulation of transcription is still unclear. PMID:8127648
Wang, G; Liao, J; Tang, M; Yu, S
2018-02-01
1. Microphthalmia-associated transcription factor (MITF) plays a pivotal role in melanocyte development by regulating the transcription of major pigmentation enzymes (e.g. TYR, TYRP1 and DCT). A single-nucleotide polymorphism (SNP), c.-638T>C, was identified in the MITF promoter, and genotyping of a population (n = 426) revealed that SNP c.-638T>C was associated with skin colour in black-boned chickens. 2. Individuals with genotypes CC and TC exhibited greater MTIF expression than those with genotype TT. Luciferase assays also revealed that genotype CC and TC promoters had higher activity levels than genotype TT. Expression of melanogenesis-related gene (TYR) was higher in the skin of chickens with the CC and CT genotype compared to TT chickens (P < 0.05). 3. Transcription factor-binding site analyses showed that the c.-638C allele contains a putative binding site for transcription factor sterol regulatory element-binding transcription factor 2, aryl hydrocarbon receptor nuclear translocator, transcription factor binding to IGHM enhancer 3 and upstream transcription factor 2. In contrast, the c.-638T allele contains binding sites for Sp3 transcription factor and Krüppel-like factor 1. 4. It was concluded that MITF promoter polymorphisms affected chicken skin colour. SNP c.-638T>C could be used for the marker-assisted selection of skin colour in black-boned chicken breeding.
Transcriptional regulation of human papillomavirus type 18 P105 promoter by the co-activator CBP.
Valencia-Hernández, Armando; Cuevas-Bennett, Christian; Garrido, Efraín
2007-01-01
Human papillomaviruses (HPVs) are the etiological agents of cervical cancer, with HPV-16 and 18 being the representative types of the higher risk group. The expression of the viral genes with transforming activity (E6 and E7) is controlled by the upstream regulatory region (URR), a segment of the viral genome that contains elements recognized by several transcription factors. We have analyzed the participation of the cellular co-activator CBP on the transcriptional regulation of the HPV-18 URR. We generated mutants and 5' end deletion constructs derived from the HPV-18 URR and evaluated their transcriptional activity performing transient co-transfection assays on C-33A cells with a plasmid that over-expresses the co-activator CBP. We also performed quantitative chromatin immunoprecipitation assays to analyze the participation of the co-activator CBP on the HPV-18 P105 promoter. Our results demonstrate that in C-33A cells CBP acts as a strong activator of the HPV-18 P105 promoter by a mechanism that depends on the integrity of the SP1-binding site, directly correlating with the acetylation of the histone H3 that is involved in nucleosomal stability. We propose a mechanism of regulation of the HPV-18 P105 promoter by the cellular co-activator CBP, recruited by the transcription factor SP1. (c) 2008 S. Karger AG, Basel
Msn2p/Msn4p act as a key transcriptional activator of yeast cytoplasmic thiol peroxidase II.
Hong, Seung-Keun; Cha, Mee-Kyung; Choi, Yong-Soo; Kim, Won-Cheol; Kim, Il-Han
2002-04-05
We observed that the transcription of Saccharomyces cerevisiae cytoplasmic thiol peroxidase type II (cTPx II) (YDR453C) is regulated in response to various stresses (e.g. oxidative stress, carbon starvation, and heat-shock). It has been suggested that both transcription-activating proteins, Yap1p and Skn7p, regulate the transcription of cTPx II upon exposure to oxidative stress. However, a dramatic loss of transcriptional response to various stresses in yeast mutant strains lacking both Msn2p and Msn4p suggests that the transcription factors act as a principal transcriptional activator. In addition to two Yap1p response elements (YREs), TTACTAA and TTAGTAA, the presence of two stress response elements (STREs) (CCCCT) in the upstream sequence of cTPx II also suggests that Msn2p/Msn4p could control stress-induced expression of cTPx II. Analysis of the transcriptional activity of site-directed mutagenesis of the putative STREs (STRE1 and STRE2) and YREs (TRE1 and YRE2) in terms of the activity of a lacZ reporter gene under control of the cTPx II promoter indicates that STRE2 acts as a principal binding element essential for transactivation of the cTPx II promoter. The transcriptional activity of the cTPx II promoter was exponentially increased after postdiauxic growth. The transcriptional activity of the cTPx II promoter is greatly increased by rapamycin. Deletion of Tor1, Tor2, Ras1, and Ras2 resulted in a considerable induction when compared with their parent strains, suggesting that the transcription of cTPx II is under negative control of the Ras/cAMP and target of rapamycin signaling pathways. Taken together, these results suggest that cTPx II is a target of Msn2p/Msn4p transcription factors under negative control of the Ras-protein kinase A and target of rapamycin signaling pathways. Furthermore, the accumulation of cTPx II upon exposure to oxidative stress and during the postdiauxic shift suggests an important antioxidant role in stationary phase yeast cells.
TEs or not TEs? That is the evolutionary question.
Vaknin, Keren; Goren, Amir; Ast, Gil
2009-10-23
Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.
Zock, C; Iselt, A; Doerfler, W
1993-01-01
Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kerr, J.M.; Fisher, L.W.; Termine, J.D.
The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less
Inaba, Takehito; Nagano, Yukio; Sakakibara, Toshihiro; Sasaki, Yukiko
1999-01-01
The pra2 gene encodes a pea (Pisum sativum) small GTPase belonging to the YPT/rab family, and its expression is down-regulated by light, mediated by phytochrome. We have isolated and characterized a genomic clone of this gene and constructed a fusion DNA of its 5′-upstream region in front of the gene for firefly luciferase. Using this construct in a transient assay, we determined a pra2 cis-regulatory region sufficient to direct the light down-regulation of the luciferase reporter gene. Both 5′- and internal deletion analyses revealed that the 93-bp sequence between −734 and −642 from the transcriptional start site was important for phytochrome down-regulation. Gain-of-function analysis showed that this 93-bp region could confer light down-regulation when fused to the cauliflower mosaic virus 35S promoter. Furthermore, linker-scanning analysis showed that a 12-bp sequence within the 93-bp region mediated phytochrome down-regulation. Gel-retardation analysis showed the presence of a nuclear factor that was specifically bound to the 12-bp sequence in vitro. These results indicate that this element is a cis-regulatory element involved in phytochrome down-regulated expression. PMID:10364400
Gao, Feng; Simon, Anne E.
2016-01-01
Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5′-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3′ terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603
Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming
2013-10-01
Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.
Van Doorslaer, Koenraad; Chen, Dan; Chapman, Sandra; Khan, Jameela
2017-01-01
ABSTRACT Human papillomavirus (HPV) genomes are replicated and maintained as extrachromosomal plasmids during persistent infection. The viral E2 proteins are thought to promote stable maintenance replication by tethering the viral DNA to host chromatin. However, this has been very difficult to prove genetically, as the E2 protein is involved in transcriptional regulation and initiation of replication, as well as its assumed role in genome maintenance. This makes mutational analysis of viral trans factors and cis elements in the background of the viral genome problematic and difficult to interpret. To circumvent this problem, we have developed a complementation assay in which the complete wild-type HPV18 genome is transfected into primary human keratinocytes along with subgenomic or mutated replicons that contain the minimal replication origin. The wild-type genome provides the E1 and E2 proteins in trans, allowing us to determine additional cis elements that are required for long-term replication and partitioning of the replicon. We found that, in addition to the core replication origin (and the three E2 binding sites located therein), additional sequences from the transcriptional enhancer portion of the URR (upstream regulatory region) are required in cis for long-term genome replication. PMID:29162712
Damania, Blossom; Mital, Renu; Alwine, James C.
1998-01-01
The TATA-binding protein (TBP) is common to the basal transcription factors of all three RNA polymerases, being associated with polymerase-specific TBP-associated factors (TAFs). Simian virus 40 large T antigen has previously been shown to interact with the TBP-TAFII complexes, TFIID (B. Damania and J. C. Alwine, Genes Dev. 10:1369–1381, 1996), and the TBP-TAFI complex, SL1 (W. Zhai, J. Tuan, and L. Comai, Genes Dev. 11:1605–1617, 1997), and in both cases these interactions are critical for transcriptional activation. We show a similar mechanism for activation of the class 3 polymerase III (pol III) promoter for the U6 RNA gene. Large T antigen can activate this promoter, which contains a TATA box and an upstream proximal sequence element but cannot activate the TATA-less, intragenic VAI promoter (a class 2, pol III promoter). Mutants of large T antigen that cannot activate pol II promoters also fail to activate the U6 promoter. We provide evidence that large T antigen can interact with the TBP-containing pol III transcription factor human TFIIB-related factor (hBRF), as well as with at least two of the three TAFs in the pol III-specific small nuclear RNA-activating protein complex (SNAPc). In addition, we demonstrate that large T antigen can cofractionate and coimmunoprecipitate with the hBRF-containing complex TFIIIB derived from HeLa cells infected with a recombinant adenovirus which expresses large T antigen. Hence, similar to its function with pol I and pol II promoters, large T antigen interacts with TBP-containing, basal pol III transcription factors and appears to perform a TAF-like function. PMID:9488448
Rohmer, Stanimira; Mainka, Astrid; Knippertz, Ilka; Hesse, Andrea; Nettelbeck, Dirk M
2008-04-01
Key to the realization of gene therapy is the development of efficient and targeted gene transfer vectors. Therapeutic gene transfer by replication-deficient or more recently by conditionally replication-competent/oncolytic adenoviruses has shown much promise. For specific applications, however, it will be advantageous to provide vectors that allow for external control of gene expression. The efficient cellular heat shock system in combination with available technology for focused and controlled hyperthermia suggests heat-regulated transcription control as a promising tool for this purpose. We investigated the feasibility of a short fragment of the human hsp70B' promoter, with and without upstream insulator elements, for the regulation of transgene expression by replication-deficient or oncolytic adenoviruses. Two novel adenoviral vectors with an insulated hsp70B' promoter were developed and showed stringent heat-inducible gene expression with induction ratios up to 8000-fold. In contrast, regulation of gene expression from the hsp70B' promoter without insulation was suboptimal. In replication-competent/oncolytic adenoviruses regulation of the hsp70B' promoter was lost specifically during late replication in permissive cells and could not be restored by the insulators. We developed novel adenovirus gene transfer vectors that feature improved and stringent regulation of transgene expression from the hsp70B' promoter using promoter insulation. These vectors have potential for gene therapy applications that benefit from external modulation of therapeutic gene expression or for combination therapy with hyperthermia. Furthermore, our study reveals that vector replication can deregulate inserted cellular promoters, an observation which is of relevance for the development of replication-competent/oncolytic gene transfer vectors. (c) 2008 John Wiley & Sons, Ltd.
Detection of neuroendocrine tumors using promoter-specific secreted Gaussia luciferase.
Tseng, Alan Wei-Shun; Akerstrom, Victoria; Chen, Chiachen; Breslin, Mary B; Lan, Michael S
2016-01-01
Accurate detection of neuroendocrine (NE) tumors is critically important for better prognosis and treatment outcomes in patients. To demonstrate the efficacy of using an adenoviral vector for the detection of NE tumors, we have constructed a pair of adenoviral vectors which, in combination, can conditionally replicate and release Gaussia luciferase into the circulation after infecting the NE tumors. The expression of these two vectors is regulated upstream by an INSM1-promoter (insulinoma-associated-1) that is specifically active in NE tumors and developing NE tissues, but silenced in normal adult tissues. In order to retain the tumor-specificity of the INSM1 promoter, we have modified the promoter using the core insulator sequence from the chicken β-globin HS4 insulator and the neuronal restrictive silencing element (NRSE). This modified INSM1-promoter can retain NE tumor specificity in an adenoviral construct while driving a mutated adenovirus E1A gene (∆24E1A), the Metridia, or Gaussia luciferase gene. The in vitro cell line and mouse xenograft human tumor studies revealed the NE specificity of the INSM1-promoter in NE lung cancer, neuroblastoma, medulloblastoma, retinoblastoma, and insulinoma. When we combined the INSM1-promoter driven Gaussia luciferase with ∆24E1A, the co-infected NE tumor secreted higher levels of Gaussia luciferase as compared to the INSM1p-Gaussia virus alone. In a mouse subcutaneous xenograft tumor model, the combination viruses secreted detectable level of Gaussia luciferase after infecting an INSM1-positive NE lung tumor for ≥12 days. Therefore, the INSM1-promoter specific conditional replicating adenovirus represents a sensitive diagnostic tool to aid clinicians in the detection of NE tumors.
Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.
1998-01-01
Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886
Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L
2015-06-01
IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.
Purification and characterization of human mitochondrial transcription factor 1.
