Summary of Environmental Monitoring and Assessment Program (EMAP) activities in South Dakota, 2000-2004

USGS Publications Warehouse

Heakin, Allen J.; Neitzert, Kathleen M.; Shearer, Jeffrey S.

2006-01-01

The U.S. Environmental Protection Agency (USEPA) initiated data-collection activities for the Environmental Monitoring and Assessment Program-West (EMAP-West) in South Dakota during 2000. The objectives of the study were to develop the monitoring tools necessary to produce unbiased estimates of the ecological condition of surface waters across a large geographic area of the western United States, and to demonstrate the effectiveness of those tools in a large-scale assessment. In 2001, the U.S. Geological Survey (USGS) and the South Dakota Department of Game, Fish and Parks (GF&P) established a cooperative agreement and assumed responsibility for completing the remaining assessments for the perennial, wadable streams of the EMAP-West in the State. Stream assessment sites were divided into two broad categories-the first category of sites was randomly selected and assigned by the USEPA for South Dakota. The second category consisted of sites that were specifically selected because they appeared to have reasonable potential for representing the best available physical, chemical, and biological conditions in the State. These sites comprise the second category of assessment sites and were called 'reference' sites and were selected following a detailed evaluation process. Candidate reference site data will serve as a standard or benchmark for assessing the overall ecological condition of the randomly selected sites. During 2000, the USEPA completed 22 statewide stream assessments in South Dakota. During 2001-2003, the USGS and GF&P completed another 42 stream assessments bringing the total of randomly selected stream assessments within South Dakota to 64. In addition, 18 repeat assessments designed to meet established quality-assurance/quality-control requirements were completed at 12 of these 64 sites. During 2002-2004, the USGS in cooperation with GF&P completed stream assessments at 45 candidate reference sites. Thus, 109 sites had stream assessments completed in South Dakota for EMAP-West (2000-2004). Relatively early in the EMAP-West stream-assessment process, it became apparent that for some streams in south-central South Dakota, in-stream conditions varied considerably over relatively short distances of only a few miles. These changes appeared to be a result of geomorphic changes associated with changes in the underlying geology. For these streams, moving stream assessment sites short distances upstream or downstream had the potential to provide substantially different bioassessment data. In order to obtain a better understanding of how geology influences stream conditions, two streams located in south-central South Dakota were chosen for multiple stream sampling at sites located along their longitudinal profile at points where notable changes in geomorphology were observed. Subsequently, three sites on Bear-in-the-Lodge Creek and three sites on Black Pipe Creek were selected for multiple stream sampling using EMAP-West protocols so that more could be learned about geologic influences on stream conditions. Values for dissolved oxygen and specific conductance generally increased from upstream to downstream locations on Bear-in-the-Lodge Creek. Values for pH and water temperature generally decreased from upstream to downstream locations. Decreasing water temperature could be indicative of ground-water inflows. Values for dissolved oxygen, pH, and water temperature generally increased from upstream to downstream locations on Black Pipe Creek. The increase in temperature at the lower sites is a result of less dense riparian cover, and the warmer water also could account for the lower concentrations of dissolved oxygen found in the lower reaches of Black Pipe Creek. Values for specific conductance were more than three times greater at the lower site (1,342 microsiemens per centimeter (?S/cm)) than at the upper site (434 ?S/cm). The increase probably occurs when the stream transitions from contacting the underlying Ar

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site.

PubMed

Kassotis, Christopher D; Iwanowicz, Luke R; Akob, Denise M; Cozzarelli, Isabelle M; Mumford, Adam C; Orem, William H; Nagel, Susan C

2016-07-01

Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby. Copyright © 2016 Elsevier B.V. All rights reserved.

Endocrine disrupting activities of surface water associated with a West Virginia oil and gas industry wastewater disposal site

USGS Publications Warehouse

Kassotis, Christopher D.; Iwanowicz, Luke R.; Akob, Denise M.; Cozzarelli, Isabelle M.; Mumford, Adam; Orem, William H.; Nagel, Susan C.

2016-01-01

Currently, >95% of end disposal of hydraulic fracturing wastewater from unconventional oil and gas operations in the US occurs via injection wells. Key data gaps exist in understanding the potential impact of underground injection on surface water quality and environmental health. The goal of this study was to assess endocrine disrupting activity in surface water at a West Virginia injection well disposal site. Water samples were collected from a background site in the area and upstream, on, and downstream of the disposal facility. Samples were solid-phase extracted, and extracts assessed for agonist and antagonist hormonal activities for five hormone receptors in mammalian and yeast reporter gene assays. Compared to reference water extracts upstream and distal to the disposal well, samples collected adjacent and downstream exhibited considerably higher antagonist activity for the estrogen, androgen, progesterone, glucocorticoid and thyroid hormone receptors. In contrast, low levels of agonist activity were measured in upstream/distal sites, and were inhibited or absent at downstream sites with significant antagonism. Concurrent analyses by partner laboratories (published separately) describe the analytical and geochemical profiling of the water; elevated conductivity as well as high sodium, chloride, strontium, and barium concentrations indicate impacts due to handling of unconventional oil and gas wastewater. Notably, antagonist activities in downstream samples were at equivalent authentic standard concentrations known to disrupt reproduction and/or development in aquatic animals. Given the widespread use of injection wells for end-disposal of hydraulic fracturing wastewater, these data raise concerns for human and animal health nearby.

Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

PubMed Central

Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

2000-01-01

The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

EPA Science Inventory

Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a baseline of fish from refer...

USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

EPA Science Inventory

Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a basline of fish from refere...

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Factors affecting food chain transfer of mercury in the vicinity of the Nyanza site, Sudbury River, Massachusetts

USGS Publications Warehouse

Haines, T.A.; May, T.W.; Finlayson, R.T.; Mierzykowski, S.E.

2003-01-01

The influence of the Nyanza Chemical Waste Dump Superfund Site on the Sudbury River, Massachusetts, was assessed by analysis of sediment, fish prey organisms, and predator fish from four locations in the river system. Whitehall Reservoir is an impoundment upstream of the site, and Reservoir #2 is an impoundment downstream of the site. Cedar Street is a flowing reach upstream of the site, and Sherman Bridge is a flowing reach downstream of the site. Collections of material for analysis were made three times, in May, July, and October. Sediment was analyzed for acid-volatile sulfide (AVS), simultaneously-extracted (SEM) metals (As, Cd, Cr, Hg, Pb, Sb, Zn), and total recoverable Hg. The dominant predatory fish species collected at all sites, largemouth bass (Micropterus salmoides), was analyzed for the same suite of metals as sediment. Analysis of stomach contents of bass identified small fish (yellow perch Perca flavescens, bluegill Lepomis macrochirus, and pumpkinseed Lepomis gibbosus), crayfish, and dragonfly larvae as the dominant prey organisms. Samples of the prey were collected from the same locations and at the same times as predator fish, and were analyzed for total and methyl mercury. Results of AVS and SEM analyses indicated that sediments were not toxic to aquatic invertebrates at any site. The SEM concentrations of As, Cd, and Cr were significantly higher at Reservoir #2 than at the reference sites, and SEM As and Cd were significantly higher at Sherman Bridge than at Cedar St. Sediment total Hg was elevated only at Reservoir #2. Hg was higher at site-influenced locations in all fish species except brown bullhead (Ameiurus nebulosus). Cd was higher in bluegill, black crappie (Pomoxis nigromaculatus), and brown bullhead, and Cr was higher in largemouth bass fillet samples but not in whole-body samples. There were no seasonal differences in sediment or prey organism metals, but some metals in some fish species did vary over time in an inconsistent manner. Predator fish Hg concentration was significantly linearly related to weighted prey organism methyl Hg concentration. Largemouth bass Hg was significantly lower at Reservoir #2 in our study than in previous investigations in 1989 and 1990. High concentrations of inorganic Hg remain in river sediment as a result of operation of the Nyanza site, and fish Hg concentrations in river reaches downstream of the site are elevated compared to upstream reference sites. However, the differences are relatively small and Hg concentrations in largemouth bass from the site-influenced locations are no higher than those from some other, nearby uncontaminated sites. We hypothesize that this results from burial of contaminated sediment with cleaner material, which reduces bioavailability of contaminants and possibly reduces methylation of mercury.

Drainage areas of the Guyandotte River basin, West Virginia

USGS Publications Warehouse

Mathes, M.V.

1977-01-01

This report, prepared in cooperation with the West Virginia Office of Federal-State Relations (now the Office of Economic and Community Development), lists in tabular form 435 drainage areas for basins within the Guyandotte River basin of West Virginia. Drainage areas are compiled for sites at the mouths of all streams having drainage areas of approximately five square miles or greater, for sites at U.S. Geological Survey gaging stations (past and present), and for other miscellaneous sites. Drainage areas are summed in a downstream direction to provide areas for main channel sites. The site or reference point of each basin can be located by stream miles measured upstream from the mouth of each stream, by county, by quadrangle, and by latitude and longitude.

Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

PubMed Central

Gilmartin, G M; Fleming, E S; Oetjen, J

1992-01-01

The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

Effects of historical lead–zinc mining on riffle-dwelling benthic fish and crayfish in the Big River of southeastern Missouri, USA

USGS Publications Warehouse

Allert, A.L.; DiStefano, R.J.; Fairchild, J.F.; Schmitt, C.J.; McKee, M.J.; Girondo, J.A.; Brumbaugh, W.G.; May, T.W.

2013-01-01

The Big River (BGR) drains much of the Old Lead Belt mining district (OLB) in southeastern Missouri, USA, which was historically among the largest producers of lead–zinc (Pb–Zn) ore in the world. We sampled benthic fish and crayfish in riffle habitats at eight sites in the BGR and conducted 56-day in situ exposures to the woodland crayfish (Orconectes hylas) and golden crayfish (Orconectes luteus) in cages at four sites affected to differing degrees by mining. Densities of fish and crayfish, physical habitat and water quality, and the survival and growth of caged crayfish were examined at sites with no known upstream mining activities (i.e., reference sites) and at sites downstream of mining areas (i.e., mining and downstream sites). Lead, zinc, and cadmium were analyzed in surface and pore water, sediment, detritus, fish, crayfish, and other benthic macro-invertebrates. Metals concentrations in all materials analyzed were greater at mining and downstream sites than at reference sites. Ten species of fish and four species of crayfish were collected. Fish and crayfish densities were significantly greater at reference than mining or downstream sites, and densities were greater at downstream than mining sites. Survival of caged crayfish was significantly lower at mining sites than reference sites; downstream sites were not tested. Chronic toxic-unit scores and sediment probable effects quotients indicated significant risk of toxicity to fish and crayfish, and metals concentrations in crayfish were sufficiently high to represent a risk to wildlife at mining and downstream sites. Collectively, the results provided direct evidence that metals associated with historical mining activities in the OLB continue to affect aquatic life in the BGR.

Long term trends of fish after liming of Swedish streams and lakes

NASA Astrophysics Data System (ADS)

Holmgren, Kerstin; Degerman, Erik; Petersson, Erik; Bergquist, Björn

2016-12-01

Thousands of Swedish acidified lakes and streams have been regularly limed for about 30 years. Standard sampling of fish assemblages in lakes and streams was an important part of monitoring the trends after liming, i.e. sampling with multi-mesh gillnets in lakes (EN 14757) and electrofishing in streams (EN 14011). Monitoring data are nationally managed, in the National Register of Survey test-fishing and the Swedish Electrofishing Register. We evaluated long-term data from 1029 electrofishing sites in limed streams and gillnet sampling in 750 limed lakes, along with reference data from 195 stream sites and 101 lakes with no upstream liming in their catchments. The median year of first liming was 1986 for both streams and lakes. The proportion of limed stream sites with no fish clearly decreased with time, mean species richness and proportion of sites with brown trout (Salmo trutta) recruits increased. There were no consistent trends in fish occurrence or species richness at non-limed sites, but occurrence of brown trout recruits also increased in acid as well as neutral reference streams. Abundance of brown trout, perch (Perca fluviatilis) and roach (Rutilus rutilus) increased significantly more at limed sites than at non-limed reference sites sampled before and after 1986. The mean species richness did not change consistently in limed lakes, but decreased in low alkalinity reference lakes, and fish abundance decreased significantly in limed as well as in non-limed lakes.

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Detections, concentrations, and distributional patterns of compounds of emerging concern in the San Antonio River Basin, Texas, 2011-12

USGS Publications Warehouse

Opsahl, Stephen P.; Lambert, Rebecca B.

2013-01-01

The distributional patterns of detections and concentrations of individual compounds and compound classes show the influence of wastewater-treatment plant (WWTP) outfalls on the quality of water in the San Antonio River Basin. In the Medina River Subbasin, the minimal influence of wastewater is evident as far downstream as the Macdona site. Downstream from the Macdona site, the Medina River receives treated municipal wastewater from both the Medio Creek Water Recycling Center site from an unnamed tributary at the plant and the Leon Creek Water Recycling Center site from Comanche Creek at the plant, and corresponding increases in both the number of detections and the total concentrations of all measured compounds at all downstream sampling sites were evident. Similarly, the San Antonio River receives treated municipal wastewater as far upstream as the SAR Witte site (San Antonio River at Witte Museum, San Antonio, Tex.) and additional WWTP outfalls along the Medina River upstream from the confluence of the Medina and San Antonio Rivers. Consequently, all samples collected along the main stem of the San Antonio River had higher concentrations of CECs in comparison to sites without upstream WWTPs. Sites in urbanized areas without upstream WWTPs include the Leon 35 site (Leon Creek at Interstate Highway 35, San Antonio, Tex.), the Alazan site (Alazan Creek at Tampico Street, San Antonio, Tex.), and the San Pedro site (San Pedro Creek at Probandt Street, at San Antonio, Tex.). The large number of detections at sites with no upstream wastewater source demonstrated that CECs can be detected in streams flowing through urbanized areas without a large upstream source of treated municipal wastewater. A general lack of detection of pharmaceuticals in streams without upstream outfalls of treated wastewater appears to be typical for streams throughout the San Antonio River Basin and may be a useful indicator of point-source versus nonpoint-source contributions of these compounds in urban streams. Observations of lower concentrations of compounds at the furthest downstream sampling sites in the basin indicate some natural attenuation of these compounds during transport; however, a more focused assessment is needed to make this determination.

Bioaccumulation of polycyclic aromatic hydrocarbons in bivalves from Sugarland Run and the Potomac River

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barber, T.R.; Lauren, D.J.; Dimitry, J.A.

1995-12-31

A bioaccumulation study was conducted following a release of Fuel Oil {number_sign}2 into Sugarland Run, a small northern Virginia stream. Caged clams (Corbicula sp.) were placed in 3 downstream locations and 2 upstream reference areas for an exposure period of approximately 28 days. In addition, resident clams from the Potomac River were sampled at the start of the study and at 4 and 8 weeks. Chemical fingerprinting techniques were employed to identify spill-related polycyclic aromatic hydrocarbons (PAHs) and to differentiate these compounds from background sources of contamination. The greatest concentration of spill-related PAHs (2 and 3-ring compounds) were measured inmore » clams placed immediately downstream of the spill site, and tissue concentrations systematically decreased with distance from the spill site. PAHs that were not related to Fuel Oil {number_sign}2 were found in all clams and accounted for up to 90% of the total body burden at downstream locations. Furthermore, the highest concentrations of 4-, 5-, and 6-ring PAH were found at the upstream reference location, and indicated an important source of PAHs into the environment. Body burdens measured in this study were compared to ambient concentrations reported for bivalves from a variety of environments. Tissue concentrations were also compared to concentrations that have been reported to cause adverse biological effects.« less

Active biomonitoring with Corbicula for USEPA priority pollutant and metal sources in the Anacostia River (DC, Maryland, USA).

PubMed

Phelps, Harriette L

2016-07-01

The freshwater Anacostia River watershed (Maryland, DC, USA) was surveyed for the sources of bioavailable US Environmental Protection Agency (USEPA) Priority Pollutants and toxic metals by active biomontoring (ABM) using the freshwater Asiatic clam Corbicula fluminea. The Anacostia River is a 456 km(2) tributary of the tidal freshwater Potomac River that includes the city of Washington, DC where edible fish are highly contaminated with PCBs and chlordane. From 1999 to 2011, Corbicula were collected for ABM from a Potomac reference site and translocated in cages placed at 45 sites in the tidal and nontidal Anacostia watershed. Minimum clam mortality and maximum contaminant bioaccumulation was with 2-week translocation. The clam tissues (28-50) were combined at sites and analyzed by TestAmerica for 66 USEPA Priority Pollutants plus technical chlordane, benz(e) pyrene, and 6 metals (As, Cd, Cr, Cu, Fe, Pb). Tissue contaminants reflected water, not sediment, levels. To compare sites, all contaminant data above detection or reference were grouped as total metals (TMET), total polycyclic aromatic hydrocarbons (TPAH), total PCB congeners (TPCB), total pesticides (TPEST), and total technical chlordane (TCHL). Tidal Anacostia ABM found highest TPAH and TCHL upstream at Bladensburg Marina (MD) except for TCHL at site PP near the confluence. Five nontidal MD subtributaries (94% of flow) had 17 sites with bioavailable TPAH, TPCB, or TCHL 2 to 3 times higher than found at the toxic-sediment "hotspots" near Washington. The only TMET noted was Fe at 1 site. TPAH in MD subtributaries was highest near industrial parks and Metro stations. A naphthalene spill was detected in Watts Branch. TPCB (low molecular weight) originated upstream at 1 industrial park. Total technical chlordane (80% of TPEST) was 2 to 5 times the US Food and Drug Administration action in 4 nontidal tributaries where heptachlor indicated legacy chlordane dumpsites. Total technical chlordane fell to reference below a stormwater pond, suggesting transport via suspended sediment. Controlling the formation and movement of contaminated TSS in MD should enable the uncontaminated-sediment capping of Washington DC's toxic-sediment "hot-spots" that are presently considered responsible for fish contamination. Integr Environ Assess Manag 2016;12:548-558. © 2015 SETAC. © 2015 SETAC.

Environmental signatures and effects of an oil and gas wastewater spill in the Williston Basin, North Dakota.

PubMed

Cozzarelli, I M; Skalak, K J; Kent, D B; Engle, M A; Benthem, A; Mumford, A C; Haase, K; Farag, A; Harper, D; Nagel, S C; Iwanowicz, L R; Orem, W H; Akob, D M; Jaeschke, J B; Galloway, J; Kohler, M; Stoliker, D L; Jolly, G D

2017-02-01

Wastewaters from oil and gas development pose largely unknown risks to environmental resources. In January 2015, 11.4ML (million liters) of wastewater (300g/L TDS) from oil production in the Williston Basin was reported to have leaked from a pipeline, spilling into Blacktail Creek, North Dakota. Geochemical and biological samples were collected in February and June 2015 to identify geochemical signatures of spilled wastewaters as well as biological responses along a 44-km river reach. February water samples had elevated chloride (1030mg/L) and bromide (7.8mg/L) downstream from the spill, compared to upstream levels (11mg/L and <0.4mg/L, respectively). Lithium (0.25mg/L), boron (1.75mg/L) and strontium (7.1mg/L) were present downstream at 5-10 times upstream concentrations. Light hydrocarbon measurements indicated a persistent thermogenic source of methane in the stream. Semi-volatile hydrocarbons indicative of oil were not detected in filtered samples but low levels, including tetramethylbenzenes and di-methylnaphthalenes, were detected in unfiltered water samples downstream from the spill. Labile sediment-bound barium and strontium concentrations (June 2015) were higher downstream from the Spill Site. Radium activities in sediment downstream from the Spill Site were up to 15 times the upstream activities and, combined with Sr isotope ratios, suggest contributions from the pipeline fluid and support the conclusion that elevated concentrations in Blacktail Creek water are from the leaking pipeline. Results from June 2015 demonstrate the persistence of wastewater effects in Blacktail Creek several months after remediation efforts started. Aquatic health effects were observed in June 2015; fish bioassays showed only 2.5% survival at 7.1km downstream from the spill compared to 89% at the upstream reference site. Additional potential biological impacts were indicated by estrogenic inhibition in downstream waters. Our findings demonstrate that environmental signatures from wastewater spills are persistent and create the potential for long-term environmental health effects. Published by Elsevier B.V.

Response of imperiled Okaloosa darters to stream restoration

USGS Publications Warehouse

Reeves, David B.; Tate, William B.; Jelks, Howard L.; Jordan, Frank

2016-01-01

The Okaloosa Darter Etheostoma okaloosae is a small percid endemic to six stream drainages in northwestern Florida. The U.S. Fish and Wildlife Service listed Okaloosa Darters as endangered in 1973 and downlisted them to threatened in 2011 because of habitat improvements and increasing abundance across much of their geographic range. Delisting is possible if remaining recovery criteria are met, including restoration of degraded stream reaches. Impounded reaches of Anderson Branch, Mill Creek, and Toms Creek were restored by removing impediments to water flow, draining impoundments, and reconstructing stream reaches. Restorations of Anderson Branch and Mill Creek were designed to rehabilitate populations of Okaloosa Darters without significantly affecting popular recreational activities at these locations. Restorations were evaluated from 2007 to 2013 by comparing counts of Okaloosa Darters and the composition of microhabitats in restored and nearby undisturbed reference sites. Okaloosa Darters were absent from degraded stream reaches at the beginning of the study, but they rapidly colonized once restorations were completed. Counts of Okaloosa Darters in reference and restoration sites in Anderson Branch were similar by the end of the study, whereas counts in restoration sites were significantly lower than nearby reference sites in Mill and Toms creeks. Restoration sites tended to have lower coverage of sand and root and higher coverage of macrophytes. As riparian vegetation surrounding restoration sites matures to a closed canopy that reduces excessive growth of macrophytes, stream microhabitats and numbers of darters will probably become similar to reference sites. Restoration of degraded stream sites increased abundance and distribution of Okaloosa Darters and reconnected formerly isolated upstream and downstream populations. These projects demonstrated that restoration is a useful conservation tool for imperiled fishes such as Okaloosa Darters and can be undertaken without interfering with popular recreational activities.

Parasite fauna of Etheostoma nigrum (Percidae: Etheostomatinae) in localities of varying pollution stress in the St. Lawrence River, Quebec, Canada.

PubMed

Krause, Rachel J; McLaughlin, J Daniel; Marcogliese, David J

2010-07-01

Parasite communities were examined in johnny darters (Etheostoma nigrum) collected from five localities in the St. Lawrence River in southwestern Quebec: two reference localities, one polluted locality upstream of the Island of Montreal and downstream of industrial and agricultural activity, and two polluted localities downstream of the Island of Montreal in the plume from the wastewater treatment facility. Twenty-four helminth species were found. Fish from the upstream polluted locality had the highest parasite species richness and total parasite numbers, and fish from the downstream polluted localities the lowest. Nonmetric multivariate analyses were conducted using square-root-transformed Bray-Curtis dissimilarity index. An analysis of similarity, dendrogram of centroids, and a permutational multivariate analysis of variance with contrasts all showed that fish from the reference localities had different parasite community composition than those from the polluted localities, and fish from the upstream polluted locality had different parasite communities than fish from the downstream polluted localities. Differences between reference and polluted localities were mainly due to higher abundances of the brain-encysting trematode, Ornithodiplostomum sp., at the reference localities. Differences between upstream and downstream polluted localities were mainly due to a higher diversity and abundance of trematodes in fish at the upstream locality.

Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

PubMed Central

Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

2003-01-01

The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

Are mangroves as tough as a seawall? Flow-vegetation interaction in a living shoreline restoration

NASA Astrophysics Data System (ADS)

Kibler, K. M.; Kitsikoudis, V.; Spiering, D. W.

2017-12-01

This study aims to assess the impact of an established living shoreline restoration on near-shore hydraulics, shoreline slope, and sediment texture and organic matter content. We collected data from three 100 m shoreline sites within an estuarine lagoon in Canaveral National Seashore: one restored; one that had been stabilized by a seawall; and one in a reference condition stabilized by mature mangrove vegetation. The living shoreline site was restored five years prior with a breakwater of oyster shell bags, emergent marsh grasses (Spartina alterniflora), and mangroves (Rhizophora mangle and Avicennia germinans). We sampled water depth and incoming velocity profiles of the full water column at 2 Hz using a 2 MHz Acoustic Doppler Current Profiler (ADCP, Nortek), stationed down-looking, approximately 10 m offshore. A 2 - 3 cm velocity profile above the bed was sampled on the shoreline at 100 Hz, using a Nortek Vectrino profiler. In restored and reference sites, the onshore probe was placed within vegetation. We surveyed vegetation upstream of the probe for species and diameter at water level. Windspeed and direction were collected 2 m above the water surface. Shorelines were surveyed in transects using GPS survey equipment. Five sediment cores were collected to 20 cm depth from both onshore and offshore of each site. Individual cores were processed for loss on ignition before being pooled by site for analysis of grain size distribution. While incoming velocity profiles were similar between sites, hydraulic conditions onshore within the vegetated sites deviated from the seawall site, which was devoid of vegetation. Offshore to onshore gradients in shear stress, mean velocity, and turbulent kinetic energy differed widely between sites, despite similar wind and tidal conditions. Sediment grain sizes were finer and contained more organic matter in the restored and reference sites than in the seawall site. Profiles of the restored and seawall sites were similar, though the reference site had a more complex bathymetry. Variable hydraulic patterns observed at restored and reference sites may attribute to differences in dominant vegetation-water interactions. Interactions at the reference site were characterized by flow between mangrove prop roots while the restored site consisted mainly of Spartina leaves.

Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

USGS Publications Warehouse

Juracek, Kyle E.

2011-01-01

Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 691,000 pounds per square mile per year. In general, no pronounced changes in channel width were evident at six streamgage sites located upstream from the reservoir. At the Barnes and Marysville streamgage sites, located upstream from the reservoir, long-term channel-bed degradation followed by stability was indicated. At the Frankfort streamgage site, located upstream from the reservoir, channel-bed aggradation of 1.65 feet from 1969 to 1989 followed by channel-bed degradation of 2.4 feet from 1989 to 2010 was indicated and may represent the passage of a sediment pulse caused by historical disturbances (for example, channelization) in the upstream basin. With the exception of the Frankfort streamgage site, current (2010) conditions at four streamgages located upstream from the reservoir were typified by channel-bed stability. At the Manhattan streamgage site, located downstream from the reservoir, high-flow releases associated with the 1993 flood widened the channel about 60 feet (30 percent). The channel bed at this site degraded 4.2 feet from 1960 to 1998 and since has been relatively stable. For the purpose of computing suspended-sediment concentration and load, the use of turbidity data in a regression model can provide more reliable and reproducible estimates than a regression model that uses discharge as the sole independent variable. Moreover, the use of discharge only to compute suspended-sediment concentration and load may result in overprediction. Stream channel banks, compared to channel beds, likely are a more important source of sediment to Kanopolis and Tuttle Creek Lakes from the upstream basins. Other sediment sources include surface-soil erosion in the basins and shoreline erosion in the reservoirs.

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

Response of benthic invertebrate assemblages to metal exposure and bioaccumulation associated with hard-rock mining in northwestern streams, USA

USGS Publications Warehouse

Maret, T.R.; Cain, D.J.; MacCoy, D.E.; Short, T.M.

2003-01-01

Benthic macroinvertebrate assemblages, environmental variables, and associated mine density were evaluated during the summer of 2000 at 18 reference and test sites in the Coeur d'Alene and St. Regis River basins, northwestern USA as part of the US Geological Survey's National Water-Quality Assessment Program. Concentrations of Cd, Pb, and Zn in water and (or) streambed sediment at test sites in basins where production mine density was ???0.2 mines/km2 (in a 500-m stream buffer) were significantly higher than concentrations at reference sites. Zn and Pb were identified as the primary contaminants in water and streambed sediment, respectively. These metal concentrations often exceeded acute Ambient Water Quality Criteria for aquatic life and the National Oceanic and Atmospheric Administration Probable Effect Level for streambed sediment. Regression analysis identified significant correlations between production mine density in each basin and Zn concentrations in water and Pb in streambed sediment (r2 = 0.69 and 0.65, p < 0.01). Metal concentrations in caddisfly tissue, used to verify site-specific exposures of benthos, also were highest at sites downstream from intensive mining. Benthic invertebrate taxa richness and densities were lower at sites downstream than upstream of areas of intensive hard-rock mining and associated metal enrichment. Benthic invertebrate metrics that were most effective in discriminating changes in assemblage structure between reference and mining sites were total number of taxa, number of Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa, and densities of total individuals, EPT individuals, and metal-sensitive Ephemeroptera individuals.

Environmental signatures and effects of an oil and gas wastewater spill in the Williston Basin, North Dakota

USGS Publications Warehouse

Cozzarelli, Isabelle M.; Skalak, Katherine; Kent, D.B.; Engle, Mark A.; Benthem, Adam J.; Mumford, Adam; Haase, Karl B.; Farag, Aïda M.; Harper, David; Nagel, S. C.; Iwanowicz, Luke R.; Orem, William H.; Akob, Denise M.; Jaeschke, Jeanne B.; Galloway, Joel M.; Kohler, Matthias; Stoliker, Deborah L.; Jolly, Glenn D.

2017-01-01

Wastewaters from oil and gas development pose largely unknown risks to environmental resources. In January 2015, 11.4 M L (million liters) of wastewater (300 g/L TDS) from oil production in the Williston Basin was reported to have leaked from a pipeline, spilling into Blacktail Creek, North Dakota. Geochemical and biological samples were collected in February and June 2015 to identify geochemical signatures of spilled wastewaters as well as biological responses along a 44-km river reach. February water samples had elevated chloride (1030 mg/L) and bromide (7.8 mg/L) downstream from the spill, compared to upstream levels (11 mg/L and < 0.4 mg/L, respectively). Lithium (0.25 mg/L), boron (1.75 mg/L) and strontium (7.1 mg/L) were present downstream at 5–10 times upstream concentrations. Light hydrocarbon measurements indicated a persistent thermogenic source of methane in the stream. Semi-volatile hydrocarbons indicative of oil were not detected in filtered samples but low levels, including tetramethylbenzenes and di-methylnaphthalenes, were detected in unfiltered water samples downstream from the spill. Labile sediment-bound barium and strontium concentrations (June 2015) were higher downstream from the Spill Site. Radium activities in sediment downstream from the Spill Site were up to 15 times the upstream activities and, combined with Sr isotope ratios, suggest contributions from the pipeline fluid and support the conclusion that elevated concentrations in Blacktail Creek water are from the leaking pipeline. Results from June 2015 demonstrate the persistence of wastewater effects in Blacktail Creek several months after remediation efforts started. Aquatic health effects were observed in June 2015; fish bioassays showed only 2.5% survival at 7.1 km downstream from the spill compared to 89% at the upstream reference site. Additional potential biological impacts were indicated by estrogenic inhibition in downstream waters. Our findings demonstrate that environmental signatures from wastewater spills are persistent and create the potential for long-term environmental health effects.

Effects of an oil spill on leafpack-inhabiting macroinvertebrates in the Chariton river, Missouri

USGS Publications Warehouse

Poulton, B.C.; Callahan, E.V.; Hurtubise, R.D.; Mueller, B.G.

1998-01-01

Artificial leaf packs were used to determine the effects of an oil spill on stream macroinvertebrate communities in the Chariton River, Missouri. Plastic mesh leaf retainers with approximately 10 g of leaves from five tree species were deployed at five sites (two upstream of the spill and three downstream) immediately after the spill and one year later. Four macroinvertebrate species dominating the community at upstream sites were virtually eliminated below the spill, including the stonefly Isoperla bilineata, the caddisfly Potamyia flava, the midge Thienemanniella xena, and blackfly larvae (Simulium sp.). Density of collector and shredder functional groups, and number of shredder taxa differed between upstream sites and the two furthest downstream sites during the 1990 sample period (Kruskal-Wallis w/Bonferroni paired comparisons, experiment wise error rate = 0.05). With one exception, no differences between sites were detected in the 1991-1992 sample period, indicating that the benthic community had at least partially recovered from the oil spill after one year. The odds of obtaining a sample with a small abundance of shredders (abundance < median) in 1990 was significantly greater downstream of the spill than upstream, and the odds of obtaining a sample with a small abundance of shredders at downstream sites was greater in 1990 than in 1991-1992. A similar pattern was observed in abundance and taxa richness of the collector functional group. No significant differences between the two sampling periods were detected at upstream sites. Observed effects appeared to be associated with oil sorption and substrate coating, creating conditions unsuitable for successful colonization.

Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

PubMed

Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

2008-06-01

The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

Synthesis of natural flows at selected sites in the upper Missouri River basin, Montana, 1928-89

USGS Publications Warehouse

Cary, L.E.; Parrett, Charles

1996-01-01

Natural monthly streamflows were synthesized for the years 1928-89 for 43 sites in the upper Missouri River Basin upstream from Fort Peck Lake in Montana. The sites are represented as nodes in a streamflow accounting model being developed by the Bureau of Reclamation. Recorded and historical flows at most sites have been affected by human activities including reservoir storage, diversions for irrigation, and municipal use. Natural flows at the sites were synthesized by eliminating the effects of these activities. Recorded data at some sites do not include the entire study period. The missing flows at these sites were estimated using a statistical procedure. The methods of synthesis varied, depending on upstream activities and information available. Recorded flows were transferred to nodes that did not have streamflow-gaging stations from the nearest station with a sufficient length of record. The flows at one node were computed as the sum of flows from three upstream tributaries. Monthly changes in reservoir storage were computed from monthend contents. The changes in storage were corrected for the effects of evaporation and precipitation using pan-evaporation and precipitation data from climate stations. Irrigation depletions and consumptive use by the three largest municipalities were computed. Synthesized natural flow at most nodes was computed by adding algebraically the upstream depletions and changes in reservoir storage to recorded or historical flow at the nodes.

The role of periphyton in mediating the effects of pollution in a stream ecosystem.

PubMed

Hill, Walter R; Ryon, Michael G; Smith, John G; Adams, S Marshall; Boston, Harry L; Stewart, Arthur J

2010-03-01

The effects of pollutants on primary producers ramify through ecosystems because primary producers provide food and structure for higher trophic levels and they mediate the biogeochemical cycling of nutrients and contaminants. Periphyton (attached algae) were studied as part of a long-term biological monitoring program designed to guide remediation efforts by the Department of Energy's Y-12 National Security Complex on East Fork Poplar Creek (EFPC) in Oak Ridge, Tennessee. High concentrations of nutrients entering EFPC were responsible for elevated periphyton production and placed the stream in a state of eutrophy. High rates of primary production at upstream locations in EFPC were associated with alterations in both invertebrate and fish communities. Grazers represented >50% of the biomass of invertebrates and fish near the Y-12 Complex but <10% at downstream and reference sites. An index of epilithic periphyton production accounted for 95% of the site-to-site variation in biomass of grazing fish. Analyses of heavy metals in EFPC periphyton showed that concentrations of zinc, cadmium, copper and nickel in periphyton decreased exponentially with distance downstream from Y-12. Zinc uptake by periphyton was estimated to reduce the concentration of this metal in stream water approximately 60% over a 5-km reach of EFPC. Management options for mitigating eutrophy in EFPC include additional reductions in nutrient inputs and/or allowing streamside trees to grow and shade the stream. However, reducing periphyton growth may lead to greater downstream transport of contaminants while simultaneously causing higher concentrations of mercury and PCBs in fish at upstream sites.

Geophysical bed sediment characterization of the Androscoggin River from the former Chlor-Alkali Facility Superfund Site, Berlin, New Hampshire, to the state border with Maine, August 2009

USGS Publications Warehouse

Degnan, James R.; Teeple, Andrew; Johnston, Craig M.; Marvin-DiPasquale, Mark C.; Luce, Darryl

2011-01-01

The former Chlor-Alkali Facility in Berlin, New Hampshire, was listed on the U.S. Environmental Protection Agency National Priorities List in 2005 as a Superfund site. The Chlor-Alkali Facility lies on the east bank of the Androscoggin River. Elemental mercury currently discharges from that bank into the Androscoggin River. The nature, extent, and the speciation of mercury and the production of methyl mercury contamination in the adjacent Androscoggin River is the subject of continuing investigations. The U.S. Geological Survey, in cooperation with Region I of the U.S. Environmental Protection Agency, used geophysical methods to determine the distribution, thickness, and physical properties of sediments in the Androscoggin River channel at a small area of an upstream reference reach and downstream from the site to the New Hampshire–Maine State border. Separate reaches of the Androscoggin River in the study area were surveyed with surface geophysical methods including ground-penetrating radar and step-frequency electromagnetics. Results were processed to assess sediment characteristics including grain size, electrical conductivity, and pore-water specific conductance. Specific conductance measured during surface- and pore-water sampling was used to help interpret the results of the geophysical surveys. The electrical resistivity of sediment samples was measured in the laboratory with intact pore water for comparison with survey results. In some instances, anthropogenic features and land uses, such as roads and power lines affected the detection of riverbed properties using geophysical methods; when this occurred, the data were removed. Through combining results, detailed riverbed sediment characterizations were made. Results from ground-penetrating radar surveys were used to image and measure the depth to the riverbed, depth to buried riverbeds, riverbed thickness and to interpret material-type variations in terms of relative grain size. Fifty two percent of the riverbed in the study area was covered with gravel and finer sediments. The electrically resistive river water and sediment in this study area were conducive to the penetration of the ground-penetrating radar and step-frequency electromagnetic signals and allowed for effective sediment characterization by geophysical methods. The reach between the former Chlor-Alkali Facility and the Riverside Dam, had small areas of fine sediment (estimated 11 percent of riverbed area), found on the upstream left bank and the downstream right bank, with an electromagnetic conductivity (31.4 millisiemens per meter (mS/m) maximum) that was higher than the upstream reference reach. The greatest electromagnetic conductivity (195 mS/m), pore-water specific conductance (324 mS/m) and lab measured sediment conductivity of (76.8 mS/m, measured with a direct-current resistivity test box) in the study were measured approximately 1 mile (mi) downstream of the site from a sandbar on the left bank. Reaches adjacent to and within 2 mi downstream from the site had elevated electromagnetic conductivity despite having lower estimated percentages of riverbed area covered in sediment (11, 25, and 61 percent, respectively) than the reference reach (97). Typically finer grained sediment with similar mineralogy will be more conductive. The Shelburne Reservoir is approximately 8 mi downstream from the site had the second greatest pore-water specific conductance measured, 45.8 mS/m. Many of the locations with the largest step-frequency electromagnetic values have not been sampled for pore water and sediment.

Effects of Hardened Low-Water Crossings on Periphyton and Water Quality in Selected Streams at the Fort Polk Military Reservation, Louisiana, 1998-99 and 2003-04

USGS Publications Warehouse

Bryan, Barbara W.; Bryan, C. Frederick; Lovelace, John K.; Tollett, Roland W.

2007-01-01

In 2003, the U.S. Geological Survey (USGS), at the request of the U.S. Army Joint Readiness Training Center and Fort Polk, began a follow-up study to determine whether installation and modification of hardened low-water crossings had short-term (less than 1 year) or long-term (greater than 1 year) effects on periphyton or water quality in five streams at the Fort Polk Military Reservation, Louisiana. Periphyton data were statistically analyzed for possible differences between samples collected at upstream and downstream sites and before and after low-water crossings were modified on three streams, Big Brushy Creek, Tributary to East Fork of Sixmile Creek, and Tributary to Birds Creek, during 2003?04. Periphyton data also were analyzed for possible differences between samples collected at upstream and downstream sites on two streams, Tributary to Big Brushy Creek and Little Brushy Creek, during 1998?99 and 2003. Variations in periphyton communities could not be conclusively attributed to the modifications. Most of the significant changes in percent frequency of occurrence and average cell density of the 10 most frequently occurring periphyton taxa were increases at downstream sites after the hardened low-water crossing installations or modifications. However, these changes in the periphyton community are not necessarily deleterious to the community structure. Water-quality data collected from upstream and downstream sites on the five streams during 2003?04 were analyzed for possible differences caused by the hardened crossings. Generally, average water-quality values and concentrations were similar at upstream and downstream sites. When average water-quality values or concentrations changed significantly, they almost always changed significantly at both the upstream and downstream sites. It is probable that observed variations in water quality at both upstream and downstream sites are related to differences in rainfall and streamflow during the sample collection periods rather than an effect of the hardened low-water crossing installations or modifications, but additional study is needed.

Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

PubMed

Li, Shisheng; Smerdon, Michael J

2004-04-02

Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

Spatial and temporal patterns of micropollutants upstream and downstream of 24 WWTPs across Switzerland

NASA Astrophysics Data System (ADS)

Spycher, Barbara; Deuber, Fabian; Kistler, David; Burdon, Frank; Reyes, Marta; Alder, Alfredo C.; Joss, Adriano; Eggen, Rik; Singer, Heinz; Stamm, Christian

2015-04-01

Treated wastewater is an important source of micropollutants in many streams. These chemicals consist of very diverse set of compounds that may vary in space and time. In order to improve our understanding of such spatio-temporal patterns of micropollutants in surface waters, we compared upstream and downstream locations at 24 sites across the Swiss Plateau and Jura (12 sites in the 2013 campaign, 12 sites during the 2014 campaign). Each site represents the most upstream treatment plant in the corresponding catchment. This survey is part of the interdisciplinary, Eawag-wide research project EcoImpact that aims at elucidating the ecological effects of micropollutants on stream ecosystems. In 2013, a broad analytical screening was applied to samples collected during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 were analysed for a set of about 60 selected organic micropollutants and 10 heavy metals. The screening results demonstrate that generally pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest part of the organic micropollutants. Pesticides including biocides and plant protection products are also regularly found but at lower concentrations. This presentation will analyse the variability of the micropollutant patterns across the different sites and how upstream conditions and the wastewater composition changes with season.

Recommendations for a wind profiling network to support Space Shuttle launches

NASA Technical Reports Server (NTRS)

Zamora, R. J.

1992-01-01

The feasibility is examined of a network of clear air radar wind profilers to forecast wind conditions before Space Shuttle launches during winter. Currently, winds are measured only in the vicinity of the shuttle launch site and wind loads on the launch vehicle are estimated using these measurements. Wind conditions upstream of the Cape are not monitored. Since large changes in the wind shear profile can be associated with weather systems moving over the Cape, it may be possible to improve wind forecasts over the launch site if wind measurements are made upstream. A radar wind profiling system is in use at the Space Shuttle launch site. This system can monitor the wind profile continuously. The existing profiler could be combined with a number of radars located upstream of the launch site. Thus, continuous wind measurements would be available upstream and at the Cape. NASA-Marshall representatives have set the requirements for radar wind profiling network. The minimum vertical resolution of the network must be set so that the wind shears over the depths greater than or = 1 km will be detected. The network should allow scientists and engineers to predict the wind profile over the Cape 6 hours before a Space Shuttle launch.

Characterization of sediment transport upstream and downstream from Lake Emory on the Little Tennessee River near Franklin, North Carolina, 2014–15

USGS Publications Warehouse

Huffman, Brad A.; Hazell, William F.; Oblinger, Carolyn J.

2017-09-06

Federal, State, and local agencies and organizations have expressed concerns regarding the detrimental effects of excessive sediment transport on aquatic resources and endangered species populations in the upper Little Tennessee River and some of its tributaries. In addition, the storage volume of Lake Emory, which is necessary for flood control and power generation, has been depleted by sediment deposition. To help address these concerns, a 2-year study was conducted in the upper Little Tennessee River Basin to characterize the ambient suspended-sediment concentrations and suspended-sediment loads upstream and downstream from Lake Emory in Franklin, North Carolina. The study was conducted by the U.S. Geological Survey in cooperation with Duke Energy. Suspended-sediment samples were collected periodically, and time series of stage and turbidity data were measured from December 2013 to January 2016 upstream and downstream from Lake Emory. The stage data were used to compute time-series streamflow. Suspended-sediment samples, along with time-series streamflow and turbidity data, were used to develop regression models that were used to estimate time-series suspended-sediment concentrations for the 2014 and 2015 calendar years. These concentrations, along with streamflow data, were used to compute suspended-sediment loads. Selected suspended-sediment samples were collected for analysis of particle-size distribution, with emphasis on high-flow events. Bed-load samples were also collected upstream from Lake Emory.The estimated annual suspended-sediment loads (yields) for the upstream site for the 2014 and 2015 calendar years were 27,000 short tons (92 short tons per square mile) and 63,300 short tons (215 short tons per square mile), respectively. The annual suspended-sediment loads (yields) for the downstream site for 2014 and 2015 were 24,200 short tons (75 short tons per square mile) and 94,300 short tons (292 short tons per square mile), respectively. Overall, the suspended-sediment load at the downstream site was about 28,300 short tons greater than the upstream site over the study period.As expected, high-flow events (the top 5 percent of daily mean flows) accounted for the majority of the sediment load; 80 percent at the upstream site and 90 percent at the downstream site. A similar relation between turbidity (the top 5 percent of daily mean turbidity) and high loads was also noted. In general, when instantaneous streamflows at the upstream site exceeded 5,000 cubic feet per second, increased daily loads were computed at the downstream site. During low to moderate flows, estimated suspended-sediment loads were lower at the downstream site when compared to the upstream site, which suggests that sediment deposition may be occurring in the intervening reach during those conditions. During the high-flow events, the estimated suspended-sediment loads were higher at the downstream site; however, it is impossible to say with certainty whether the increase in loading was due to scouring of lake sediment, contributions from the additional source area, model error, or a combination of one or more of these factors. The computed loads for a one-week period (December 24–31, 2015), during which the two largest high-flow events of the study period occurred, were approximately 52 percent of the 2015 annual sediment load (36 percent of 2-year load) at the upstream site and approximately 72 percent of the 2015 annual sediment load (57 percent of 2-year load) at the downstream site. Six bedload samples were collected during three events; two high-flow events and one base-flow event. The contribution of bedload to the total sediment load was determined to be insignificant for sampled flows. In general, streamflows for long-term streamgages in the study area were below normal for the majority of the study period; however, flows during the last 3 months of the study period were above normal, including the extreme events during the last week of the study period.

Drinking water treatment response following a Colorado wildfire.

PubMed

Hohner, Amanda K; Cawley, Kaelin; Oropeza, Jill; Summers, R Scott; Rosario-Ortiz, Fernando L

2016-11-15

Wildfires can greatly alter the vegetation, soils, and hydrologic processes of watersheds serving as drinking water supplies, which may negatively influence source water quality and treatment. To address wildfire impacts on treatment, a drinking water intake below a burned watershed and an upstream, unburned reference site were monitored following the High Park wildfire (2012) in the Cache la Poudre watershed of northern Colorado, USA. Turbidity, nutrients, dissolved organic matter (DOM) character, coagulation treatability, and disinfection byproduct formation were evaluated and compared to pre-fire data. Post-fire paired spatial differences between the treatment plant intake and reference site for turbidity, nitrogen, and phosphorus increased by an order of magnitude compared to pre-fire differences. Fluorescence index (FI) values were significantly higher at the intake compared to the reference site (Δ = 0.04), and higher than pre-fire years, suggesting the wildfire altered the DOM character of the river. Total trihalomethane (TTHM) and haloacetonitrile (HAN4) formation at the intake were 10.1 μg L -1 and 0.91 μg L -1 higher than the reference site. Post-fire water was amenable to conventional treatment at a 10 mg L -1 higher average alum dose than reference samples. The intake was also monitored following rainstorms. Post-rainstorm samples showed the maximum observed FI values (1.52), HAN4 (3.4 μg mg C -1 ) and chloropicrin formation yields (3.6 μg mg C -1 ), whereas TTHM and haloacetic acid yields were not elevated. Several post-rainstorm samples presented treatment challenges, and even at high alum doses (65 mg L -1 ), showed minimal dissolved organic carbon removal (<10%). The degraded water quality of the post-rainstorm samples is likely attributed to the combined effects of runoff from precipitation and greater erosion following wildfire. Wildfire impacts cannot be separated from rainfall effects due to the lack of post-rainstorm samples from the reference site. Results suggest for this study region, wildfire may have consequences for influent water quality, coagulant dosing, and DBP speciation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sediment transport to and from small impoundments in northeast Kansas, March 2009 through September 2011

USGS Publications Warehouse

Foster, Guy M.; Lee, Casey J.; Ziegler, Andrew C.

2012-01-01

The U.S. Geological Survey, in cooperation with the Kansas Water Office, investigated sediment transport to and from three small impoundments (average surface area of 0.1 to 0.8 square miles) in northeast Kansas during March 2009 through September 2011. Streamgages and continuous turbidity sensors were operated upstream and downstream from Atchison County, Banner Creek, and Centralia Lakes to study the effect of varied watershed characteristics and agricultural practices on sediment transport in small watersheds in northeast Kansas. Atchison County Lake is located in a predominantly agricultural basin of row crops, with wide riparian buffers along streams, a substantial amount of tile drainage, and numerous small impoundments (less than 0.05 square miles; hereafter referred to as “ponds”). Banner Creek Lake is a predominantly grassland basin with numerous small ponds located in the watershed, and wide riparian buffers along streams. Centralia Lake is a predominantly agricultural basin of row crops with few ponds, few riparian buffers along streams, and minimal tile drainage. Upstream from Atchison County, Banner Creek, and Centralia Lakes 24, 38, and 32 percent, respectively, of the total load was transported during less than 0.1 percent (approximately 0.9 days) of the time. Despite less streamflow in 2011, larger sediment loads during that year indicate that not all storm events transport the same amount of sediment; larger, extreme storms during the spring may transport much larger sediment loads in small Kansas watersheds. Annual sediment yields were 360, 400, and 970 tons per square mile per year at Atchison County, Banner, and Centralia Lake watersheds, respectively, which were less than estimated yields for this area of Kansas (between 2,000 and 5,000 tons per square mile per year). Although Centralia and Atchison County Lakes had similar percentages of agricultural land use, mean annual sediment yields upstream from Centralia Lake were about 2.7 times those at Atchison County or Banner Creek Lakes. These data indicate larger yields of sediment from watersheds with row crops and those with fewer small ponds, and smaller yields in watersheds which are primarily grassland, or agricultural with substantial tile drainage and riparian buffers along streams. These results also indicated that a cultivated watershed can produce yields similar to those observed under the assumed reference (or natural) condition. Selected small ponds were studied in the Atchison County Lake watershed to characterize the role of small ponds in sediment trapping. Studied ponds trapped about 8 percent of the sediment upstream from the sediment-sampling site. When these results were extrapolated to the other ponds in the watershed, differences in the extent of these ponds was not the primary factor affecting differences in yields among the three watersheds. However, the selected small ponds were both 45 years old at the time of this study, and have reduced capacity because of being filled in with sediments. Additionally, trapping efficiency of these small ponds decreased over five observed storms, indicating that processes that suspended or resuspended sediments in these shallow ponds, such as wind and waves, affected their trapping efficiencies. While small ponds trapped sediments in small storms, they could be a source of sediment in larger or more closely spaced storm events. Channel slope was similar at all three watersheds, 0.40, 0.46, and 0.31 percent at Atchison County, Banner Creek, and Centralia Lake watersheds, respectively. Other factors, such as increased bank and stream erosion, differences in tile drainage, extent of grassland, or riparian buffers, could be the predominant factors affecting sediment yields from these basins. These results show that reference-like sediment yields may be observed in heavily agricultural watersheds through a combination of field-scale management activities and stream channel protection. When computing loads using published erosion rates obtained by single-point survey methodology, streambank contributions from the main stem of Banner Creek are three times more than the sediment load observed by this study at the sediment sampling site at Banner Creek, 2.6 times more than the sediment load observed by this study at the sediment sampling site at Clear Creek (upstream from Atchison County Lake), and are 22 percent of the load observed by this study at the sediment sampling site at Black Vermillion River above Centralia Lake. Comparisons of study sites to similarly sized urban and urbanizing watersheds in Johnson County, Kansas indicated that sediment yields from the Centralia Lake watershed were similar to those in construction-affected watersheds, while much smaller sediment yields in the Atchison County and Banner Creek watersheds were comparable to stable, heavily urbanized watersheds. Comparisons of study sites to larger watersheds upstream from Tuttle Creek Lake indicate the Black Vermillion River watershed continues to have high sediment yields despite 98 percent of sediment from the Centralia watershed (a headwater of the Black Vermillion River) being trapped in Centralia Lake. Estimated trapping efficiencies for the larger watershed lakes indicated that Banner Creek and Centralia Lakes trapped 98 percent of incoming sediment, whereas Atchison County Lake trapped 72 percent of incoming sediment during the 3-year study period.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Thermal effects of dams in the Willamette River basin, Oregon

USGS Publications Warehouse

Rounds, Stewart A.

2010-01-01

Methods were developed to assess the effects of dams on streamflow and water temperature in the Willamette River and its major tributaries. These methods were used to estimate the flows and temperatures that would occur at 14 dam sites in the absence of upstream dams, and river models were applied to simulate downstream flows and temperatures under a no-dams scenario. The dams selected for this study include 13 dams built and operated by the U.S. Army Corps of Engineers (USACE) as part of the Willamette Project, and 1 dam on the Clackamas River owned and operated by Portland General Electric (PGE). Streamflows in the absence of upstream dams for 2001-02 were estimated for USACE sites on the basis of measured releases, changes in reservoir storage, a correction for evaporative losses, and an accounting of flow effects from upstream dams. For the PGE dam, no-project streamflows were derived from a previous modeling effort that was part of a dam-relicensing process. Without-dam streamflows were characterized by higher peak flows in winter and spring and much lower flows in late summer, as compared to with-dam measured flows. Without-dam water temperatures were estimated from measured temperatures upstream of the reservoirs (the USACE sites) or derived from no-project model results (the PGE site). When using upstream data to estimate without-dam temperatures at dam sites, a typical downstream warming rate based on historical data and downstream river models was applied over the distance from the measurement point to the dam site, but only for conditions when the temperature data indicated that warming might be expected. Regressions with measured temperatures from nearby or similar sites were used to extend the without-dam temperature estimates to the entire 2001-02 time period. Without-dam temperature estimates were characterized by a more natural seasonal pattern, with a maximum in July or August, in contrast to the measured patterns at many of the tall dam sites where the annual maximum temperature typically occurred in September or October. Without-dam temperatures also tended to have more daily variation than with-dam temperatures. Examination of the without-dam temperature estimates indicated that dam sites could be grouped according to the amount of streamflow derived from high-elevation, spring-fed, and snowmelt-driven areas high in the Cascade Mountains (Cougar, Big Cliff/Detroit, River Mill, and Hills Creek Dams: Group A), as opposed to flow primarily derived from lower-elevation rainfall-driven drainages (Group B). Annual maximum temperatures for Group A ranged from 15 to 20 degree(s)C, expressed as the 7-day average of the daily maximum (7dADM), whereas annual maximum 7dADM temperatures for Group B ranged from 21 to 25 degrees C. Because summertime stream temperature is at least somewhat dependent on the upstream water source, it was important when estimating without-dam temperatures to use correlations to sites with similar upstream characteristics. For that reason, it also is important to maintain long-term, year-round temperature measurement stations at representative sites in each of the Willamette River basin's physiographic regions. Streamflow and temperature estimates downstream of the major dam sites and throughout the Willamette River were generated using existing CE-QUAL-W2 flow and temperature models. These models, originally developed for the Willamette River water-temperature Total Maximum Daily Load process, required only a few modifications to allow them to run under the greatly reduced without-dam flow conditions. Model scenarios both with and without upstream dams were run. Results showed that Willamette River streamflow without upstream dams was reduced to levels much closer to historical pre-dam conditions, with annual minimum streamflows approximately one-half or less of dam-augmented levels. Thermal effects of the dams varied according to the time of year, from cooling in mid-summer to warm

Spawning chronology, nest site selection and nest success of smallmouth bass during benign streamflow conditions

USGS Publications Warehouse

Dauwalter, D.C.; Fisher, W.L.

2007-01-01

We documented the nesting chronology, nest site selection and nest success of smallmouth bass Micropterus dolomieu in an upstream (4th order) and downstream (5th order) reach of Baron Fork Creek, Oklahoma. Males started nesting in mid-Apr. when water temperatures increased to 16.9 C upstream, and in late-Apr. when temperatures increased to 16.2 C downstream. Streamflows were low (77% upstream to 82% downstream of mean Apr. streamflow, and 12 and 18% of meanjun. streamflow; 47 and 55 y of record), and decreased throughout the spawning period. Larger males nested first upstream, as has been observed in other populations, but not downstream. Upstream, progeny in 62 of 153 nests developed to swim-up stage. Downstream, progeny in 31 of 73 nests developed to swim-up. Nesting densities upstream (147/km) and downstream (100/km) were both higher than any densities previously reported. Males selected nest sites with intermediate water depths, low water velocity and near cover, behavior that is typical of smallmouth bass. Documented nest failures resulted from human disturbance, angling, and longear sunfish predation. Logistic exposure models showed that water velocity at the nest was negatively related and length of the guarding male was positively related to nest success upstream. Male length and number of degree days were both positively related to nest success downstream. Our results, and those of other studies, suggest that biological factors account for most nest failures during benign (stable, low flow) streamflow conditions, whereas nest failures attributed to substrate mobility or nest abandonment dominate when harsh streamflow conditions (spring floods) coincide with the spawning season.

Risk assessment of imidacloprid use in forest settings on the aquatic macroinvertebrate community.

PubMed

Benton, Elizabeth P; Grant, Jerome F; Nichols, Rebecca J; Webster, R Jesse; Schwartz, John S; Bailey, Joseph K

2017-11-01

The isolated effects of a single insecticide can be difficult to assess in natural settings because of the presence of numerous pollutants in many watersheds. Imidacloprid use for suppressing hemlock woolly adelgid, Adelges tsugae (Annand) (Hemiptera: Adelgidae), in forests offers a rare opportunity to assess potential impacts on aquatic macroinvertebrates in relatively pristine landscapes. Aquatic macroinvertebrate communities were assessed in 9 streams in Great Smoky Mountains National Park (southern Appalachian Mountains, USA). The streams flow through hemlock conservation areas where imidacloprid soil drench treatments were applied for hemlock woolly adelgid suppression. Sites were located upstream and downstream of the imidacloprid treatments. Baseline species presence data (pre-imidacloprid treatment) were available from previous sample collections at downstream sites. Downstream and upstream sites did not vary in numerous community measures. Although comparisons of paired upstream and downstream sites showed differences in diversity in 7 streams, higher diversity was found more often in downstream sites. Macroinvertebrate functional feeding groups and life habits were similar between downstream and upstream sites. Downstream and baseline stream samples were similar. While some functional feeding group and life habit species richness categories varied, variations did not indicate poorer quality downstream communities. Imidacloprid treatments applied according to US Environmental Protection Agency federal restrictions did not result in negative effects to aquatic macroinvertebrate communities, which indicates that risks of imidacloprid use in forest settings are low. Environ Toxicol Chem 2017;36:3108-3119. © 2017 SETAC. © 2017 SETAC.

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

Barriers impede upstream spawning migration of flathead chub

USGS Publications Warehouse

Walters, David M.; Zuellig, Robert E.; Crockett, Harry J.; Bruce, James F.; Lukacs, Paul M.; Fitzpatrick, Ryan M.

2014-01-01

Many native cyprinids are declining throughout the North American Great Plains. Some of these species require long reaches of contiguous, flowing riverine habitat for drifting eggs or larvae to develop, and their declining populations have been attributed to habitat fragmentation or barriers (e.g., dams, dewatered channels, and reservoirs) that restrict fish movement. Upstream dispersal is also needed to maintain populations of species with passively drifting eggs or larvae, and prior researchers have suggested that these fishes migrate upstream to spawn. To test this hypothesis, we conducted a mark–recapture study of Flathead Chub Platygobio gracilis within a 91-km reach of continuous riverine habitat in Fountain Creek, Colorado. We measured CPUE, spawning readiness (percent of Flathead Chub expressing milt), and fish movement relative to a channel-spanning dam. Multiple lines of evidence indicate that Flathead Chub migrate upstream to spawn during summer. The CPUE was much higher at the base of the dam than at downstream sites; the seasonal increases in CPUE at the dam closely tracked seasonal increases in spawning readiness, and marked fish moved upstream as far as 33 km during the spawning run. The upstream migration was effectively blocked by the dam. The CPUE of Flathead Chub was much lower upstream of the OHDD than at downstream sites, and <0.2% of fish marked at the dam were recaptured upstream. This study provides the first direct evidence of spawning migration for Flathead Chub and supports the general hypothesis that barriers limit adult dispersal of these and other plains fishes.

Measurement of bridge scour at the SR-32 crossing of the Sacramento River at Hamilton City, California, 1987-92

USGS Publications Warehouse

Blodgett, J.C.; Harris, Carroll D.; ,

1993-01-01

A study of the State Route 32 crossing of the Sacramento River near Hamilton City, California, is being made to determine those channel and bridge factors that contribute to scour at the site. Three types of scour data have been measured-channel bed (natural) scour, constriction (general) scour, and local (bridge-pier induced) scour. During the years 1979-93, a maximum of 3.4 ft of channel bed scour, with a mean of 1.4 ft, has been measured. Constriction scour, which may include channel bed scour, has been measured at the site nine times during the years 1987-92. The calculated amount of constriction scour ranged from 0.2 to 3.0 ft, assuming the reference is the mean bed elevation. Local scour was measured four times at the site in 1991 and 1992 and ranged from -2.1 (fill) to 11.6 ft , with the calculated amounts dependent on the bed reference elevation and method of computation used. Surveys of the channel bed near the bridge piers indicate the horizontal location of lowest bed elevation (maximum depth of scour) may vary at least 17 ft between different surveys at the same pier and most frequently is located downstream from the upstream face of the pier.

Application of a multidisciplinary and integrative weight-of-evidence approach to a 1-year monitoring survey of the Seine River.

PubMed

Barjhoux, Iris; Fechner, Lise C; Lebrun, Jérémie D; Anzil, Adriana; Ayrault, Sophie; Budzinski, Hélène; Cachot, Jérôme; Charron, Laetitia; Chaumot, Arnaud; Clérandeau, Christelle; Dedourge-Geffard, Odile; Faburé, Juliette; François, Adeline; Geffard, Olivier; George, Isabelle; Labadie, Pierre; Lévi, Yves; Munoz, Gabriel; Noury, Patrice; Oziol, Lucie; Quéau, Hervé; Servais, Pierre; Uher, Emmanuelle; Urien, Nastassia; Geffard, Alain

2016-06-08

Quality assessment of environments under high anthropogenic pressures such as the Seine Basin, subjected to complex and chronic inputs, can only be based on combined chemical and biological analyses. The present study integrates and summarizes a multidisciplinary dataset acquired throughout a 1-year monitoring survey conducted at three workshop sites along the Seine River (PIREN-Seine program), upstream and downstream of the Paris conurbation, during four seasonal campaigns using a weight-of-evidence approach. Sediment and water column chemical analyses, bioaccumulation levels and biomarker responses in caged gammarids, and laboratory (eco)toxicity bioassays were integrated into four lines of evidence (LOEs). Results from each LOE clearly reflected an anthropogenic gradient, with contamination levels and biological effects increasing from upstream to downstream of Paris, in good agreement with the variations in the structure and composition of bacterial communities from the water column. Based on annual average data, the global hazard was summarized as "moderate" at the upstream station and as "major" at the two downstream ones. Seasonal variability was also highlighted; the winter campaign was least impacted. The model was notably improved using previously established reference and threshold values from national-scale studies. It undoubtedly represents a powerful practical tool to facilitate the decision-making processes of environment managers within the framework of an environmental risk assessment strategy.

Effects of aquifer storage and recovery activities on water quality in the Little Arkansas River and Equus Beds Aquifer, south-central Kansas, 2011–14

USGS Publications Warehouse

Stone, Mandy L.; Garrett, Jessica D.; Poulton, Barry C.; Ziegler, Andrew C.