Fisher, R P; Clayton, D A
1988-01-01
We purified to near homogeneity a transcription factor from human KB cell mitochondria. This factor, designated mitochondrial transcription factor 1 (mtTF1), is required for the in vitro recognition of both major promoters of human mitochondrial DNA by the homologous mitochondrial RNA polymerase. Furthermore, it has been shown to bind upstream regulatory elements of the two major promoters. After separation from RNA polymerase by phosphocellulose chromatography, mtTF1 was chromatographed on a MonoQ anion-exchange fast-performance liquid chromatography column. Analysis of mtTF1-containing fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single major polypeptide with an Mr of approximately 25,000. Centrifugation in analytical glycerol gradients indicated a sedimentation coefficient of approximately 2.5 S, consistent with a monomeric 25-kilodalton protein. Finally, when the 25-kilodalton polypeptide was excised from a stained sodium dodecyl sulfate-polyacrylamide gel and allowed to renature, it regained DNA-binding and transcriptional stimulatory activities at both promoters. Although mtTF1 is the only mitochondrial DNA-binding transcription factor to be purified and characterized, its properties, such as a high affinity for random DNA and a weak specificity for one of its target sequences, may typify this class of regulatory proteins. Images PMID:3211148
Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J
2016-01-04
The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.
Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.
2015-01-01
The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315
Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji
2018-05-03
Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.
The human phospholamban gene: structure and expression.
McTiernan, C F; Frye, C S; Lemster, B H; Kinder, E A; Ogletree-Hughes, M L; Moravec, C S; Feldman, A M
1999-03-01
Phospholamban, through modulation of sarcoplasmic reticulum calcium-ATPase activity, is a key regulator of cardiac diastolic function. Alterations in phospholamban expression may define parameters of muscle relaxation. In experimental animals, phospholamban is differentially expressed in various striated and smooth muscles, and within the four chambers of the heart. Decreased phospholamban expression within the heart during heart failure has also been observed. Furthermore, regulatory elements of mammalian phospholamban genes remain poorly defined. To extend these studies to humans, we (1) characterized phospholamban expression in various human organs, (2) isolated genomic clones encoding the human phospholamban gene, and (3) prepared human phospholamban promoter/luciferase reporter constructs and performed transient transfection assays to begin identification of regulatory elements. We observed that human ventricle and quadriceps displayed high levels of phospholamban transcripts and proteins, with markedly lower expression observed in smooth muscles, while the right atria also expressed low levels of phospholamban. The human phospholamban gene structure closely resembles that reported for chicken, rabbit, rat, and mouse. Comparison of the human to other mammalian phospholamban genes indicates a marked conservation of sequence for at least 217 bp upstream of the transcription start site, which contains conserved motifs for GATA, CP1/NFY, M-CAT-like, and E-box elements. Transient transfection assays with a series of plasmids containing deleted 5' flanking regions (between -2530 and -66 through +85) showed that sequences between -169 and the CP1-box at -93 were required for maximal promoter activity in neonatal rat cardiomyocytes. Activity of these reporters in HeLa cells was markedly lower than that observed in rat cardiomyocytes, suggesting at least a partial tissue selectivity of these reporter constructs.
Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra
2012-01-01
We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr+). The epithelial invasion of Dr+ E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by down-regulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5′-untranslated region and mapped NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5′-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3′-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. The NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. PMID:23176121
Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra
2013-02-01
We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr(+) ). The epithelial invasion of Dr(+) E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by downregulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5'-untranslated region and mapped the NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5'-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3'-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to the AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. © 2012 The Authors Journal compilation © 2012 FEBS.
Taylor, J P; Pomerantz, R; Bagasra, O; Chowdhury, M; Rappaport, J; Khalili, K; Amini, S
1992-01-01
The Tat protein of human immunodeficiency virus type 1 (HIV-1) is essential for productive infection and is a potential target for antiviral therapy. Tat, a potent activator of HIV-1 gene expression, serves to greatly increase the rate of transcription directed by the viral promoter. This induction, which seems to be an important component in the progression of acquired immune deficiency syndrome (AIDS), may be due to increased transcriptional initiation, increased transcriptional elongation, or a combination of these processes. Much attention has been focused on the interaction of Tat with a specific RNA target termed TAR (transactivation responsive) which is present in the leader sequence of all HIV-1 mRNAs. This interaction is believed to be an important component of the mechanism of transactivation. In this report we demonstrate that in certain CNS-derived cells Tat is capable of activating HIV-1 through a TAR-independent pathway. A Tat-responsive element is found upstream within the viral promoter that in glial-derived cell lines allows transactivation in the absence of TAR. Deletion mapping and hybrid promoter constructs demonstrate that the newly identified Tat-responsive element corresponds to a sequence within the viral long terminal repeat (LTR) previously identified as the HIV-1 enhancer, or NF-kappa B domain. DNA band-shift analysis reveals NF-kappa B binding activity in glial cells that differs from that present in T lymphoid cells. Further, we observe that TAR-deleted mutants of HIV-1 demonstrate normal late gene expression in glial cells as evidenced by syncytia formation and production of viral p24 antigen.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1505523
Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).
Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko
2010-02-01
GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.
Particle Velocity Measuring System
NASA Technical Reports Server (NTRS)
Arndt, G. Dickey (Inventor); Carl, James R. (Inventor)
1998-01-01
Method and apparatus are provided for determining the velocity of individual food particles within a liquid/solid food mixture that is cooked by an aseptic cooking method whereby the food mixture is heated as it flows through a flowline. At least one upstream and at least one downstream microwave transducer are provided to determine the minimum possible travel time of the fastest food particle through the flowline. In one embodiment, the upstream detector is not required. In another embodiment, a plurality of small dipole antenna markers are secured to a plurality of food particles to provide a plurality of signals as the markers pass the upstream and downstream transducers. The dipole antenna markers may also include a non-linear element to reradiate a harmonic frequency of a transmitter frequency. Upstream and downstream transducers include dipole antennas that are matched to the impedance of the food slurry and a signal transmission cable by various impedance matching means including unbalanced feed to the antennas.
Synthetic Promoters Functional in Francisella novicida and Escherichia coli
McWhinnie, Ralph L.
2014-01-01
In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126
Das, G; Henning, D; Wright, D; Reddy, R
1988-01-01
Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121
Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M
1984-01-01
Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178
Chen, Liang; Zheng, Yuhong; Dong, Zhimin; Meng, Fanfan; Sun, Xingmiao; Fan, Xuhong; Zhang, Yunfeng; Wang, Mingliang; Wang, Shuming
2018-04-01
Soybean is the world's most important leguminous crop producing high-quality protein and oil. Elevating oil accumulation in soybean seed is always many researchers' goal. WRINKLED1 (WRI1) encodes a transcription factor of the APETALA2/ethylene responsive element-binding protein (AP2/EREBP) family that plays important roles during plant seed oil accumulation. In this study, we isolated and characterized three distinct orthologues of WRI1 in soybean (Glycine max) that display different organ-specific expression patterns, among which GmWRI1a was highly expressed in maturing soybean seed. Electrophoretic mobility shift assays and yeast one-hybrid experiments demonstrated that the GmWRI1a protein was capable of binding to AW-box, a conserved sequence in the proximal upstream regions of many genes involved in various steps of oil biosynthesis. Transgenic soybean seeds overexpressing GmWRI1a under the control of the seed-specific napin promoter showed the increased total oil and fatty acid content and the changed fatty acid composition. Furthermore, basing on the activated expressions in transgenic soybean seeds and existence of AW-box element in the promoter regions, direct downstream genes of GmWRI1a were identified, and their products were responsible for fatty acid production, elongation, desaturation and export from plastid. We conclude that GmWRI1a transcription factor can positively regulate oil accumulation in soybean seed by a complex gene expression network related to fatty acid biosynthesis.
Niu, Gai-Li; Gou, Wei; Han, Xiang-Long; Qin, Cheng; Zhang, Li-Xin; Ashraf, Muhammad
2018-01-01
Betaine, a non-toxic osmoprotectant, is believed to accumulate considerably in plants under stress conditions to maintain the osmotic pressure and promote a variety of processes involved in growth and development. Phosphoethanolamine N-methyltransferase (PEAMT), a key enzyme for betaine synthesis, is reported to be regulated by its upstream promoter. In the present investigation, by using the transgenic approach, a 1048 bp long promoter region of ZmPEAMT gene from Zea mays was cloned and functionally characterized in tobacco. Computational analysis affirmed the existence of abiotic stress responsive cis-elements like ABRE, MYC, HST, LST etc., as well as pathogen, wound and phytohormone responsive motifs. For transformation in tobacco, four 5′-deletion constructs of 826 bp (P2), 642 bp (P3), 428 bp (P4) and 245 bp (P5) were constructed from the 1048 bp (P1) promoter fragment. The transgenic plants generated through a single event exhibited a promising expression of GUS reporter protein in the leaf tissues of treated with salt, drought, oxidative and cold stress as well as control plants. The GUS expression level progressively reduced from P1 to P5 in the leaf tissues, whereas a maximal expression was observed with the P3 construct in the leaves of control plants. The expression of GUS was noted to be higher in the leaves of osmotically- or salt-treated transgenic plants than that in the untreated (control) plants. An effective expression of GUS in the transgenic plants manifests that this promoter can be employed for both stress-inducible and constitutive expression of gene(s). Due to this characteristic, this potential promoter can be effectively used for genetic engineering of several crops. PMID:29316727
de Dios Barajas-López, Juan; Serrato, Antonio Jesús; Olmedilla, Adela; Chueca, Ana; Sahrawy, Mariam
2007-11-01
Plant thioredoxins (TRXs) are involved in redox regulation of a wide variety processes and usually exhibit organ specificity. We report strong evidence that chloroplastic TRXs are localized in heterotrophic tissues and suggest some ways in which they might participate in several metabolic and developmental processes. The promoter regions of the chloroplastic f and m1 TRX genes were isolated from a pea (Pisum sativum) plant genomic bank. Histochemical staining for beta-glucuronidase (GUS) in transgenic homozygous Arabidopsis (Arabidopsis thaliana) plants showed preferential expression of the 444-bp PsTRXf1 promoter in early seedlings, stems, leaves, and roots, as well as in flowers, stigma, pollen grains, and filaments. GUS activity under the control of the 1,874-bp PsTRXm1 promoter was restricted to the leaves, roots, seeds, and flowers. To gain insight into the translational regulation of these genes, a series of deletions of 5' elements in both TRX promoters were analyzed. The results revealed that a 126-bp construct of the PsTRXf2 promoter was unable to reproduce the expression pattern observed with the full promoter. The differences in expression and tissue specificity between PsTRXm1 and the deleted promoters PsTRXm2 and PsTRXm3 suggest the existence of upstream positive or negative regulatory regions that affect tissue specificity, sucrose metabolism, and light regulation. PsTRXm1 expression is finely regulated by light and possibly by other metabolic factors. In situ hybridization experiments confirmed new localizations of these chloroplastic TRX transcripts in vascular tissues and flowers, and therefore suggest possible new functions in heterotrophic tissues related to cell division, germination, and plant reproduction.
Alternative intronic promoters in development and disease.
Vacik, Tomas; Raska, Ivan
2017-05-01
Approximately 20,000 mammalian genes are estimated to encode between 250 thousand and 1 million different proteins. This enormous diversity of the mammalian proteome is caused by the ability of a single-gene locus to encode multiple protein isoforms. Protein isoforms encoded by one gene locus can be functionally distinct, and they can even have antagonistic functions. One of the mechanisms involved in creating this proteome complexity is alternative promoter usage. Alternative intronic promoters are located downstream from their canonical counterparts and drive the expression of alternative RNA isoforms that lack upstream exons. These upstream exons can encode some important functional domains, and proteins encoded by alternative mRNA isoforms can be thus functionally distinct from the full-length protein encoded by canonical mRNA isoforms. Since any misbalance of functionally distinct protein isoforms is likely to have detrimental consequences for the cell and the whole organism, their expression must be precisely regulated. Misregulation of alternative intronic promoters is frequently associated with various developmental defects and diseases including cancer, and it is becoming increasingly clear that this phenomenon deserves more attention.
Structural features of diverse Pin-II proteinase inhibitor genes from Capsicum annuum.