2016-07-18

The Equus Beds aquifer in south-central Kansas is aprimary water source for the city of Wichita. The Equus Beds aquifer storage and recovery (ASR) project was developed to help the city of Wichita meet increasing current (2016) and future water demands. The Equus Beds ASR project pumps water out of the Little Arkansas River during above-base flow conditions, treats it using drinking-water quality standards as a guideline, and recharges it into the Equus Beds aquifer for later use. Phase II of the Equus Beds ASR project currently (2016) includes a river intake facility and a surface-water treatment facility with a 30 million gallon per day capacity. Water diverted from the Little Arkansas River is delivered to an adjacent presedimentation basin for solids removal. Subsequently, waste from the surface-water treatment facility and the presedimentation basin is returned to the Little Arkansas River through a residuals return line. The U.S. Geological Survey, in cooperation with the city of Wichita, developed and implemented a hydrobiological monitoring program as part of the ASR project to characterize and quantify the effects of aquifer storage and recovery activities on the Little Arkansas River and Equus Beds aquifer water quality.Data were collected from 2 surface-water sites (one upstream and one downstream from the residuals return line), 1 residuals return line site, and 2 groundwater well sites (each having a shallow and deep part): the Little Arkansas River upstream from the ASR facility near Sedgwick, Kansas (upstream surface-water site 375350097262800), about 0.03 mile (mi) upstream from the residuals return line site; the Little Arkansas River near Sedgwick, Kans. (downstream surface-water site 07144100), about 1.68 mi downstream from the residuals return line site; discharge from the Little Arkansas River ASR facility near Sedgwick, Kansas (residuals return line site 375348097262800); 25S 01 W 07BCCC01 SMW–S11 near CW36 (MW–7 shallow groundwater well site 375327097285401); 25S01 W 07BCCC02 DMW–S10 near CW36 (MW–7 deep groundwater well site 375327097285402); 25S 01W 07BCCA01 SMW–S13 near CW36 (MW–8 shallow groundwater well site 375332097284801); and 25S 01W 07BCCA02 DMW–S14 near CW36 (MW–8 deep groundwater well site 375332097284802). The U.S. Geological Survey, in cooperation with the city of Wichita, assessed the effects of the ASR Phase II facility residuals return line discharges on stream quality of the Little Arkansas River by measuring continuous physicochemical properties and collecting discrete water-quality and sediment samples for about 2 years pre- (January 2011 through April 2013) and post-ASR (May 2013 through December 2014) Phase II facility operation upstream and downstream from the ASR Phase II facility. Additionally, habitat variables were quantified and macroinvertebrate and fish communities were sampled upstream and downstream from the ASR Phase II facility during the study period. To assess the effects of aquifer recharge on Equus Beds groundwater quality, continuous physicochemical properties were measured and discrete water-quality samples were collected before and during the onset of Phase II aquifer recharge in two (shallow and deep) groundwater wells.Little Arkansas River streamflow was about 10 times larger after the facility began operating because of greater rainfall. Residuals return line release volumes were a very minimal proportion (0.06 percent) of downstream streamflow volume during the months the ASR facility was operating. Upstream and downstream continuously measured water temperature and dissolved oxygen median differences were smaller post-ASR than pre-ASR. Turbidity generally was smaller at the downstream site throughout the study period and decreased at both sites after the ASR Phase II facility began discharging despite a median residuals return line turbidity that was about an order of magnitude larger than the median turbidity at the downstream site. Upstream and downstream continuously measured turbidity median differences were larger post-ASR than pre-ASR. Median post-ASR continuously measured nitrite plus nitrate and continuously computed total suspended solids and suspended-sediment concentrations were smaller than pre-ASR likely because of higher streamflows and dilution; whereas, median continuously computed dissolved and total organic carbon concentrations were larger likely because of higher streamflows and runoff conditions.None of the discretely measured water-quality constituents (dissolved and suspended solids, primary ions, suspended sediment, nutrients, carbon, trace elements, viral and bacterial indicators, and pesticides) in surface water were significantly different between the upstream and downstream sites after the ASR Phase II facility began discharging; however, pre-ASR calcium, sodium, hardness, manganese, and arsenate concentrations were significantly larger at the upstream site, which indicates that some water-quality conditions at the upstream and downstream sites were more similar post-ASR. Most of the primary constituents that make up dissolved solids decreased at both sites after the ASR Phase II facility began operation. Discretely collected total suspended solids concentrations were similar between the upstream and downstream sites before the facility began operating but were about 27 percent smaller at the downstream site after the facility began operating, despite the total suspended solids concentrations in the residuals return line being 15 times larger than the downstream site.Overall habitat scores were indicative of suboptimal conditions upstream and downstream from the ASR Phase II facility throughout the study period. Substrate fouling and sediment deposition mean scores indicated marginal conditions at the upstream and downstream sites during the study period, demonstrating that sediment deposition was evident pre- and post-ASR and no substantial changes in these habitat characteristics were noted after the ASR Phase II facility began discharging. Macroinvertebrate community composition (evaluated using functional feeding, behavioral, and tolerance metrics) generally was similar between sites during the study period. Fewer macroinvertebrate metrics were significant between the upstream and downstream sites post-ASR (6) than pre-ASR (14), which suggests that macroinvertebate communities were more similar after the ASR facility began discharging. Upstream-downstream comparisons in macroinvertebrate aquatic-life-support metrics had no significant differences for the post-ASR time period and neither site was fully supporting for any of the Kansas Department of Health and Environment aquatic-life-support metrics (Macroinvertebrate Biotic Index; Kansas Biotic Index with tolerances for nutrients and oxygen-demanding substances; Ephemeroptera, Plecoptera, and Trichoptera [EPT] richness; and percentage of EPT species). Overall, using macroinvertebrate aquatic life-support criteria from the Kansas Department of Health and Environment, upstream and downstream sites were classified as partially supporting before and after the onset of ASR facility operations. Fish community trophic status and tolerance groups generally were similar among sites during the study period. Fish community Little Arkansas River Basin Index of Biotic Integrity scores at the upstream and downstream sites were indicative of fair-to-good conditions before the facility began operating and decreased to fair conditions after the facility began operating.Groundwater physicochemical changes concurrent with the beginning of recharge operations at the Sedgwick basin were more pronounced in shallow groundwater. No constituent concentrations in the pre-recharge period in comparison to the post-recharge period increased to concentrations exceeding drinking water regulations; however, nitrate decreased significantly from a pre-recharge exceedance of the U.S. Environmental Protection Agency maximum contaminant level to a post recharge nonexceedance. Shallow groundwater chemical concentrations or rates of detection increased after artificial recharge began for the ions potassium, chloride, and fluoride; phosphorus and organic carbon species; trace elements barium, manganese, nickel, arsenate, arsenic, and boron; agricultural pesticides atrazine, metolachlor, metribuzin, and simazine; organic disinfection byproducts bromodichloromethane and trichloromethane; and gross beta levels. Additionally, water temperature, and pH were larger after recharge began; and total solids and slime-forming bacteria concentrations and densities were smaller. Total solids, nitrate, and selenium significantly decreased; and potassium, chloride, nickel, arsenic, fluoride, phosphorus and carbon species, and gross beta levels significantly increased in shallow groundwater after artificial recharge. Results of biological activity reaction tests indicated that water quality microbiology was different before and after artificial recharge began; at times, these differences may lead to changes in dominant bacterial populations that, in turn, may lead to formation and expansion in populations that may cause bioplugging and other unwanted effects. Calcite, iron (II) hydroxide, hydroxyapatite, and similar minerals, had shifts in saturation indices that generally were from undersaturation toward equilibrium and, in some cases, toward oversaturation. These shifts toward neutral saturation indices might suggest reduced weathering of the minerals present in the Equus Beds aquifer. Chemical weathering in the shallow parts of the aquifer may be accelerated because of the increased water temperatures and the system is more vulnerable to clogged pores and mineral dissolution as the equilibrium state is affected by recharge and withdrawal. When oversaturation is indicated for iron minerals, plugging of aquifer materials may happen.

Biological assessment of aquaculture effects on effluent-receiving streams in Ghana using structural and functional composition of fish and macroinvertebrate assemblages.

PubMed

Ansah, Yaw Boamah; Frimpong, Emmanuel A; Amisah, Stephen

2012-07-01

Biological assessment of aquatic ecosystems is widely employed as an alternative or complement to chemical and toxicity testing due to numerous advantages of using biota to determine ecosystem condition. These advantages, especially to developing countries, include the relatively low cost and technical requirements. This study was conducted to determine the biological impacts of aquaculture operations on effluent-receiving streams in the Ashanti Region of Ghana. We collected water, fish and benthic macroinvertebrate samples from 12 aquaculture effluent-receiving streams upstream and downstream of fish farms and 12 reference streams between May and August of 2009, and then calculated structural and functional metrics for biotic assemblages. Fish species with non-guarding mode of reproduction were more abundant in reference streams than downstream (P = 0.0214) and upstream (P = 0.0251), and sand-detritus spawning fish were less predominant in reference stream than upstream (P = 0.0222) and marginally less in downstream locations (P = 0.0539). A possible subsidy-stress response of macroinvertebrate family richness and abundance was also observed, with nutrient (nitrogen) augmentation from aquaculture and other farming activities likely. Generally, there were no, or only marginal differences among locations downstream and upstream of fish farms and in reference streams in terms of several other biotic metrics considered. Therefore, the scale of impact in the future will depend not only on the management of nutrient augmentation from pond effluents, but also on the consideration of nutrient discharges from other industries like fruit and vegetable farming within the study area.

Biomonitoring in the Boulder River watershed, Montana, USA: metal concentrations in biofilm and macroinvertebrates, and relations with macroinvertebrate assemblage

USGS Publications Warehouse

Rhea, D.T.; Harper, D.D.; Farag, A.M.; Brumbaugh, W.G.

2006-01-01

Portions of the Boulder River watershed contain elevated concentrations of arsenic, cadmium, copper, lead, and zinc in water, sediment, and biota. We measured concentrations of As, Cd, Cu, Pb, and Zn in biofilm and macroinvertebrates, and assessed macroinvertebrate assemblage and aquatic habitat with the objective of monitoring planned remediation efforts. Concentrations of metals were generally higher in downstream sites compared with upstream or reference sites, and two sites contained metal concentrations in macroinvertebrates greater than values reported to reduce health and survival of resident trout. Macroinvertebrate assemblage was correlated with metal concentrations in biofilm and macroinvertebrates. However, macroinvertebrate metrics were significantly correlated with a greater number of biofilm metals (8) than metals in invertebrates (4). Lead concentrations in biofilm appeared to have the most significant impact on macroinvertebrate assemblage. Metal concentrations in macroinvertebrates were directly proportional to concentrations in biofilm, indicating biofilm as a potential surrogate for monitoring metal impacts in aquatic systems. ?? Springer Science+Business Media, Inc. 2006.

Sediment transport and water-quality characteristics and loads, White River, northwestern Colorado, water years 1975-88

USGS Publications Warehouse

Tobin, R.L.

1993-01-01

Streamflow, sediment, and water-quality data are summarized for 6 sites on the White River, Colorado for water years 1975-88. Correlation techniques were used to estimate annual data for unmeasured years. Annual stream discharge in the main stem of the White River ranged from about 200,000 to about 1 million acre-feet. Generally, bedload was less than/= 3.3 percent of total sediment load. Annual suspended-sediment loads ranged from about 2,100 tons at the upstream sites on the North Fork and South Fork of the White River to about 2 million tons at the most downstream site. Average annual suspended-sediment loads ranged from about 11,000 tons at the upstream sites to about 705,000 tons at the most downstream site. Annual capacity losses in a 50,000 acre-ft reservoir could range from less than 0.01 percent near upstream sites to about 2.5 percent near downstream sites. Maximum water temperatures in the White River ranged from less than 20 to 25 C in summer. Specific conductance ranged from 200 to 1,000 microsiemens/cm. Generally, values of pH ranged from 7.6 to 8.8, and concentrations of dissolved oxygen were greater than 6.0 mg/L. In small streamflows, values of pH and dissolved oxygen were affected by biologic processes. Composition of dissolved solids in the White River was mostly calcium, bicarbonate, and(or) sulfate. Changes in the composition of dissolved solids caused by the changes in the concentrations of sodium and sulfate were greatest in small stream discharges. Annual loads of dissolved solids ranged from 21,100 tons in the South Fork to about 480,000 tons at the most downstream site. Total solids transport in the White River was mostly as dissolved solids at upstream sites and mostly as suspended sediment at downstream sites. Concentration ranges of nutrients and trace constituents were determined.

Investigation of water quality and aquatic-community structure in Village and Valley Creeks, City of Birmingham, Jefferson County, Alabama, 2000-01

USGS Publications Warehouse

McPherson, Ann K.; Abrahamsen, Thomas A.; Journey, Celeste A.

2002-01-01

The U.S. Geological Survey conducted a 16-month investigation of water quality, aquatic-community structure, bed sediment, and fish tissue in Village and Valley Creeks, two urban streams that drain areas of highly intensive residential, commercial, and industrial land use in Birmingham, Alabama. Water-quality data were collected between February 2000 and March 2001 at four sites on Village Creek, three sites on Valley Creek, and at two reference sites near Birmingham?Fivemile Creek and Little Cahaba River, both of which drain less-urbanized areas. Stream samples were analyzed for major ions, nutrients, fecal bacteria, trace and major elements, pesticides, and selected organic constituents. Bed-sediment and fish-tissue samples were analyzed for trace and major elements, pesticides, polychlorinated biphenyls, and additional organic compounds. Aquatic-community structure was evaluated by conducting one survey of the fish community and in-stream habitat and two surveys of the benthic-invertebrate community. Bed-sediment and fish-tissue samples, benthic-invertebrates, and habitat data were collected between June 2000 and October 2000 at six of the nine water-quality sites; fish communities were evaluated in April and May 2001 at the six sites where habitat and benthic-invertebrate data were collected. The occurrence and distribution of chemical constituents in the water column and bed sediment provided an initial assessment of water quality in the streams. The structure of the aquatic communities, the physical condition of the fish, and the chemical analyses of fish tissue provided an indication of the cumulative effects of water quality on the aquatic biota. Water chemistry was similar at all sites, characterized by strong calcium-bicarbonate component and magnesium components. Median concentrations of total nitrogen and total phosphorus were highest at the headwaters of Valley Creek and lowest at the reference site on Fivemile Creek. In Village Creek, median concentrations of nitrite and ammonia increased in a downstream direction. In Valley Creek, median concentrations of nitrate, nitrite, ammonia, organic nitrogen, suspended phosphorus, and orthophosphate decreased in a downstream direction. Median concentrations of Escherichia coli and fecal coliform bacteria were highest at the most upstream site of Valley Creek and lowest at the reference site on Fivemile Creek. Concentrations of enterococci exceeded the U.S. Environmental Protection Agency criterion in 80 percent of the samples; concentrations of Escherichia coli exceeded the criterion in 56 percent of the samples. Concentrations of bacteria at the downstream sites on Village and Valley Creeks were elevated during high flow rather than low flow, indicating the presence of nonpoint sources. Surface-water samples were analyzed for chemical compounds that are commonly found in wastewater and urban runoff. The median number of wastewater indicators was highest at the most upstream site on Valley Creek and lowest at the reference site on Fivemile Creek. Concentrations of total recoverable cadmium, copper, lead, and zinc in surface water exceeded acute and chronic aquatic life criteria in up to 24 percent of the samples that were analyzed for trace and major elements. High concentrations of trace and major elements in the water column were detected most frequently during high flow, indicating the presence of nonpoint sources. Of the 24 pesticides detected in surface water, 17 were herbicides and 7 were insecticides. Atrazine, simazine, and prometon were the most commonly detected herbicides; diazinon, chlorpyrifos, and carbaryl were the most commonly detected insecticides. Concentrations of atrazine, carbaryl, chlorpyrifos, diazinon, and malathion periodically exceeded criteria for the protection of aquatic life. Trace-element priority pollutants, pesticides, and other organic compounds were detected in higher concentrations in bed sediment at the Village and Valley Creek sites t

Occurrence and concentrations of selected trace elements and halogenated organic compounds in stream sediments and potential sources of polychlorinated biphenyls, Leon Creek, San Antonio, Texas, 2012–14

USGS Publications Warehouse

Wilson, Jennifer T.

2016-06-23

Sediment samples collected from Leon Creek by the USGS during 2007–9 and 2012–14 at a total of eight sites following identical field and laboratory methods were evaluated to determine if potential PCB sources could be identified. Total PCB concentrations in the sediment samples collected upstream from the Joint Base site were low or nondetections; while concentrations in the samples collected on and downstream from the Joint Base site were greater. Congeners 180 and 138 constituted the greatest proportion of the PCB mixture in samples collected upstream from, on, and downstream from the Joint Base site. Upstream from the Joint Base site, congeners 180 and 138 constituted 50 percent and 35 percent respectively of the PCBs congeners found in the samples. On and downstream from the Joint Base site, congeners 180 and 138 constituted 80 percent and 13 percent respectively of the PCBs congeners found in the samples. Chi-square (C2) tests also indicate that samples collected from the Loop 410 site were statistically different from samples collected from the Joint Base site and sites downstream. The PCB congener pattern in the Leon Creek samples is most like the congener mixture in Aroclor 1260, which is chemically similar to the PCBs detected in the fish samples that resulted in the 2003 fish consumption advisory.

Predicting thermal reference conditions for USA streams and rivers

USGS Publications Warehouse

Hill, Ryan A.; Hawkins, Charles P.; Carlisle, Daren M.

2013-01-01

Temperature is a primary driver of the structure and function of stream ecosystems. However, the lack of stream temperature (ST) data for the vast majority of streams and rivers severely compromises our ability to describe patterns of thermal variation among streams, test hypotheses regarding the effects of temperature on macroecological patterns, and assess the effects of altered STs on ecological resources. Our goal was to develop empirical models that could: 1) quantify the effects of stream and watershed alteration (SWA) on STs, and 2) accurately and precisely predict natural (i.e., reference condition) STs in conterminous USA streams and rivers. We modeled 3 ecologically important elements of the thermal regime: mean summer, mean winter, and mean annual ST. To build reference-condition models (RCMs), we used daily mean ST data obtained from several thousand US Geological Survey temperature sites distributed across the conterminous USA and iteratively modeled ST with Random Forests to identify sites in reference condition. We first created a set of dirty models (DMs) that related STs to both natural factors (e.g., climate, watershed area, topography) and measures of SWA, i.e., reservoirs, urbanization, and agriculture. The 3 models performed well (r2 = 0.84–0.94, residual mean square error [RMSE] = 1.2–2.0°C). For each DM, we used partial dependence plots to identify SWA thresholds below which response in ST was minimal. We then used data from only the sites with upstream SWA below these thresholds to build RCMs with only natural factors as predictors (r2 = 0.87–0.95, RMSE = 1.1–1.9°C). Use of only reference-quality sites caused RCMs to suffer modest loss of predictor space and spatial coverage, but this loss was associated with parts of ST response curves that were flat and, therefore, not responsive to further variation in predictor space. We then compared predictions made with the RCMs to predictions made with the DMs with SWA set to 0. For most DMs, setting SWAs to 0 resulted in biased estimates of thermal reference condition.

Water quality in the Little Sac River basin near Springfield, Missouri, 1999-2001

USGS Publications Warehouse

Smith, Brenda J.

2002-01-01

The Little Sac River, north of Springfield, Missouri, flows through mainly agricultural and forest land. However, the quality of the river water is a concern because the river flows into Stockton Lake, which is a supplemental drinking water source for Springfield. Large bacterial densities and nutrient concentrations are primary concerns to the water quality of the river.A 29-river mile reach of the Little Sac River is on the 1998 list of waters of Missouri designated under section 303(d) of the Federal Clean Water Act because of fecal coliform densities larger than the Missouri Department of Natural Resources standard (hereinafter referred to as Missouri standard) of 200 colonies per 100 milliliters for whole-body contact recreation. During an investigation of the water quality in the Little Sac River by the U.S. Geological Survey, in cooperation with the Watershed Committee of the Ozarks, fecal coliform bacteria densities exceeded the Missouri standard (the standard applies from April 1 through October 31) in one sample from a site near Walnut Grove. At other sites on the Little Sac River, the Missouri standard was exceeded in two samples and equalled in one sample upstream from the Northwest Wastewater Treatment Plant (NW WTP) and in one sample immediately downstream from the NW WTP.Effluent from the NW WTP flows into the Little Sac River. Annually from April 1 through October 31, the effluent is disinfected to meet the Missouri standard for whole-body contact recreation. Fecal coliform bacteria densities in samples collected during this period generally were less than 100 colonies per 100 milliliters. For the rest of the year when the effluent was not disinfected, the bacteria densities in samples ranged from 50 (sample collected on November 1, 2000) to 10,100 colonies per 100 milliliters (both counts were non-ideal). When the effluent was disinfected and the fecal coliform bacteria density was small, samples from sites upstream and downstream from the NW WTP had a bacteria density larger than the density in the effluent. Other sources of bacteria are likely to be present in the study area in addition to the NW WTP. These potential sources include effluent from domestic septic systems and animal wastes.Nutrient concentrations in the Little Sac River immediately downstream from the NW WTP were affected by effluent from the NW WTP and possibly other sources. At two sites upstream from the NW WTP, median nitrite plus nitrate concentrations were 1.1 and 1.4 milligrams per liter. The median nitrite plus nitrate concentration for the effluent from the NW WTP was 6.4 milligrams per liter, and the median concentration decreased downstream in the Little Sac River to 2.2, 1.2, and 0.56 milligrams per liter.The effects of the effluent from the NW WTP on the water quality of the Little Sac River downstream from the NW WTP were reflected in an increase in discharge (effluent from the NW WTP can be as much as 50 percent of the flow at the site about 1.5 river miles downstream from the NW WTP), an increase in specific conductance values, an increase in several inorganic constituent concentrations, including calcium, magnesium, and sulfate, and a large increase in sodium and chloride concentrations. The effluent from the NW WTP seemed to have no effect on the pH value, temperature, and dissolved oxygen concentrations in the Little Sac River.Results of repetitive element polymerase chain reaction (rep-PCR) pattern analysis indicated that most Escherichia coli (E. coli) bacteria in water samples probably were from nonhuman sources, such as horses and cattle. The rep-PCR pattern analysis indicated that horses were an important source of E. coli downstream from the NW WTP, which was consistent with horses pastured adjacent to the sampling site. Fecal coliform bacteria loads increased upstream from the NW WTP from the most upstream site to the site immediately upstream from the NW WTP. Loads in the effluent from the NW WTP and also tho

Assessing the status of sediment toxicity and macroinvertebrate communities in the Eighteenmile Creek Area of Concern, New York

USGS Publications Warehouse

George, Scott D.; Duffy, Brian T.; Baldigo, Barry P.

2017-01-01

In 1972, the governments of Canada and the United States committed to restoring the physical, chemical, and biological integrity of the Laurentian Great Lakes under the Great Lakes Water Quality Agreement. Through this framework, the downstream-most section of Eighteenmile Creek, a tributary to the south shore of Lake Ontario in New York, was designated as an Area of Concern (AOC) because water quality and bed sediments were contaminated by past industrial and municipal discharges, waste disposal, and pesticide usage. Five beneficial use impairments (BUIs) have been identified in the AOC including the degradation of the “benthos”, or the benthic macroinvertebrate community. This investigation used sediment toxicity testing and macroinvertebrate community assessments to determine if the toxicity of bed sediments in the AOC differed from that of an unimpacted reference stream. Results from 10-day toxicity tests indicated that survival and growth of the dipteran Chironomus dilutus and the amphipod Hyalella azteca did not differ significantly between sediments from the AOC and reference area. Analyses of benthic macroinvertebrate community integrity and structure also indicated that macroinvertebrate communities, while impacted across most sites on both streams, were generally similar between the AOC and reference area. Despite these findings, the upstream-most AOC site consistently scored poorly in all analyses, which suggests that localized sediment toxicity may exist in the AOC, even if large scale differences between the AOC and a comparable reference stream are minimal.

Field deployment of a scope for growth assay involving Gammarus pulex, a freshwater benthic invertebrate.

PubMed

Maltby, L; Naylor, C; Calow, P

1990-06-01

Scope for growth (SfG) is a measure of the energy balance of an animal (i.e., the difference between energy intake and metabolic output). The SfG of marine invertebrates, particularly the mussel Mytilus edulis, has been successfully used as the basis of a field bioassay to detect a range of stresses both natural (temperature, food, salinity) and anthropogenic (hydrocarbons, sewage sludge). SfG of the freshwater amphipod Gammarus pulex was found to be a sensitive indicator of stress under laboratory conditions and here we describe the field deployment of this technique and present data from three field trials. In every case, SfG was reduced at the downstream polluted site compared with that at an upstream reference site. This reduction in SfG was the result of a decrease in energy intake (absorption) rather than an increase in energy expenditure (respiration).

Environmental fate of mercury discharged into the upper Wisconsin River

USGS Publications Warehouse

Rada, R.G.; Findley, J.E.; Wiener, J.G.

1986-01-01

The authors studied the distribution of Hg in sediments, fish, and crayfish in a 60 km reach of the Upper Wisconsin River that formerly received Hg in discharges from pulp and paper mills. The most heavily contaminated strata of sediments were deposited during the 1950s and early 1960s and buried under subsequent deposits; however, surficial sediments remained substantially enriched at certain sites in 1981. Median concentrations of Hg in surficial sediments, adjusted for grain size, were at least 10-fold greater at the main study area than at an upstream reference site. Total concentrations exceeded 1.0 mu g g super(-1) wet weight in axial muscle tissue in only 2 of 173 fish analyzed from the study area; however, historical comparisons revealed that Hg contamination of fish (common carp Cyprinus carpio and walleye Stizostedion vitreum vitreum ) and crayfish (Orconectes ) in the river had not decreased since the early 1970s.

Occurrence and degree of intersex (testis-ova) in darters (Etheostoma SPP.) across an urban gradient in the Grand River, Ontario, Canada.

PubMed

Tanna, Rajiv N; Tetreault, Gerald R; Bennett, Charles J; Smith, Brendan M; Bragg, Leslie M; Oakes, Ken D; McMaster, Mark E; Servos, Mark R

2013-09-01

The variability and extent of the intersex condition (oocytes in testes, or testis-ova) was documented in fish along an urban gradient in the Grand River, Ontario, Canada, that included major wastewater treatment plant outfalls. A method for rapid enumeration of testis-ova was developed and applied that increased the capacity to quantify intersex prevalence and severity. Male rainbow darters (Etheostoma caeruleum) sampled downstream of the first major wastewater outfall (Waterloo) had a significant increase, relative to 4 upstream reference sites, in the mean proportion of fish with at least 1 testis-oocyte per lobe of testes (9-20% proportion with ≤ 1 testis-oocyte/lobe vs 32-53% and >1.4 testis-oocyte/lobe). A much higher mean incidence of intersex proportion and degree was observed immediately downstream of the second wastewater outfall (Kitchener; 73-100% and 8-70 testis-oocyte/lobe); but only 6.3 km downstream of the Kitchener outfall, the occurrence of intersex dropped to those of the reference sites. In contrast, downstream of a tertiary treated wastewater outfall on a small tributary, intersex was similar to reference sites. Estrogenicity, measured using a yeast estrogen screen, followed a similar pattern, increasing from 0.81 ± 0.02 ng/L 17b-estradiol equivalents (EEq) (Guelph), to 4.32 ± 0.07 ng/L (Waterloo), and 16.99 ± 0.40 ng/L (Kitchener). Female rainbow darter downstream of the Kitchener outfall showed significant decreases in gonadosomatic index and liver somatic index, and increases in condition factor (k) relative to corresponding reference sites. The prevalence of intersex and alterations in somatic indices suggest that exposure to municipal wastewater effluent discharges can impact endocrine function, energy use, and energy storage in wild fish. Copyright © 2013 SETAC.

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Estimating bioaccessibility of trace elements in particles suspended in the Athabasca River using sequential extraction.

PubMed

Javed, Muhammad Babar; Shotyk, William

2018-05-10

Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.

Relationships of field habitat measurements, visual habitat indices, and land cover to benthic macroinvertebrates in urbanized streams of the Santa Clara Valley, California

USGS Publications Warehouse

Fend, S.V.; Carter, J.L.; Kearns, F.R.

2005-01-01

We evaluated several approaches for measuring natural and anthropogenic habitat characteristics to predict benthic macroinvertebrate assemblages over a range of urban intensity at 85 stream sites in the Santa Clara Valley, California. Land cover was summarized as percentage urban land cover and impervious area within upstream buffers and the upstream subwatersheds. Field measurements characterized water chemistry, channel slope, sediment, and riparian canopy. In . addition to applying the visual-based habitat assessment in U.S. Environmental Protection Agency's rapid bioassessment protocol, we developed a simplified urban habitat assessment index based on turbidity, fine sediment deposition, riparian condition, and channel modification. Natural and anthropogenic habitat variables covaried along longitudinal stream gradients and were highly correlated with elevation. At the scale of the entire watershed, benthic macroinvertebrate measures were equally correlated with variables expressing natural gradients and urbanization effects. When natural gradients were reduced by partitioning sites into ecoregion subsection groupings, habitat variables most highly correlated with macroinvertebrate measures differed between upland and valley floor site groups. Among the valley floor sites, channel slope and physical modification of channel and riparian habitats appeared more important than upstream land cover or water quality in determining macroinvertebrate richness and ordination scores. Among upland sites, effects of upstream reservoir releases on habitat quality appeared important. Rapid habitat evaluation methods appeared to be an effective method for describing habitat features important to benthic macroinvertebrates when adapted for the region and the disturbance of interest. ?? 2005 by the American Fisheries Society.

Mercury accumulation in biota of Thunder Creek, Saskatchewan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Munro, D.J.; Gummer, W.D.

Collection of biological organisms was undertaken to investigate the bioaccumulation of mercury in the food chain, the results of which are reported. Two sites were selected on Thunder Creek; the control or background site, site number 2, is located approximately 2.5 km upstream, from site number 1. The selection of organisms for analysis was based on the presence and abundance of each at both locations. Only crayfish (Orconcetes virilis) pearl dace (Semotilus margarita) and brook stickleback (Culaea inconstans) were found to be sufficiently abundant. The importance of the data obtained is the significant difference in concentration between the upstream andmore » downstream sites on Thunder Creek. This difference shows that more mercury is available to the biological community at site number 1 than at site number 2 confirming that mercury in the contaminated sediments is being methylated and taken up into the food chain.« less

A Reconnaissance of selected organic compounds in streams in tribal lands in Central Oklahoma, January-February 2009

USGS Publications Warehouse

Becker, Carol J.

2010-01-01

The U.S. Geological Survey worked in cooperation with the U.S. Environmental Protection Agency and the Kickapoo Tribe of Oklahoma on two separate reconnaissance projects carried out concurrently. Both projects entailed the use of passive samplers as a sampling methodology to investigate the detection of selected organic compounds at stream sites in jurisdictional areas of several tribes in central Oklahoma during January-February 2009. The focus of the project with the U.S. Environmental Protection Agency was the detection of pesticides and pesticide metabolites using Semipermeable Membrane Devices at five stream sites in jurisdictional areas of several tribes. The project with the Kickapoo Tribe of Oklahoma focused on the detection of pesticides, pesticide metabolites, polycyclic aromatic hydrocarbons, polychlorinated biphenyl compounds, and synthetic organic compounds using Semipermeable Membrane Devices and Polar Organic Chemical Integrative Samplers at two stream sites adjacent to the Kickapoo tribal lands. The seven stream sites were located in central Oklahoma on the Cimarron River, Little River, North Canadian River, Deep Fork, and Washita River. Extracts from SPMDs submerged at five stream sites, in cooperation with the U.S. Environmental Protection Agency, were analyzed for 46 pesticides and 6 pesticide metabolites. Dacthal, a pre-emergent herbicide, was detected at all five sites. Pendimethalin, also a pre-emergent, was detected at one site. The insecticides chlorpyrifos and dieldrin were detected at three sites and p,p'-DDE, a metabolite of the insecticide DDT, also was detected at three sites. SPMDs and POCIS were submerged at the upstream edge and downstream edge of the Kickapoo tribal boundaries. Both sites are downstream from the Oklahoma City metropolitan area and multiple municipal wastewater treatment plants. Extracts from the passive samplers were analyzed for 62 pesticides, 10 pesticide metabolites, 3 polychlorinated biphenyl compounds, 35 polycyclic aromatic hydrocarbons, and 49 synthetic organic compounds. Ten pesticides and four pesticide metabolites were detected at the upstream site and seven pesticides and four pesticide metabolites were detected at the downstream site. Pesticides detected at both sites were atrazine, chlorpyrifos, dacthal, dieldrin, metolachlor, pendimethalin, and trans-nonachlor. Additionally at the upstream site, heptachlor, pentachlorophenol, and prometon were detected. The pesticide metabolites p,p'-DDE, cis-chlordane, and trans-chlordane also were detected at both sites. Polychlorinated biphenyl compounds aroclor-1016/1242, aroclor-1254, and aroclor-1260 were detected at both sites. The upstream site had 16 polycyclic aromatic hydrocarbon detections and the downstream site had 8 detections. Because of chromatographic interference during analysis, a positive identification of 17 polycyclic aromatic hydrocarbons could not be made. Consequently, there may have been a greater number of these compounds detected at both sites. A total of 36 synthetic organic compounds were detected at the two sites adjacent to the Kickapoo tribal lands. The upstream site had 21 synthetic organic compound detections: three detergent metabolites, two fecal indicators, three flame retardants, seven industrial compounds, five compounds related to personal care products, and beta-sitosterol, a plant sterol. Fifteen synthetic organic compounds were detected at the downstream site and included: one fecal indicator, three flame retardants, six industrial compounds, and five compounds related to personal care products.

Optimization Review, Black Butte Mine Superfund Site, Lane County, Oregon

EPA Pesticide Factsheets

The BBM Superfund Site (the site) is located in Lane County, Oregon, approximately 35 miles southeast of Eugene and approximately 10 miles upstream from the Cottage Grove Reservoir (CGR). Mercury mining and processing operations were active at the site...

Reservoirs override seasonal variability of phytoplankton communities in a regulated Mediterranean river.

PubMed

Tornés, E; Pérez, M C; Durán, C; Sabater, S

2014-03-15

Water hydrology, temperature and transparency, as well as nutrient retention downstream of the reservoirs alter the temporal and spatial distribution patterns of phytoplankton communities in regulated rivers. The seasonal dynamics of phytoplankton communities in the Ebro was analysed in contrasting water flow periods in sections upstream and downstream of three large reservoirs, as well as in an intermediate site. Phytoplankton communities changed in response to seasonal variations in the areas not influenced by the reservoirs, but the phytoplankton distribution downstream of the reservoirs was driven by their particular hydrodynamics. The change in environmental conditions promoted by reservoirs influenced the pattern of replacement between diatoms and green algae of the upstream section. Differences in the phytoplankton community structure, abundance and environmental variables between upstream and downstream sites were maximal during low flow periods. Chlorophytes and dinoflagellates were present during low flow periods upstream of the reservoirs and in the intermediate site. Cocconeis cf. placentula characterized the downstream section, associated to the presence of macrophytes in that section. The present study sheds light on the consequences of river regulation under potential scenarios of climate change, and results could be used to anticipate ecological problems in large regulated rivers under these circumstances. Copyright © 2013 Elsevier B.V. All rights reserved.

Responses of riparian reptile communities to damming and urbanization

USGS Publications Warehouse

Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.

2013-01-01

Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.

Hydrological threats to riparian wetlands of international importance - a global quantitative and qualitative analysis

NASA Astrophysics Data System (ADS)

Schneider, Christof; Flörke, Martina; De Stefano, Lucia; Petersen-Perlman, Jacob D.

2017-06-01

Riparian wetlands have been disappearing at an accelerating rate. Their ecological integrity as well as their vital ecosystem services for humankind depend on regular patterns of inundation and drying provided by natural flow regimes. However, river hydrology has been altered worldwide. Dams cause less variable flow regimes and water abstractions decrease the amount of flow so that ecologically important flood pulses are often reduced. Given growing population pressure and projected climate change, immediate action is required. However, the implementation of counteractive measures is often a complex task. This study develops a screening tool for assessing hydrological threats to riparian wetlands on global scales. The approach is exemplified on 93 Ramsar sites, many of which are located in transboundary basins. First, the WaterGAP3 hydrological modeling framework is used to quantitatively compare current and future modified flow regimes to reference flow conditions. In our simulations current water resource management seriously impairs riparian wetland inundation at 29 % of the analyzed sites. A further 8 % experience significantly reduced flood pulses. In the future, eastern Europe, western Asia, as well as central South America could be hotspots of further flow modifications due to climate change. Second, a qualitative analysis of the 93 sites determined potential impact on overbank flows resulting from planned or proposed dam construction projects. They take place in one-third of the upstream areas and are likely to impair especially wetlands located in South America, Asia, and the Balkan Peninsula. Third, based on the existing legal/institutional framework and water resource availability upstream, further qualitative analysis evaluated the capacity to preserve overbank flows given future streamflow changes due to dam construction and climate change. Results indicate hotspots of vulnerability exist, especially in northern Africa and the Persian Gulf.

Iron budgets for three distinct biogeochemical sites around the Kerguelen Archipelago (Southern Ocean) during the natural fertilisation study, KEOPS-2

NASA Astrophysics Data System (ADS)

Bowie, A. R.; van der Merwe, P.; Quéroué, F.; Trull, T.; Fourquez, M.; Planchon, F.; Sarthou, G.; Chever, F.; Townsend, A. T.; Obernosterer, I.; Sallée, J.-B.; Blain, S.

2015-07-01

Iron availability in the Southern Ocean controls phytoplankton growth, community composition and the uptake of atmospheric CO2 by the biological pump. The KEOPS-2 (KErguelen Ocean and Plateau compared Study 2) "process study", took place around the Kerguelen Plateau in the Indian sector of the Southern Ocean. This is a region naturally fertilised with iron on the scale of hundreds to thousands of square kilometres, producing a mosaic of spring blooms which show distinct biological and biogeochemical responses to fertilisation. This paper presents biogeochemical iron budgets (incorporating vertical and lateral supply, internal cycling, and sinks) for three contrasting sites: an upstream high-nutrient low-chlorophyll reference, over the plateau and in the offshore plume east of the Kerguelen Islands. These budgets show that distinct regional environments driven by complex circulation and transport pathways are responsible for differences in the mode and strength of iron supply, with vertical supply dominant on the plateau and lateral supply dominant in the plume. Iron supply from "new" sources (diffusion, upwelling, entrainment, lateral advection, atmospheric dust) to the surface waters of the plume was double that above the plateau and 20 times greater than at the reference site, whilst iron demand (measured by cellular uptake) in the plume was similar to that above the plateau but 40 times greater than at the reference site. "Recycled" iron supply by bacterial regeneration and zooplankton grazing was a relatively minor component at all sites (< 8 % of new supply), in contrast to earlier findings from other biogeochemical iron budgets in the Southern Ocean. Over the plateau, a particulate iron dissolution term of 2.5 % was invoked to balance the budget; this approximately doubled the standing stock of dissolved iron in the mixed layer. The exchange of iron between dissolved, biogenic particulate and lithogenic particulate pools was highly dynamic in time and space, resulting in a decoupling of the iron supply and carbon export and, importantly, controlling the efficiency of fertilisation.

Assessment of potential effects of water produced from coalbed natural gas development on macroinvertebrate and algal communities in the Powder River and Tongue River, Wyoming and Montana, 2010

USGS Publications Warehouse

Peterson, David A.; Hargett, Eric G.; Feldman, David L.

2011-01-01

Ongoing development of coalbed natural gas in the Powder River structural basin in Wyoming and Montana led to formation of an interagency aquatic task group to address concerns about the effects of the resulting production water on biological communities in streams of the area. Ecological assessments, made from 2005–08 under the direction of the task group, indicated biological condition of the macroinvertebrate and algal communities in the middle reaches of the Powder was lower than in the upper or lower reaches. On the basis of the 2005–08 results, sampling of the macroinvertebrate and algae communities was conducted at 18 sites on the mainstem Powder River and 6 sites on the mainstem Tongue River in 2010. Sampling-site locations were selected on a paired approach, with sites located upstream and downstream of discharge points and tributaries associated with coalbed natural gas development. Differences in biological condition among site pairs were evaluated graphically and statistically using multiple lines of evidence that included macroinvertebrate and algal community metrics (such as taxa richness, relative abundance, functional feeding groups, and tolerance) and output from observed/expected (O/E) macroinvertebrate models from Wyoming and Montana. Multiple lines of evidence indicated a decline in biological condition in the middle reaches of the Powder River, potentially indicating cumulative effects from coalbed natural gas discharges within one or more reaches between Flying E Creek and Wild Horse Creek in Wyoming. The maximum concentrations of alkalinity in the Powder River also occurred in the middle reaches. Biological condition in the upper and lower reaches of the Powder River was variable, with declines between some site pairs, such as upstream and downstream of Dry Fork and Willow Creek, and increases at others, such as upstream and downstream of Beaver Creek. Biological condition at site pairs on the Tongue River showed an increase in one case, near the Wyoming-Montana border, and a decrease in another case, upstream of Tongue River Reservoir. Few significant differences were noted from upstream to downstream of Prairie Dog Creek, a major tributary to the Tongue River. Further study would be needed to confirm the observed patterns and choose areas to examine in greater detail.

Optimal frequency-response sensitivity of compressible flow over roughness elements

NASA Astrophysics Data System (ADS)

Fosas de Pando, Miguel; Schmid, Peter J.

2017-04-01

Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Contaminants in ospreys from the Pacific Northwest: I. Trends and Patterns in polychlorinated dibenzo-p-dioxins and -dibenzofurans in eggs and plasma

USGS Publications Warehouse

Elliott, J.E.; Machmer, M.M.; Henny, Charles J.; Wilson, L.K.; Norstrom, R.J.

1998-01-01

Osprey (Pandion haliaetus) eggs were collected from 1991 to 1997 at nests (na??=a??121) upstream and downstream of bleached kraft pulp mills and at reference sites in the Fraser and Columbia River drainage systems of British Columbia, Washington, and Oregon. Blood samples were collected from nestling ospreys during the 1992 breeding season on the Thompson River. Samples were analyzed for polychlorinated dibenzo-p-dioxins (PCDDs) and -dibenzofurans (PCDFs). Mean concentrations of 2,3,7,8-TCDD were significantly higher in eggs collected in 1991 at downstream compared to upstream nests near pulp mills at Kamloops and Castlegar, British Columbia. There were no significant temporal trends in 2,3,7,8-TCDD, -TCDF or other measured compounds at a sample of nests monitored between 1991 and 1994 downstream of the Castlegar pulp mill, despite changes in bleaching technology (CIO2 substitution). However, by 1997 concentrations of 2,3,7,8-TCDD and -TCDF were significantly lower than previous years in nests sampled downstream at both Castlegar and Kamloops. An unusual pattern of higher chlorinated PCDDs and PCDFs was found in many of the osprey eggs collected in this study, and considerable individual variation in the pattern existed among eggs from the same site. For example, eggs from four different nests at one study area (Quesnel) on the Fraser River had concentrations of 1,2,3,4,6,7,8-HpCDD ranging from <1 to 1,100 ng/kg and OCDD from <1 to 7,000 ng/kg wet weight. Higher mean concentrations of HpCDD and OCDD were found in eggs from the Thompson River, a tributary of the Fraser, compared to the Columbia River, and concentrations were generally higher at nests upstream of pulp mills. In plasma samples, 1,2,3,4,6,7,8-HpCDD and OCDD were the main compounds detected, with no significant differences measured between samples upstream versus downstream or earlier versus later in the breeding season. Use of chlorophenolic wood preservatives by lumber processors was considered the main source of higher chlorinated PCDD/Fs throughout the systems, based on patterns of trace PCDFs in eggs and significant correlations between egg concentrations of pentachlorophenol and both HpCDD (ra??=a??0.891, pa??

Contaminants in ospreys from the Pacific Northwest: I. Trends and patterns in polychlorinated dibenzo-p-dioxins and -dibenzofurans in eggs and plasma.

PubMed

Elliott, J E; Machmer, M M; Henny, C J; Wilson, L K; Norstrom, R J

1998-11-01

Osprey (Pandion haliaetus) eggs were collected from 1991 to 1997 at nests (n = 121) upstream and downstream of bleached kraft pulp mills and at reference sites in the Fraser and Columbia River drainage systems of British Columbia, Washington, and Oregon. Blood samples were collected from nestling ospreys during the 1992 breeding season on the Thompson River. Samples were analyzed for polychlorinated dibenzo-p-dioxins (PCDDs) and -dibenzofurans (PCDFs). Mean concentrations of 2,3,7,8-TCDD were significantly higher in eggs collected in 1991 at downstream compared to upstream nests near pulp mills at Kamloops and Castlegar, British Columbia. There were no significant temporal trends in 2,3,7,8-TCDD, -TCDF or other measured compounds at a sample of nests monitored between 1991 and 1994 downstream of the Castlegar pulp mill, despite changes in bleaching technology (CIO2 substitution). However, by 1997 concentrations of 2, 3,7,8-TCDD and -TCDF were significantly lower than previous years in nests sampled downstream at both Castlegar and Kamloops. An unusual pattern of higher chlorinated PCDDs and PCDFs was found in many of the osprey eggs collected in this study, and considerable individual variation in the pattern existed among eggs from the same site. For example, eggs from four different nests at one study area (Quesnel) on the Fraser River had concentrations of 1,2,3,4,6,7,8-HpCDD ranging from <1 to 1,100 ng/kg and OCDD from <1 to 7,000 ng/kg wet weight. Higher mean concentrations of HpCDD and OCDD were found in eggs from the Thompson River, a tributary of the Fraser, compared to the Columbia River, and concentrations were generally higher at nests upstream of pulp mills. In plasma samples, 1,2,3,4,6,7,8-HpCDD and OCDD were the main compounds detected, with no significant differences measured between samples upstream versus downstream or earlier versus later in the breeding season. Use of chlorophenolic wood preservatives by lumber processors was considered the main source of higher chlorinated PCDD/Fs throughout the systems, based on patterns of trace PCDFs in eggs and significant correlations between egg concentrations of pentachlorophenol and both HpCDD (r = 0.891, p < 0.01) and OCDD (r = 0.870, p < 0.01).

Eco-Design of River Fishways for Upstream Passage: Application for Hanfeng Dam, Pengxi River, China

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Gary E.; Rainey, William S.

2012-05-20

This paper provides a scientific approach to eco-design of river fishways to allow upstream movement of fish past new and existing dams in China. This eco-design approach integrates principles of fish ecology/behavior and engineering, a scientific field also known as bio-engineering or eco-hydraulics. We define a fishway as a structure or mechanism to convey fish upstream past a dam. Man-made or natural stream beds can be part of the fishway mechanism. Fish include bony and non-bony fishes, and upstream passage is the concern here, not downstream passage. The problem is dams block access to upstream habitat used for spawning, rearing,more » and refuge, i.e., dams decrease habitat connectivity. A solution to alleviate this problem is to design fishways, preferably while the dam is being designed, but if necessary, as retrofits afterward to provide a route that fish can and will use to pass safely upstream without undue delay. Our eco-design approach for fishways involves eight steps: 1) identify the primary species of importance; 2) understand basic ecology and behavior of these fish; 3) characterize the environmental conditions where passage is or will be blocked; 4 identify fishway alternatives and select a preferred alternative; 5) establish eco-design criteria for the fishway, either from management agencies or, if necessary, developed specifically for the given site; 6) where needed, identify and perform research required to resolve critical uncertainties and finalize the eco-design criteria; 7) apply the eco-design criteria and site-specific considerations to design the fishway, involving peer-review by local stakeholders in the process; 8) build the fishway, monitor its effectiveness, and apply the lessons learned. Example fishways are described showing a range of eco-designs depending on the dam site and fish species of concern. We apply the eco-design principles to recommend an approach and next steps for a fishway to pass fish upstream at Hanfeng Dam, an existing regulating dam forming Hanfeng Lake on the Pengxi River near Kaixian, China.« less

Characterization of the Kootenai River Algae Community and Primary Productivity Before and After Experimental Nutrient Addition, 2004–2007 [Chapter 2, Kootenai River Algal Community Characterization, 2009 KTOI REPORT].

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holderman, Charlie; Bonners Ferry, ID; Anders, Paul

2009-07-01

The Kootenai River ecosystem (spelled Kootenay in Canada) has experienced numerous ecological changes since the early 1900s. Some of the largest impacts to habitat, biological communities, and ecological function resulted from levee construction along the 120 km of river upstream from Kootenay Lake, completed by the 1950s, and the construction and operation of Libby Dam on the river near Libby Montana, completed in 1972. Levee construction isolated tens of thousands of hectares of historic functioning floodplain habitat from the river channel downstream in Idaho and British Columbia (B.C.) severely reducing natural biological productivity and habitat diversity crucial to large river-floodplainmore » ecosystem function. Libby Dam greatly reduces sediment and nutrient transport to downstream river reaches, and dam operations cause large changes in the timing, duration, and magnitude of river flows. These and other changes have contributed to the ecological collapse of the post-development Kootenai River ecosystem and its native biological communities. In response to large scale loss of nutrients, experimental nutrient addition was initiated in the North Arm of Kootenay Lake in 1992, in the South Arm of Kootenay Lake in 2004, and in the Kootenai River at the Idaho-Montana border during 2005. This report characterizes baseline chlorophyll concentration and accrual (primary productivity) rates and diatom and algal community composition and ecological metrics in the Kootenai River for four years, one (2004) before, and three (2005 through 2007) after nutrient addition. The study area encompassed a 325 km river reach from the upper Kootenay River at Wardner, B.C. (river kilometer (rkm) 445) downstream through Montana and Idaho to Kootenay Lake in B.C. (rkm 120). Sampling reaches included an unimpounded reach furthest upstream and four reaches downstream from Libby Dam affected by impoundment: two in the canyon reach (one with and one without nutrient addition), a braided reach, and a meandering reach. The study design included 14 sampling sites: an upstream, unimpounded reference site (KR-14), four control (non-fertilized) canyon sites downstream from Libby Dam, but upstream from nutrient addition (KR-10 through KR-13), two treatment sites referred to collectively as the nutrient addition zone (KR-9 and KR-9.1, located at and 5 km downstream from the nutrient addition site), two braided reach sites (KR-6 and KR-7), and four meander reach sites (KR-1 through KR-4). A series of qualitative evaluations and quantitative analyses were used to assess baseline conditions and effects of experimental nutrient addition treatments on chlorophyll, primary productivity, and taxonomic composition and metric arrays for the diatom and green algae communities. Insufficient density in the samples precluded analyses of bluegreen algae taxa and metrics for pre- and post-nutrient addition periods. Chlorophyll a concentration (mg/m{sup 2}), chlorophyll accrual rate (mg/m{sup 2}/30d), total chlorophyll concentration (chlorophyll a and b) (mg/m{sup 2}), and total chlorophyll accrual rate (mg/m{sup 2}/30d) were calculated. Algal taxa were identified and grouped by taxonomic order as Cyanophyta (blue-greens), Chlorophyta (greens), Bacillariophyta (diatoms), Chrysophyta (goldens), and dominant species from each sample site were identified. Algal densities (number/ml) in periphyton samples were calculated for each sample site and sampling date. Principal Component Analysis (PCA) was performed to reduce the dimension of diatom and algae data and to determine which taxonomic groups and metrics were contributing significantly to the observed variation. PCA analyses were tabulated to indicate eigenvalues, proportion, and cumulative percent variation, as well as eigenvectors (loadings) for each of the components. Biplot graphic displays of PCA axes were also generated to characterize the pattern and structure of the underlying variation. Taxonomic data and a series of biological and ecological metrics were used with PCA for diatoms and algae. Algal metrics included a suite of abundance, diversity, richness, dominance, and other measures, whereas additional trophic status and chemical limnology metrics, Van Dam indices and morphological groupings were employed in diatom PCAs. Analysis of Variance (ANOVA) was carried out using chlorophyll metrics and taxa and metric arrays for the diatom and green algae community data for comparing site differences from 2004 through 2007. Clear, statistically significant, biological responses from chlorophyll metrics, and taxa and metrics of the diatom and algal communities were revealed following experimental nutrient addition in the Kootenai River. Chlorophyll metric responses were more often significant and generally greater in magnitude than diatom and green algae taxa and metric responses.« less

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

Least Disturbed Condition for European Mediterranean rivers.

PubMed

Feio, M J; Aguiar, F C; Almeida, S F P; Ferreira, J; Ferreira, M T; Elias, C; Serra, S R Q; Buffagni, A; Cambra, J; Chauvin, C; Delmas, F; Dörflinger, G; Erba, S; Flor, N; Ferréol, M; Germ, M; Mancini, L; Manolaki, P; Marcheggiani, S; Minciardi, M R; Munné, A; Papastergiadou, E; Prat, N; Puccinelli, C; Rosebery, J; Sabater, S; Ciadamidaro, S; Tornés, E; Tziortzis, I; Urbanič, G; Vieira, C

2014-04-01

The present report describes a three-step approach that was used to characterize and define thresholds for the Least Disturbed Condition in Mediterranean streams of four different types, regarding organic pollution and nutrients, hydrological and morphological alterations, and land use. For this purpose, a common database composed of national reference sites (929 records) from seven countries, sampled for invertebrates, diatoms and macrophytes was used. The analyses of reference sites showed that small (catchment <100 km(2)) siliceous and non-siliceous streams were mainly affected by channelization, bank alteration and hydropeaking. Medium-sized siliceous rivers were the most affected by stressors: 25-43% of the samples showed at least slight alterations regarding channelization, connectivity, upstream dam influence, hydropeaking and degradation of riparian vegetation. Temporary streams were the least affected by hydromorphological changes, but they were nevertheless affected by alterations in riparian vegetation. There were no major differences between all permanent stream types regarding water quality, but temporary streams showed lower values for oxygenation (DO) and wider ranges for other variables, such as nitrates. A lower threshold value for DO (60%) was determined for this stream type and can be attributed to the streams' natural characteristics. For all other river types, common limits were found for the remaining variables (ammonium, nitrate, phosphate, total P, % of artificial areas, % of intensive and extensive agriculture, % of semi-natural areas in the catchment). These values were then used to select the list of reference sites. The biological communities were characterized, revealing the existence of nine groups of Mediterranean invertebrate communities, six for diatoms and five for macrophytes: each group was characterized by specific indicator taxa that highlighted the differences between groups. Copyright © 2013 Elsevier B.V. All rights reserved.

From Midges to Spiders: Mercury Biotransport in Riparian Zones Near the Buffalo River Area of Concern (AOC), USA.

PubMed

Pennuto, C M; Smith, M

2015-12-01

Riparian communities can receive environmental contaminants from adjacent aquatic 'donor' habitats. We investigated mercury biotransport from aquatic to terrestrial habitats via aquatic insect emergence and uptake by riparian spiders at sites within and upstream of the Buffalo River Area of Concern (AOC), a site with known sediment Hg contamination. Mercury concentration in emerging midges was roughly 10× less than contaminated sediment levels with the AOC, but biomagnification factors from midges to spiders ranged from 2.0 to 2.65 between sites. There was a significantly negative body mass:total mercury relationship in spiders (p < 0.001), indicating that mercury depuration is rapid or tissue dilution occurs in these riparian predators. Spiders contained significantly more mercury than their midge prey and spiders upstream of the AOC had higher mercury concentrations than spiders from within the AOC. Collectively, these data indicate that riparian spiders can be good mercury sentinels in urban environments, and that riparian communities upstream from the AOC may be at greater risk to mercury than has been previously considered.

Assessing potential effects of highway runoff on receiving-water quality at selected sites in Oregon with the Stochastic Empirical Loading and Dilution Model (SELDM)

USGS Publications Warehouse

Risley, John C.; Granato, Gregory E.

2014-01-01

6. An analysis of the use of grab sampling and nonstochastic upstream modeling methods was done to evaluate the potential effects on modeling outcomes. Additional analyses using surrogate water-quality datasets for the upstream basin and highway catchment were provided for six Oregon study sites to illustrate the risk-based information that SELDM will produce. These analyses show that the potential effects of highway runoff on receiving-water quality downstream of the outfall depends on the ratio of drainage areas (dilution), the quality of the receiving water upstream of the highway, and the concentration of the criteria of the constituent of interest. These analyses also show that the probability of exceeding a water-quality criterion may depend on the input statistics used, thus careful selection of representative values is important.

Responses of macroinvertebrate community metrics to a wastewater discharge in the Upper Blue River of Kansas and Missouri, USA

USGS Publications Warehouse

Poulton, Barry C.; Graham, Jennifer L.; Rasmussen, Teresa J.; Stone, Mandy L.

2015-01-01

The Blue River Main wastewater treatment facility (WWTF) discharges into the upper Blue River (725 km2), and is recently upgraded to implement biological nutrient removal. We measured biotic condition upstream and downstream of the discharge utilizing the macroinvertebrate protocol developed for Kansas streams. We examined responses of 34 metrics to determine the best indicators for discriminating site differences and for predicting biological condition. Significant differences between sites upstream and downstream of the discharge were identified for 15 metrics in April and 12 metrics in August. Upstream biotic condition scores were significantly greater than scores at both downstream sites in April (p = 0.02), and in August the most downstream site was classified as non-biologically supporting. Thirteen EPT taxa (Ephemeroptera, Plecoptera, Trichoptera) considered intolerant of degraded stream quality were absent at one or both downstream sites. Increases in tolerance metrics and filtering macroinvertebrates, and a decline in ratio of scrapers to filterers all indicated effects of increased nutrient enrichment. Stepwise regressions identified several significant models containing a suite of metrics with low redundancy (R2 = 0.90 - 0.99). Based on the rapid decline in biological condition downstream of the discharge, the level of nutrient removal resulting from the facility upgrade (10% - 20%) was not enough to mitigate negative effects on macroinvertebrate communities.

Antibiotic resistance of native and faecal bacteria isolated from rivers, reservoirs and sewage treatment facilities in Victoria, south-eastern Australia.

PubMed

Boon, P I; Cattanach, M

1999-03-01

The incidence of resistance to ampicillin, chloramphenicol, kanamycin, nalidixic acid, neomycin and streptomycin was significantly greater (P < 0.001) in native heterotrophic bacteria than in Escherichia coli isolated from a range of sites along the Yarra River in south-eastern Australia. There was no significant difference in the incidence of resistance between native and faecal bacteria to tetracycline. Both groups were almost totally resistant to penicillin. Multivariate analyses indicated little clear spatial pattern in the incidence of resistance in native bacteria from upstream vs downstream sites along the Yarra River. In contrast, E. coli isolated from upstream (rural) sites tended to have a lower incidence of resistance than isolates from downstream (urban) sites. These findings have implications for the use of antibiotic resistance as a bacteriological water quality parameter.

Estimation of constituent concentrations, densities, loads, and yields in lower Kansas River, northeast Kansas, using regression models and continuous water-quality monitoring, January 2000 through December 2003

USGS Publications Warehouse

Rasmussen, Teresa J.; Ziegler, Andrew C.; Rasmussen, Patrick P.

2005-01-01

The lower Kansas River is an important source of drinking water for hundreds of thousands of people in northeast Kansas. Constituents of concern identified by the Kansas Department of Health and Environment (KDHE) for streams in the lower Kansas River Basin include sulfate, chloride, nutrients, atrazine, bacteria, and sediment. Real-time continuous water-quality monitors were operated at three locations along the lower Kansas River from July 1999 through September 2004 to provide in-stream measurements of specific conductance, pH, water temperature, turbidity, and dissolved oxygen and to estimate concentrations for constituents of concern. Estimates of concentration and densities were combined with streamflow to calculate constituent loads and yields from January 2000 through December 2003. The Wamego monitoring site is located 44 river miles upstream from the Topeka monitoring site, which is 65 river miles upstream from the DeSoto monitoring site, which is 18 river miles upstream from where the Kansas River flows into the Missouri River. Land use in the Kansas River Basin is dominated by grassland and cropland, and streamflow is affected substantially by reservoirs. Water quality at the three monitoring sites varied with hydrologic conditions, season, and proximity to constituent sources. Nutrient and sediment concentrations and bacteria densities were substantially larger during periods of increased streamflow, indicating important contributions from nonpoint sources in the drainage basin. During the study period, pH remained well above the KDHE lower criterion of 6.5 standard units at all sites in all years, but exceeded the upper criterion of 8.5 standard units annually between 2 percent of the time (Wamego in 2001) and 65 percent of the time (DeSoto in 2003). The dissolved oxygen concentration was less than the minimum aquatic-life-support criterion of 5.0 milligrams per liter less than 1 percent of the time at all sites. Dissolved solids, a measure of the dissolved material in water, exceeded 500 milligrams per liter about one-half of the time at the three Kansas River sites. Larger dissolved-solids concentrations upstream likely were a result of water inflow from the highly mineralized Smoky Hill River that is diluted by tributary flow as it moves downstream. Concentrations of total nitrogen and total phosphorus at the three monitoring sites exceeded the ecoregion water-quality criteria suggested by the U.S. Environmental Protection Agency during the entire study period. Median nitrogen and phosphorus concentrations were similar at all three sites, and nutrient load increased moving from the upstream to downstream sites. Total nitrogen and total phosphorus yields were nearly the same from site to site indicating that nutrient sources were evenly distributed throughout the lower Kansas River Basin. About 11 percent of the total nitrogen load and 12 percent of the total phosphorus load at DeSoto during 2000-03 originated from wastewater-treatment facilities. Escherichia coli bacteria densities were largest at the middle site, Topeka. On average, 83 percent of the annual bacteria load at DeSoto during 2000-03 occurred during 10 percent of the time, primarily in conjunction with runoff. The average annual sediment loads at the middle and downstream monitoring sites (Topeka and DeSoto) were nearly double those at the upstream site (Wamego). The average annual sediment yield was largest at Topeka. On average, 64 percent of the annual suspended-sediment load at DeSoto during 2000-03 occurred during 10 percent of the time. Trapping of sediment by reservoirs located on contributing tributaries decreases transport of sediment and sediment-related constituents. The average annual suspended-sediment load in the Kansas River at DeSoto during 2000-03 was estimated at 1.66 million tons. An estimated 13 percent of this load consisted of sand-size particles, so approximately 216,000 tons of sand were transported

Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

PubMed Central

Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

1998-01-01

Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

PubMed Central

2014-01-01

Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

Survival, growth, and movement of subadult humpback chub, Gila cypha, in the Little Colorado River, Arizona

USGS Publications Warehouse

Dzul, Maria C.; Yackulic, Charles B.; Stone, Dennis M.; Van Haverbeke, David R.

2016-01-01

Ecologists estimate vital rates, such as growth and survival, to better understand population dynamics and identify sensitive life history parameters for species or populations of concern. Here, we assess spatiotemporal variation in growth, movement, density, and survival of subadult humpback chub living in the Little Colorado River, Grand Canyon, AZ from 2001–2002 and 2009–2013. We divided the Little Colorado River into three reaches and used a multistate mark-recapture model to determine rates of movement and differences in survival and density between sites for different cohorts. Additionally, site-specific and year-specific effects on growth were evaluated using a linear model. Results indicate that summer growth was higher for upstream sites compared with downstream sites. In contrast, there was not a consistent spatial pattern across years in winter growth; however, river-wide winter growth was negatively related to the duration of floods from 1 October to 15 May. Apparent survival was estimated to be lower at the most downstream site compared with the upstream sites; however, this could be because in part of increased emigration into the Colorado River at downstream sites. Furthermore, the 2010 cohort (i.e. fish that are age 1 in 2010) exhibited high apparent survival relative to other years. Movement between reaches varied with year, and some years exhibited preferential upstream displacement. Improving understanding of spatiotemporal effects on age 1 humpback chub survival can help inform current management efforts to translocate humpback chub into new locations and give us a better understanding of the factors that may limit this tributary's carrying capacity for humpback chub.

Does biofilm contribute to diel cycling of Zn in High Ore Creek, Montana?

USGS Publications Warehouse

Morris, J.M.; Nimick, D.A.; Farag, A.M.; Meyer, J.S.

2005-01-01

Concentrations of metals cycle daily in the water column of some mining-impacted streams in the Rocky Mountains of the western USA. We hypothesized that biofilm in High Ore Creek, Montana, USA, sorbs and releases Zn on a diel cycle, and this uptake-and-release cycle controls the total and dissolved (0.45-??m filtered) Zn concentrations. We collected water samples from three sites (upstream, middle and downstream at 0, 350 and 650 m, respectively) along a 650-m reach of High Ore Creek during a 47-h period in August 2002 and from the upstream and downstream sites during a 24-h period in August 2003; we also collected biofilm samples at these sites. In 2002 and 2003, total and dissolved Zn concentrations did not exhibit a diel cycle at the upstream sampling site, which was ???30 m downstream from a settling pond through which the creek flows. However, total and dissolved Zn concentrations exhibited a diel cycle at the middle and downstream sampling sites, with the highest Zn concentrations occurring at dawn and the lowest Zn concentrations occurring during late afternoon (>2-fold range of concentrations at the downstream site). Based on (1) concentrations of Zn in biofilm at the three sites and (2) results of streamside experiments that demonstrated Zn uptake and release by nai??ve biofilm during the light and dark hours of a photocycle, respectively, we conclude that Zn uptake in photosynthetic biofilms could contribute a large percentage to the cycling of Zn concentrations in the water column in High Ore Creek. ?? Springer 2005.