Mahajan, Neha S; Dewangan, Veena; Lomate, Purushottam R; Joshi, Rakesh S; Mishra, Manasi; Gupta, Vidya S; Giri, Ashok P
2015-02-01
The proteinase inhibitor (PI) genes from Capsicum annuum were characterized with respect to their UTR, introns and promoter elements. The occurrence of PIs with circularly permuted domain organization was evident. Several potato inhibitor II (Pin-II) type proteinase inhibitor (PI) genes have been analyzed from Capsicum annuum (L.) with respect to their differential expression during plant defense response. However, complete gene characterization of any of these C. annuum PIs (CanPIs) has not been carried out so far. Complete gene architectures of a previously identified CanPI-7 (Beads-on-string, Type A) and a member of newly isolated Bracelet type B, CanPI-69 are reported in this study. The 5' UTR (untranslated region), 3'UTR, and intronic sequences of both the CanPI genes were obtained. The genomic sequence of CanPI-7 exhibited, exon 1 (49 base pair, bp) and exon 2 (740 bp) interrupted by a 294-bp long type I intron. We noted the occurrence of three multi-domain PIs (CanPI-69, 70, 71) with circularly permuted domain organization. CanPI-69 was found to possess exon 1 (49 bp), exon 2 (551 bp) and a 584-bp long type I intron. The upstream sequence analysis of CanPI-7 and CanPI-69 predicted various transcription factor-binding sites including TATA and CAAT boxes, hormone-responsive elements (ABRELATERD1, DOFCOREZM, ERELEE4), and a defense-responsive element (WRKY71OS). Binding of transcription factors such as zinc finger motif MADS-box and MYB to the promoter regions was confirmed using electrophoretic mobility shift assay followed by mass spectrometric identification. The 3' UTR analysis for 25 CanPI genes revealed unique/distinct 3' UTR sequence for each gene. Structures of three domain CanPIs of type A and B were predicted and further analyzed for their attributes. This investigation of CanPI gene architecture will enable the better understanding of the genetic elements present in CanPIs.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Computation of Feedback Aeroacoustic System by the CE/SE Method
NASA Technical Reports Server (NTRS)
Loh, Ching Y.; Wang, Xiao Y.; Chang, Sin-Chung; Jorgenson, Philip C. E.
2000-01-01
It is well known that due to vortex shedding in high speed flow over cutouts, cavities, and gaps, intense noise may be generated. Strong tonal oscillations occur in a feedback cycle in which the vortices shed from the upstream edge of the cavity convect downstream and impinge on the cavity lip, generating acoustic waves that propagate upstream to excite new vortices. Numerical simulation of such a complicated process requires a scheme that can: (1) resolve acoustic waves with low dispersion and numerical dissipation, (2) handle nonlinear and discontinuous waves (e.g. shocks), and (3) have an effective (near field) nonreflecting boundary condition (NRBC). The new space time conservation element and solution element method, or CE/SE for short, is a numerical method that meets the above requirements.
Erpen, L; Tavano, E C R; Harakava, R; Dutt, M; Grosser, J W; Piedade, S M S; Mendes, B M J; Mourão Filho, F A A
2018-05-23
Regulatory sequences from the citrus constitutive genes cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1) were isolated, fused to the uidA gene, and qualitatively and quantitatively evaluated in transgenic sweet orange plants. The 5' upstream region of a gene (the promoter) is the most important component for the initiation and regulation of gene transcription of both native genes and transgenes in plants. The isolation and characterization of gene regulatory sequences are essential to the development of intragenic or cisgenic genetic manipulation strategies, which imply the use of genetic material from the same species or from closely related species. We describe herein the isolation and evaluation of the promoter sequence from three constitutively expressed citrus genes: cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1). The functionality of the promoters was confirmed by a histochemical GUS assay in leaves, stems, and roots of stably transformed citrus plants expressing the promoter-uidA construct. Lower uidA mRNA levels were detected when the transgene was under the control of citrus promoters as compared to the expression under the control of the CaMV35S promoter. The association of the uidA gene with the citrus-derived promoters resulted in mRNA levels of up to 60-41.8% of the value obtained with the construct containing CaMV35S driving the uidA gene. Moreover, a lower inter-individual variability in transgene expression was observed amongst the different transgenic lines, where gene constructs containing citrus-derived promoters were used. In silico analysis of the citrus-derived promoter sequences revealed that their activity may be controlled by several putative cis-regulatory elements. These citrus promoters will expand the availability of regulatory sequences for driving gene expression in citrus gene-modification programs.
Intragenic Locus in Human PIWIL2 Gene Shares Promoter and Enhancer Functions.
Skvortsova, Yulia V; Kondratieva, Sofia A; Zinovyeva, Marina V; Nikolaev, Lev G; Azhikina, Tatyana L; Gainetdinov, Ildar V
2016-01-01
Recently, more evidence supporting common nature of promoters and enhancers has been accumulated. In this work, we present data on chromatin modifications and non-polyadenylated transcription characteristic for enhancers as well as results of in vitro luciferase reporter assays suggesting that PIWIL2 alternative promoter in exon 7 also functions as an enhancer for gene PHYHIP located 60Kb upstream. This finding of an intragenic enhancer serving as a promoter for a shorter protein isoform implies broader impact on understanding enhancer-promoter networks in regulation of gene expression.
Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P
2007-08-01
To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.
O'Sullivan, D J; O'Gara, F
1991-08-01
An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.
Drake, Carly; Gahagan, Jacqueline
2015-01-01
The use of cognitive-behavioral interventions that aim to improve men's health-seeking behaviors via women-a trend that grows increasingly troublesome as gender inequality persists-cannot address the deep-seated social, economic, and political inequalities contributing to the spread of HIV/AIDS, such as sexism and poverty. Such methods often rely on generalizations about men and women and regard female empowerment as a key goal, despite employing shaky definitions of the concept. Here we use the principles of health promotion, particularly determinants of health, to reflect upon and critique current interventions and present alternative programming models that engage both men and women in changing men's health-seeking behaviors and working "upstream" rather than "downstream" of the epidemic.
Cawley, William E.; Warnick, Robert F.
1982-01-01
1. In a nuclear reactor incorporating a plurality of columns of tubular fuel elements disposed in horizontal tubes in a mass of graphite wherein water flows through the tubes to cool the fuel elements, the improvement comprising at least one control column disposed in a horizontal tube including fewer fuel elements than in a normal column of fuel elements and tubular control elements disposed at both ends of said control column, and means for varying the horizontal displacement of the control column comprising a winch at the upstream end of the control column and a cable extending through the fuel and control elements and attached to the element at the downstream end of the column.
Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro
2010-01-01
Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].
Serial killers: ordering caspase activation events in apoptosis.
Slee, E A; Adrain, C; Martin, S J
1999-11-01
Caspases participate in the molecular control of apoptosis in several guises; as triggers of the death machinery, as regulatory elements within it, and ultimately as a subset of the effector elements of the machinery itself. The mammalian caspase family is steadily growing and currently contains 14 members. At present, it is unclear whether all of these proteases participate in apoptosis. Thus, current research in this area is focused upon establishing the repertoire and order of caspase activation events that occur during the signalling and demolition phases of cell death. Evidence is accumulating to suggest that proximal caspase activation events are typically initiated by molecules that promote caspase aggregation. As expected, distal caspase activation events are likely to be controlled by caspases activated earlier in the cascade. However, recent data has cast doubt upon the functional demarcation of caspases into signalling (upstream) and effector (downstream) roles based upon their prodomain lengths. In particular, caspase-3 may perform an important role in propagating the caspase cascade, in addition to its role as an effector caspase within the death programme. Here, we discuss the apoptosis-associated caspase cascade and the hierarchy of caspase activation events within it.
Huang, Xi; Duan, Min; Liao, Jiakai; Yuan, Xi; Chen, Hui; Feng, Jiejie; Huang, Ji; Zhang, Hong-Sheng
2014-01-01
Homeodomain-leucine zipper type I (HD-Zip I) proteins are involved in the regulation of plant development and response to environmental stresses. In this study, OsSLI1 (Oryza sativa stress largely induced 1), encoding a member of the HD-Zip I subfamily, was isolated from rice. The expression of OsSLI1 was dramatically induced by multiple abiotic stresses and exogenous abscisic acid (ABA). In silico sequence analysis discovered several cis-acting elements including multiple ABREs (ABA-responsive element binding factors) in the upstream promoter region of OsSLI1. The OsSLI1-GFP fusion protein was localized in the nucleus of rice protoplast cells and the transcriptional activity of OsSLI1 was confirmed by the yeast hybrid system. Further, it was found that OsSLI1 expression was enhanced in an ABI5-Like1 (ABL1) deficiency rice mutant abl1 under stress conditions, suggesting that ABL1 probably negatively regulates OsSLI1 gene expression. Moreover, it was found that OsSLI1 was regulated in panicle development. Taken together, OsSLI1 may be a transcriptional activator regulating stress-responsive gene expression and panicle development in rice.
Insulin signalling mechanisms for triacylglycerol storage.
Czech, M P; Tencerova, M; Pedersen, D J; Aouadi, M
2013-05-01
Insulin signalling is uniquely required for storing energy as fat in humans. While de novo synthesis of fatty acids and triacylglycerol occurs mostly in liver, adipose tissue is the primary site for triacylglycerol storage. Insulin signalling mechanisms in adipose tissue that stimulate hydrolysis of circulating triacylglycerol, uptake of the released fatty acids and their conversion to triacylglycerol are poorly understood. New findings include (1) activation of DNA-dependent protein kinase to stimulate upstream stimulatory factor (USF)1/USF2 heterodimers, enhancing the lipogenic transcription factor sterol regulatory element binding protein 1c (SREBP1c); (2) stimulation of fatty acid synthase through AMP kinase modulation; (3) mobilisation of lipid droplet proteins to promote retention of triacylglycerol; and (4) upregulation of a novel carbohydrate response element binding protein β isoform that potently stimulates transcription of lipogenic enzymes. Additionally, insulin signalling through mammalian target of rapamycin to activate transcription and processing of SREBP1c described in liver may apply to adipose tissue. Paradoxically, insulin resistance in obesity and type 2 diabetes is associated with increased triacylglycerol synthesis in liver, while it is decreased in adipose tissue. This and other mysteries about insulin signalling and insulin resistance in adipose tissue make this topic especially fertile for future research.
Regulation of zebrafish CYP3A65 transcription by AHR2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting
2013-07-15
CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenicmore » lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in mammalian CYP3 genes.« less
Hubin, Elizabeth A; Fay, Allison; Xu, Catherine; Bean, James M; Saecker, Ruth M; Glickman, Michael S; Darst, Seth A; Campbell, Elizabeth A
2017-01-01
RbpA and CarD are essential transcription regulators in mycobacteria. Mechanistic analyses of promoter open complex (RPo) formation establish that RbpA and CarD cooperatively stimulate formation of an intermediate (RP2) leading to RPo; formation of RP2 is likely a bottleneck step at the majority of mycobacterial promoters. Once RPo forms, CarD also disfavors its isomerization back to RP2. We determined a 2.76 Å-resolution crystal structure of a mycobacterial transcription initiation complex (TIC) with RbpA as well as a CarD/RbpA/TIC model. Both CarD and RbpA bind near the upstream edge of the −10 element where they likely facilitate DNA bending and impede transcription bubble collapse. In vivo studies demonstrate the essential role of RbpA, show the effects of RbpA truncations on transcription and cell physiology, and indicate additional functions for RbpA not evident in vitro. This work provides a framework to understand the control of mycobacterial transcription by RbpA and CarD. DOI: http://dx.doi.org/10.7554/eLife.22520.001 PMID:28067618
Consequences of reductive evolution for gene expression in an obligate endosymbiont.
Wilcox, Jennifer L; Dunbar, Helen E; Wolfinger, Russell D; Moran, Nancy A
2003-06-01
The smallest cellular genomes are found in obligate symbiotic and pathogenic bacteria living within eukaryotic hosts. In comparison with large genomes of free-living relatives, these reduced genomes are rearranged and have lost most regulatory elements. To test whether reduced bacterial genomes incur reduced regulatory capacities, we used full-genome microarrays to evaluate transcriptional response to environmental stress in Buchnera aphidicola, the obligate endosymbiont of aphids. The 580 genes of the B. aphidicola genome represent a subset of the 4500 genes known from the related organism, Escherichia coli. Although over 20 orthologues of E. coli heat stress (HS) genes are retained by B. aphidicola, only five were differentially expressed after near-lethal heat stress treatments, and only modest shifts were observed. Analyses of upstream regulatory regions revealed loss or degradation of most HS (sigma32) promoters. Genomic rearrangements downstream of an intact HS promoter yielded upregulation of a functionally unrelated and an inactivated gene. Reanalyses of comparable experimental array data for E. coli and Bacillus subtilis revealed that genome-wide differential expression was significantly lower in B. aphidicola. Our demonstration of a diminished stress response validates reports of temperature sensitivity in B. aphidicola and suggests that this reduced bacterial genome exhibits transcriptional inflexibility.
NASA Astrophysics Data System (ADS)
Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.
2004-12-01
Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.
Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Ripmaster, Tracy L; Levin, Henry L
2011-01-01
Long terminal repeat (LTR) retrotransposons are closely related to retroviruses and, as such, are important models for the study of viral integration and target site selection. The transposon Tf1 of Schizosaccharomyces pombe integrates with a strong preference for the promoters of polymerase II (Pol II)-transcribed genes. Previous work in vivo with plasmid-based targets revealed that the patterns of insertion were promoter specific and highly reproducible. To determine which features of promoters are recognized by Tf1, we studied integration in a promoter that has been characterized. The promoter of fbp1 has two upstream activating sequences, UAS1 and UAS2. We found that integration was targeted to two windows, one 180 nucleotides (nt) upstream and the other 30 to 40 nt downstream of UAS1. A series of deletions in the promoter showed that the integration activities of these two regions functioned autonomously. Integration assays of UAS2 and of a synthetic promoter demonstrated that strong promoter activity alone was not sufficient to direct integration. The factors that modulate the transcription activities of UAS1 and UAS2 include the activators Atf1p, Pcr1p, and Rst2p as well as the repressors Tup11p, Tup12p, and Pka1p. Strains lacking each of these proteins revealed that Atf1p alone mediated the sites of integration. These data indicate that Atf1p plays a direct and specific role in targeting integration in the promoter of fbp1.
Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Ripmaster, Tracy L.; Levin, Henry L.
2011-01-01
Long terminal repeat (LTR) retrotransposons are closely related to retroviruses and, as such, are important models for the study of viral integration and target site selection. The transposon Tf1 of Schizosaccharomyces pombe integrates with a strong preference for the promoters of polymerase II (Pol II)-transcribed genes. Previous work in vivo with plasmid-based targets revealed that the patterns of insertion were promoter specific and highly reproducible. To determine which features of promoters are recognized by Tf1, we studied integration in a promoter that has been characterized. The promoter of fbp1 has two upstream activating sequences, UAS1 and UAS2. We found that integration was targeted to two windows, one 180 nucleotides (nt) upstream and the other 30 to 40 nt downstream of UAS1. A series of deletions in the promoter showed that the integration activities of these two regions functioned autonomously. Integration assays of UAS2 and of a synthetic promoter demonstrated that strong promoter activity alone was not sufficient to direct integration. The factors that modulate the transcription activities of UAS1 and UAS2 include the activators Atf1p, Pcr1p, and Rst2p as well as the repressors Tup11p, Tup12p, and Pka1p. Strains lacking each of these proteins revealed that Atf1p alone mediated the sites of integration. These data indicate that Atf1p plays a direct and specific role in targeting integration in the promoter of fbp1. PMID:20980525
Göpel, Yvonne; Lüttmann, Denise; Heroven, Ann Kathrin; Reichenbach, Birte; Dersch, Petra; Görke, Boris
2011-01-01
Small RNAs GlmY and GlmZ compose a cascade that feedback-regulates synthesis of enzyme GlmS in Enterobacteriaceae. Here, we analyzed the transcriptional regulation of glmY/glmZ from Yersinia pseudotuberculosis, Salmonella typhimurium and Escherichia coli, as representatives for other enterobacterial species, which exhibit similar promoter architectures. The GlmY and GlmZ sRNAs of Y. pseudotuberculosis are transcribed from σ54-promoters that require activation by the response regulator GlrR through binding to three conserved sites located upstream of the promoters. This also applies to glmY/glmZ of S. typhimurium and glmY of E. coli, but as a difference additional σ70-promoters overlap the σ54-promoters and initiate transcription at the same site. In contrast, E. coli glmZ is transcribed from a single σ70-promoter. Thus, transcription of glmY and glmZ is controlled by σ54 and the two-component system GlrR/GlrK (QseF/QseE) in Y. pseudotuberculosis and presumably in many other Enterobacteria. However, in a subset of species such as E. coli this relationship is partially lost in favor of σ70-dependent transcription. In addition, we show that activity of the σ54-promoter of E. coli glmY requires binding of the integration host factor to sites upstream of the promoter. Finally, evidence is provided that phosphorylation of GlrR increases its activity and thereby sRNA expression. PMID:20965974
Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.
Ogino; Itakura; Kato; Aoki; Sato
1999-07-01
: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but also other regulatory elements, possibly ERE, play an important role in induced and constitutive expressions of the eel CYP1A1 gene.
Dong, Yewei; Wang, Shuqi; Chen, Junliang; Zhang, Qinghao; Liu, Yang; You, Cuihong; Monroig, Óscar; Tocher, Douglas R.; Li, Yuanyou
2016-01-01
Rabbitfish Siganus canaliculatus was the first marine teleost demonstrated to have the capability of biosynthesizing long-chain polyunsaturated fatty acids (LC-PUFA) from C18 precursors, and to possess a Δ4 fatty acyl desaturase (Δ4 Fad) which was the first report in vertebrates, and is a good model for studying the regulatory mechanisms of LC-PUFA biosynthesis in teleosts. In order to understand regulatory mechanisms of transcription of Δ4 Fad, the gene promoter was cloned and characterized in the present study. An upstream sequence of 1859 bp from the initiation codon ATG was cloned as the promoter candidate. On the basis of bioinformatic analysis, several binding sites of transcription factors (TF) including GATA binding protein 2 (GATA-2), CCAAT enhancer binding protein (C/EBP), nuclear factor 1 (NF-1), nuclear factor Y (NF-Y), hepatocyte nuclear factor 4α (HNF4α) and sterol regulatory element (SRE), were identified in the promoter by site-directed mutation and functional assays. HNF4α and NF-1 were confirmed to interact with the core promoter of Δ4 Fad by gel shift assay and mass spectrometry. Moreover, over-expression of HNF4α increased promoter activity in HEK 293T cells and mRNA level of Δ4 Fad in rabbitfish primary hepatocytes, respectively. The results indicated that HNF4α is a TF of rabbitfish Δ4 Fad. To our knowledge, this is the first report on promoter structure of a Δ4 Fad, and also the first demonstration of HNF4α as a TF of vertebrate Fad gene involved in transcription regulation of LC-PUFA biosynthesis. PMID:27472219
Judd, Jenni; Keleher, Helen
2013-12-01
Reorientation of the workforce in primary health care is a complex process and requires specific strategies and interventions. Primary health care providers are a key health care workforce that is expected to deliver tangible outcomes from disease prevention and health promotion strategies. This paper describes a training intervention that occurred as part of a broader participatory action research process for building health promotion capacity in the primary health care workforce. Participatory action research (PAR) was conducted over six action and reflection cycles in a two-year period (2001-02) in an urban community health setting in the Northern Territory. One of the PAR cycles was a training intervention that was identified as a need from a survey in the first action and reflection cycle. This training was facilitated by a health promotion specialist, face-to-face and comprised five 3.5-h sessions over a 5-month period. A pre-post questionnaire was used to measure the knowledge and skills components of the training intervention. The results reinforced the importance of using a participatory approach that involved the primary health care providers themselves. Multiple strategies such as workforce development within capacity building frameworks assisted in shifting work practice more upstream. Additionally, these strategies encouraged more reflective practice and built social capital within the primary health care workforce. Lessons from practice reinforce that workforce development influenced work practice change and is an important element in building the health promotion capacity of primary health care centres. SO WHAT?: Workforce development is critical for reorienting health services. Health promotion specialists play an important role in reorienting practice, which is only effective when combined with other strategies, and driven and led by the primary health care workforce.
Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression
Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula
2014-01-01
Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622
Dunn, R. C.; Laurie, C. C.
1995-01-01
Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745
White, J H; Johnson, A L; Lowndes, N F; Johnston, L H
1991-01-01
By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644
Zimmerman, Marc J.; Waldron, Marcus C.; DeSimone, Leslie A.
2015-01-01
Analysis of the representative constituents (total phosphorus, total chromium, and suspended sediment) upstream and downstream of impoundments indicated that the existing impoundments, such as Rice City Pond, can be sources of particulate contaminant loads in the Blackstone River. Loads of particulate phosphorus, particulate chromium, and suspended sediment were consistently higher downstream from Rice City Pond than upstream during high-flow events, and there was a positive, linear relation between streamflow and changes in these constituents from upstream to downstream of the impoundment. Thus, particulate contaminants were mobilized from Rice City Pond during high-flow events and transported downstream. In contrast, downstream loads of particulate phosphorus, particulate chromium, and suspended sediment were generally lower than or equal to upstream loads for the former Rockdale Pond impoundment. Sediments associated with the former impoundment at Rockdale Pond, breached in the late 1960s, did not appear to be mobilized during the high-flow events monitored during this study.
Goller, Carlos; Wang, Xin; Itoh, Yoshikane; Romeo, Tony
2006-01-01
The pgaABCD operon of Escherichia coli is required for production of the biofilm adhesin poly-β-1,6-N-acetyl-d-glucosamine (PGA). We establish here that NhaR, a DNA-binding protein of the LysR family of transcriptional regulators, activates transcription of this operon. Disruption of the nhaR gene decreased biofilm formation without affecting planktonic growth. PGA production was undetectable in an nhaR mutant strain. Expression of a pgaA′-′lacZ translational fusion was induced by NaCl and alkaline pH, but not by CaCl2 or sucrose, in an nhaR-dependent fashion. Primer extension and quantitative real-time reverse transcription-PCR analyses further revealed that NhaR affects the steady-state level of pga mRNA. A purified recombinant NhaR protein bound specifically and with high affinity within the pgaABCD promoter region; one apparent binding site overlaps the −35 element, and a second site lies immediately upstream of the first. This protein was necessary and sufficient for activation of in vitro transcription from the pgaA promoter. These results define a novel mechanism for regulation of biofilm formation in response to environmental conditions and suggest an expanded role for NhaR in promoting bacterial survival. PMID:16997959
Chowdhary, Surabhi; Kainth, Amoldeep S.
2017-01-01
ABSTRACT Three-dimensional (3D) chromatin organization is important for proper gene regulation, yet how the genome is remodeled in response to stress is largely unknown. Here, we use a highly sensitive version of chromosome conformation capture in combination with fluorescence microscopy to investigate Heat Shock Protein (HSP) gene conformation and 3D nuclear organization in budding yeast. In response to acute thermal stress, HSP genes undergo intense intragenic folding interactions that go well beyond 5′-3′ gene looping previously described for RNA polymerase II genes. These interactions include looping between upstream activation sequence (UAS) and promoter elements, promoter and terminator regions, and regulatory and coding regions (gene “crumpling”). They are also dynamic, being prominent within 60 s, peaking within 2.5 min, and attenuating within 30 min, and correlate with HSP gene transcriptional activity. With similarly striking kinetics, activated HSP genes, both chromosomally linked and unlinked, coalesce into discrete intranuclear foci. Constitutively transcribed genes also loop and crumple yet fail to coalesce. Notably, a missense mutation in transcription factor TFIIB suppresses gene looping, yet neither crumpling nor HSP gene coalescence is affected. An inactivating promoter mutation, in contrast, obviates all three. Our results provide evidence for widespread, transcription-associated gene crumpling and demonstrate the de novo assembly and disassembly of HSP gene foci. PMID:28970326
Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D; Castle, John C; Raymond, Christopher K; Lappala, Colin R; Schaefer, Amy L; Harwood, Caroline S; Greenberg, E Peter
2011-05-01
The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon.
Chowdhary, Surabhi; Kainth, Amoldeep S; Gross, David S
2017-12-15
Three-dimensional (3D) chromatin organization is important for proper gene regulation, yet how the genome is remodeled in response to stress is largely unknown. Here, we use a highly sensitive version of chromosome conformation capture in combination with fluorescence microscopy to investigate Heat Shock Protein ( HSP ) gene conformation and 3D nuclear organization in budding yeast. In response to acute thermal stress, HSP genes undergo intense intragenic folding interactions that go well beyond 5'-3' gene looping previously described for RNA polymerase II genes. These interactions include looping between upstream activation sequence (UAS) and promoter elements, promoter and terminator regions, and regulatory and coding regions (gene "crumpling"). They are also dynamic, being prominent within 60 s, peaking within 2.5 min, and attenuating within 30 min, and correlate with HSP gene transcriptional activity. With similarly striking kinetics, activated HSP genes, both chromosomally linked and unlinked, coalesce into discrete intranuclear foci. Constitutively transcribed genes also loop and crumple yet fail to coalesce. Notably, a missense mutation in transcription factor TFIIB suppresses gene looping, yet neither crumpling nor HSP gene coalescence is affected. An inactivating promoter mutation, in contrast, obviates all three. Our results provide evidence for widespread, transcription-associated gene crumpling and demonstrate the de novo assembly and disassembly of HSP gene foci. Copyright © 2017 American Society for Microbiology.
The Promoter of AtUSP Is Co-regulated by Phytohormones and Abiotic Stresses in Arabidopsis thaliana.
Bhuria, Monika; Goel, Parul; Kumar, Sanjay; Singh, Anil K
2016-01-01
Universal stress proteins (USPs) are known to be expressed in response to various abiotic stresses in a wide variety of organisms, such as bacteria, archaebacteria, protists, algae, fungi, plants, and animals. However, in plants, biological function of most of the USPs still remains obscure. In the present study, Arabidopsis USP gene ( AtUSP ) showed induction in response to abscisic acid (ABA) and various abiotic stresses viz . heat, dehydration, salt, osmotic, and cold stresses. Additionally, in silico analysis of AtUSP promoter identified several cis -elements responsive to phytohormones and abiotic stresses such as ABRE, ERE, DRE, and HSE, etc. To functionally validate the AtUSP promoter, the 1115 bp region of promoter was characterized under phytohormone and abiotic stress treatments. Deletion analysis of promoter was carried out by cloning the full length promoter (D0) and its three 5' deletion derivatives, D1 (964 bp), D2 (660 bp), and D3 (503 bp) upstream of the β-glucuronidase (GUS) reporter gene, which were then stably transformed in Arabidopsis plants. The AtUSP promoter (D0) showed minimal activity under non-stress conditions which was enhanced in response to phytohormone treatments (ABA and ACC) and abiotic stresses such as dehydration, heat, cold, salt, and osmotic stresses. The seedlings harboring D1 and D2 deletion fragments showed constitutive GUS expression even under control condition with increased activity almost under all the treatments. However, D3 seedlings exhibited complete loss of activity under control condition with induction under ACC treatment, dehydration, heat, oxidative, salt, and osmotic stresses. Thus, present study clearly showed that AtUSP promoter is highly inducible by phytohormones and multiple abiotic stresses and it can be exploited as stress inducible promoter to generate multi-stress tolerant crops with minimal effects on their other important traits.
Regulatory elements of Caenorhabditis elegans ribosomal protein genes
2012-01-01
Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635
Qiao, Huan; May, James M.
2012-01-01
Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872
Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.
1976-11-01
periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic
Kubo, E; Fatma, N; Sharma, P; Shinohara, T; Chylack, L T; Akagi, Y; Singh, D P
2002-07-26
Human involucrin (hINV), first appears in the cytosol of keratinocytes and ultimately cross-linked to membrane proteins via transglutaminase and forms a protective barrier as an insoluble envelope beneath the plasma membrane. Although the function and evolution of involucrin is known, the regulation of its gene expression is not well understood. An analysis of the hINV gene sequence, upstream of the transcription start site (-534 to +1 nt) revealed the presence of potential sites for binding of lens epithelium-derived growth factor (LEDGF); stress response element (STRE; A/TGGGGA/T) and heat shock element (HSE; nGAAn). We reported earlier that LEDGF activates stress-associated genes by binding to these elements and elevates cellular resistance to various stresses. Here, gel-shift and super-shift assays confirm the binding of LEDGF to the DNA fragments containing HSEs and STREs that are present in the involucrin gene promoter. Furthermore, hINV promoter linked to CAT reporter gene, cotransfected in human corneal simian virus 40-transformed keratinocytes (HCK), was transactivated by LEDGF significantly. In contrast, the activity of hINV promoter bearing mutations at the WT1 (containing HSE and STRE), WT2 (containing STRE) and WT3 (containing STRE) binding sites was diminished. In addition, in HCK cell over-expressing LEDGF, the levels of hINV mRNA and hINV protein are increased by four to five-fold. LEDGF is inducible to oxidants. Cells treated with 12-O-tetradecanoyl-phorbol-13-acetate (TPA), known to stimulate production of H(2)O(2), showed higher levels of LEDGF mRNA. Furthermore, our immunohistochemical studies revealed that hINV protein is found in the cytoplasm of HCK cells over-expressing LEDGF, but not detectable in the normal HCK cells or HCK cells transfected with vector. This regulation appears to be physiologically important, as over-expression of HCK with LEDGF increases the expression of the endogenous hINV gene and may provide new insight to understand the molecular mechanism of transcriptional regulation of this gene. LEDGF may play an important role in establishing an important barrier in corneal keratinocytes by maintaining epidermal turn-over rate, and protecting HCKs against stress.
ElemeNT: a computational tool for detecting core promoter elements.
Sloutskin, Anna; Danino, Yehuda M; Orenstein, Yaron; Zehavi, Yonathan; Doniger, Tirza; Shamir, Ron; Juven-Gershon, Tamar
2015-01-01
Core promoter elements play a pivotal role in the transcriptional output, yet they are often detected manually within sequences of interest. Here, we present 2 contributions to the detection and curation of core promoter elements within given sequences. First, the Elements Navigation Tool (ElemeNT) is a user-friendly web-based, interactive tool for prediction and display of putative core promoter elements and their biologically-relevant combinations. Second, the CORE database summarizes ElemeNT-predicted core promoter elements near CAGE and RNA-seq-defined Drosophila melanogaster transcription start sites (TSSs). ElemeNT's predictions are based on biologically-functional core promoter elements, and can be used to infer core promoter compositions. ElemeNT does not assume prior knowledge of the actual TSS position, and can therefore assist in annotation of any given sequence. These resources, freely accessible at http://lifefaculty.biu.ac.il/gershon-tamar/index.php/resources, facilitate the identification of core promoter elements as active contributors to gene expression.
AtmiRNET: a web-based resource for reconstructing regulatory networks of Arabidopsis microRNAs.
Chien, Chia-Hung; Chiang-Hsieh, Yi-Fan; Chen, Yi-An; Chow, Chi-Nga; Wu, Nai-Yun; Hou, Ping-Fu; Chang, Wen-Chi
2015-01-01
Compared with animal microRNAs (miRNAs), our limited knowledge of how miRNAs involve in significant biological processes in plants is still unclear. AtmiRNET is a novel resource geared toward plant scientists for reconstructing regulatory networks of Arabidopsis miRNAs. By means of highlighted miRNA studies in target recognition, functional enrichment of target genes, promoter identification and detection of cis- and trans-elements, AtmiRNET allows users to explore mechanisms of transcriptional regulation and miRNA functions in Arabidopsis thaliana, which are rarely investigated so far. High-throughput next-generation sequencing datasets from transcriptional start sites (TSSs)-relevant experiments as well as five core promoter elements were collected to establish the support vector machine-based prediction model for Arabidopsis miRNA TSSs. Then, high-confidence transcription factors participate in transcriptional regulation of Arabidopsis miRNAs are provided based on statistical approach. Furthermore, both experimentally verified and putative miRNA-target interactions, whose validity was supported by the correlations between the expression levels of miRNAs and their targets, are elucidated for functional enrichment analysis. The inferred regulatory networks give users an intuitive insight into the pivotal roles of Arabidopsis miRNAs through the crosstalk between miRNA transcriptional regulation (upstream) and miRNA-mediate (downstream) gene circuits. The valuable information that is visually oriented in AtmiRNET recruits the scant understanding of plant miRNAs and will be useful (e.g. ABA-miR167c-auxin signaling pathway) for further research. Database URL: http://AtmiRNET.itps.ncku.edu.tw/ © The Author(s) 2015. Published by Oxford University Press.
2012-01-01
Background Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication. PMID:23241244
Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling
2012-12-15
Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication.
Effects of metals on a montane aquatic system evaluated using an integrated assessment approach
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beltman, D.; Lipton, J.; Cacela, D.
Surface water, benthic invertebrates, aufwuchs, and sediments were sampled in a Rocky Mountain stream impacted by a cobalt-copper mine. A randomized study design was employed to ensure valid inferences beyond the areas sampled. As, Co, and Cu concentrations in all media downstream of the mine were 1--3 orders of magnitude greater than concentrations upstream, and concentrations in invertebrates were greater than those that adversely affect trout via dietary intake. Correlational analysis shows that bioaccumulation mechanisms and pathways between the different media differ from element to element; the differences are related to geochemical characteristics of the elements. The benthic invertebrate communitymore » is severely impacted for at least 50 km downstream of the mine: Ephemeropteran density, number of taxa, and total biomass are as low as 0.1% of values upstream. Other indices of the effects of metals on invertebrate communities that have been used elsewhere were ineffective in detecting these severe impacts. The integrated assessment approach used in this study provides information on contaminant sources, exposure pathways and mechanisms, and impacts to the stream ecosystem at several organizational levels.« less
Lekunberri, Itziar; Balcázar, José Luis; Borrego, Carles M
2018-03-01
Mobile genetic elements (MGEs) are key agents in the spread of antibiotic resistance genes (ARGs) across environments. Here we used metagenomics to compare the river resistome (collection of all ARGs) and mobilome (e.g., integrases, transposases, integron integrases and insertion sequence common region "ISCR" elements) between samples collected upstream (n = 6) and downstream (n = 6) of an urban wastewater treatment plant (UWWTP). In comparison to upstream metagenomes, downstream metagenomes showed a drastic increase in the abundance of ARGs, as well as markers of MGEs, particularly integron integrases and ISCR elements. These changes were accompanied by a concomitant prevalence of 16S rRNA gene signatures of bacteria affiliated to families encompassing well-known human and animal pathogens. Our results confirm that chronic discharges of treated wastewater severely impact the river resistome affecting not only the abundance and diversity of ARGs but also their potential spread by enriching the river mobilome in a wide variety of MGEs. Copyright © 2017 Elsevier Ltd. All rights reserved.
Dansithong, Warunee; Paul, Sharan; Scoles, Daniel R; Pulst, Stefan M; Huynh, Duong P
2015-01-01
Parkinson's disease (PD) is a progressive neurodegenerative disorder caused by loss of dopaminergic neurons of the substantia nigra. The hallmark of PD is the appearance of neuronal protein aggregations known as Lewy bodies and Lewy neurites, of which α-synuclein forms a major component. Familial PD is rare and is associated with missense mutations of the SNCA gene or increases in gene copy number resulting in SNCA overexpression. This suggests that lowering SNCA expression could be therapeutic for PD. Supporting this hypothesis, SNCA reduction was neuroprotective in cell line and rodent PD models. We developed novel cell lines expressing SNCA fused to the reporter genes luciferase (luc) or GFP with the objective to enable high-throughput compound screening (HTS) for small molecules that can lower SNCA expression. Because SNCA expression is likely regulated by far-upstream elements (including the NACP-REP1 located at 8852 bp upstream of the transcription site), we employed zinc finger nuclease (ZFN) genome editing to insert reporter genes in-frame downstream of the SNCA gene in order to retain native SNCA expression control. This ensured full retention of known and unknown up- and downstream genetic elements controlling SNCA expression. Treatment of cells with the histone deacetylase inhibitor valproic acid (VPA) resulted in significantly increased SNCA-luc and SNCA-GFP expression supporting the use of our cell lines for identifying small molecules altering complex modes of expression control. Cells expressing SNCA-luc treated with a luciferase inhibitor or SNCA siRNA resulted in Z'-scores ≥ 0.75, suggesting the suitability of these cell lines for use in HTS. This study presents a novel use of genome editing for the creation of cell lines expressing α-synuclein fusion constructs entirely under native expression control. These cell lines are well suited for HTS for compounds that lower SNCA expression directly or by acting at long-range sites to the SNCA promoter and 5'-UTR.
Promoters, toll like receptors and microRNAs: a strange association.
Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K
2013-06-01
Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Culvert roughness elements for native Utah fish passage : phase II.
DOT National Transportation Integrated Search
2012-04-01
Native fishes have become an increasingly important concern when designing fish passable culverts. Many operational culverts constrict waterways which increase velocities and prevent upstream passage of small fish species. The current method to ensur...
Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko
2015-04-21
Limb skeletal elements originate from the limb progenitor cells, which undergo expansion and patterning to develop each skeletal element. Posterior-distal skeletal elements, such as the ulna/fibula and posterior digits develop in a Sonic hedgehog (Shh)-dependent manner. However, it is poorly understood how anterior-proximal elements, such as the humerus/femur, the radius/tibia and the anterior digits, are developed. Here we show that the zinc finger factors Sall4 and Gli3 cooperate for proper development of the anterior-proximal skeletal elements and also function upstream of Shh-dependent posterior skeletal element development. Conditional inactivation of Sall4 in the mesoderm before limb outgrowth caused severe defects in the anterior-proximal skeletal elements in the hindlimb. We found that Gli3 expression is reduced in Sall4 mutant hindlimbs, but not in forelimbs. This reduction caused posteriorization of nascent hindlimb buds, which is correlated with a loss of anterior digits. In proximal development, Sall4 integrates Gli3 and the Plzf-Hox system, in addition to proliferative expansion of cells in the mesenchymal core of nascent hindlimb buds. Whereas forelimbs developed normally in Sall4 mutants, further genetic analysis identified that the Sall4-Gli3 system is a common regulator of the early limb progenitor cells in both forelimbs and hindlimbs. The Sall4-Gli3 system also functions upstream of the Shh-expressing ZPA and the Fgf8-expressing AER in fore- and hindlimbs. Therefore, our study identified a critical role of the Sall4-Gli3 system at the early steps of limb development for proper development of the appendicular skeletal elements.