Iron budgets for three distinct biogeochemical sites around the Kerguelen archipelago (Southern Ocean) during the natural fertilisation experiment KEOPS-2

NASA Astrophysics Data System (ADS)

Bowie, A. R.; van der Merwe, P.; Quéroué, F.; Trull, T.; Fourquez, M.; Planchon, F.; Sarthou, G.; Chever, F.; Townsend, A. T.; Obernosterer, I.; Sallée, J.-B.; Blain, S.

2014-12-01

Iron availability in the Southern Ocean controls phytoplankton growth, community composition and the uptake of atmospheric CO2 by the biological pump. The KEOPS-2 experiment took place around the Kerguelen plateau in the Indian sector of the Southern Ocean, a region naturally fertilised with iron at the scale of hundreds to thousands of square kilometres, producing a mosaic of spring blooms which showed distinct biological and biogeochemical responses to fertilisation. This paper presents biogeochemical iron budgets (incorporating vertical and lateral supply, internal cycling, and sinks) for three contrasting sites: an upstream high-nutrient low-chlorophyll reference, over the plateau, and in the offshore plume east of Kerguelen Island. These budgets show that distinct regional environments driven by complex circulation and transport pathways are responsible for differences in the mode and strength of iron supply, with vertical supply dominant on the plateau and lateral supply dominant in the plume. Iron supply from "new" sources to surface waters of the plume was double that above the plateau and 20 times greater than at the reference site, whilst iron demand (measured by cellular uptake) in the plume was similar to the plateau but 40 times greater than the reference. "Recycled" iron supply by bacterial regeneration and zooplankton grazing was a relative minor component at all sites (<8% of "new" supply), in contrast to earlier findings from other biogeochemical iron budgets in the Southern Ocean. Over the plateau, a particulate iron dissolution term of 2.5% was invoked to balance the budget; this approximately doubled the standing stock of dissolved iron in the mixed layer. The exchange of iron between dissolved, biogenic and lithogenic particulate pools was highly dynamic in time and space, resulting in a decoupling of iron supply and carbon export and, importantly, controlling the efficiency of fertilisation.

Neglected sources of pharmaceuticals in river water--footprints of a Reggae festival.

PubMed

Daneshvar, Atlasi; Svanfelt, Jesper; Kronberg, Leif; Weyhenmeyer, Gesa A

2012-02-01

Wastewater treatment plants (WWTPs) are commonly considered as the main source of pharmaceuticals in surface waters. Here, however, we show that an open-air festival, attracting approximately 10,000 visitors per year at the shores of River Fyris upstream of Uppsala WWTP, can temporarily result in a higher pharmaceutical input into the river water than the WWTP. Studying the influence of Uppsala Reggae festival on the occurrence of ten commonly used acidic and basic pharmaceuticals upstream, in the effluent, and downstream of the Uppsala WWTP, we found that occasional heavy rainfalls during the festival in 2008 severely increased the mass flows of all pharmaceuticals at the WWTP upstream site. Also, strong increases in ammonium (210-fold), nitrate (21-fold), and total nitrogen (21-fold) mass flows were observed. The pharmaceutical mass flows at the upstream site were up to 3.4 times higher than those observed in the WWTP effluent. In contrast, in 2009, the festival was not accompanied with rainfalls and no major additional input of pharmaceuticals and nitrogen was observed. The findings of this study give new insights into risk assessments and are relevant for monitoring programmes.

Two alternative ways of start site selection in human norovirus reinitiation of translation.

PubMed

Luttermann, Christine; Meyers, Gregor

2014-04-25

The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

Change in the Structure of Escherichia coli Population and the Pattern of Virulence Genes along a Rural Aquatic Continuum

PubMed Central

Petit, Fabienne; Clermont, Olivier; Delannoy, Sabine; Servais, Pierre; Gourmelon, Michèle; Fach, Patrick; Oberlé, Kenny; Fournier, Matthieu; Denamur, Erick; Berthe, Thierry

2017-01-01

The aim of this study was to investigate the diversity of the Escherichia coli population, focusing on the occurrence of pathogenic E. coli, in surface water draining a rural catchment. Two sampling campaigns were carried out in similar hydrological conditions (wet period, low flow) along a river continuum, characterized by two opposite density gradients of animals (cattle and wild animals) and human populations. While the abundance of E. coli slightly increased along the river continuum, the abundance of both human and ruminant-associated Bacteroidales markers, as well as the number of E. coli multi-resistant to antibiotics, evidenced a fecal contamination originating from animals at upstream rural sites, and from humans at downstream urban sites. A strong spatial modification of the structure of the E. coli population was observed. At the upstream site close to a forest, a higher abundance of the B2 phylogroup and Escherichia clade strains were observed. At the pasture upstream site, a greater proportion of both E and B1 phylogroups was detected, therefore suggesting a fecal contamination of mainly bovine origin. Conversely, in downstream urban sites, A, D, and F phylogroups were more abundant. To assess the occurrence of intestinal pathogenic strains, virulence factors [afaD, stx1, stx2, eltB (LT), estA (ST), ipaH, bfpA, eae, aaiC and aatA] were screened among 651 E. coli isolates. Intestinal pathogenic strains STEC O174:H21 (stx2) and EHEC O26:H11 (eae, stx1) were isolated in water and sediments close to the pasture site. In contrast, in the downstream urban site aEPEC/EAEC and DAEC of human origin, as well as extra-intestinal pathogenic E. coli belonging to clonal group A of D phylogroup, were sampled. Even if the estimated input of STEC (Shiga toxin-producing E. coli) – released in water at the upstream pasture site – at the downstream site was low, we show that STEC could persist in sediment. These results show that, the run-off of small cattle farms contributed, as much as the wastewater effluent, in the dissemination of pathogenic E. coli in both water and sediments, even if the microbiological quality of the water was good or to average quality according to the French water index. PMID:28458656

Effects of urbanization on water quality in the Kansas River, Shunganunga Creek Basin, and Soldier Creek, Topeka, Kansas, October 1993 through September 1995

USGS Publications Warehouse

Pope, L.M.; Putnam, J.E.

1997-01-01

A study of urban-related water-qulity effects in the Kansas River, Shunganunga Creek Basin, and Soldier Creek in Topeka, Kansas, was conducted from October 1993 through September 1995. The purpose of this report is to assess the effects of urbanization on instream concentrations of selected physical and chemical constituents within the city of Topeka. A network of seven sampling sites was established in the study area. Samples principally were collected at monthly intervals from the Kansas River and from the Shunganunga Creek Basin, and at quarterly intervals from Soldier Creek. The effects of urbanization werestatistically evaluated from differences in constituent concentrations between sites on the same stream. No significant differences in median concentrations of dissolved solids, nutrients, or metals and trace elements, or median densities offecal bacteria were documented between sampling sites upstream and downstream from the major urbanized length of the Kansas River in Topeka.Discharge from the city's primary wastewater- treatment plant is the largest potential source of contamination to the Kansas River. This discharge increased concentrations of dissolved ammonia, totalphosphorus, and densities of fecal bacteria.Calculated dissolved ammonia as nitrogen concentrations in water from the Kansas River ranged from 0.03 to 1.1 milligrams per liter after receiving treatment-plant discharge. However, most of the calculated concentrations wereconsiderably less than 50 percent of Kansas Department of Health and Environment water- quality criteria, with a median value of 20 percent.Generally, treatment-plant discharge increased calculated total phosphorus concentrations in water from the Kansas River by 0.01 to 0.04 milligrams per liter, with a median percentage increase of 7.6 percent. The calculated median densities of fecal coliform and fecal Streptococci bacteria in water from the Kansas River increased from 120 and 150colonies per 100 milliliters of water, respectively, before treatment-plant discharge to a calculated 4,900 and 4,700 colonies per 100 milliliters of water, respectively, after discharge. Median concentrations of dissolved solids were not significantly different between three sampling sites in the Shunganunga Creek Basin. Median concentrations of dissolved nitrate as nitrogen, total phosphorus, and dissolved orthophosphate were significantly larger in water from the upstream- most Shunganunga Creek sampling site than in water from either of the other sampling sites in the Shunganunga Creek Basin probably because of the site's proximity to a wastewater-treatment plant.Median concentrations of dissolved nitrate as nitrogen and total phosphorus during 1993-95 at upstream sampling sites were either significantlylarger than during 1979-81 in response to increase of wastewater-treatment plant discharge or smaller because of the elimination of wastewater-treatment plant discharge. Median concentrations of dissolved ammonia as nitrogen were significantly less during 1993-95 than during 1979-81. Median concentrations of total aluminum, iron, maganese, and molybdenum were significantly larger in water from the downstream-mostShunganunga Creek sampling site than in water from the upstream-most sampling site. This probably reflects their widespread use in the urbanenvironment between the upstream and downstream Shunganunga Creek sampling sites. Little water-quality effect from the urbanization was indicated by results from the Soldier Creek sampling site. Median concentrations of most water-quality constituents in water from this sampling site were the smallest in water from any sampling site in the study area. Herbicides were detected in water from all sampling sites. Some of the more frequently detected herbicides included acetochlor, alachlor,atrazine, cyanazine, EPTC, metolachlor, prometon, simazine, and tebuthiuron. Detected insecticides including chlordane,

Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

USGS Publications Warehouse

Fallon, James D.; Yaeger, Christine S.

2009-01-01

Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1.7 percent), ammonia plus organic nitrogen (13 percent), total phosphorus (62 percent), and suspended sediment (11 percent) during the study. All constituents had seasonal peaks in spring and fall. The large loads during the fall resulted from unusually large precipitation and streamflow patterns. This caused the two greatest streamflow peaks at both sites to occur during October (2004 and 2005). In Seguchie Creek, bed-sediment concentrations of five metals and trace elements (arsenic, cadmium, chromium, lead, and zinc) exceeded the Interim Sediment Quality Guidelines (ISQG) set by the Canadian Council of Ministers of the Environment. Bed-sediment samples from the upstream site had more exceedances of ISQGs for metals and trace elements than did samples from the downstream site (seven and two exceedances, respectively). Bed-sediment samples from the downstream site had more exceedances of ISQGs (20 exceedances) for semivolatile organic compounds than did samples from the upstream site (8 exceedances), indicating different sources for organic compounds than for metals and trace elements. Concentrations of 11 semivolatile organic compounds exceeded ISQGs: ancenaphthene, acenaphthylene, anthracene, benzo[a]anthracene, benzo[a]pyrene, chrysene, fluoranthene, fluorene, naphthalene, phenanthrene, and pyrene. In bed-sediment samples collected from three wetlands, concentrations of all six metals exceeded ISQGs: arsenic, cadmium, chromium, copper, lead, and zinc. Concentrations of three semivolatile organic compounds exceeded ISQGs: flouranthene, phenanthrene, and pyrene. Results indicate that areas appearing relatively undisturbed and of high resource value can have degraded quality from previous unknown land use.

Modification of suburban carbon and nitrogen fluxes by a coupled channel/floodplain system assessed using in situ sensors

NASA Astrophysics Data System (ADS)

Wollheim, W. M.; Pellerin, B. A.; Saraceno, J.; Hopkinson, C.; Hope, A.; Morse, N.

2010-12-01

Biogeochemical fluxes in human dominated streams and rivers are highly impacted, but effects can be attenuated downstream through natural ecosystem processes. We deployed in situ nitrate, fdom, and chlorophyll sensors to characterize biogeochemical fluxes draining a suburban catchment, and modifications by a channel-floodplain system located immediately downstream. The upstream site reflects the suburban signal; the downstream site reflects the influence of the channel/floodplain on the suburban signal. FDOM showed a diurnal signal at both sites, but was stronger downstream, likely indicating new DOC production within the channel-floodplain system, which contained a small pond. In situ chlorophyll concentrations were also highly correlated with FDOM. FDOM showed a stronger storm response upstream than downstream, indicating terrestrial sources are mobilized by storms and subsequent dampening of the pulse by the floodplain. Nitrate concentrations consistently dropped from 0.6 to 0.7 mg/l upstream to less than 0.4 mg/l downstream, indicating likely nitrogen retention or removal over a relatively short distance (~500m). Use of in situ sensors is likely to greatly advance our understanding of biogeochemical processes in aquatic systems.

A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

PubMed Central

Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

2000-01-01

Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

PubMed Central

Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

1997-01-01

GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

Characterization of Stormflows and Wastewater Treatment-Plant Effluent Discharges on Water Quality, Suspended Sediment, and Stream Morphology for Fountain and Monument Creek Watersheds, Colorado, 1981-2006

USGS Publications Warehouse

Mau, David P.; Stogner, Sr., Robert W.; Edelmann, Patrick

2007-01-01

In 1998, the U.S. Geological Survey, in cooperation with Colorado Springs City Engineering, began a study of the Fountain and Monument Creek watersheds to characterize water quality and suspended-sediment conditions in the watershed for different flow regimes, with an emphasis on characterizing water quality during storm runoff. Water-quality and suspended-sediment samples were collected in the Fountain and Monument Creek watersheds from 1981 through 2006 to evaluate the effects of stormflows and wastewater-treatment effluent on Fountain and Monument Creeks in the Colorado Springs, Colorado, area. Water-quality data were collected at 11 sites between 1981 and 2001, and 14 tributary sites were added in 2003 to increase spatial coverage and characterize water quality throughout the watersheds. Suspended-sediment samples collected daily at 7 sites from 1998 through 2001, 6 sites daily from 2003 through 2006, and 13 tributary sites intermittently from 2003 through 2006 were used to evaluate the effects of stormflow on suspended-sediment concentrations, discharges, and yields. Data were separated into three flow regimes: base flow, normal flow, and stormflow. Stormflow concentrations from 1998 through 2006 were compared to Colorado acute instream standards and, with the exception of a few isolated cases, did not exceed water-quality standards for inorganic constituents that were analyzed. However, stormflow concentrations of both fecal coliform and Escherichia coli (E. coli) frequently exceeded water-quality standards during 1998 through 2006 on main-stem and tributary sites by more than an order of magnitude. There were two sites on Cottonwood Creek, a tributary to Monument Creek, with elevated concentrations of dissolved nitrite plus nitrate: site 07103985 (TbCr), a tributary to Cottonwood Creek and site 07103990 (lower_CoCr), downstream from site 07103985 (TbCr), and near the confluence with Monument Creek. During base-flow and normal-flow conditions, the median concentrations of dissolved nitrite plus nitrate ranged from 5.1 to 6.1 mg/L and were 4 to 7 times larger than concentrations at the nearest upstream site on Monument Creek, site 07103970 (MoCr_Woodmen). The source of these larger dissolved nitrite plus nitrate concentrations has not been identified, but the fact that all measurements had elevated dissolved nitrite plus nitrate concentrations indicates a relatively constant source. Most stormflow concentrations of dissolved trace elements were smaller than concentrations from base-flow or normal-flow samples. However, median concentrations of total arsenic, copper, lead, manganese, nickel, and zinc generally were much larger during periods of stormflow than during base flow or normal flow. Concentrations of dissolved and total copper, total manganese, total nickel, dissolved and total selenium, and dissolved and total zinc ranged from 3 to 27 times larger at site 07103707 (FoCr_8th) than site 07103700 (FoCr_Manitou) during base flow, indicating a large source of trace elements between these two sites. Both of these sites are located on Fountain Creek, upstream from the confluence with Monument Creek. The likely source area is Gold Hill Mesa, a former tailings pile for a gold refinery located just upstream from the confluence with Monument Creek, and upstream from site 07103707 (FoCr_8th). Farther downstream in Fountain Creek, stormflow samples for total copper, manganese, lead, nickel, and zinc were larger at the downstream site near the city of Security, site 07105800 (FoCr_Security), than at the upstream site near Janitell Road, site 07105530 (FoCr_Janitell), compared with other main-stem sites and indicated a relatively large source of these metals between the two sites. Nitrogen, phosphorus, and trace-element loads substantially increased during stormflow. Suspended-sediment concentrations, discharges, and yields associated with stormflow were significantly larger than those associated with normal flow. The Apr

Effects of wastewater effluent discharge and treatment facility upgrades on environmental and biological conditions of Indian Creek, Johnson County, Kansas, June 2004 through June 2013

USGS Publications Warehouse

Graham, Jennifer L.; Stone, Mandy L.; Rasmussen, Teresa J.; Foster, Guy M.; Poulton, Barry C.; Paxson, Chelsea R.; Harris, Theodore D.

2014-01-01

Indian Creek is one of the most urban drainage basins in Johnson County, Kansas, and environmental and biological conditions of the creek are affected by contaminants from point and other urban sources. The Johnson County Douglas L. Smith Middle Basin (hereafter referred to as the “Middle Basin”) and Tomahawk Creek Wastewater Treatment Facilities (WWTFs) discharge to Indian Creek. In summer 2010, upgrades were completed to increase capacity and include biological nutrient removal at the Middle Basin facility. There have been no recent infrastructure changes at the Tomahawk Creek facility; however, during 2009, chemically enhanced primary treatment was added to the treatment process for better process settling before disinfection and discharge with the added effect of enhanced phosphorus removal. The U.S. Geological Survey, in cooperation with Johnson County Wastewater, assessed the effects of wastewater effluent on environmental and biological conditions of Indian Creek by comparing two upstream sites to four sites located downstream from the WWTFs using data collected during June 2004 through June 2013. Environmental conditions were evaluated using previously and newly collected discrete and continuous data and were compared with an assessment of biological community composition and ecosystem function along the upstream-downstream gradient. This study improves the understanding of the effects of wastewater effluent on stream-water and streambed sediment quality, biological community composition, and ecosystem function in urban areas. After the addition of biological nutrient removal to the Middle Basin WWTF in 2010, annual mean total nitrogen concentrations in effluent decreased by 46 percent, but still exceeded the National Pollutant Discharge Elimination System (NPDES) wastewater effluent permit concentration goal of 8.0 milligrams per liter (mg/L); however, the NPDES wastewater effluent permit total phosphorus concentration goal of 1.5 mg/L or less was achieved at the Middle Basin WWTF. At the Tomahawk Creek WWTF, after the addition of chemically enhanced primary treatment in 2009, effluent discharges also had total phosphorus concentrations below 1.5 mg/L. After the addition of biological nutrient removal, annual total nitrogen and phosphorus loads from the Middle Basin WWTF decreased by 42 and 54 percent, respectively, even though effluent volume increased by 11 percent. Annual total phosphorus loads from the Tomahawk Creek WWTF after the addition of chemically enhanced primary treatment decreased by 54 percent despite a 33-percent increase in effluent volume. Total nitrogen and phosphorus from the WWTFs contributed between 30 and nearly 100 percent to annual nutrient loads in Indian Creek depending on streamflow conditions. In-stream total nitrogen primarily came from wastewater effluent except during years with the highest streamflows. Most of the in-stream total phosphorus typically came from effluent during dry years and from other urban sources during wet years. During 2010 through 2013, annual mean discharge from the Middle Basin WWTF was about 75 percent of permitted design capacity. Annual nutrient loads likely will increase when the facility is operated at permitted design capacity; however, estimated maximum annual nutrient loads from the Middle Basin WWTF were 27 to 38 percent lower than before capacity upgrades and the addition of biological nutrient removal to treatment processes. Thus, the addition of biological nutrient removal to the Middle Basin wastewater treatment process should reduce overall nutrient loads from the facility even when the facility is operated at permitted design capacity. The effects of wastewater effluent on the water quality of Indian Creek were most evident during below-normal and normal streamflows (about 75 percent of the time) when wastewater effluent represented about 24 percent or more of total streamflow. Wastewater effluent had the most substantial effect on nutrient concentrations in Indian Creek. Total and inorganic nutrient concentrations at the downstream sites during below-normal and normal streamflows were 10 to 100 times higher than at the upstream sites, even after changes in treatment practices at the WWTFs. Median total phosphorus concentrations during below-normal and normal streamflows at a downstream site were 43 percent lower following improvements in wastewater treatment processes. Similar decreases in total nitrogen were not observed, likely because total nitrogen concentrations only decreased in Middle Basin effluent and wastewater contributed a higher percentage to streamflows when nutrient samples were collected during the after-upgrade period. The wastewater effluent discharges to Indian Creek caused changes in stream-water quality that may affect biological community structure and ecosystem processes, including higher concentrations of bioavailable nutrients (nitrate and orthophosphorus) and warmer water temperatures during winter months. Other urban sources of contaminants also caused changes in stream-water quality that may affect biological community structure and ecosystem processes, including higher turbidities downstream from construction areas and higher specific conductance and chloride concentrations during winter months. Chloride concentrations exceeded acute and chronic exposure criteria at all Indian Creek study sites, regardless of wastewater influence, for weeks or months during winter. Streambed sediment chemistry was affected by wastewater (elevated nutrient and organic wastewater-indicator compound concentrations) and other contaminants from urban sources (elevated polyaromatic hydrocarbon concentrations). Overall habitat conditions were suboptimal or marginal at all sites; general decline in habitat conditions along the upstream-downstream gradient likely was caused by the cumulative effects of urbanization with increasing drainage basin size. Wastewater effluent likely affected algal periphyton biomass and community composition, primary production, and community respiration in Indian Creek. Functional stream health, evaluated using a preliminary framework based on primary production and community respiration, was mildly or severely impaired at most downstream sites relative to an urban upstream Indian Creek site. The mechanistic cause of the changes in these biological variables are unclear, though elevated nutrient concentrations were positively correlated with algal biomass, primary production, and community respiration. Macroinvertebrate communities indicated impairment at all sites, and Kansas Department of Health and Environment aquatic life support scores indicated conditions nonsupporting of aquatic life, regardless of wastewater influences. Urban influences, other than wastewater effluent discharge, likely control macroinvertebrate community structure in Indian Creek. Changes in treatment processes at the Middle Basin and Tomahawk Creek WWTFs improved wastewater effluent quality and decreased nutrient loads, but wastewater effluent discharges still had negative effects on the environmental and biological conditions at downstream Indian Creek sites. Wastewater effluent discharge into Indian Creek likely contributed to changes in measures of ecosystem structure (streamflow, water and streambed-sediment chemistry, algal biomass, and algal periphyton community composition) and function (primary production and community respiration) along the upstream-downstream gradient. Wastewater effluent discharges maintained streamflows and increased nutrient concentrations, algal biomass, primary production, and community respiration at the downstream sites. Functional stream health was severely impaired downstream from the Middle Basin WWTF and mildly impaired downstream from the Tomahawk WWTF relative to the urban upstream site. As distance from the Middle Basin WWTF increased, nutrient concentrations, algal biomass, primary production, and community respiration decreased, and functional stream health was no longer impaired 9.5 kilometers downstream from the discharge relative to the urban upstream site. Therefore, although wastewater effluent caused persistent changes in environmental and biological conditions and functional stream health at sites located immediately downstream from WWTF effluent discharges, some recovery to conditions more similar to the urban upstream site occurred within a relatively short distance.

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

Analyzing legacy U.S. Geological Survey geochemical databases using GIS: applications for a national mineral resource assessment

USGS Publications Warehouse

Yager, Douglas B.; Hofstra, Albert H.; Granitto, Matthew

2012-01-01

This report emphasizes geographic information system analysis and the display of data stored in the legacy U.S. Geological Survey National Geochemical Database for use in mineral resource investigations. Geochemical analyses of soils, stream sediments, and rocks that are archived in the National Geochemical Database provide an extensive data source for investigating geochemical anomalies. A study area in the Egan Range of east-central Nevada was used to develop a geographic information system analysis methodology for two different geochemical datasets involving detailed (Bureau of Land Management Wilderness) and reconnaissance-scale (National Uranium Resource Evaluation) investigations. ArcGIS was used to analyze and thematically map geochemical information at point locations. Watershed-boundary datasets served as a geographic reference to relate potentially anomalous sample sites with hydrologic unit codes at varying scales. The National Hydrography Dataset was analyzed with Hydrography Event Management and ArcGIS Utility Network Analyst tools to delineate potential sediment-sample provenance along a stream network. These tools can be used to track potential upstream-sediment-contributing areas to a sample site. This methodology identifies geochemically anomalous sample sites, watersheds, and streams that could help focus mineral resource investigations in the field.

The Impact of Moisture on Mountain Waves During T-REX

DTIC Science & Technology

2009-11-01

sensitivity to the upstream wind speed. After re- moving these three outliers, the linear least squares re- gression using the other 21 points yields W( U c )5...The wave amplitudes for the 24 flights normalized by the reference wave amplitude are plotted versus the upstream RH maxima in Fig. 3b. There are four...mountaintop level de- rived from the upwind sondes for 24 UWKA flights. The filled circles represent moist cases as defined in the text. The bold line

Fish assemblages in the Upper Esopus Creek, NY: Current status, variability, and controlling factors

USGS Publications Warehouse

Baldigo, Barry P.; George, Scott D.; Keller, Walter T

2015-01-01

The Upper Esopus Creek receives water diversions from a neighboring basin through the Shandaken Tunnel (the portal) from the Schoharie Reservoir. Although the portal is closed during floods, mean flows and turbidity of portal waters are generally greater than in Esopus Creek above their confluence. These conditions could potentially affect local fish assemblages, yet such effects have not been assessed in this highly regulated stream. We studied water quality, hydrology, temperature, and fish assemblages at 18 sites in the Upper Esopus Creek during 2009–2011 to characterize the effects of the portal input on resident-fish assemblages and to document the status of the fishery resource. In general, fish-community richness increased by 2–3 species at mainstem sites near the portal, and median density and biomass of fish communities at sites downstream of the portal were significantly lower than they were at sites upstream of the portal. Median densities of Salmo trutta (Brown Trout) and all trout species were significantly lower than at mainstem sites downstream from the portal—25.1 fish/0.1 ha and 148.9 fish/0.1 ha, respectively—than at mainstem sites upstream from the portal—68.8 fish/0.1 ha and 357.7 fish/0.1 ha, respectively—yet median biomass for Brown Trout and all trout did not differ between sites from both reaches. The median density of young-of-year Brown Trout at downstream sites (9.3 fish/0.1 ha) was significantly lower than at upstream sites (33.9 fish/0.1 ha). Waters from the portal appeared to adversely affect the density and biomass of young-of-year Brown Trout, but lower temperatures and increased flows also improved habitat quality for mature trout at downstream sites during summer. These findings, and those from companion studies, indicate that moderately turbid waters from the portal had few if any adverse impacts on trout populations and overall fish communities in the Upper Esopus Creek during this study.

Evolution of Advection Upstream Splitting Method Schemes

NASA Technical Reports Server (NTRS)

Liou, Meng-Sing

2010-01-01

This paper focuses on the evolution of advection upstream splitting method(AUSM) schemes. The main ingredients that have led to the development of modern computational fluid dynamics (CFD) methods have been reviewed, thus the ideas behind AUSM. First and foremost is the concept of upwinding. Second, the use of Riemann problem in constructing the numerical flux in the finite-volume setting. Third, the necessity of including all physical processes, as characterised by the linear (convection) and nonlinear (acoustic) fields. Fourth, the realisation of separating the flux into convection and pressure fluxes. The rest of this review briefly outlines the technical evolution of AUSM and more details can be found in the cited references. Keywords: Computational fluid dynamics methods, hyperbolic systems, advection upstream splitting method, conservation laws, upwinding, CFD

Occurrence of emerging contaminants in water and bed material in the Missouri River, North Dakota, 2007

USGS Publications Warehouse

Damschen, William C.; Lundgren, Robert F.

2009-01-01

The U.S. Geological Survey (USGS), in cooperation with the Standing Rock Sioux Tribe, conducted a reconnaissance study to determine the occurrence of emerging contaminants in water and bed sediment within the Missouri River upstream and downstream from the cities of Bismarck and Mandan, North Dakota, and upstream from the city of Fort Yates, North Dakota, during September-October 2007. At each site, water samples were collected twice and bed-sediment samples were collected once. Samples were analyzed for more than 200 emerging contaminants grouped into four compound classes - wastewater compounds, human-health pharmaceutical compounds, hormones, and antibiotics. Only sulfamethoxazole, an antibiotic, was present at a concentration higher than minimum detection limits. It was detected in a water sample collected downstream from the cities of Bismarck and Mandan, and in bed-sediment samples collected at the two sites downstream from the cities of Bismarck and Mandan and upstream from Fort Yates. Sulfamethoxazole is an antibiotic commonly used for treating bacterial infections in humans and animals.

Hydrologic characteristics of surface-mined land reclaimed by sludge irrigation, Fulton County, Illinois

USGS Publications Warehouse

Patterson, G.L.; Fuentes, R.F.; Toler, L.G.

1982-01-01

Analyses of water samples collected at four stream-monitoring stations, in an area surface mined for coal and being reclaimed by sludge irrigation, show the principal metals are sodium, calcium, and magnesium and principal non-metals are chloride, sulfate, and bicarbonate. Comparing yearly mean chemical concentrations shows no changing trends since reclamation began, nor are there differences between stations upstream and downstream from the site. Yearly suspended-sediment loads and discharge relations upstream and downstream from the site also show no differences. Discharge hydrographs of two streams draining the site show a delayed response to precipitation due to the storage capacity of several upstream strip-mine lakes. The water-table surface generally follows the irregular topography. Monthly water-level fluctuations were dependent on the surface material (mined or unmined) and proximity to surface discharge. The largest fluctuations were in unmined land away from discharge while the smallest were in mined land near discharge. The water table is closer to the surface in unmined land. Analyses of water samples from 70 wells within or adjacent to the reclamation site showed no differences in water quality which could be attributed to sludge or supernatant application. Samples from wells in mined land, however, had higher concentrations of dissolved sulfate, calcium, magnesium, chloride, iron, zinc, and manganese than samples from wells in unmined land. (USGS)

Genetic and morphological consequences of Quaternary glaciations: A relic barbel lineage (Luciobarbus pallaryi, Cyprinidae) of Guir Basin (Algeria).

PubMed

Brahimi, Amina; Tarai, Nacer; Benhassane, Abdelkrim; Henrard, Arnaud; Libois, Roland

2016-02-01

Climatic variations during the Quaternary period had a considerable impact on landscapes and habitat fragmentation (rivers) in North Africa. These historical events can have significant consequences on the genetic structure of the populations. Indeed, geographically separated and genetically isolated populations tend to differentiate themselves through time, eventually becoming distinct lineages, allowing new species to emerge in later generations. The aim of the present study is to use genetic and morphological techniques to evaluate the major role of the Saalian glaciation (Middle Quaternary) in the establishment of the geographic space and in the evolution of the intraspecific genetic diversity, by tracing the demographic history of barbels belonging to the Luciobarbus pallaryi (Cyprinidae) species in the Guir Basin (Algeria). In this context, two populations, from two distinct and isolated sites, were studied. Analysis of the cytochrome b (cyt b) mitochondrial markers and of the "D-loop" control region has shown that the "upstream" and "downstream" Guir populations are genetically differentiated. The molecular analyses suggest that the upstream population was disconnected from this hydrographic system during the Saalian glaciation period of the Quaternary. Subsequently, it was isolated in the foggaras underground waters in the Great Western Erg, at approximately 320 000 years BP, creating, through a bottleneck effect, a new allopatric lineage referred to as "Adrar". Conversely, the high genetic diversity in the upstream Guir (Bechar) population suggests that the stock is globally in expansion. These barbels (n=52) were also examined with meristic, morphometric, osteological, and biological features. These data also reveal a complete discrimination between the two populations, with a remarkable and distinctive behavioural adaptation for the Adrar specimens: neoteny. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Characterization of the microbial community composition and the distribution of Fe-metabolizing bacteria in a creek contaminated by acid mine drainage.

PubMed

Sun, Weimin; Xiao, Enzong; Krumins, Valdis; Dong, Yiran; Xiao, Tangfu; Ning, Zengping; Chen, Haiyan; Xiao, Qingxiang

2016-10-01

A small watershed heavily contaminated by long-term acid mine drainage (AMD) from an upstream abandoned coal mine was selected to study the microbial community developed in such extreme system. The watershed consists of AMD-contaminated creek, adjacent contaminated soils, and a small cascade aeration unit constructed downstream, which provide an excellent contaminated site to study the microbial response in diverse extreme AMD-polluted environments. The results showed that the innate microbial communities were dominated by acidophilic bacteria, especially acidophilic Fe-metabolizing bacteria, suggesting that Fe and pH are the primary environmental factors in governing the indigenous microbial communities. The distribution of Fe-metabolizing bacteria showed distinct site-specific patterns. A pronounced shift from diverse communities in the upstream to Proteobacteria-dominated communities in the downstream was observed in the ecosystem. This location-specific trend was more apparent at genus level. In the upstream samples (sampling sites just below the coal mining adit), a number of Fe(II)-oxidizing bacteria such as Alicyclobacillus spp., Metallibacterium spp., and Acidithrix spp. were dominant, while Halomonas spp. were the major Fe(II)-oxidizing bacteria observed in downstream samples. Additionally, Acidiphilium, an Fe(III)-reducing bacterium, was enriched in the upstream samples, while Shewanella spp. were the dominant Fe(III)-reducing bacteria in downstream samples. Further investigation using linear discriminant analysis (LDA) effect size (LEfSe), principal coordinate analysis (PCoA), and unweighted pair group method with arithmetic mean (UPGMA) clustering confirmed the difference of microbial communities between upstream and downstream samples. Canonical correspondence analysis (CCA) and Spearman's rank correlation indicate that total organic carbon (TOC) content is the primary environmental parameter in structuring the indigenous microbial communities, suggesting that the microbial communities are shaped by three major environmental parameters (i.e., Fe, pH, and TOC). These findings were beneficial to a better understanding of natural attenuation of AMD.