Ihara, Kohei; Sato, Kazuki; Hori, Hatsuhiro; Makino, Yumiko; Shigenobu, Shuji; Ando, Tasuke; Isogai, Emiko; Yoneyama, Hiroshi
2017-04-01
The alaE gene in Escherichia coli encodes an l-alanine exporter that catalyzes the active export of l-alanine using proton electrochemical potential. In our previous study, alaE expression was shown to increase in the presence of l-alanyl-l-alanine (Ala-Ala). In this study, the global regulator leucine-responsive regulatory protein (Lrp) was identified as an activator of the alaE gene. A promoter less β-galactosidase gene was fused to an alaE upstream region (240 nucleotides). Cells that were lacZ-deficient and harbored this reporter plasmid showed significant induction of β-galactosidase activity (approximately 17-fold) in the presence of 6 mM l-alanine, l-leucine, and Ala-Ala. However, a reporter plasmid possessing a smaller alaE upstream region (180 nucleotides) yielded transformants with strikingly low enzyme activity under the same conditions. In contrast, lrp-deficient cells showed almost no β-galactosidase induction, indicating that Lrp positively regulates alaE expression. We next performed an electrophoretic mobility shift assay (EMSA) and a DNase I footprinting assay using purified hexahistidine-tagged Lrp (Lrp-His). Consequently, we found that Lrp-His binds to the alaE upstream region spanning nucleotide -161 to -83 with a physiologically relevant affinity (apparent K D , 288.7 ± 83.8 nM). Furthermore, the binding affinity of Lrp-His toward its cis-element was increased by l-alanine and l-leucine, but not by Ala-Ala and d-alanine. Based on these results, we concluded that the gene expression of the alaE is regulated by Lrp in response to intracellular levels of l-alanine, which eventually leads to intracellular homeostasis of l-alanine concentrations. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S
1991-09-11
The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.
NASA Technical Reports Server (NTRS)
Bedalov, A.; Salvatori, R.; Dodig, M.; Kronenberg, M. S.; Kapural, B.; Bogdanovic, Z.; Kream, B. E.; Woody, C. O.; Clark, S. H.; Mack, K.;
1995-01-01
Previous deletion studies using a series of COL1A1-CAT fusion genes have indicated that the 625 bp region of the COL1A1 upstream promoter between -2295 and -1670 bp is required for high levels of expression in bone, tendon, and skin of transgenic mice. To further define the important sequences within this region, a new series of deletion constructs extending to -1997, -1794, -1763, and -1719 bp has been analyzed in transgenic mice. Transgene activity, determined by measuring CAT activity in tissue extracts of 6- to 8-day-old transgenic mouse calvariae, remains high for all the new deletion constructs and drops to undetectable levels in calvariae containing the -1670 bp construct. These results indicate that the 49 bp region of the COL1A1 promoter between -1719 and -1670 bp is required for high COL1A1 expression in bone. Although deletion of the same region caused a substantial reduction of promoter activity in tail tendon, the construct extending to -1670 bp is still expressed in this tissue. However, further deletion of the promoter to -944 bp abolished activity in tendon. Gel mobility shift studies identified a protein in calvarial nuclear extracts that is not found in tendon nuclear extracts, which binds within this 49 bp region. Our study has delineated sequences in the COL1A1 promoter required for expression of the COL1A1 gene in high type I collagen-producing tissues, and suggests that different cis elements control expression of the COL1A1 gene in bone and tendon.
Fukuchi, Mamoru; Nakashima, Fukumi; Tabuchi, Akiko; Shimotori, Masataka; Tatsumi, Saori; Okuno, Hiroyuki; Bito, Haruhiko; Tsuda, Masaaki
2015-03-13
We examined the transcriptional regulation of the activity-regulated cytoskeleton-associated protein gene (Arc), focusing on BDNF-induced Arc expression in cultured rat cortical cells. Although the synaptic activity-responsive element (SARE), located -7 kbp upstream of the Arc transcription start site, responded to NMDA, BDNF, or FGF2, the proximal region of the promoter (Arc/-1679) was activated by BDNF or FGF2, but not by NMDA, suggesting the presence of at least two distinct Arc promoter regions, distal and proximal, that respond to extracellular stimuli. Specificity protein 4 (SP4) and early growth response 1 (EGR1) controlled Arc/-1679 transcriptional activity via the region encompassing -169 to -37 of the Arc promoter. We found that trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, significantly enhanced the inductive effects of BDNF or FGF2, but not those of NMDA on Arc expression. Inhibitors of class I/IIb HDACs, SAHA, and class I HDACs, MS-275, but not of class II HDACs, MC1568, enhanced BDNF-induced Arc expression. The enhancing effect of TSA was mediated by the region from -1027 to -1000 bp, to which serum response factor (SRF) and HDAC1 bound. The binding of HDAC1 to this region was reduced by TSA. Thus, Arc expression was suppressed by class I HDAC-mediated mechanisms via chromatin modification of the proximal promoter whereas the inhibition of HDAC allowed Arc expression to be markedly enhanced in response to BDNF or FGF2. These results contribute to our understanding of the physiological role of Arc expression in neuronal functions such as memory consolidation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Involvement of Sp1 elements in the promoter activity of genes affected in keratoconus.
Maruyama, Y; Wang, X; Li, Y; Sugar, J; Yue, B Y
2001-08-01
Keratoconus is a progressive disease that thins and scars the corneal stroma. In keratoconus corneas, levels of degradative enzymes, including lysosomal acid phosphatase (LAP) and cathepsin B, are elevated, and those of the inhibitors alpha1-proteinase inhibitor (alpha 1-PI) and alpha 2-macroglobulin (alpha 2-M) are reduced, especially in the epithelial layer. An increased expression of the transcription factor Sp1 was also demonstrated. The role of Sp1 in regulation of the genes affected in keratoconus was examined in this study. DNA segments, containing 5'-flanking promoter sequences of the alpha 1-PI, LAP, cathepsin B, and alpha 2-M genes were ligated into the secreted alkaline phosphatase (SEAP) reporter gene vector. These constructs, along with the pSV beta-galactosidase control vector, were transfected into cultured human corneal epithelial and stromal cells and skin fibroblasts. Cotransfection with the Sp1 expression vector was performed in parallel. SEAP and beta-galactosidase enzyme activities were assayed. In corneal epithelial cells, as in stromal cells, alpha 1-PI promoter activity was suppressed by cotransfection of pPacSp1. The LAP, cathepsin B, and alpha 2-M promoters were functional in corneal cells, whereas activities of these promoters were much lower in skin fibroblasts. Cotransfection experiments indicated that the up- or downregulation of LAP, cathepsin B, and alpha 2-M observed in keratoconus-affected corneas was not mediated by Sp1. These results support the theory that the corneal epithelium, along with the stroma, is involved in keratoconus. An upstream role of Sp1 is indicated and the Sp1-mediated downregulation of the alpha 1-PI gene may be a key event in the disease development.
Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S
1994-10-25
DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.
Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S
1994-01-01
DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1. Images PMID:7971267
Regulation of Id2 expression in EL4 T lymphoma cells overexpressing growth hormone.
Weigent, Douglas A
2009-01-01
In previous studies, we have shown that overexpression of growth hormone (GH) in cells of the immune system upregulates proteins involved in cell growth and protects from apoptosis. Here, we report that overexpression of GH in EL4 T lymphoma cells (GHo) also significantly increased levels of the inhibitor of differentiation-2 (Id2). The increase in Id2 was suggested in both Id2 promoter luciferase assays and by Western analysis for Id2 protein. To identify the regulatory elements that mediate transcriptional activation by GH in the Id2 promoter, promoter deletion analysis was performed. Deletion analysis revealed that transactivation involved a 301-132bp region upstream to the Id2 transcriptional start site. The pattern in the human GHo Jurkat T lymphoma cell line paralleled that found in the mouse GHo EL4 T lymphoma cell line. Significantly less Id2 was detected in the nucleus of GHo EL4 T lymphoma cells compared to vector alone controls. Although serum increased the levels of Id2 in control vector alone cells, no difference was found in the total levels of Id2 in GHo EL4 T lymphoma cells treated with or without serum. The increase in Id2 expression in GHo EL4 T lymphoma cells measured by Id2 promoter luciferase expression and Western blot analysis was blocked by the overexpression of a dominant-negative mutant of STAT5. The results suggest that in EL4 T lymphoma cells overexpressing GH, there is an upregulation of Id2 protein that appears to involve STAT protein activity.
Cai, Lei; Cai, Shuangfeng; Zhao, Dahe; Wu, Jinhua; Wang, Lei; Liu, Xiaoqing; Li, Ming; Hou, Jing; Zhou, Jian; Liu, Jingfang; Han, Jing
2014-01-01
Among all known archaeal strains, the phosphoenolpyruvate-dependent phosphotransferase system (PTS) for fructose utilization is used primarily by haloarchaea, which thrive in hypersaline environments, whereas the molecular details of the regulation of the archaeal PTS under fructose induction remain unclear. In this study, we present a comprehensive examination of the regulatory mechanism of the fructose PTS in the haloarchaeon Haloferax mediterranei. With gene knockout and complementation, microarray analysis, and chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR), we revealed that GlpR is the indispensable activator, which specifically binds to the PTS promoter (PPTS) during fructose induction. Further promoter-scanning mutation indicated that three sites located upstream of the H. mediterranei PPTS, which are conserved in most haloarchaeal PPTSs, are involved in this induction. Interestingly, two PTS transcripts (named T8 and T17) with different lengths of 5′ untranslated region (UTR) were observed, and promoter or 5′ UTR swap experiments indicated that the shorter 5′ UTR was most likely generated from the longer one. Notably, the translation efficiency of the transcript with this shorter 5′ UTR was significantly higher and the ratio of T8 (with the shorter 5′ UTR) to T17 increased during fructose induction, implying that a posttranscriptional mechanism is also involved in PTS activation. With these insights into the molecular regulation of the haloarchaeal PTS, we have proposed a working model for haloarchaea in response to environmental fructose. PMID:24334671
Sawado, T; Igarashi, K; Groudine, M
2001-08-28
The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.
Culvert roughness elements for native Utah fish passage : phase I.
DOT National Transportation Integrated Search
2011-01-01
Laboratory flume testing of native Utah non-salmonid fish was performed to observe how : they use altered flow around obstacles to swim upstream. Three experimental setups included : a bare Plexiglas flume, vertical cylinders, and natural substrate p...
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.
2014-01-01
Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-04-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.
Sakumi, K; Sekiguchi, M
1989-01-20
The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.
Low exhaust temperature electrically heated particulate matter filter system
Gonze, Eugene V [Pinckney, MI; Paratore, Jr., Michael J.; Bhatia, Garima [Bangalore, IN
2012-02-14
A system includes a particulate matter (PM) filter, a sensor, a heating element, and a control module. The PM filter includes with an upstream end that receives exhaust gas, a downstream end and multiple zones. The sensor detects a temperature of the exhaust gas. The control module controls current to the heating element to convection heat one of the zones and initiate a regeneration process. The control module selectively increases current to the heating element relative to a reference regeneration current level when the temperature is less than a predetermined temperature.
Upstream paths for Hippo signaling in Drosophila organ development.
Choi, Kwang-Wook
2018-03-01
Organ growth is fundamental to animal development. One of major mechanisms for growth control is mediated by the conserved Hippo signaling pathway initially identified in Drosophila. The core of this pathway in Drosophila consists of a cascade of protein kinases Hippo and Warts that negatively regulate transcriptional coactivator Yorkie (Yki). Activation of Yki promotes cell survival and proliferation to induce organ growth. A key issue in Hippo signaling is to understand how core kinase cascade is activated. Activation of Hippo kinase cascade is regulated in the upstream by at least two transmembrane proteins Crumbs and Fat that act in parallel. These membrane proteins interact with additional factors such as FERM-domain proteins Expanded and Merlin to modulate subcellular localization and function of the Hippo kinase cascade. Hippo signaling is also influenced by cytoskeletal networks and cell tension in epithelia of developing organs. These upstream events in the regulation of Hippo signaling are only partially understood. This review focuses on our current understanding of some upstream processes involved in Hippo signaling in developing Drosophila organs. [BMB Reports 2018; 51(3): 134-142].
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe
2014-01-01
Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.
Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B
1994-01-01
The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427
Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D.; Castle, John C.; Raymond, Christopher K.; Lappala, Colin R.; Schaefer, Amy L.; Harwood, Caroline S.; Greenberg, E. Peter
2011-01-01
The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His6-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon. PMID:21378182
René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y
2000-01-04
In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.
Yoshino, T P; Wu, X J; Liu, H D
1998-09-01
Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable integration and expression of snail genes of interest into the Bge cell line.
Laimins, L; Holmgren-König, M; Khoury, G
1986-01-01
The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279
Identification of hypothalamic arcuate nucleus-specific enhancer region of Kiss1 gene in mice.
Goto, Teppei; Tomikawa, Junko; Ikegami, Kana; Minabe, Shiori; Abe, Hitomi; Fukanuma, Tatsuya; Imamura, Takuya; Takase, Kenji; Sanbo, Makoto; Tomita, Koichi; Hirabayashi, Masumi; Maeda, Kei-ichiro; Tsukamura, Hiroko; Uenoyama, Yoshihisa
2015-01-01
Pulsatile secretion of GnRH plays a pivotal role in follicular development via stimulating tonic gonadotropin secretion in mammals. Kisspeptin neurons, located in the arcuate nucleus (ARC), are considered to be an intrinsic source of the GnRH pulse generator. The present study aimed to determine ARC-specific enhancer(s) of the Kiss1 gene by an in vivo reporter assay. Three green fluorescent protein (GFP) reporter constructs (long, medium length, and short) were generated by insertion of GFP cDNA at the Kiss1 locus. Transgenic female mice bearing the long and medium-length constructs showed apparent GFP signals in kisspeptin-immunoreactive cells in both the ARC and anteroventral periventricular nucleus, in which another population of kisspeptin neurons are located. On the other hand, transgenic mice bearing 5'-truncated short construct showed few GFP signals in the ARC kisspeptin-immunoreactive cells, whereas they showed colocalization of GFP- and kisspeptin-immunoreactivities in the anteroventral periventricular nucleus. In addition, chromatin immunoprecipitation and chromosome conformation capture assays revealed recruitment of unoccupied estrogen receptor-α in the 5'-upstream region and intricate chromatin loop formation between the 5'-upstream and promoter regions of Kiss1 locus in the ARC. Taken together, the present results indicate that 5'-upstream region of Kiss1 locus plays a critical role in Kiss1 gene expression in an ARC-specific manner and that the recruitment of estrogen receptor-α and formation of a chromatin loop between the Kiss1 promoter and the 5' enhancer region may be required for the induction of ARC-specific Kiss1 gene expression. These results suggest that the 5'-upstream region of Kiss1 locus functions as an enhancer for ARC Kiss1 gene expression in mice.
Scieglinska, D; Widłak, W; Konopka, W; Poutanen, M; Rahman, N; Huhtaniemi, I; Krawczyk, Z
2001-01-01
The rat Hst70 gene and its mouse counterpart Hsp70.2 belong to the family of Hsp70 heat shock genes and are specifically expressed in male germ cells. Previous studies regarding the structure of the 5' region of the transcription unit of these genes as well as localization of the 'cis' elements conferring their testis-specific expression gave contradictory results [Widlak, Markkula, Krawczyk, Kananen and Huhtaniemi (1995) Biochim. Biophys. Acta 1264, 191-200; Dix, Rosario-Herrle, Gotoh, Mori, Goulding, Barret and Eddy (1996) Dev. Biol. 174, 310-321]. In the present paper we solve these controversies and show that the 5' untranslated region (UTR) of the Hst70 gene contains an intron which is localized similar to that of the mouse Hsp70.2 gene. Reverse transcriptase-mediated PCR, Northern blotting and RNase protection analysis revealed that the transcription initiation of both genes starts at two main distant sites, and one of them is localized within the intron. As a result two populations of Hst70 gene transcripts with similar sizes but different 5' UTR structures can be detected in total testicular RNA. Functional analysis of the Hst70 gene promoter in transgenic mice and transient transfection assays proved that the DNA fragment of approx. 360 bp localized upstream of the ATG transcription start codon is the minimal promoter required for testis-specific expression of the HST70/chloramphenicol acetyltransferase transgene. These experiments also suggest that the expression of the gene may depend on 'cis' regulatory elements localized within exon 1 and the intron sequences. PMID:11563976
Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B
2013-12-06
Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.
Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.
2013-01-01
Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027
Nishinaka, Toru; Ichijo, Yusuke; Ito, Maki; Kimura, Masayoshi; Katsuyama, Masato; Iwata, Kazumi; Miura, Takeshi; Terada, Tomoyuki; Yabe-Nishimura, Chihiro
2007-05-15
Curcumin is a plant-derived diferuloylmethane compound extracted from Curcuma longa, possessing antioxidative and anticarcinogenic properties. Antioxidants and oxidative stress are known to induce the expression of certain classes of detoxification enzymes. Since the upregulation of detoxifying enzymes affects the drug metabolism and cell defense system, it is important to understand the gene regulation by such agents. In this study, we demonstrated that curcumin could induce the expression of human glutathione S-transferase P1 (GSTP1). In HepG2 cells treated with 20muM curcumin, the level of GSTP1 mRNA was significantly increased. In luciferase reporter assays, curcumin augmented the promoter activity of a reporter construct carrying 336bp upstream of the 5'-flanking region of the GSTP1 gene. Mutation analyses revealed that the region including antioxidant response element (ARE), which overlaps AP1 in sequence, was essential to the response to curcumin. While the introduction of a wild-type Nrf2 expression construct augmented the promoter activity of the GSTP1 gene, co-expression of a dominant-negative Nrf2 abolished the responsiveness to curcumin. In addition, curcumin activated the expression of the luciferase gene from a reporter construct carrying multiple ARE consensus sequences but not one with multiple AP1 sites. In a gel mobility shift assay with an oligonucleotide with GSTP1 ARE, an increase in the amount of the binding complex was observed in the nuclear extracts of curcumin-treated HepG2 cells. These results suggested that ARE is the primary sequence for the curcumin-induced transactivation of the GSTP1 gene. The induction of GSTP1 may be one of the mechanisms underlying the multiple actions of curcumin.
Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee
2005-11-01
The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.
Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.
Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning
2016-08-01
miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Cloning of the promoter region of a human gene, FOXL2, and its regulation by STAT3.
Han, Yangyang; Wang, Tianxiao; Sun, Shudong; Zhai, Zhaohui; Tang, Shengjian
2017-09-01
Forkhead box L2 (FOXL2) is a transcription factor, which is involved in blepharophimosis, ptosis, and epicanthus in versus syndrome (BPES), premature ovarian failure (POF), as well as almost all stages of ovarian development and function. FOXL2 has various target genes, which are implicated in numerous processes, including sex determination, cell cycle regulation and apoptosis and stress response regulation in mammals. However, studies regarding the upstream regulation of FOXL2 are limited. In the present study, the promoter of FOXL2 was successfully cloned and registered in Gen Bank, and a dual luciferase reporter (DLR) analysis demonstrated that the luciferase activity was significantly induced by the promoter of FOXL2. Subsequently, bioinformatics analysis indicated that FOXL2 may be regulated by STAT3, and this was confirmed by a DLR analysis and western blotting, using STAT3 inhibitors. Further study using real‑time cellular analysis indicated that the viability of He La cells was markedly suppressed by STAT3 inhibitors. The present study demonstrated novel findings regarding the upstream regulation of FOXL2 expression and provide a new perspective for future studies in the field.
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE
Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-01-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651
León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.
2013-01-01
Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liebhaber, S.A.; Weiss, I.; Cash, F.E.
Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less
Weiss, Daniel; Lillefjell, Monica; Magnus, Eva
2016-02-11
Health promotion, with a focus on multidimensional upstream factors and an ecological, life-course approach, is establishing itself as the guiding philosophy for addressing public health. Action at the political and programmatic level on the Social Determinants of Health has proven effective for promoting and building public health at all levels but has been particularly evident at the national and international levels - due in large part to available documents and guidelines. Although research and experience establish that health promotion is most effective when settings-based, the development of health promoting policies and programs at the local level is still difficult. This study intended to investigate available knowledge on the development and implementation of health promoting policies and programs at the local level and identify factors most important for facilitating capacity building and outcome achievement. We used a scoping review in order to review the current literature on local policy development and program implementation. Keywords were chosen based on results of a previous literature review. A total of 53 articles were divided into two categories: policy and implementation. Critical analysis was conducted for each article and a summary assembled. Data was charted with specific focus on the aims of the study, data acquisition, key theories/concepts/frameworks used, outcome measures, results, and conclusions. The articles included in this study primarily focused on discussing factors that facilitate the development of health promoting policy and the implementation of health promotion programs. Most significant facilitators included: collaborative decision-making, agreement of objectives and goals, local planning and action, effective leadership, building and maintaining trust, availability of resources, a dynamic approach, a realistic time-frame, and trained and knowledgeable staff. Within each of these important facilitating factors, various elements supporting implementation were discussed and highlighted in this study. Our results indicate that clear and consistent facilitators exist for supporting health promoting policy development and program implementation at the local level. These results offer a starting point for local action on the Social Determinants of Health and have the potential to contribute to the development of a framework for improving action at the local level.
Influence of Forced Flow on the Dendritic Growth of Fe-C Alloy: 3D vs 2D Simulation
NASA Astrophysics Data System (ADS)
Wang, Weiling; Wang, Zhaohui; Luo, Sen; Ji, Cheng; Zhu, Miaoyong
2017-12-01
A 3D parallel cellular automaton-finite volume method (CA-FVM) model was used to simulate the equiaxed dendritic growth of an Fe-0.82 wt pct C alloy with xy- in- out and xyz- in- out type forced flows and the columnar dendritic growth with y- in- out type forced flow. In addition, the similarities and differences between the results of the 3D and 2D models are discussed and summarized in detail. The capabilities of the 3D and 2D CA-FVM models to predict the dendritic growth of the alloy with forced flow are validated through comparison with the boundary layer correction and Oseen-Ivanstov models, respectively. Because the forced flow can pass around perpendicular arms of the dendrites, the secondary arms at the sides upstream from the perpendicular arms are more developed than those on the upstream side of the upstream arms, especially at higher inlet velocities. In addition, compared to the xy- in- out case, the growth of the downstream arms is less inhibited and the secondary arms are more developed in the xyz- in- out case because of the greater lateral flow around their tips. Compared to the 3D case, the 2D equiaxed dendrites are more asymmetrical and lack secondary arms because of the thicker solute envelope. In the 3D case, the columnar dendrites on the upstream side (left one) are promoted, while the middle and downstream dendrites are inhibited in sequence. However, the sequential inhibition starts on the upstream side in the 2D case. This is mainly because the melt can pass around the upstream branch in 3D space. However, it can only climb over the upstream tip in 2D space. Additionally, the secondary arms show upstream development, which is more significant with increasing inlet velocity. The level of development of the secondary arms is also affected by the decay of the forced flow in the flow direction.
Tchoudakova, A; Kishida, M; Wood, E; Callard, G V
2001-11-01
Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most prominently in retinal ganglion cells (RGC) and axon-like projections to the optic tectum. Expression of a cyp19a/GFP reporter was not detectable up to 72 hpf. Tandem analysis of cyp19a and cyp19b promoters in living zebrafish embryos can be a useful approach for identifying cis-elements and cellular factors involved in the correct tissue-specific, spatial, temporal and estrogen regulated expression of aromatase genes during CNS and gonadal development.
Degl'Innocenti, Andrea; Parrilla, Marta; Harr, Bettina; Teschke, Meike
2016-01-01
In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings favor Olfr266 as a model gene to investigate odorant receptor gene choice.
2017-01-01
Tight and tunable control of gene expression is a highly desirable goal in synthetic biology for constructing predictable gene circuits and achieving preferred phenotypes. Elucidating the sequence–function relationship of promoters is crucial for manipulating gene expression at the transcriptional level, particularly for inducible systems dependent on transcriptional regulators. Sort-seq methods employing fluorescence-activated cell sorting (FACS) and high-throughput sequencing allow for the quantitative analysis of sequence–function relationships in a robust and rapid way. Here we utilized a massively parallel sort-seq approach to analyze the formaldehyde-inducible Escherichia coli promoter (Pfrm) with single-nucleotide resolution. A library of mutated formaldehyde-inducible promoters was cloned upstream of gfp on a plasmid. The library was partitioned into bins via FACS on the basis of green fluorescent protein (GFP) expression level, and mutated promoters falling into each expression bin were identified with high-throughput sequencing. The resulting analysis identified two 19 base pair repressor binding sites, one upstream of the −35 RNA polymerase (RNAP) binding site and one overlapping with the −10 site, and assessed the relative importance of each position and base therein. Key mutations were identified for tuning expression levels and were used to engineer formaldehyde-inducible promoters with predictable activities. Engineered variants demonstrated up to 14-fold lower basal expression, 13-fold higher induced expression, and a 3.6-fold stronger response as indicated by relative dynamic range. Finally, an engineered formaldehyde-inducible promoter was employed to drive the expression of heterologous methanol assimilation genes and achieved increased biomass levels on methanol, a non-native substrate of E. coli. PMID:28463494
NASA Astrophysics Data System (ADS)
Agarwal, Karuna; Gao, Jian; Katz, Joseph
2017-11-01
The shape, size, and spacing between roughness elements in turbulent boundary layers affect the associated drag and noise. Understanding them require data on the flow structure around these elements. Dual-view tomographic holography is used to study the 3D 3-component velocity field around a pair of cubic roughness elements immersed in a turbulent boundary layer at Reτ = 2500 . These a = 1 mm high cubes correspond to 4% of the half channel height and 90 wall units (δν = 11 μ m). Tests are performed for spanwise spacings of a, 1.5 a and 2.5 a. The sample volume is 385δν × 250δν × 190δν and the vector spacing is 5.4δν. Conversed statistics is obtained by recording 1500 realizations in volumes centered upstream, downstream and around a cube. The boundary layer separating upstream of the cube does not reattach until the wake region, resulting in formation of a vortical ``canopy'' that engulfs each cube. It is dominated by spanwise vorticity above the cube and separated region, bounded by vertical vorticity on the sides. Flow channeling in the space between cubes causes asymmetry in the vorticity distributions along the inner and outer walls. The legs of horseshoe vortices remain near the wall between cubes, but grow and expand in the wake region. Funded by NSF and ONR.