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

PubMed Central

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

PubMed

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

Distribution of spawning activity by anadromous fishes in an atlantic slope drainage after removal of a low-head dam

USGS Publications Warehouse

Burdick, S.M.; Hightower, J.E.

2006-01-01

In 1998, the Quaker Neck Dam was removed from the Neuse River near Goldsboro, North Carolina, restoring access to more than 120 km of potential main-stem spawning habitat and 1,488 km of potential tributary spawning habitat to anadromous fishes. We used plankton sampling and standardized electrofishing to examine the extent to which anadromous fishes utilized this restored spawning habitat in 2003 and 2004. Evidence of spawning activity was detected upstream of the former dam site for three anadromous species: American shad Alosa sapidissima, hickory shad A. mediocris, and striped bass Morone saxatilis. The percentages of eggs and larvae collected in the restored upstream habitat were greater in 2003, when spring flows were high, than in 2004. River reaches where spawning occurred were estimated from egg stage and water velocity data. Spawning of American shad and striped bass occurred primarily in main-stem river reaches that were further upstream during the year of higher spring flows. Hickory shad generally spawned in downstream reaches and in tributaries above and below the former dam site. These results demonstrate that anadromous fishes will take advantage of upper basin spawning habitat restored through dam removal as long as instream flows are adequate to facilitate upstream migration.

Use of a Fish Transportation Barge for Increasing Returns of Steelhead Imprinted for Homing, Final Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harmon, Jerrel R.

1989-08-01

The objective of this 7-year National Fisheries Service study, which began is 1982, was to determine if transporting juvenile steelhead (Oncorhynchus mykiss) by truck and barge from Dworshak National Fish Hatchery (NFH), on the Clearwater River, to a release site on the Columbia River below Bonneville Dam would result in increased returns of adults to the various fisheries and to the hatchery homing site. During 1982 and 1983, over 500,000 marked juvenile steelhead were serially released as controls from the hatchery or barged as test fish to below Bonneville Dam. Recoveries of marked adults to various recovery sites are complete.more » Fish released in 1983 showed a stronger homing ability and more rapid upstream migration than test fish released in 1982. Most adults from both control and test releases in 1983 and control releases in 1982 migrated a considerable distance upstream and overwintered in the Snake and Clearwater Rivers--behavior similar to Clearwater River fish previously transported from Lower Granite Dam. In contrast, many of the adults from test releases in 1982 failed to migrate upstream during the fall, overwintered in the Columbia River, and migrated upstream the following spring. Survival of control fish released at Dworshak NFH in late April 1982 was substantially higher than survival of those released in mid-May. Survival and homing of control fish released in late April and early May 1983 were over 10 times that for fish released in late May. Return of adults from normal hatchery releases in 1982 was the highest ever observed at Dworshak NFH.« less

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

Oxidative stress markers in fish (Astyanax sp. and Danio rerio) exposed to urban and agricultural effluents in the Brazilian Pampa biome.

PubMed

Costa-Silva, D G; Nunes, M E M; Wallau, G L; Martins, I K; Zemolin, A P P; Cruz, L C; Rodrigues, N R; Lopes, A R; Posser, T; Franco, J L

2015-10-01

Aquatic ecosystems are under constant risk due to industrial, agricultural, and urban activities, compromising water quality and preservation of aquatic biota. The assessment of toxicological impacts caused by pollutants to aquatic environment using biomarker measurements in fish can provide reliable data to estimate sublethal effects posed by chemicals in contaminated areas. In this study, fish (Astyanax sp. and Danio rerio) exposed to agricultural and urban effluents at the Vacacaí River, Brazil, were tested for potential signs of aquatic contamination. This river comprehends one of the main watercourses of the Brazilian Pampa, a biome with a large biodiversity that has been neglected in terms of environmental and social-economic development. Sites S1 and S2 were chosen by their proximity to crops and wastewater discharge points, while reference site was located upstream of S1 and S2, in an apparently non-degraded area. Fish muscle and brain tissues were processed for determination of acetylcholinesterase as well as oxidative stress-related biomarkers. The results showed signs of environmental contamination, hallmarked by significant changes in cholinesterase activity, expression of metallothionein, antioxidant enzymes, glutathione levels, and activation of antioxidant/cell stress response signaling pathways in fish exposed to contaminated sites when compared to reference. Based on these results, it is evidenced that urban and agricultural activities are posing risk to the environmental quality of water resources at the studied area. It is also demonstrated that cell stress biomarkers may serve as important tools for biomonitoring and development of risk assessment protocols in the Pampa biome.

Bed Sediment Monitoring of Multiple Contiguous Small Dam Removals

NASA Astrophysics Data System (ADS)

Galster, J. C.; Wyrick, J. R.

2010-12-01

Dam removal is crucial for reconnecting river habitats, restoring passage of fish and other aquatic organisms, and restoring the free flow of water and sediment. However, removal of obsolete dams is often resisted due to concerns of releasing sediment and initiating channel instability. Two dams on the Musconetcong River in northern New Jersey have been removed as part of a watershed-wide effort to remove or breach all major obstructions to restore the river to its original free-flowing state. The two dams were consecutively situated 1 kilometer apart and their removals provided an opportunity to study the geomorphic response in the form of bed elevation changes and sediment size through pre- and post-removal monitoring. Initial geomorphic surveys of the riverbed in the vicinity of and between the two dams have shown areas of erosion and deposition. These surveys have established a set of control points along the river channel between the two dams, and confirm the downstream movement of a sediment plume and localized areas of erosion. At the upstream dam, comparisons pre- and post-dam removal surveys show greater than 100 cubic meters of sediment being both eroded and deposited within the site. Most but not all of the erosion occurred around the newly exposed sediment bar upstream of the former dam, where the thalweg has reestablished itself following the dam’s removal. Areas that were excavated during removal have experienced deposition. Most of the deposition occurred downstream and on the left-hand bank. Due to the two low flow culverts in the former dam, a mid-channel sediment bar formed but has subsequently eroded. At the downstream dam site, erosion has removed up to 1.1 m of sediment from the bed in places while depositing up to 0.5 m sediment in others. As sediment from the former impoundment migrated through the project site, areas excavated during the removal became areas of deposition following the removal, and; alternately, areas in the channel margins where sediments were placed experienced gradual erosion. Grain size analysis shows a coarsening of the riverbed over the first nine months since removal. Grain size analyses were done upstream and downstream of the dam sites as well as at two locations between the sites. Pebble counts were completed using the random walk method at each of the six sites. The largest change in grain sizes at the four sites occurred upstream of the downstream dam site, where there was a significant coarsening of the sediment from October 2008 to June 2009. This has most likely occurred from the increase in energy upstream of the dam post-removal, which has transported many of the fine-grained sediments downstream. Downstream of this dam site sediment size has not significantly changed, suggesting that the fine sediments have been transported downstream far enough to leave the site. Surveys of the channel thalweg above and below both dams also show a pulse of sediment migrating slowing from the uppermost impoundment areas. Long-term monitoring of the channel thalweg may reveal reach-level changes in channel slope.

Geological nominations at UNESCO World Heritage, an upstream struggle

NASA Astrophysics Data System (ADS)

Olive-Garcia, Cécile; van Wyk de Vries, Benjamin

2017-04-01

Using my 10 years experience in setting up and defending a UNESCO world Heritage Geological nomination, this presentation aims to give a personal insight into this international process and the differential use of science, subjective perception (aesthetic and 'naturality'), and politics. At this point in the process, new protocols have been tested in order to improve the dialogue, accountability and transparency between the different stake-holders. These are, the State parties, the IUCN, the scientific community, and UNESCO itself. Our proposal is the Chaîne des Puys-Limagne fault ensemble, which combines tectonic, geomorphological evolution and volcanology. The project's essence is a conjunction of inseparable geological features and processes, set in the context of plate tectonics. This very unicit yof diverse forms and processes creates the value of the site. However, it is just this that has caused a problem, as the advisory body has a categorical approach of nominations that separates items to assess them in an unconnected manner.From the start we proposed a combined approach, where a property is seen in its entirety, and the constituent elements seen as interlinked elements reflecting the joint underlying phenomena. At this point, our project has received the first ever open review by an independent technical mission (jointly set up by IUCN, UNESCO and the State party). The subsequent report was broadly supportive of the project's approach and of the value of the ensemble of features. The UNESCO committee in 2016, re-referred the nomination, acknowledging the potential Outstanding Universal Value of the site and requesting the parties to continue the upstream process (e.g. collaborative work), notably on the recommendations and conclusions of the Independent Technical mission report. Meetings are continuing, and I shall provide you with the hot-off-the-press news as this ground breaking nomination progresses.

Invasion and Colonisation of a Tropical Stream by an Exotic Loricariid Fish: Indices of Gradual Displacement of the Native Common Pleco (Hypostomus punctatus) by the Red Fin Dwarf Pleco (Parotocinclus maculicauda) over Fifteen Years

PubMed Central

Mazzoni, Rosana; Costa da Silva, Raquel; Pinto, Míriam Plaza

2015-01-01

The introduction of invasive species represents a major threat to the integrity of stream-dwelling fish populations worldwide, and this issue is receiving increasing attention from scientists, in particular because of potential impact on biodiversity. In this study, we analysed the dispersal of an exotic loricariid fish the red fin dwarf pleco (Parotocinclus maculicauda) in a stream of the Atlantic Forest biome in coastal south-eastern Brazil and evaluated the effects of this invasion on the native loricariid common pleco (Hypostomus punctatus). Specimens were collected at eight sites located along the course of the stream over a 15-year period. The distribution and density of the two species were determined by the Successive Removal Method. The introduction of P. maculicauda occurred in the medium sector of the stream, and during the course of the study, the species dispersed to new sites further upstream. By the end of the study, it was found at all points upstream from the original site. Hypostomus punctatus was registered at all sample sites both before and after the introduction of P. maculicauda, but its density decreased at all upstream sites after the arrival of the exotic species. Our analysis shows that colonisation by P. maculicauda seems to have a negative effect on H. punctatus densities. The maintenance of H. punctatus densities at the sites not colonised by P. maculicauda reinforces the conclusion that the colonisation of the stream by the exotic species had deleterious effects on the density of the resident H. punctatus populations, either by direct or indirect action. PMID:26440412

Temporal trends and spatial patterns in nutrient export along the Mississippi River and its Tributaries

NASA Astrophysics Data System (ADS)

Stewart, B.; Li, L.

2017-12-01

The Mississippi River, the largest river in the U. S., exports excessive nutrients from the land to the sea, causing the problem of hypoxia in the Gulf of Mexico. In this research, we examined nutrient export along the Mississippi River and its tributaries to understand its trends and patterns and to identify the major factors contributing to these trends. We examined nutrient data from 1950 - 2017 for four sites along the Mississippi River and four tributary sites from the U. S. Geological Survey. The species included: total nitrogen, organic nitrogen, ammonia, nitrate, orthophosphate, and phosphorous. We analyzed the power law relationship of concentration and discharge, for which the export of nutrient species exhibited several trends. Both nitrogen (N) and phosphorous (P) species exhibited mostly chemodynamic behavior. This is in contrast to previous observations in smaller agricultural land where N and P export was mostly chemostatic with no significant change in concentration as discharge varies, suggesting possible scaling effects at different spatial scales. We also compared the average annual concentration over time at each site. The N concentration decreased from upstream to downstream, likely due to greater agricultural activities in the upstream Mississippi river and possible denitrification along the river. The N concentration also increased with time. The P species, however, fluctuated from site to site with no clear spatial patterns, but consistently exhibited higher concentrations at upstream sites with greater agricultural activities. The P species also fluctuated over time, likely due to patterns in discharge and agricultural activities. The results of this research can be further explored by calculating the total export of nutrients into the Gulf of Mexico to determine limits and drivers of nutrient export for better water management, thus helping prevent hypoxia and eutrophication within the Mississippi River basin.

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

PubMed

Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

2012-07-01

The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

PubMed

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

The effects of road crossings on prairie stream habitat and function

USGS Publications Warehouse

Bouska, Wesley W.; Keane, Timothy; Paukert, Craig P.

2010-01-01

Improperly designed stream crossing structures may alter the form and function of stream ecosystems and habitat and prohibit the movement of aquatic organisms. Stream sections adjoining five concrete box culverts, five low-water crossings (concrete slabs vented by one or multiple culverts), and two large, single corrugated culvert vehicle crossings in eastern Kansas streams were compared to reference reaches using a geomorphologic survey and stream classification. Stream reaches were also compared upstream and downstream of crossings, and crossing measurements were used to determine which crossing design best mimicked the natural dimensions of the adjoining stream. Four of five low-water crossings, three of five box culverts, and one of two large, single corrugated pipe culverts changed classification from upstream to downstream of the crossings. Mean riffle spacing upstream at low-water crossings (8.6 bankfull widths) was double that of downstream reaches (mean 4.4 bankfull widths) but was similar upstream and downstream of box and corrugated pipe culverts. There also appeared to be greater deposition of fine sediments directly upstream of these designs. Box and corrugated culverts were more similar to natural streams than low-water crossings at transporting water, sediments, and debris during bankfull flows.

Body morphology differs in wild juvenile Chinook salmon Oncorhynchus tshawytscha in the Willamette River, Oregon, USA

USGS Publications Warehouse

Billman, E.J.; Whitman, L.D.; Schroeder, R.K.; Sharpe, C.S.; Noakes, David L. G.; Schreck, Carl B.

2014-01-01

Body morphology of juvenile Chinook salmon Oncorhynchus tshawytscha in the upper Willamette River, Oregon, U.S.A., was analysed to determine if variation in body shape is correlated with migratory life-history tactics followed by juveniles. Body shape was compared between migrating juveniles that expressed different life-history tactics, i.e. autumn migrants and yearling smolts, and among parr sampled at three sites along a longitudinal river gradient. In the upper Willamette River, the expression of life-history tactics is associated with where juveniles rear in the basin with fish rearing in downstream locations generally completing ocean ward migrations earlier in life than fish rearing in upstream locations. The morphological differences that were apparent between autumn migrants and yearling smolts were similar to differences between parr rearing in downstream and upstream reaches, indicating that body morphology is correlated with life-history tactics. Autumn migrants and parr from downstream sampling sites had deeper bodies, shorter heads and deeper caudal peduncles compared with yearling smolts and parr from the upstream sampling site. This study did not distinguish between genetic and environmental effects on morphology; however, the results suggest that downstream movement of juveniles soon after emergence is associated with differentiation in morphology and with the expression of life-history variation.

Seasonal variation of benthic macro invertebrates from Tons River of Garhwal Himalaya Uttarakhand.

PubMed

Negi, R K; Mamgain, Sheetal

2013-11-15

Present investigation was carried out to assess the seasonal variation of benthic macro-invertebrates from the Tons river, a tributary of Yamuna River in Garhwal Himalaya, Uttrakhand during December, 2007 to November, 2009. The seasonal benthic diversity was correlated with various physic-chemical parameters which documented that the macrobenthic diversity is mostly regulated by the dissolved oxygen in the water while temperature and free CO2 were found to be inversely correlated with the benthic fauna. Maximum diversity of benthos was reported at the upstream site ('H' 0.204) during the winter season while it was recorded minimum during the rainy season at all the sites. Maximum diversity is reported during the winter season at all the sites. The benthic fauna is represented by three phylum, 4 classes and 10 orders with Insecta emerging as the most dominant class. Maximum genera were reported from midstream site as it acts as ecotone between upstream and downstream.

Terrestrial Contributions to the Aquatic Food Web in the Middle Yangtze River

PubMed Central

Wang, Jianzhu; Gu, Binhe; Huang, Jianhui; Han, Xingguo; Lin, Guanghui; Zheng, Fawen; Li, Yuncong

2014-01-01

Understanding the carbon sources supporting aquatic consumers in large rivers is essential for the protection of ecological integrity and for wildlife management. The relative importance of terrestrial and algal carbon to the aquatic food webs is still under intensive debate. The Yangtze River is the largest river in China and the third longest river in the world. The completion of the Three Gorges Dam (TGD) in 2003 has significantly altered the hydrological regime of the middle Yangtze River, but its immediate impact on carbon sources supporting the river food web is unknown. In this study, potential production sources from riparian and the main river channel, and selected aquatic consumers (invertebrates and fish) at an upstream constricted-channel site (Luoqi), a midstream estuarine site (Huanghua) and a near dam limnetic site (Maoping) of the TGD were collected for stable isotope (δ13C and δ15N) and IsoSource analyses. Model estimates indicated that terrestrial plants were the dominant carbon sources supporting the consumer taxa at the three study sites. Algal production appeared to play a supplemental role in supporting consumer production. The contribution from C4 plants was more important than that of C3 plants at the upstream site while C3 plants were the more important carbon source to the consumers at the two impacted sites (Huanghua and Maoping), particularly at the midstream site. There was no trend of increase in the contribution of autochthonous production from the upstream to the downstream sites as the flow rate decreased dramatically along the main river channel due to the construction of TGD. Our findings, along with recent studies in rivers and lakes, are contradictory to studies that demonstrate the importance of algal carbon in the aquatic food web. Differences in system geomorphology, hydrology, habitat heterogeneity, and land use may account for these contradictory findings reported in various studies. PMID:25047656

Terrestrial contributions to the aquatic food web in the middle Yangtze River.

PubMed

Wang, Jianzhu; Gu, Binhe; Huang, Jianhui; Han, Xingguo; Lin, Guanghui; Zheng, Fawen; Li, Yuncong

2014-01-01

Understanding the carbon sources supporting aquatic consumers in large rivers is essential for the protection of ecological integrity and for wildlife management. The relative importance of terrestrial and algal carbon to the aquatic food webs is still under intensive debate. The Yangtze River is the largest river in China and the third longest river in the world. The completion of the Three Gorges Dam (TGD) in 2003 has significantly altered the hydrological regime of the middle Yangtze River, but its immediate impact on carbon sources supporting the river food web is unknown. In this study, potential production sources from riparian and the main river channel, and selected aquatic consumers (invertebrates and fish) at an upstream constricted-channel site (Luoqi), a midstream estuarine site (Huanghua) and a near dam limnetic site (Maoping) of the TGD were collected for stable isotope (δ13C and δ15N) and IsoSource analyses. Model estimates indicated that terrestrial plants were the dominant carbon sources supporting the consumer taxa at the three study sites. Algal production appeared to play a supplemental role in supporting consumer production. The contribution from C4 plants was more important than that of C3 plants at the upstream site while C3 plants were the more important carbon source to the consumers at the two impacted sites (Huanghua and Maoping), particularly at the midstream site. There was no trend of increase in the contribution of autochthonous production from the upstream to the downstream sites as the flow rate decreased dramatically along the main river channel due to the construction of TGD. Our findings, along with recent studies in rivers and lakes, are contradictory to studies that demonstrate the importance of algal carbon in the aquatic food web. Differences in system geomorphology, hydrology, habitat heterogeneity, and land use may account for these contradictory findings reported in various studies.

Assimilation of aged organic carbon in a glacial river food web

NASA Astrophysics Data System (ADS)

Fellman, J.; Hood, E. W.; Raymond, P. A.; Bozeman, M.; Hudson, J.; Arimitsu, M.

2013-12-01

Identifying the key sources of organic carbon supporting fish and invertebrate consumers is fundamental to our understanding of stream ecosystems. Recent laboratory bioassays highlight that aged organic carbon from glacier environments is highly bioavailable to stream bacteria relative to carbon originating from ice-free areas. However, there is little evidence suggesting that this aged, bioavailable organic carbon is also a key basal carbon source for stream metazoa. We used natural abundance of Δ14C, δ13C, and δ15N to determine if fish and invertebrate consumers are subsidized by aged organic carbon in a glacial river in southeast Alaska. We collected biofilm, leaf litter, three different species of macroinvertebrates, and resident juvenile salmonids from a reference stream and two sites (one site is directly downstream of the glacial outflow and one site is upstream of the tidal estuary) on the heavily glaciated Herbert River. Key producers, fish, and invertebrate consumers in the reference stream had carbon isotope values that ranged from -26 to -30‰ for δ13C and from -12 to 53‰ for Δ14C, reflecting a food web sustained mainly on contemporary primary production. In contrast, biofilm in the two glacial sites was highly Δ14C depleted (-203 to -215‰) relative to the reference site. Although biofilm may consist of both bacteria and benthic algae utilizing carbon depleted in Δ14C, δ13C values for biofilm (-24.1‰), dissolved inorganic carbon (-5.9‰), and dissolved organic carbon (-24.0‰) suggest that biofilm consist of bacteria sustained in part by glacier-derived, aged organic carbon. Invertebrate consumers (mean Δ14C of -80.5, mean δ13C of -26.5) and fish (mean Δ14C of -63.3, mean δ13C of -25.7) in the two glacial sites had carbon isotope values similar to biofilm. These results similarly show that aged organic carbon is incorporated into the metazoan food web. Overall, our findings indicate that continued watershed deglaciation and subsequent decreases in glacier runoff may shift support of stream food web structure from mainly aged organic carbon to that of one sustained by contemporary primary production. This may have previously unrecognized effects on the productivity and biodiversity of glacier stream ecosystems.

Spawning migration movements of Lost River and shortnose suckers in the Williamson and Sprague Rivers, Oregon, following the removal of Chiloquin Dam-2009 Annual Report

USGS Publications Warehouse

Ellsworth, Craig M.; VanderKooi, Scott P.

2011-01-01

The Chiloquin Dam was located at river kilometer (rkm) 1.3 on the Sprague River near the town of Chiloquin, Oregon. The dam was identified as a barrier that potentially inhibited or prevented the upstream spawning migrations and other movements of endangered Lost River suckers (Deltistes luxatus), shortnose suckers (Chasmistes brevirostris), and other fish in the Sprague River. Our research objectives in 2009 were to evaluate adult catostomid spawning migration patterns using radio telemetry to identify and describe shifts in spawning area distribution and migration behavior following the removal of Chiloquin Dam in 2008. We attached external radio transmitters to 58 Lost River suckers and 59 shortnose suckers captured at the Williamson River fish weir. A total of 17 radio-tagged Lost River suckers and one radio-tagged shortnose sucker were detected approaching the site of the former Chiloquin Dam but only two radio-tagged fish (one male Lost River sucker and one female Lost River sucker) were detected crossing upstream of the dam site. A lower proportion of radio-tagged shortnose suckers were detected migrating into the Sprague River when compared with previous years. Detections on remote passive integrated transponder (PIT) tag arrays located in the Sprague River show that although the proportion of fish coming into the Sprague River is small when compared to the number of fish crossing the Williamson River fish weir, the number of fish migrating upstream of the Chiloquin Dam site increased exponentially in the first year since its removal. These data will be used in conjunction with larval production and adult spawning distribution data to evaluate the effectiveness of dam removal in order to provide increased access to underutilized spawning habitat located further upstream in the Sprague River and to reduce the crowding of spawning fish below the dam site.

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Northeastern Florida Bay estuarine creek data, water years 1996-2000

USGS Publications Warehouse

Hittle, Clinton D.; Zucker, Mark A.

2004-01-01

From October 1995 to September 2000 (water years 1996-2000), continuous 15-minute stage, water velocity, salinity, and water temperature data were collected at seven estuarine creeks that flow into northeastern Florida Bay. These creeks include West Highway Creek, Stillwater Creek, Trout Creek, Mud Creek, Taylor River, Upstream Taylor River, and McCormick Creek. Discharge was computed at 15-minute intervals using mean water velocity and the cross-sectional area of the channel. Fifteen-minute unit values are presented for comparison of the quantity, quality, timing, and distribution of flows through the creeks. Revised discharge estimation formulas are presented for three noninstrumented sites (East Highway Creek, Oregon Creek and Stillwater Creek) that utilize an improved West Highway discharge rating. Stillwater Creek and Upstream Taylor River were originally noninstrumented sites; both were fully instrumented in 1999. Discharge rating equations are presented for these sites and were developed using a simple linear regression.

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

Routine versus aggressive upstream rhythm control for prevention of early atrial fibrillation in heart failure: background, aims and design of the RACE 3 study.

PubMed

Alings, M; Smit, M D; Moes, M L; Crijns, H J G M; Tijssen, J G P; Brügemann, J; Hillege, H L; Lane, D A; Lip, G Y H; Smeets, J R L M; Tieleman, R G; Tukkie, R; Willems, F F; Vermond, R A; Van Veldhuisen, D J; Van Gelder, I C

2013-07-01

Rhythm control for atrial fibrillation (AF) is cumbersome because of its progressive nature caused by structural remodelling. Upstream therapy refers to therapeutic interventions aiming to modify the atrial substrate, leading to prevention of AF. The Routine versus Aggressive upstream rhythm Control for prevention of Early AF in heart failure (RACE 3) study hypothesises that aggressive upstream rhythm control increases persistence of sinus rhythm compared with conventional rhythm control in patients with early AF and mild-to-moderate early systolic or diastolic heart failure undergoing electrical cardioversion. RACE 3 is a prospective, randomised, open, multinational, multicenter trial. Upstream rhythm control consists of angiotensin converting enzyme inhibitors and/or angiotensin receptor blockers, mineralocorticoid receptor antagonists, statins, cardiac rehabilitation therapy, and intensive counselling on dietary restrictions, exercise maintenance, and drug adherence. Conventional rhythm control consists of routine rhythm control therapy without cardiac rehabilitation therapy and intensive counselling. In both arms, every effort is made to keep patients in the rhythm control strategy, and ion channel antiarrhythmic drugs or pulmonary vein ablation may be instituted if AF relapses. Total inclusion will be 250 patients. If upstream therapy proves to be effective in improving maintenance of sinus rhythm, it could become a new approach to rhythm control supporting conventional pharmacological and non-pharmacological rhythm control.

Moving Upstream in U.S. Hospital Care Toward Investments in Population Health.

PubMed

Begun, James W; Potthoff, Sandra

The root causes for most health outcomes are often collectively referred to as the social determinants of health. Hospitals and health systems now must decide how much to "move upstream," or invest in programs that directly affect the social determinants of health. Moving upstream in healthcare delivery requires an acceptance of responsibility for the health of populations. We examine responses of 950 nonfederal, general hospitals in the United States to the 2015 American Hospital Association Population Health Survey to identify characteristics that distinguish those hospitals that are most aligned with population health and most engaged in addressing social determinants of health. Those "upstream" hospitals are significantly more likely to be large, not-for-profit, metropolitan, teaching-affiliated, and members of systems. Internally, the more upstream hospitals are more likely to organize their population health activities with strong executive-level involvement, full-time-equivalent support, and coordination at the system level.The characteristics differentiating hospitals strongly involved in population health and upstream activity are not unlike those characteristics associated with diffusion of many innovations in hospitals. These hospitals may be the early adopters in a diffusion process that will eventually include most hospitals or, at least, most not-for-profit hospitals. Alternatively, the population health and social determinants movements could be transient or could be limited to a small portion of hospitals such as those identified here, with distinctive patient populations, missions, and resources.

Cryptosporidium source tracking in the Potomac River watershed - MCEARD

EPA Science Inventory

To better characterize Cryptosporidium in the Potomac River watershed, a PCR-based genotyping tool was used to analyze 64 base-flow and 28 storm-flow samples from five sites within the watershed. These sites included two water treatment plant intakes as well as three upstream si...

Effects of backpacker use, pack stock trail use, and pack stock grazing on water-quality indicators, including nutrients, E. coli, hormones, and pharmaceuticals, in Yosemite National Park, USA

USGS Publications Warehouse

Forrester, Harrison; Clow, David W.; Roche, James W.; Heyvaert, Alan C.; Battaglin, William A.

2017-01-01

We investigated how visitor-use affects water quality in wilderness in Yosemite National Park. During the summers of 2012–2014, we collected and analyzed surface-water samples for water-quality indicators, including fecal indicator bacteria Escherichia coli, nutrients (nitrogen, phosphorus, carbon), suspended sediment concentration, pharmaceuticals, and hormones. Samples were collected upstream and downstream from different types of visitor use at weekly to biweekly intervals and during summer storms. We conducted a park-wide synoptic sampling campaign during summer 2014, and sampled upstream and downstream from meadows to evaluate the mitigating effect of meadows on water quality. At pack stock stream crossings, Escherichia coli concentrations were greater downstream from crossings than upstream (median downstream increase in Escherichia coli of three colony forming units 100 mL−1), with the greatest increases occurring during storms (median downstream increase in Escherichia coli of 32 CFU 100 mL−1). At backpacker use sites, hormones, and pharmaceuticals (e.g., insect repellent) were detected at downstream sites, and Escherichia coli concentrations were greater at downstream sites (median downstream increase in Escherichia coli of 1 CFU 100 mL−1). Differences in water quality downstream vs. upstream from meadows grazed by pack stock were not detectable for most water-quality indicators, however, Escherichia coli concentrations decreased downstream, suggesting entrapment and die-off of fecal indicator bacteria in meadows. Our results indicate that under current-use levels pack stock trail use and backpacker use are associated with detectable, but relatively minor, effects on water quality, which are most pronounced during storms.

Effects of Backpacker Use, Pack Stock Trail Use, and Pack Stock Grazing on Water-Quality Indicators, Including Nutrients, E. coli, Hormones, and Pharmaceuticals, in Yosemite National Park, USA

NASA Astrophysics Data System (ADS)

Forrester, Harrison; Clow, David; Roche, James; Heyvaert, Alan; Battaglin, William

2017-09-01

We investigated how visitor-use affects water quality in wilderness in Yosemite National Park. During the summers of 2012-2014, we collected and analyzed surface-water samples for water-quality indicators, including fecal indicator bacteria Escherichia coli, nutrients (nitrogen, phosphorus, carbon), suspended sediment concentration, pharmaceuticals, and hormones. Samples were collected upstream and downstream from different types of visitor use at weekly to biweekly intervals and during summer storms. We conducted a park-wide synoptic sampling campaign during summer 2014, and sampled upstream and downstream from meadows to evaluate the mitigating effect of meadows on water quality. At pack stock stream crossings, Escherichia coli concentrations were greater downstream from crossings than upstream (median downstream increase in Escherichia coli of three colony forming units 100 mL-1), with the greatest increases occurring during storms (median downstream increase in Escherichia coli of 32 CFU 100 mL-1). At backpacker use sites, hormones, and pharmaceuticals (e.g., insect repellent) were detected at downstream sites, and Escherichia coli concentrations were greater at downstream sites (median downstream increase in Escherichia coli of 1 CFU 100 mL-1). Differences in water quality downstream vs. upstream from meadows grazed by pack stock were not detectable for most water-quality indicators, however, Escherichia coli concentrations decreased downstream, suggesting entrapment and die-off of fecal indicator bacteria in meadows. Our results indicate that under current-use levels pack stock trail use and backpacker use are associated with detectable, but relatively minor, effects on water quality, which are most pronounced during storms.

[Spatial distribution characteristics of the physical and chemical properties of water in the Kunes River after the supply of snowmelt during spring].