Agarwal, Parul; Garg, Varsha; Gautam, Taru; Pillai, Beena; Kanoria, Shaveta; Burma, Pradeep Kumar
2014-04-01
Several reports of promoters from plants, viral and artificial origin that confer high constitutive expression are known. Among these the CaMV 35S promoter is used extensively for transgene expression in plants. We identified candidate promoters from Arabidopsis based on their transcript levels (meta-analysis of available microarray control datasets) to test their activity in comparison to the CaMV 35S promoter. A set of 11 candidate genes were identified which showed high transcript levels in the aerial tissue (i.e. leaf, shoot, flower and stem). In the initial part of the study binary vectors were developed wherein the promoter and 5'UTR region of these candidate genes (Upstream Regulatory Module, URM) were cloned upstream to the reporter gene β glucuronidase (gus). The promoter strengths were tested in transformed callus of Nicotiana tabacum and Gossypium hirsutum. On the basis of the results obtained from the callus, the influence of the URM cassettes on transgene expression was tested in transgenic tobacco. The URM regions of the genes encoding a subunit of photosystem I (PHOTO) and geranyl geranyl reductase (GGR) in A. thaliana genome showed significantly high levels of GUS activity in comparison to the CaMV 35S promoter. Further, when the 5'UTRs of both the genes were placed downstream to the CaMV 35S promoter it led to a substantial increase in GUS activity in transgenic tobacco lines and cotton callus. The enhancement observed was even higher to that observed with the viral leader sequences like Ω and AMV, known translational enhancers. Our results indicate that the two URM cassettes or the 5'UTR regions of PHOTO and GGR when placed downstream to the CaMV 35S promoter can be used to drive high levels of transgene expression in dicotyledons.
The role of heterologous chloroplast sequence elements in transgene integration and expression.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-04-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-01-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101
Control of rRNA transcription in Escherichia coli.
Condon, C; Squires, C; Squires, C L
1995-01-01
The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889
Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G
2009-01-01
Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.
Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition
Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.
2000-01-01
Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123
Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain
2017-01-01
ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037
Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar
2017-07-01
Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.
Yang, Ke; Monfared, Sajad Rashidi; Monafared, Rashidi Sajad; Wang, Hongzhen; Lundgren, Anneli; Brodelius, Peter E
2015-07-01
The artemisinic aldehyde double bond reductase (DBR2) plays an important role in the biosynthesis of the antimalarial artemisinin in Artemisia annua. Artemisinic aldehyde is reduced into dihydroartemisinic aldehyde by DBR2. Artemisinic aldehyde can also be oxidized by amorpha-4,11-diene 12-hydroxylase and/or aldehyde dehydrogenase 1 to artemisinic acid, a precursor of arteannuin B. In order to better understand the effects of DBR2 expression on the flow of artemisinic aldehyde into either artemisinin or arteannuin B, we determined the content of dihydroartemisinic aldehyde, artemisinin, artemisinic acid and arteannuin B content of A. annua varieties sorted into two chemotypes. The high artemisinin producers (HAPs), which includes the '2/39', 'Chongqing' and 'Anamed' varieties, produce more artemisinin than arteannuin B; the low artemisinin producers (LAPs), which include the 'Meise', 'Iran#8', 'Iran#14', 'Iran#24' and 'Iran#47' varieties, produce more arteannuin B than artemisinin. Quantitative PCR showed that the relative expression of DBR2 was significantly higher in the HAP varieties. We cloned and sequenced the promoter of the DBR2 gene from varieties of both the LAP and the HAP groups. There were deletions/insertions in the region just upstream of the ATG start codon in the LAP varities, which might be the reason for the different promoter activities of the HAP and LAP varieties. The relevance of promoter variation, DBR2 expression levels and artemisinin biosynthesis capabilities are discussed and a selection method for HAP varieties with a DNA marker is suggested. Furthermore, putative cis-acting regulatory elements differ between the HAP and LAP varieties.
Identification of the promoter of the myelomonocytic leukocyte integrin CD11b.
Hickstein, D D; Baker, D M; Gollahon, K A; Back, A L
1992-01-01
The CD11b (or macrophage-1 antigen; MAC-1) subunit of the leukocyte integrin family forms a noncovalently associated heterodimeric structure with the CD18 (beta) subunit on the surface of human granulocytes and monocyte/macrophages, where it enables these myeloid cells to participate in a variety of adherence-related activities. Expression of the CD11b subunit is restricted to cells of the myelomonocytic lineage and depends upon the stage of differentiation with the most mature myeloid cells expressing the highest levels of CD11b. To study the regulation of CD11b expression, a genomic clone corresponding to the 5' region of the CD11b gene was isolated from a human chromosome 16 library. Primer extension and RNase protection assays identified two major transcriptional start sites, located 90 base pairs and 54 base pairs upstream from the initiation methionine. DNA sequence analysis of 1.7 kilobases of the 5' flanking sequence of the CD11b gene indicated the absence of a "CAAT" or "TATA" box; however, potential binding sites for the transcription activators Sp1, PU.1, ets, and AP-2 are present, as well as retinoic acid response elements. The 1.7-kilobase CD11b promoter sequence displayed functional activity in transient transfection assays in the monocytic cell line THP-1 and the myeloid cell line HL-60. In contrast, this 1.7-kilobase promoter sequence did not display functional activity in the Jurkat T-lymphoid cell line. Detailed characterization of the CD11b promoter sequence should provide insight into the molecular events regulating the tissue-specific and developmental stage-specific expression of the CD11b molecule in myelomonocytic cells. Images PMID:1347945
NASA Astrophysics Data System (ADS)
Mattheus, Christopher R.; Rodriguez, Antonio B.; McKee, Brent A.
2009-10-01
Low-relief fluvial systems that originate in the lower coastal plain and discharge into estuaries are common along passive margins. These watersheds are thought to be disconnected from their termini by floodplains, which buffer the sediment-routing system by sequestration. Here, we present a detailed study of the Newport River, a typical lower coastal-plain system, which reveals high connectivity between watershed and delta. Connectivity is measured as the time lag between initiation of a silviculture operation, which increased landscape erosion, and when the sediment appeared at the bay-head delta. The time lag, measured from aerial photographs and sedimentation rates calculated from 210Pb- and 137Cs-activities in cores from the watershed and delta, is <3 years. Most lower coastal-plain rivers are steeper and have less floodplain accommodation available for storage than their larger counterparts that originate landward of the fall line, which promotes higher connectivity between upstream and downstream.
Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.
2016-01-01
Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841
Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L
Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.
Al-Khouri, Anna Maria; Paule, Marvin R.
2002-01-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852
Al-Khouri, Anna Maria; Paule, Marvin R
2002-02-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.
Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J
2012-09-01
Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.
Bortleson, Gilbert Carl; Cox, S.E.; Munn, M.D.; Schumaker, R.J.; Block, E.K.
2001-01-01
Elevated concentrations of trace elements were found in bed sediment of Lake Roosevelt and the Columbia River, its principal source of inflow. Trace-element concentrations in whole water samples did not exceed criteria for freshwater organisms. Bed sediments of Lake Roosevelt were analyzed for organic compounds associated with wood-pulp waste. Dioxins and furans were found in suspended sediment and water of the Columbia River. Abundance and diversity of benthic invertebrate communities were analyzed.
Universal light-switchable gene promoter system
Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae
2005-02-22
An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.
Szczyglowski, K; Szabados, L; Fujimoto, S Y; Silver, D; de Bruijn, F J
1994-01-01
Sesbania rostrata leghemoglobin glb3 (Srglb3) promoter sequences responsible for expression in infected cells of transgenic Lotus corniculatus nodules were delimited to a 78-bp Dral-Hinfl fragment. This region, which is located between coordinates -194 to -116 relative to the start codon of the Srglb3 gene, was named the nodule-infected cell expression (NICE) element. Insertion of the NICE element into the truncated nopaline synthase promoter was found to confer a nodule-specific expression pattern on this normally root-enhanced promoter. Within the NICE element, three distinct motifs ([A]AAAGAT, TTGTCTCTT, and CACCC[T]) were identified; they are highly conserved in the promoter regions of a variety of plant (leg)hemoglobin genes. The NICE element and the adjacent AT-rich element (ATRE-BS2*) were subjected to site-directed mutagenesis. The expression patterns of nine selected Srglb3 promoter fragments carrying mutations in ATRE-BS2* and 19 with mutations in the NICE element were examined. Mutations in ATRE-BS2* had varying effects on Srglb3 promoter activity, ranging from a two- to threefold reduction to a slight stimulation of activity. Mutations in the highly conserved (A)AAAGAT motif of the NICE element reduced Srglb3 promoter activity two- to fourfold, whereas mutations in the TCTT portion of the TTGTCTCTT motif virtually abolished promoter activity, demonstrating the essential nature of these motifs for Srglb3 gene expression. An A-to-T substitution in the CACCC(T) motif of the NICE element also abolished Srglb3 promoter activity, while a C-to-T mutation at position 4 resulted in a threefold reduction of promoter strength. The latter phenotypes resemble the effect of similar mutations in the conserved CACCC motif located in the promoter region of mammalian beta-globin genes. The possible analogies between these two systems will be discussed. PMID:8180496
Tatematsu, Kiyoshi; Nakabayashi, Kazumi; Kamiya, Yuji; Nambara, Eiji
2008-01-01
To understand the molecular mechanisms underlying regulation of seed germination, we searched enriched cis elements in the upstream regions of Arabidopsis genes whose transcript levels increased during seed germination. Using available published microarray data, we found that two cis elements, Up1 or Up2, which regulate outgrowth of Arabidopsis axillary shoots, were significantly over-represented. Classification of Up1- and Up2-containing genes by gene ontology revealed that protein synthesis-related genes, especially ribosomal protein genes, were highly over-represented. Expression analysis using a reporter gene driven by a synthetic promoter regulated by these elements showed that the Up1 is necessary and sufficient for germination-associated gene induction, whereas Up2 acts as an enhancer of Up1. Up1-mediated gene expression was suppressed by treatments that blocked germination. Up1 is almost identical to the site II motif, which is the predicted target of TCP transcription factors. Of 24 AtTCP genes, AtTCP14, which showed the highest transcript level just prior to germination, was functionally characterized to test its involvement in the regulation of seed germination. Transposon-tagged lines for AtTCP14 showed delayed germination. In addition, germination of attcp14 mutants exhibited hypersensitivity to exogenously applied abscisic acid and paclobutrazol, an inhibitor of gibberellin biosynthesis. AtTCP14 was predominantly expressed in the vascular tissues of the embryo, and affected gene expression in radicles in a non-cell-autonomous manner. Taken together, these results indicate that AtTCP14 regulates the activation of embryonic growth potential in Arabidopsis seeds.
Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M
2004-02-01
The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.
Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim
2013-07-01
Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.
McCullen, M V; Li, H; Cam, M; Sen, S K; McVicar, D W; Anderson, S K
2016-09-01
The variegated expression of murine Ly49 loci has been associated with the probabilistic behavior of an upstream promoter active in immature cells, the Pro1 element. However, recent data suggest that Pro1 may be active in mature natural killer (NK) cells and function as an enhancer element. To assess directly if Pro1 transcripts are present in mature Ly49-expressing NK cells, RNA-sequencing of the total transcript pool was performed on freshly isolated splenic NK cells sorted for expression of either Ly49G or Ly49I. No Pro1 transcripts were detected from the Ly49a, Ly49c or Ly49i genes in mature Ly49(+) NK cells that contained high levels of Pro2 transcripts. Low levels of Ly49g Pro1 transcripts were found in both Ly49G(+) and Ly49G(-) populations, consistent with the presence of a small population of mature NK cells undergoing Ly49g gene activation, as previously demonstrated by culture of splenic NK cells in interleukin-2. Ly49 gene reporter constructs containing Pro1 failed to show any enhancer activity of Pro1 on Pro2 in a mature Ly49-expressing cell line. Taken together, the results are consistent with Pro1 transcription having a role in gene activation in developing NK, and argue against a role for Pro1 in Ly49 gene transcription by mature NK cells.