PubMed

Liu, Xiang; Guo, Ling-Peng; Zhang, Fei-Yun; Ma, Jie; Mu, Shu-Yong; Zhao, Xin; Li, Lan-Hai

2015-02-01

Eight physical and chemical indicators related to water quality were monitored from nineteen sampling sites along the Kunes River at the end of snowmelt season in spring. To investigate the spatial distribution characteristics of water physical and chemical properties, cluster analysis (CA), discriminant analysis (DA) and principal component analysis (PCA) are employed. The result of cluster analysis showed that the Kunes River could be divided into three reaches according to the similarities of water physical and chemical properties among sampling sites, representing the upstream, midstream and downstream of the river, respectively; The result of discriminant analysis demonstrated that the reliability of such a classification was high, and DO, Cl- and BOD5 were the significant indexes leading to this classification; Three principal components were extracted on the basis of the principal component analysis, in which accumulative variance contribution could reach 86.90%. The result of principal component analysis also indicated that water physical and chemical properties were mostly affected by EC, ORP, NO3(-) -N, NH4(+) -N, Cl- and BOD5. The sorted results of principal component scores in each sampling sites showed that the water quality was mainly influenced by DO in upstream, by pH in midstream, and by the rest of indicators in downstream. The order of comprehensive scores for principal components revealed that the water quality degraded from the upstream to downstream, i.e., the upstream had the best water quality, followed by the midstream, while the water quality at downstream was the worst. This result corresponded exactly to the three reaches classified using cluster analysis. Anthropogenic activity and the accumulation of pollutants along the river were probably the main reasons leading to this spatial difference.

Concentrations and ratios of Sr, Ba and Ca along an estuarine river to the Gulf of Mexico - implication for sea level rise effects on trace metal distribution

NASA Astrophysics Data System (ADS)

He, S.; Xu, Y. J.

2015-11-01

Strontium and barium to calcium ratios are often used as proxies for tracking animal movement across salinity gradients. As sea level rise continues, many estuarine rivers in the world face saltwater intrusion, which may cause changes in mobility and distribution of these metals upstream. Despite intensive research on metal adsorption and desorption in marine systems, knowledge of the spatiotemporal distribution of these elements along estuarine rivers is still limited. In this study, we conducted an intensive monitoring of Sr and Ba dynamics along an 88 km long estuary, the Calcasieu River in South Louisiana, USA, which has been strongly affected by saltwater intrusion. Over the period from May 2013 to August 2015, we collected monthly water samples and performed in-situ water quality measurements at six sites from the upstream to the river mouth, with a salinity range from 0.02 to 29.50 ppt. Water samples were analyzed for Sr, Ba, and Ca concentrations. In-situ measurements were made on salinity, pH, water temperature, dissolved oxygen concentration, and specific conductance. We found that the Sr and Ca concentrations and the Sr / Ca ratio all increased significantly with increasing salinity. The average Sr concentration at the site closest to the Gulf of Mexico (site 6) was 46.21 μmol L-1, which was about 130 times higher than that of the site furthest upstream (site 1, 0.35 μmol L-1). The average Ca concentration at site 6 was 8.19 mmol L-1, which was about 60 times higher than that of site 1 (0.13 mmol L-1). The average Sr / Ca ratio at site 6 (8.41 mmol mol-1) was about 3 times the average Sr / Ca ratio at site 1 (2.89 mmol mol-1). However, the spatial variation in Ba concentration was marginal, varying from 0.36 μmol L-1 at site 6 to 0.47 at site 5. The average Ba / Ca ratio at site 1 (4.82 mmol mol-1) was about 54 times the average Ba / Ca ratio at site 6 (0.09 mmol mol-1), showing a clear negative relation between the Ba / Ca ratio and increasing salinity. All the elemental concentrations and ratios had considerable seasonal variations, with significant differences among sampling months for the Sr, Ba concentrations and the Ba / Ca ratio (p < 0.01). The results from this study suggest that concentrations of Sr and Ca in the world's estuaries will very likely increase in the future as sea level rise continues. For low-gradient estuarine rivers such as the Calcasieu River in South Louisiana, USA, water chemistry upstream would experience substantial Sr and Ca enrichment, which could affect aquatic environments and biological communities.

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

NASA Astrophysics Data System (ADS)

Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

1994-07-01

We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

Occurrence of organic wastewater compounds in drinking water, wastewater effluent, and the Big Sioux River in or near Sioux Falls, South Dakota, 2001-2004

USGS Publications Warehouse

Sando, Steven K.; Furlong, Edward T.; Gray, James L.; Meyer, Michael T.

2006-01-01

The U.S. Geological Survey (USGS) in cooperation with the city of Sioux Falls conducted several rounds of sampling to determine the occurrence of organic wastewater compounds (OWCs) in the city of Sioux Falls drinking water and waste-water effluent, and the Big Sioux River in or near Sioux Falls during August 2001 through May 2004. Water samples were collected during both base-flow and storm-runoff conditions. Water samples were collected at 8 sites, which included 4 sites upstream from the wastewater treatment plant (WWTP) discharge, 2 sites downstream from the WWTP discharge, 1 finished drinking-water site, and 1 WWTP effluent (WWE) site. A total of 125 different OWCs were analyzed for in this study using five different analytical methods. Analyses for OWCs were performed at USGS laboratories that are developing and/or refining small-concentration (less than 1 microgram per liter (ug/L)) analytical methods. The OWCs were classified into six compound classes: human pharmaceutical compounds (HPCs); human and veterinary antibiotic compounds (HVACs); major agricultural herbicides (MAHs); household, industrial,and minor agricultural compounds (HIACs); polyaromatic hydrocarbons (PAHs); and sterol compounds (SCs). Some of the compounds in the HPC, MAH, HIAC, and PAH classes are suspected of being endocrine-disrupting compounds (EDCs). Of the 125 different OWCs analyzed for in this study, 81 OWCs had one or more detections in environmental samples reported by the laboratories, and of those 81 OWCs, 63 had acceptable analytical method performance, were detected at concentrations greater than the study reporting levels, and were included in analyses and discussion related to occurrence of OWCs in drinking water, wastewater effluent, and the Big Sioux River. OWCs in all compound classes were detected in water samples from sampling sites in the Sioux Falls area. For the five sampling periods when samples were collected from the Sioux Falls finished drinking water, only one OWC was detected at a concentration greater than the study reporting level (metolachlor; 0.0040 ug/L). During base-flow conditions, Big Sioux River sites upstream from the WWTP discharge had OWC contributions that primarily were from nonpoint animal or crop agriculture sources or had OWC concentrations that were minimal. The influence of the WWTP discharge on OWCs at downstream river sites during base-flow conditions ranged from minimal influence to substantial influence depending on the sampling period. During runoff conditions, OWCs at sites upstream from the WWTP discharge probably were primarily contributed by nonpoint animal and/or crop agriculture sources and possibly by stormwater runoff from nearby roads. OWCs at sites downstream from the WWTP discharge probably were contributed by sources other than the WWTP effluent discharge, such as stormwater runoff from urban and/or agriculture areas and/or resuspension of OWCs adsorbed to sediment deposited in the Big Sioux River. OWC loads generally were substantially smaller for upstream sites than downstream sites during both base-flow and runoff conditions.discharge had OWC contributions that primarily were from nonpoint animal or crop agriculture sources or had OWC concentrations that were minimal. The influence of the WWTP discharge on OWCs at downstream river sites during base-flow conditions ranged from minimal influence to substantial influence depending on the sampling period. During runoff conditions, OWCs at sites upstream from the WWTP discharge probably were primarily contributed by nonpoint animal and/or crop agriculture sources and possibly by stormwater runoff from nearby roads. OWCs at sites downstream from the WWTP discharge probably were contributed by sources other than the WWTP effluent discharge, such as stormwater runoff from urban and/or agriculture areas and/or resuspension of OWCs adsorbed to sediment deposited in the Big Sioux River. OWC loads generally were substantially smaller for

Proceedings of a workshop on American Eel passage technologies

USGS Publications Warehouse

Haro, Alexander J.

2013-01-01

Recent concerns regarding a decline in recruitment of American eels (Anguilla rostrata) have prompted efforts to restore this species to historic habitats by providing passage for both upstream migrant juveniles and downstream migrant adults at riverine barriers, including low-head and hydroelectric dams (Castonguay et al. 1994, Haro et al. 2000). These efforts include development of management plans and stock assessment reviews in both the US and Canada (COSEWIC 2006, Canadian Eel Working Group 2009, DFO 2010, MacGregor et al. 2010, ASMFC 2000, ASMFC 2006, ASMFC 2008, Williams and Threader 2007), which target improvement of upstream and downstream passage for eels, as well as identification and prioritization of research needs for development of new and more effective passage technologies for American eels. Traditional upstream fish passage structures, such as fishways and fish lifts, are often ineffective passing juvenile eels, and specialized passage structures for this species are needed. Although designs for such passage structures are available and diverse (Knights and White 1998, Porcher 2002, FAO/DVWK 2002, Solomon and Beach 2004a,b, Environment Agency UK 2011), many biologists, managers, and engineers are unfamiliar with eel pass design and operation, or unaware of the technical options available for upstream eel passage, Better coordination is needed to account for eel passage requirements during restoration efforts for other diadromous fish species. Also, appropriately siting eel passes at hydropower projects is critical, and siting can be difficult and complex due to physical restrictions in access to points of natural concentrations of eels, dynamic hydraulics of tailrace areas, and presence of significant competing flows from turbine outfalls or spill. As a result, some constructed eel passes are sited poorly and may pass only a fraction of the number of eels attempting to pass the barrier. When sited and constructed appropriately, however, eel passes can effectively pass thousands of individuals in a season (Appendix D). technologies for preventing impingement and entrainment mortality and injury of downstream migrant eels at hydropower projects are not well developed. Traditional downstream fish passage mitigative techniques originally developed for salmonids and other species are frequently ineffective passing eels (Richkus and Dixon 2003, EPRI 2001, Bruijs and Durif 2009). Large hydropower projects, with high project flows or intake openings that cannot be fitted with racks or screens with openings small enough to exclude eels, pose significant passage problems for this species, and turbine impingement and entrainment mortality of eels can be as high as 100%. Spill mortality and injury may also be significant for eels, given their tendency to move during high flow events when projects typically spill large amounts of flow. Delays in migration of eels that have difficulty locating and utilizing bypass entrances can also be significant. Therefore, downstream passage technologies are at a much more nebulous state of development than upstream passage technologies, and require further evaluation and improvement before rigorous design guidelines can be established. There have been few studies conducted to evaluate effectiveness of current mitigative measures for both upstream and downstream passage of eels. Research is needed to determine eel migratory timing, behavior, and appropriate mitigation technologies for specific sites and eel life history stages. Both upstream and downstream eel passage structures can be difficult to evaluate in terms of performance, and examples of how evaluation and monitoring can be accomplished were reviewed at the workshop.

In situ impact assessment of wastewater effluents by integrating multi-level biomarker responses in the pale chub (Zacco platypus).

PubMed

Kim, Woo-Keun; Jung, Jinho

2016-06-01

The integration of biomarker responses ranging from the molecular to the individual level is of great interest for measuring the toxic effects of hazardous chemicals or effluent mixtures on aquatic organisms. This study evaluated the effects of wastewater treatment plant (WWTP) effluents on the freshwater pale chub Zacco platypus by using multi-level biomarker responses at molecular [mRNA expression of catalase (CAT), superoxide dismutase (SOD), glutathione S-transferase (GST), and metallothionein (MT)], biochemical (enzyme activities of CAT, SOD, GST, and concentration of MT), and physiological [condition factor (CF) and liver somatic index (LSI)] levels. The mRNA expression levels of GST and MT in Z. platypus from a site downstream of a WWTP significantly increased by 2.2- and 4.5-fold (p<0.05) when compared with those from an upstream site. However, the enzyme activities of CAT, SOD, and GST in fish from the downstream site significantly decreased by 43%, 98%, and 13%, respectively (p<0.05), except for an increase in MT concentration (41%). In addition, a significant increase in LSI (46%) was observed in Z. platypus from the downstream site (p<0.05). Concentrations of Cu, Zn, Cd, and Pb in the liver of Z. platypus were higher (530%, 353%, 800%, and 2,200%, respectively) in fish from a downstream site than in fish from an upstream location, and several multi-level biomarker responses were significantly correlated with the accumulated metals in Z. platypus (p<0.05). Integrated biomarker responses at molecular, biochemical, and physiological levels (multi-level IBR) were much higher (about 4-fold) at the downstream site than at the upstream site. This study suggests that the multi-level IBR approach is very useful for quantifying in situ adverse effects of WWTP effluents. Copyright © 2016 Elsevier Inc. All rights reserved.

Immediate changes in stream channel geomorphology, aquatic habitat, and fish assemblages following dam removal in a small upland catchment

NASA Astrophysics Data System (ADS)

Magilligan, F. J.; Nislow, K. H.; Kynard, B. E.; Hackman, A. M.

2016-01-01

Dam removal is becoming an increasingly important component of river restoration, with > 1100 dams having been removed nationwide over the past three decades. Despite this recent progression of removals, the lack of pre- to post-removal monitoring and assessment limits our understanding of the magnitude, rate, and sequence of geomorphic and/or ecological recovery to dam removal. Taking advantage of the November 2012 removal of an old ( 190 year-old) 6-m high, run-of-river industrial dam on Amethyst Brook (26 km2) in central Massachusetts, we identify the immediate eco-geomorphic responses to removal. To capture the geomorphic responses to dam removal, we collected baseline data at multiple scales, both upstream ( 300 m) and downstream (> 750 m) of the dam, including monumented cross sections, detailed channel-bed longitudinal profiles, embeddedness surveys, and channel-bed grain size measurements, which were repeated during the summer of 2013. These geomorphic assessments were combined with detailed quantitative electrofishing surveys of stream fish richness and abundance above and below the dam site and throughout the watershed and visual surveys of native anadromous sea lamprey (Petromyzon marinus) nest sites. Post-removal assessments were complicated by two events: (1) upstream knickpoint migration exhumed an older (ca. late eighteenth century) intact wooden crib dam 120 m upstream of the former stone dam, and (2) the occurrence of a 10-20 year RI flood 6 months after removal that caused further upstream incision and downstream aggradation. Now that the downstream reach has been reconnected to upstream sediment supply, the predominant geomorphic response was bed aggradation and associated fining (30-60% reduction). At dam proximal locations, aggradation ranged from 0.3 to > 1 m where a large woody debris jam enhanced aggradation. Although less pronounced, distal locations still showed aggradation with a mean depth of deposition of 0.20 m over the 750-m downstream reach. Post-removal, but pre-flood, bed surveys indicate 2 m of incision had migrated 25 m upstream of the former reservoir before encountering the exhumed dam, which now acts as the new grade control, limiting progressive headcutting. Approximately 1000 m3 of sediment was evacuated in the first year, with 67% of the volume occurring by pre-flood, process-driven (e.g., changes in base level) controls. The combination of changes in channel-bed sedimentology, the occurrence of a large magnitude flood, and the emergence of the new crib dam that is a likely barrier to fish movement was associated with major reductions in abundance and richness in sites downstream and immediately upstream adjacent to the former dam in post-removal sampling. At the same time, we documented the presence of four species of fish, including sea lamprey, which were not present above the dam prior to removal, indicating that upstream passage has been achieved; and we also documented lamprey spawning activity at sites immediately below the dam, which had previously been unsuitable owing to an excessively coarse and armored riverbed. Our results point to the importance of interactions between dam removal and flood disturbance effects, with important implications for short- and long-term monitoring and assessment of dam impacts to river systems.

The "WFD-effect" on upstream-downstream relations in international river basins - insights from the Rhine and the Elbe basins

NASA Astrophysics Data System (ADS)

Moellenkamp, S.

2007-06-01

The upstream-downstream relationship in international river basins is a traditional challenge in water management. Water use in upstream countries often has a negative impact on water use in downstream countries. This is most evident in the classical example of industrial pollution in upstream countries hindering drinking water production downstream. The European Water Framework Directive (WFD) gives new impetus to the river basin approach and to international co-operation in European catchments. It aims at transforming a mainly water quality oriented management into a more integrated approach of ecosystem management. After discussing the traditional upstream-downstream relationship, this article shows that the WFD has a balancing effect on upstream-downstream problems and that it enhances river basin solidarity in international basins. While it lifts the downstream countries to the same level as the upstream countries, it also leads to new duties for the downstream states. Following the ecosystem approach, measures taken by downstream countries become increasingly more important. For example, downstream countries need to take measures to allow for migrating fish species to reach upstream stretches of river systems. With the WFD, fish populations receive increased attention, as they are an important indicator for the ecological status. The European Commission acquires a new role of inspection and control in river basin management, which finally also leads to enhanced cooperation and solidarity among the states in a basin. In order to achieve better water quality and to mitigate upstream-downstream problems, also economic instruments can be applied and the WFD does not exclude the possibility of making use of financial compensations, if at the same time the polluter pays principle is taken into account. The results presented in this article originate from a broader study on integrated water resources management conducted at Bonn University and refer to the Rhine and Elbe basins (Moellenkamp, 2006).

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

PubMed

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Effect of hepatic venous sphincter contraction on transmission of central venous pressure to lobar and portal pressure.

PubMed

Lautt, W W; Legare, D J; Greenway, C V

1987-11-01

In dogs anesthetized with pentobarbital, central vena caval pressure (CVP), portal venous pressure (PVP), and intrahepatic lobar venous pressure (proximal to the hepatic venous sphincters) were measured. The objective was to determine some characteristics of the intrahepatic vascular resistance sites (proximal and distal to the hepatic venous sphincters) including testing predictions made using a recent mathematical model of distensible hepatic venous resistance. The stimulus used was a brief rise in CVP produced by transient occlusion of the thoracic vena cava in control state and when vascular resistance was elevated by infusions of norepinephrine or histamine, or by nerve stimulation. The percent transmission of the downstream pressure rise to upstream sites past areas of vascular resistance was elevated. Even small increments in CVP are partially transmitted upstream. The data are incompatible with the vascular waterfall phenomenon which predicts that venous pressure increments are not transmitted upstream until a critical pressure is overcome and then further increments would be 100% transmitted. The hepatic sphincters show the following characteristics. First, small rises in CVP are transmitted less than large elevations; as the CVP rises, the sphincters passively distend and allow a greater percent transmission upstream, thus a large rise in CVP is more fully transmitted than a small rise in CVP. Second, the amount of pressure transmission upstream is determined by the vascular resistance across which the pressure is transmitted. As nerves, norepinephrine, or histamine cause the hepatic sphincters to contract, the percent transmission becomes less and the distensibility of the sphincters is reduced. Similar characteristics are shown for the "presinusoidal" vascular resistance and the hepatic venous sphincter resistance.(ABSTRACT TRUNCATED AT 250 WORDS)

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

Mount St. Helens Long-Term Sediment Management Plan for Flood Risk Reduction

DTIC Science & Technology

2010-06-01

one dredge would direct pump to the Wasser Winters disposal site, located along the southern bank of the Cowlitz River mouth. The average annual...dredge would pipeline pump either upstream to disposal site 20cde or downstream to the Wasser Winters site. Pumping distances would not exceed 6.0...estimates referenced the Wasser Winters upland preparation estimates and were based on the relationship between acreage and effort. Total site

Community and Ecosystem-Level Impacts of an Emergent Macrophyte on the Ventura River, California.

NASA Astrophysics Data System (ADS)

Simpson, J.; Leydecker, A.; Melack, J.

2005-05-01

Ludwigia hexapetala is a pervasive, emergent vascular plant on the lower Ventura River. Presence of this plant appears to facilitate growth of shade-tolerant diatoms, while indirectly inhibiting filamentous green macroalgae. Four sites on the river were monitored during 2003; three downstream of a wastewater treatment plant, where Ludwigia is present, and one upstream site where it is absent. Filamentous algae occurred at all four sites, but declined rapidly at the below-treatment plant sites as growth and cover of vascular plants increased. By late summer, percent cover at these sites was dominated by Ludwigia, while the upstream site was consistently dominated by green macroalgae. Submerged plant parts provided substrate for diatom colonization, roughly doubling benthic diatom biomass (measured as chlorophyll a) at the downstream sites. Presence of the Ludwigia population also had strong ecosystem-level effects. The wastewater effluent produced typical stream water nitrate concentrations of 100-200 uM. Nitrate uptake rates downstream of the treatment plant inputs averaged 5 kg N/km/day, and direct uptake by Ludwigia could account for 20-40% of this nitrate drawdown. Further nitrate removal from the water column may be indirectly facilitated by the presence of Ludwigia through facilitation of diatom population growth.

Assessment of Surface Water Contamination from Coalbed Methane Fracturing-Derived Volatile Contaminants in Sullivan County, Indiana, USA.

PubMed

Meszaros, Nicholas; Subedi, Bikram; Stamets, Tristan; Shifa, Naima

2017-09-01

There is a growing concern over the contamination of surface water and the associated environmental and public health consequences from the recent proliferation of hydraulic fracturing in the USA. Petroleum hydrocarbon-derived contaminants of concern [benzene, toluene, ethylbenzene, and xylenes (BTEX)] and various dissolved cations and anions were spatially determined in surface waters around 15 coalbed methane fracking wells in Sullivan County, IN, USA. At least one BTEX compound was detected in 69% of sampling sites (n = 13) and 23% of sampling sites were found to be contaminated with all of the BTEX compounds. Toluene was the most common BTEX compound detected across all sampling sites, both upstream and downstream from coalbed methane fracking wells. The average concentration of toluene at a reservoir and its outlet nearby the fracking wells was ~2× higher than other downstream sites. However, one of the upstream sites was found to be contaminated with BTEX at similar concentrations as in a reservoir site nearby the fracking well. Calcium (~60 ppm) and sulfates (~175 ppm) were the dominant cations and anions, respectively, in surface water around the fracking sites. This study represents the first report of BTEX contamination in surface water from coalbed methane hydraulic fracturing wells.

Streamflow and Water-Quality Characteristics for Wind Cave National Park, South Dakota, 2002-03

USGS Publications Warehouse

Heakin, Allen J.

2004-01-01

A 2-year study of streamflow and water-quality characteristics in Wind Cave National Park was performed by the U.S. Geological Survey in cooperation with the National Park Service. During this study, streamflow and water-quality data were collected for three of the park's perennial streams (Cold Spring, Beaver, and Highland Creeks) from January 2002 through November 2003. The potential influence of parking lot runoff on cave drip within Wind Cave also was investigated by collecting and analyzing several time-dependent samples from a drainage culvert downstream from the parking lot and from Upper Minnehaha Falls inside the cave following a series of simulated runoff events. The primary focus of the report is on data collected during the 2-year study from January 2002 to November 2003; however, data collected previously also are summarized. Losing reaches occur on both Beaver and Highland Creeks as these streams flow across outcrops of bedrock aquifers within the park. No streamflow losses occur along Cold Spring Creek because its confluence with Beaver Creek is located upstream from the outcrop of the Madison aquifer, where most streamflow losses occur. Physical properties, major ions, trace elements, nutrients, bacteria, benthic macroinvertebrates, organic (wastewater) compounds, bottom sediment, and suspended sediment are summarized for samples collected from 2 sites on Cold Spring Creek, 2 sites on Beaver Creek, and 1 site on Highland Creek. None of the constituent concentrations for any of the samples collected during 2002-03 exceeded any of the U.S. Environmental Protection Agency drinking-water standards, with the exception of the Secondary Maximum Contaminant Level for pH, which was exceeded in numerous samples from Beaver Creek and Highland Creek. Additionally, the pH values in several of these same samples also exceeded beneficial-use criteria for coldwater permanent fisheries and coldwater marginal fisheries. Water temperature exceeded the coldwater permanent fisheries criterion in numerous samples from all three streams. Two samples from Highland Creek also exceeded the coldwater marginal fisheries criterion for water temperature. Mean concentrations of ammonia, orthophosphate, and phosphorous were higher for the upstream site on Beaver Creek than for other water-quality sampling sites. Concentrations of E. coli, fecal coliform, and total coliform bacteria also were higher at the upstream site on Beaver Creek than for any other site. Samples for the analysis of benthic macroinvertebrates were collected from one site on each of the three streams during July 2002 and May 2003. The benthic macroinvertebrate data showed that Beaver Creek had lower species diversity and a higher percentage of tolerant species than the other two streams during 2002, but just the opposite was found during 2003. However, examination of the complete data set indicates that the quality of water at the upstream site was generally poorer than the quality of water at the downstream site. Furthermore, the quality of water at the upstream site on Beaver Creek is somewhat degraded when compared to the quality of water from Highland and Cold Spring Creeks, indicating that anthropogenic activities outside the park probably are affecting the quality of water in Beaver Creek. Samples for the analysis of wastewater compounds were collected at least twice from four of the five water-quality sampling sites. Bromoform, phenol, caffeine, and cholesterol were detected in samples from Cold Spring Creek, but only phenol was detected at concentrations greater than the minimum reporting level. Concentrations of several wastewater compounds were estimated in samples collected from sites on Beaver Creek, including phenol, para-cresol, and para-nonylphenol-total. Phenol was detected at both sites on Beaver Creek at concentrations greater than the minimum reporting level. Bromoform; para-cresol; ethanol,2-butoxy-phosphate; and cholesterol were detected

3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

PubMed Central

Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

2016-01-01

Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

Beaver lodge location on the upstream Loire River.

PubMed

Fustec, Joëlle; Cormier, Jean-Paul; Lodé, Thierry

2003-08-01

In the part of the Loire River recently colonized by Eurasian beavers, we compared habitat characteristics among sites with lodges, sites with cut trees and sites without beaver. The absence of sandbank and canopy cover (by 10-15-m tall trees, by tall Salicaceae, and by bushy Salicaceae) appeared as good predictors for lodge settling. Based on this model, the number of proper lodge sites was estimated for the next downstream 36 kilometers stretch. The number of favourable sites decreases as anthropization increases.

Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

PubMed Central

Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

2005-01-01

Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

Evaluation of Streamflow Gain-Loss Characteristics of Hubbard Creek, in the Vicinity of a Mine-Permit Area, Delta County, Colorado, 2007

USGS Publications Warehouse

Ruddy, Barbara C.; Williams, Cory A.

2007-01-01

In 2007, the U.S. Geological Survey, in cooperation with Bowie Mining Company, initiated a study to characterize the streamflow and streamflow gain-loss in a reach of Hubbard Creek in Delta County, Colorado, in the vicinity of a mine-permit area planned for future coal mining. Premining streamflow characteristics and streamflow gain-loss variation were determined so that pre- and postmining gain-loss characteristics could be compared. This report describes the methods used in this study and the results of two streamflow-measurement sets collected during low-flow conditions. Streamflow gain-loss measurements were collected using rhodamine WT and sodium bromide tracers at four sites spanning the mine-permit area on June 26-28, 2007. Streamflows were estimated and compared between four measurement sites within three stream subreaches of the study reach. Data from two streamflow-gaging stations on Hubbard Creek upstream and downstream from the mine-permit area were evaluated. Streamflows at the stations were continuous, and flow at the upstream station nearly always exceeded the streamflow at the downstream station. Furthermore, streamflow at both stations showed similar diurnal patterns with traveltime offsets. On June 26, streamflow from the gain-loss measurements was greater at site 1 (most upstream site) than at site 4 (most downstream site); on June 27, streamflow was greater at site 4 than at site 2; and on June 27, there was no difference in streamflow between sites 2 and 3. Data from streamflow-gaging stations 09132940 and 09132960 showed diurnal variations and overall decreasing streamflow over time. The data indicate a dynamic system, and streamflow can increase or decrease depending on hydrologic conditions. The streamflow within the study reach was greater than the streamflows at either the upstream or downstream stations. A second set of gain-loss measurements was collected at sites 2 and 4 on November 8-9, 2007. On November 8, streamflow was greater at site 4 than at site 2, and on the following day, November 9, streamflow was greater at site 2 than at site 4. Data collection on November 8 occurred while the streamflow was increasing due to contributions from stream ice melting throughout different parts of the basin. Data collection on November 9 occurred earlier in the day with less stream ice melting and more steady-state conditions, so the indication that streamflow decreased between sites 2 and 4 may be more accurate. Diurnal variations in streamflow are common at both the upper and the lower streamflow-gaging stations. The upper streamflow-gaging station shows a melt-freeze influence from tributaries to Hubbard Creek during the winter season. Downstream from the study reach, observed diurnal variation is likely due to evapotranspiration associated with dense flood-plain vegetation, which consumes water from the creek during the middle of the day. Varying diurnal patterns in streamflow, combined with possible variations in tributary inflows to Hubbard Creek in the study reach, probably account for the observed variations in streamflow at the tracer measurement sites. During both sampling periods in June and November 2007, conditions were less than ideal and not steady state. The June 27 sampling indicates that the streamflow was increasing between measurement sites 2 and 4, and the November 9 sampling indicates that the streamflow was decreasing between measurement sites 2 and 4. The data collected during the diurnal and day-to-day variations in streamflow indicated that the streamflow reach is dynamic and can be gaining, losing, or constant.

Inhibition of erythrocytes δ-aminolevulinic acid dehydratase (ALAD) activity in fish from waters affected by lead smelters

USGS Publications Warehouse

Schmitt, Christopher J.; Caldwell, Colleen A.; Olsen, Bill; Serdar, Dave; Coffey, Mike

2002-01-01

We assessed the effects on fish of lead (Pb) released to streamsby smelters located in Trail, BC (Canada), E. Helena, MT, Herculaneum, MO, and Glover, MO. Fish were collected by electrofishing from sites located downstream of smelters and from reference sites. Blood from each fish was analyzed for δ-aminolevulinic acid dehydratase (ALAD) activity and hemoglobin (Hb), and samples of blood, liver, or carcass were analyzed for Pb, zinc (Zn), or both. Fish collected downstreamof all four smelters sites had elevated Pb concentrations, decreased ALAD activity, or both relative to their respectivereference sites. At E. Helena, fish from the downstream site also had lower Hb concentrations than fish from upstream. Differences among taxa were also apparent. Consistent with previous studies, ALAD activity in catostomids (Pisces: Catostomidae-northern hog sucker,Hypentelium nigricans;river carpsucker, Carpiodes carpio; largescale sucker, Catostomus macrocheilus; and mountain sucker, C. platyrhynchus) seemed more sensitive to Pb-induced ALADinhibition than the salmonids (Pisces: Salmonidae-rainbow trout,Oncorhynchus mykiss; brook trout,Salvelinus fontinalis) or common carp (Cyprinus carpio). Some of these differences may have resulted from differential accumulation of Zn, which was not measured at all sites. We detected noALAD activity in channel catfish (Ictaluruspunctatus) from either site on the Mississippi River at Herculaneum, MO. Our findings confirmed that Pb is releasedto aquatic ecosystems by smelters and accumulated by fish, andwe documented potentially adverse effects of Pb in fish. We recommend that Zn be measured along with Pb when ALAD activityis used as a biomarker and the collection of at least 10 fish ofa species at each site to facilitate statistical analysis.

[Research on the application of in-situ biological stabilization solidification technology in chromium contaminated site management].

PubMed

Zhang, Jian-rong; Li, Juan; Xu, Wei

2013-09-01

In-situ biological stabilization solidification (SS) technology is an effective ground water risk control method for chromium contaminated sites. Through on-site engineering test, this paper has preliminarily validated the remediation effect of in-situ SS method on a southern chromium contaminated site. The engineering test site has an area of approximately 600 m2, and is located at the upstream of the contaminated area. Due to the severe contamination of chromium, the total chromium concentration reached up to 11,850 mg x kg(-1), while the hexavalent chromium concentration reached up to 349 mg x kg(-1), and the most severely contaminated soil had a depth of -0.5 - -2 m. Variations in hexavalent chromium and total chromium concentration in groundwater were observed through the injection of reducing agents and microbial regulators into the injection wells in the test site, and through the monitoring analysis at different time and different depth under the action of the injection agents. Results of the engineering test showed that the on-site SS technology significantly changed the chromium speciation in soil and then reduced the migration of chromium, thus the groundwater risk was reduced. The injected agents had a good effect of hexavalent chromium remediation in groundwater within the effective range of the injection wells, and the SS rate of hexavalent chromium into trivalent chromium reached 94%-99.9%, the SS rate of total chromium fixation reached 83.9%-99.8%. The test results are of significant reference value for the remediation of contaminated sites with features of shallow groundwater depth and soil mainly consisting of silty clay and sandy clay.

Determination of instream metal loads using tracer-injection and synoptic-sampling techniques in Wightman Fork, southwestern Colorado, September 1997

USGS Publications Warehouse

Ortiz, Roderick F.; Bencala, Kenneth E.

2001-01-01

Spatial determinations of the metal loads in Wightman Fork can be used to identify potential source areas to the stream. In September 1997, a chloride tracer-injection study was done concurrently with synoptic water-quality sampling in Wightman Fork near the Summitville Mine site. Discharge was determined and metal concentrations at 38 sites were used to generate mass-load profiles for dissolved aluminum, copper, iron, manganese, and zinc. The U.S. Environmental Protection Agency had previously identified these metals as contaminants of concern.Metal loads increased substantially in Wightman Fork near the Summitville Mine. A large increase occurred along a 60-meter reach that is north of the North Waste Dump and generally corresponds to a region of radial faults. Metal loading from this reach was equivalent to 50 percent or more of the dissolved aluminum, copper, iron, manganese, and zinc load upstream from the outfall of the Summitville Water Treatment Facility (SWTF). Overall, sources along the entire reach upstream from the SWTF were equivalent to 15 percent of the iron, 33 percent of the copper and manganese, 58 percent of the zinc, and 66 percent of the aluminum load leaving the mine site. The largest increases in metal loading to Wightman Fork occurred as a result of inflow from Cropsy Creek. Aluminum, iron, manganese, and zinc loads from Cropsy Creek were equivalent to about 40 percent of the specific metal load leaving the mine site. Copper, iron, and manganese loads from Cropsy Creek were nearly as large or larger than the load from sources upstream from the SWTF.

Level II scour analysis for Bridge 63 (MTH0TH00120063) on Town Highway 12, crossing Russell Brook, Mount Holly, Vermont

USGS Publications Warehouse

Wild, Emily C.; Severance, Timothy

1998-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure MTHOTH00120063 on Town Highway 12 crossing Russell Brook, Mount Holly, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (FHWA, 1993). Results of a Level I scour investigation also are included in appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in appendix D. The site is in the Green Mountain section of the New England physiographic province in south-central Vermont. The 3.6-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is forest upstream and downstream of the bridge. In the study area, Russell Brook has an incised, sinuous channel with a slope of approximately 0.0263 ft/ft, an average channel top width of 29 ft and an average bank height of 3 ft. The channel bed material ranges from cobbles to boulders with a median grain size (D50) of 97.1 mm (0.318 ft). The geomorphic assessment at the time of the Level I and Level II site visit on October 4, 1995, indicated that the reach was stable. The Town Highway 12 crossing of Russell Brook is a 29-ft-long, one-lane bridge consisting of a 26-foot steel-stringer span (Vermont Agency of Transportation, written communication, March 21, 1995). The opening length of the structure parallel to the bridge face is 23.5 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 40 degrees to the opening while the computed opening-skew-to-roadway is 35 degrees. During the Level I assessment, it was observed that the upstream left wingwall footing was exposed 0.2 ft, in reference to the mean thalweg depth, and the upstream end of the left abutment was exposed 0.1 ft. The scour protection measure at the site was type-2 stone fill (less than 36 inches diameter) along the upstream end of the upstream left wingwall. Additional details describing conditions at the site are included in the Level II Summary and appendices D and E.Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and Davis, 1995) for the 100- and 500-year discharges. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 0.1 ft. The worst-case contraction scour occurred at the 100-year discharge. Left abutment scour ranged from 4.4 to 5.7 ft. Right abutment scour ranged from 11.3 to 12.2 ft. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and Davis, 1995, p. 46). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Use of the semipermeable membrane device as an in situ sampler of waterborne bioavailable PCDD and PCDF residues at sub-parts-per-quadrillion concentrations

USGS Publications Warehouse

Lebo, Jon A.; Gale, Robert W.; Petty, Jimmie D.; Tillitt, Donald E.; Huckins, James N.; Meadows, John C.; Orazio, Carl E.; Echols, Kathy R.; Schroeder, Dennis J.; Inmon, Lloyd E.

1995-01-01

Semipermeable membrane devices (SPMDs) were used to passively sample aqueous polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs) in Bayou Meto, AR. The two sites were upstream and downstream from the confluence with a tributary that delivers PCDDs and PCDFs to the Bayou. Following dialysis, cleanup, and fractionation, four replicate 17-9 SPMD samples from each site were analyzed by GUMS, and four were evaluated by H411E bioassay. Traces of only OCDD and HpCDDs were detected in samples from the upstream site. The four samples from below the tributary contained averages of 1550 ± 80 pg of 2,3,7,8-TCDD, 1640 ± 80 pg of 2,3,7,8-TCDF, and lesser quantities of other congeners. The TCDD equivalents obtained by bioassay of replicate SPMD samples agreed well with results obtained by GC/MS. The quantities of 2,3,7,8- TCDD and 2,3,7,8-TCDF sequestered by SPMDs at the downstream site were used to estimate the aqueous concentrations for both compounds as 2 pg/L.

Water quality and the composition of fish and macroinvertebrate communities in the Devils and Pecos Rivers within and upstream from the Amistad National Recreation Area, Texas, 2005-7

USGS Publications Warehouse

Moring, J. Bruce

2012-01-01

The total number of fish species collected was the same in the Devils River and Pecos River, but the species found in the two rivers varied slightly. The number of fish species generally increased from the site farthest upstream to the site farthest downstream in the Devils River, and decreased between the site farthest upstream and site farthest downstream in the Pecos River. The redbreast sunfish was the most abundant species collected in the Devils River, and the blacktail shiner was the most abundant species collected in the Pecos River. Comparing the species from each river, the percentage of omnivorous fish species was larger at the more downstream sites closer to Amistad Reservoir, and the percentage of species tolerant of environmental stressors was larger in the Pecos River. The fish community, assessed on the basis of the number of shared species among the sites sampled, was more similar to the fish community at the other sites on the same river than it was to the fish community from any other site in the other river. More macroinvertebrate taxa were collected in the Devils River than in the Pecos River. The largest number of macroinvertebrate taxa were from the site second farthest downstream on the Devils River, and the smallest numbers of macroinvertebrate taxa were from the farthest downstream site on the Pecos River. Mayflies were more common in the Devils River, and caddisflies were less common than mayflies at most sites. Net-spinning caddisflies were more common at the Devils River sites. The combined percent of mayfly, caddisfly, and stonefly taxa was generally larger at the Pecos River sites. Riffle beetles were the most commonly collected beetle taxon among all sites, and water-penny beetles were only collected at the Pecos River sites. A greater number of true midge taxa were collected more than any other taxa at the genus and species taxonomic level. Non-insect macroinvertebrate taxa were more common at the Devils River sites. Corbicula sp. (presumably the introduced Asian clam) was found at sites in both rivers, and amphipods were more abundant in the Devils River. The Margalef species richness index, based on aquatic insect taxa only, was larger at the Devils River sites than at the Pecos River sites. The Hilsenhoff's biotic index was largest at the site farthest downstream in the Devils River and smallest at the site second farthest downstream in the Pecos River. Overall similarity among sites based on the number of shared macroinvertebrate taxa indicated that each site is more similar to other sites on the same river than to sites on the other river.

Effects of selenium supplementation in cattle on aquatic ecosystems in northern California

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norman, B.; Nader, G.; Oliver, M.

1992-09-15

The potential impact on aquatic ecosystems of supplementing the diets of beef cattle with selenium (Se) was studied on 4 northern California ranches. All study sites included an area of concentrated use by cattle that had diets supplemented with Se. In each case, a stream flowed through the site and provided a control sampling area upstream and a treated sampling area downstream. Specimens of water, sediment, algae, aquatic plants, aquatic invertebrates, and fish were analyzed fluorometrically for total Se content. Significant differences in Se concentration were not found between specimens from upstream control areas and those from downstream areas subjectedmore » to use by Se-treated cattle. Evidence was not found that Se supplementation in cattle at maximal permitted concentrations caused Se accumulation in associated aquatic ecosystems.« less

Streamflow, specific-conductance, and temperature data for Bayou and Little Bayou Creeks near Paducah, Kentucky, August 15 and 16, 1989

USGS Publications Warehouse

Evaldi, R.D.; McClain, D.L.

1989-01-01

Discharge, temperature, and specific conductance measurements were made August 15 and 16, 1989, at 74 main channel sites and seven flowing tributaries on Bayou and Little Bayou Creeks, Kentucky in the vicinity of the Paducah Gaseous Diffusion Plant. These measurements were made during base flow conditions to provide data for analysis of the interaction of surface and groundwater. The discharge of Bayou Creek was 0.30 cfs at the most upstream site, and 5.8 cfs at the most downstream site. Total measured tributary inflow of Bayou Creek was 5.7 cfs. Specific conductance values in the Bayou Creek watershed ranged from 208 to 489 microsiemens/cm, and water temperature ranged from 20.0 to 32.6 C. The discharge of Little Bayou Creek was 0.65 cfs at the most upstream site, and 1.8 cfs at the most downstream site. Total measured tributary inflow of Little Bayou Creek was 0.38 cfs. Specific conductance values in the Little Bayou Creek watershed ranged from 211 to 272 microsiemens/cm, and water temperature ranged from 14.5 to 24.9 C. (USGS)

Decreased fish diversity found near marble industry effluents in River Barandu, Pakistan.

PubMed

Mulk, Shahi; Korai, Abdul Latif; Azizullah, Azizullah; Khattak, Muhammad Nasir Khan

2016-01-01

In a recently published study we observed that effluents from marble industry affected physicochemical characteristics of River Barandu in District Buner, Pakistan. These changes in water quality due to marble effluents may affect fish community. The present study was therefore conducted to evaluate the impacts of marble industry effluents on fish communities in River Barandu using abundance, richness, diversity and evenness of fish species as end point criteria. The fish samples were collected by local fishermen on monthly basis from three selected sites (upstream, effluents/industrial, and downstream sites). During the study period, a total of 18 fish species were found belonging to 4 orders, 5 families and 11 genera. The Cyprinidae was observed to be the dominant family at all the three selected sites. Lower abundance and species diversity was observed at the industrial (22%) and downstream sites (33%) as compared to the upstream site (45%). Effluents of marble industry were associated with lower abundance of species in River Barandu. It is recommended that industries should be shifted away from the vicinity of river and their effluents must be treated before discharging to prevent further loss of fish abundance and diversity in the River.

Effects of wastewater effluent discharge and treatment facility upgrades on environmental and biological conditions of the upper Blue River, Johnson County, Kansas and Jackson County, Missouri, January 2003 through March 2009

USGS Publications Warehouse

Graham, Jennifer L.; Stone, Mandy L.; Rasmussen, Teresa J.; Poulton, Barry C.

2010-01-01

The Johnson County Blue River Main Wastewater Treatment Facility discharges into the upper Blue River near the border between Johnson County, Kansas and Jackson County, Missouri. During 2005 through 2007 the wastewater treatment facility underwent upgrades to increase capacity and include biological nutrient removal. The effects of wastewater effluent on environmental and biological conditions of the upper Blue River were assessed by comparing an upstream site to two sites located downstream from the wastewater treatment facility. Environmental conditions were evaluated using previously and newly collected discrete and continuous data, and were compared with an assessment of biological community composition and ecosystem function along the upstream-downstream gradient. This evaluation is useful for understanding the potential effects of wastewater effluent on water quality, biological community structure, and ecosystem function. In addition, this information can be used to help achieve National Pollution Discharge Elimination System (NPDES) wastewater effluent permit requirements after additional studies are conducted. The effects of wastewater effluent on the water-quality conditions of the upper Blue River were most evident during below-normal and normal streamflows (about 75 percent of the time), when wastewater effluent contributed more than 20 percent to total streamflow. The largest difference in water-quality conditions between the upstream and downstream sites was in nutrient concentrations. Total and inorganic nutrient concentrations at the downstream sites during below-normal and normal streamflows were 4 to 15 times larger than at the upstream site, even after upgrades to the wastewater treatment facility were completed. However, total nitrogen concentrations decreased in wastewater effluent and at the downstream site following wastewater treatment facility upgrades. Similar decreases in total phosphorus were not observed, likely because the biological phosphorus removal process was not optimized until after the study was completed. Total nitrogen and phosphorus from the wastewater treatment facility contributed a relatively small percentage (14 to 15 percent) to the annual nutrient load in the upper Blue River, but contributed substantially (as much as 75 percent) to monthly loads during seasonal low-flows in winter and summer. During 2007 and 2008, annual discharge from the wastewater treatment facility was about one-half maximum capacity, and estimated potential maximum annual loads were 1.6 to 2.4 times greater than annual loads before capacity upgrades. Even when target nutrient concentrations are met, annual nutrient loads will increase when the wastewater treatment facility is operated at full capacity. Regardless of changes in annual nutrient loads, the reduction of nutrient concentrations in the Blue River Main wastewater effluent will help prevent further degradation of the upper Blue River. The Blue River Main Wastewater Treatment Facility wastewater effluent caused changes in concentrations of several water-quality constituents that may affect biological community structure and function including larger concentrations of bioavailable nutrients (nitrate and orthophosphorus) and smaller turbidities. Streambed-sediment conditions were similar along the upstream-downstream gradient and measured constituents did not exceed probable effect concentrations. Habitat conditions declined along the upstream-downstream gradient, largely because of decreased canopy cover and riparian buffer width and increased riffle-substrate fouling. Algal biomass, primary production, and the abundance of nutrient-tolerant diatoms substantially increased downstream from the wastewater treatment facility. Likewise, the abundance of intolerant macroinvertebrate taxa and Kansas Department of Health and Environment aquatic-life-support scores, derived from macroinvertebrate data, significantly decreased downstream from the wastewater

Assessing inundation hazards to nuclear powerplant sites using geologically extended histories of riverine floods, tsunamis, and storm surges

USGS Publications Warehouse

O'Connor, Jim; Atwater, Brian F.; Cohn, Timothy A.; Cronin, Thomas M.; Keith, Mackenzie K.; Smith, Christopher G.; Mason, Jr., Robert R.

2014-01-01

A screening of the 104 nuclear powerplants in the United States licensed by the Nuclear Regulatory Commission (at 64 sites) indicates several sites for which paleoflood studies likely would provide additional flood-frequency information. Two sites—Duane Arnold, Iowa, on the Cedar River; and David-Besse, Ohio, on the Toussaint River—have geologic conditions suitable for creating and preserving stratigraphic records of flooding and few upstream dams that may complicate flood-frequency analysis. One site—Crystal River, Florida1, on the Withlacoochee River and only 4 kilometers from the coast—has high potential as a candidate for assessing riverine and marine inundation hazards. Several sites on the Mississippi River have high geologic potential, but upstream dams almost certainly now regulate peak flows. Nevertheless, studies on the Mississippi River to evaluate long-term flood frequency may provide results applicable to a wide spectrum of regional hazard issues. Several sites in the southeastern United States have high geologic potential, and studies at these sites also may be helpful in evaluating hazards from outburst floods from landslide dams (river blockages formed by mass movements), which may be a regional hazard. For all these sites, closer investigation and field reconnaissance would be needed to confirm suitable deposits and settings for a complete paleoflood analysis. Similar screenings may help identify high-potential sites for geologic investigations of tsunami and storm-surge hazards.

Shock analysis - Three useful new relations. [collisionless hydromagnetic shocks in space plasmas

NASA Technical Reports Server (NTRS)

Smith, Edward J.; Burton, Marcia E.

1988-01-01

The behavior of collisionless hydromagnetic shocks in interplanetary space is considered analytically, with a focus on relations, implicit in the governing Rankine-Hugoniot equations, involving the magnetic field (B) and the plasma velocity (V). A moving reference frame aligned with the shock is employed, and expressions are derived which make it possible (1) to determine the speed of a shock of arbitrary orientation from upstream and downstream measurements of B and V; (2) to characterize the change in flow direction as the plasma crosses the shock in terms of the plasma beta, the Mach number, and the angle between the upstream field and the shock normal; and (3) to infer the third component of the upstream-downstream velocity jump from B and two-dimensional V measurements. These expressions are applied to ISEE-3 data on an interplanetary shock on April 5, 1979, and the results are presented in tables.

Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

NASA Astrophysics Data System (ADS)

Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

2004-12-01

Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

Effects of stock use and backpackers on water quality in wilderness in Sequoia and Kings Canyon National Parks, USA.

PubMed

Clow, David W; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O; Ryu, Hodon; Domingo, Jorge Santo

2013-12-01

During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli concentrations. The synoptic survey sites were categorized as minimal use, backpacker-use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E. coli) than those categorized as minimal-use (P ≤ 0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E. coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas (P ≤ 0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E. coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

Effects of Stock Use and Backpackers on Water Quality in Wilderness in Sequoia and Kings Canyon National Parks, USA

NASA Astrophysics Data System (ADS)

Clow, David W.; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O.; Ryu, Hodon; Domingo, Jorge Santo

2013-12-01

During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli concentrations. The synoptic survey sites were categorized as minimal use, backpacker-use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E. coli) than those categorized as minimal-use ( P ≤ 0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E. coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas ( P ≤ 0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E. coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

Effects of stock use and backpackers on water quality in wilderness in Sequoia and Kings Canyon National Parks, USA

USGS Publications Warehouse

Clow, David W.; Forrester, Harrison; Miller, Benjamin; Roop, Heidi; Sickman, James O.; Ryu, Hodon; Santo Domingo, Jorge

2013-01-01

During 2010-2011, a study was conducted in Sequoia and Kings Canyon National Parks (SEKI) to evaluate the influence of pack animals (stock) and backpackers on water quality in wilderness lakes and streams. The study had three main components: (1) a synoptic survey of water quality in wilderness areas of the parks, (2) paired water-quality sampling above and below several areas with differing types and amounts of visitor use, and (3) intensive monitoring at six sites to document temporal variations in water quality. Data from the synoptic water-quality survey indicated that wilderness lakes and streams are dilute and have low nutrient and Escherichia coli (E. coli) concentrations. The synoptic survey sites were categorized as minimal use, backpacker use, or mixed use (stock and backpackers), depending on the most prevalent type of use upstream from the sampling locations. Sites with mixed use tended to have higher concentrations of most constituents (including E.coli) than those categorized as minimal-use (p≤0.05); concentrations at backpacker-use sites were intermediate. Data from paired-site sampling indicated that E.coli, total coliform, and particulate phosphorus concentrations were greater in streams downstream from mixed-use areas than upstream from those areas (p≤0.05). Paired-site data also indicated few statistically significant differences in nutrient, E. coli, or total coliform concentrations in streams upstream and downstream from backpacker-use areas. The intensive-monitoring data indicated that nutrient and E. coli concentrations normally were low, except during storms, when notable increases in concentrations of E.coli, nutrients, dissolved organic carbon, and turbidity occurred. In summary, results from this study indicate that water quality in SEKI wilderness generally is good, except during storms; and visitor use appears to have a small, but statistically significant influence on stream water quality.

Increased risk of oesophageal adenocarcinoma among upstream petroleum workers

PubMed Central

Kirkeleit, Jorunn; Riise, Trond; Bjørge, Tone; Moen, Bente E; Bråtveit, Magne; Christiani, David C

2013-01-01

Objectives To investigate cancer risk, particularly oesophageal cancer, among male upstream petroleum workers offshore potentially exposed to various carcinogenic agents. Methods Using the Norwegian Registry of Employers and Employees, 24 765 male offshore workers registered from 1981 to 2003 was compared with 283 002 male referents from the general working population matched by age and community of residence. The historical cohort was linked to the Cancer Registry of Norway and the Norwegian Cause of Death Registry. Results Male offshore workers had excess risk of oesophageal cancer (RR 2.6, 95% CI 1.4 to 4.8) compared with the reference population. Only the adenocarcinoma type had a significantly increased risk (RR 2.7, 95% CI 1.0 to 7.0), mainly because of an increased risk among upstream operators (RR 4.3, 95% CI 1.3 to 14.5). Upstream operators did not have significant excess of respiratory system or colon cancer or mortality from any other lifestyle-related diseases investigated. Conclusion We found a fourfold excess risk of oesophageal adenocarcinoma among male workers assumed to have had the most extensive contact with crude oil. Due to the small number of cases, and a lack of detailed data on occupational exposure and lifestyle factors associated with oesophageal adenocarcinoma, the results must be interpreted with caution. Nevertheless, given the low risk of lifestyle-related cancers and causes of death in this working group, the results add to the observations in other low-powered studies on oesophageal cancer, further suggesting that factors related to the petroleum stream or carcinogenic agents used in the production process might be associated with risk of oesophageal adenocarcinoma. PMID:19858535

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

PubMed

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

Streamflow losses along the Balcones Fault Zone, Nueces River basin, Texas

USGS Publications Warehouse

Land, L.F.; Boning, C.W.; Harmsen, Lynn; Reeves, R.D.

1983-01-01

Statistical evaluations of historical daily flow records for the streams that have gaging stations upstream and downstream from the recharge zone provided mathematical relationships that expressed downstream flow in terms of other significant parameters. For each stream, flow entering the recharge zone is most significant in defining downstream flow; for some streams, antecedent flows at the upstream site and ground-water levels are also significantly related to downstream flow. The analyses also determined the discharges required upstream from the recharge zone to sustain flow downstream from that zone. These discharges ranged from 355 cubic feet per second for the combined Frio and Dry Frio Rivers to 33 cubic feet per second for the Nueces River. The entire flows of lesser magnitude are generally lost to recharge to the aquifer.

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

Distribution and speciation of metals (Cu, Zn, Cd, and Pb) in agricultural and non-agricultural soils near a stream upriver from the Pearl River, China.

PubMed

Yang, Silin; Zhou, Dequn; Yu, Huayong; Wei, Rong; Pan, Bo

2013-06-01

The distribution and chemical speciation of typical metals (Cu, Zn, Cd and Pb) in agricultural and non-agricultural soils were investigated in the area of Nanpan River, upstream of the Pearl River. The investigated four metals showed higher concentrations in agricultural soils than in non-agricultural soils, and the site located in factory district contained metals much higher than the other sampling sites. These observations suggested that human activities, such as water irrigation, fertilizer and pesticide applications might have a major impact on the distribution of metals. Metal speciation analysis presented that Cu, Zn and Cd were dominated by the residual fraction, while Pb was dominated by the reducible fraction. Because of the low mobility of the metals in the investigated area, no remarkable difference could be observed between upstream and downstream separated by the factory site. Copyright © 2013 Elsevier Ltd. All rights reserved.

Assessment of De Facto Wastewater Reuse across the US: trends between 1980 and 2008.

PubMed

Rice, Jacelyn; Wutich, Amber; Westerhoff, Paul

2013-10-01

De facto wastewater reuse is the incidental presence of treated wastewater in a water supply source. In 1980 the EPA identified drinking water treatment plants (DWTPs) impacted by upstream wastewater treatment plant (WWTP) discharges and found the top 25 most impacted DWTPs contained between 2% and 16% wastewater discharges from upstream locations (i.e., de facto reuse) under average streamflow conditions. This study is the first to provide an update to the 1980 EPA analysis. An ArcGIS model of DWTPs and WWTPs across the U.S. was created to quantify de facto reuse for the top 25 cities in the 1980 EPA study. From 1980 to 2008, de facto reuse increased for 17 of the 25 DWTPs, as municipal flows upstream of the sites increased by 68%. Under low streamflow conditions, de facto reuse in DWTP supplies ranged from 7% to 100%, illustrating the importance of wastewater in sustainable water supplies. Case studies were performed on four cities to analyze the reasons for changes in de facto reuse over time. Three of the four sites have greater than 20% treated wastewater effluent within their drinking water source for streamflow less than the 25th percentile historic flow.

A benthic-macroinvertebrate index of biotic integrity and assessment of conditions in selected streams in Chester County, Pennsylvania, 1998-2009

USGS Publications Warehouse

Reif, Andrew G.

2012-01-01

The Stream Conditions of Chester County Biological Monitoring Network (Network) was established by the U.S. Geological Survey and the Chester County Water Resources Authority in 1969. Chester County encompasses 760 square miles in southeastern Pennsylvania and has a rapidly expanding population. Land-use change has occurred in response to this continual growth, as open space, agricultural lands, and wooded lands have been converted to residential and commercial lands. In 1998, the Network was modified to include 18 fixed-location sites and 9 flexible-location sites. Sites were sampled annually in the fall (October-November) during base-flow conditions for water chemistry, instream habitat, and benthic macroinvertebrates. A new set of 9 flexible-location sites was selected each year. From 1998 to 2009, 213 samples were collected from the 18 fixed-location sites and 107 samples were collected from the 84 flexible-location sites. Eighteen flexible-location sites were sampled more than once over the 12-year period; 66 sites were sampled only once. Benthic-macroinvertebrate data from samples collected during 1998-2009 were used to establish the Chester County Index of Biotic Integrity (CC-IBI). The CC-IBI was based on the methods and metrics outlined in the Pennsylvania Department of Environmental Protection's "A Benthic Index of Biotic Integrity for Wadeable Freestone Streams in Pennsylvania." The resulting CC-IBI consists of scores for benthic-macroinvertebrate samples collected from sites in the Network that related to reference conditions in Chester County. Mean CC-IBI scores for 18 fixed-location sites ranged from 37.21 to 88.92. Thirty-nine percent of the 213 samples collected at the 18 fixed-location sites had a CC-IBI score less than 50; 33 percent, 50 to 70; 28 percent, greater than 70. CC-IBI scores from the 107 flexible-location samples ranged from 23.48 to 99.96. Twenty-five percent of the 107 samples collected at the flexible-location sites had a CC-IBI score less than 50; 33 percent, 50 to 70; and 42 percent, greater than 70. Factors that were found to affect CC-IBI scores are nutrient concentrations, habitat conditions, and percent of wooded and urban land use. A positive relation was determined between mean CC-IBI scores and mean total habitat scores for the 18 fixed-location sites. CC-IBI scores were most strongly affected by stream bank vegetative protection, embeddedness, riparian zone width, and sediment deposition. The highest CC-IBI scores were associated with sites that had greater than 28 percent wooded-wetland-water land use, less than 5 percent urban land use, and no municipal wastewater discharges within 10 miles upstream from the sampling site. The lowest CC-IBI scores were associated with sites where urban land use was greater than 15 percent or a municipal wastewater discharge was within 10 miles upstream from the sampling reach. The Mann Kendall test for trends was used to determine trends in CC-IBI scores and concentrations of nitrate, orthophosphate, and chloride for the 18 fixed-location sites. A positive trend in CC-IBI was determined for six sites, and a negative trend was determined for one site. Positive trends in nitrate concentrations were determined for 4 of the 18 fixed-location sites, and a negative trend in orthophosphate concentrations was determined for 1 of the 18 fixed-location sites. Positive trends in chloride concentrations were determined for 16 of the 18 fixed-location sites.

Invertebrates as indicators for chemical stress in sewage-influenced stream systems: toxic and endocrine effects in gammarids and reactions at the community level in two tributaries of Lake Constance, Schussen and Argen.

PubMed

Peschke, Katharina; Geburzi, Jonas; Köhler, Heinz-R; Wurm, Karl; Triebskorn, Rita

2014-08-01

The present study investigates the impact of releases from waste water treatment plants and storm water overflow basins on gammarids and other macrozoobenthos. The study relates to a recent upgrading of a waste water treatment plant (Langwiese) at the Schussen river, an important tributary to Lake Constance. Samples were taken at different sites at the Schussen river upstream and downstream of a storm water overflow basin and the waste water treatment plant Langwiese and, in parallel, at the Argen river, a less polluted reference stream. We assessed the influence of water quality on the distribution of macrozoobenthos and on the health of gammarid populations by a variety of ecotoxicological methods including biomarkers prior to the expansion of the waste water treatment plant. Through histopathological studies, the impact of parasites on host tissue health was evaluated. Analyses of heat shock protein (hsp70) levels allowed us to draw conclusions about the proteotoxicity-related stress status of the organisms. Furthermore, gammarid populations from all sites were investigated in respect to sex ratio, parasitism rate, and fecundity. Macrozoobenthos community integrity was determined by means of the saprobic index and the abundance as well as by the number of taxa. In gammarids, the sex ratio was significantly shifted towards females, fecundity was significantly decreased, and the hsp70 level was significantly increased downstream of the waste water treatment plant Langwiese, compared to the upstream sampling site. Similarly, these effects could be detected downstream of three small storm water overflow basins. In the macrozoobenthos communities, the abundance of taxa, the number of taxa, the number of ephemeroptera, plecoptera, and trichoptera taxa (EPT-taxa), and the number of sensitive taxa decreased downstream of the storm water overflow basin Mariatal as well as downstream of the waste water treatment plant Langwiese. Our study showed, that waste water treatment plants and storm water overflow basins affected macroinvertebrate communities and the health of gammarids. Copyright © 2014 Elsevier Inc. All rights reserved.

Y-12 National Security Complex Biological Monitoring and Abatement Program 2007 Calendar Yeare Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peterson, M.J.; Greeley, M. S. Jr.; Morris, G. W.

2008-07-01

The National Pollutant Discharge Elimination System (NPDES) permit issued for the Oak Ridge Y-12 National Security Complex (Y-12 Complex) which became effective May 1, 2006, continued a requirement for a Biological Monitoring and Abatement Program (BMAP). The BMAP was originally developed in 1985 to demonstrate that the effluent limitations established for the Y-12 Complex protected the classified uses of the receiving stream (East Fork Poplar Creek: EFPC), in particular, the growth and propagation of aquatic life (Loar et al. 1989). The objectives of the current BMAP are similar, specifically to assess stream ecological conditions relative to regulatory limits and criteria,more » to assess ecological impacts as well as recovery in response to Y-12 operations, and to investigate the causes of continuing impacts. The BMAP consists of three tasks that reflect complementary approaches to evaluating the effects of the Y-12 Complex discharges on the biotic integrity of EFPC. These tasks include: (1) bioaccumulation monitoring, (2) benthic macroinvertebrate community monitoring, and (3) fish community monitoring. As required by the NPDES permit, the BMAP benthic macroinvertebrate community monitoring task includes studies to annually evaluate the receiving stream's biological integrity in comparison to TN Water Quality Criteria. BMAP monitoring is currently being conducted at five primary EFPC sites, although sites may be excluded or added depending upon the specific objectives of the various tasks. Criteria used in selecting the sites include: (1) location of sampling sites used in other studies, (2) known or suspected sources of downstream impacts, (3) proximity to U.S. Department of Energy (DOE) Oak Ridge Reservation (ORR) boundaries, (4) appropriate habitat distribution, and (5) access. The primary sampling sites include upper EFPC at kilometers (EFKs) 24.4 and 23.4 [upstream and downstream of Lake Reality (LR) respectively]; EFK 18.7 (also EFK 18.2 and 19), located off the ORR and below an area of intensive commercial and light industrial development; EFK 13.8, located upstream from the Oak Ridge Wastewater Treatment Facility (ORWTF); and EFK 6.3 located approximately 1.4 km below the ORR boundary (Fig. 1.1). Actual sampling locations on EFPC may differ slightly by task according to specific requirements of the task. Brushy Fork (BF) at kilometer (BFK) 7.6 and Hinds Creek at kilometer (HCK) 20.6 are the most commonly used reference sites for the Y-12 BMAP. Additional sites off the ORR are also occasionally used for reference, including Beaver Creek, Bull Run, Cox Creek, and Paint Rock Creek (Fig. 1.2). Summaries of the sampling designs for the three primary tasks of the Y-12 Complex BMAP for EFPC are presented in Tables 1.1-1.3. This report covers the 2007 study period, although data collected outside this time period are included as appropriate. To address the biological monitoring requirements for Bear Creek and McCoy Branch, CERCLA-funded data is summarized in Appendix A (for Bear Creek) and Appendix B (for McCoy Branch). Data for these two watersheds is provided herein to address Section IX of the NPDES Permit for Y-12, where 'Results of these CERCLA programs can be used to meet the biological monitoring requirements of this permit'. For potential comparison with instream biological measures, a summary of the toxicity testing results for Y-12 outfalls into upper EFPC is provided in Appendix C (these results have been previously reported).« less

Evaluation of water-quality characteristics and sampling design for streams in North Dakota, 1970–2008

USGS Publications Warehouse

Galloway, Joel M.; Vecchia, Aldo V.; Vining, Kevin C.; Densmore, Brenda K.; Lundgren, Robert F.

2012-01-01

In response to the need to examine the large amount of historic water-quality data comprehensively across North Dakota and evaluate the efficiency of the State-wide sampling programs, a study was done by the U.S. Geological Survey in cooperation with the North Dakota State Water Commission and the North Dakota Department of Health to describe the water-quality data collected for the various programs and determine an efficient State-wide sampling design for monitoring future water-quality conditions. Although data collected for the North Dakota State Water Commission High-Low Sampling Program, the North Dakota Department of Health Ambient Water-Quality Network, and other projects and programs provide valuable information on the quality of water in streams in North Dakota, the objectives vary among the programs, some of the programs overlap spatially and temporally, and the various sampling designs may not be the most efficient or relevant to the objectives of the individual programs as they have changed through time. One objective of a State-wide sampling program was to evaluate ways to describe the spatial variability of water-quality conditions across the State in the most efficient manner. Weighted least-squares regression analysis was used to relate the average absolute difference between paired downstream and upstream concentrations, expressed as a percent of the average downstream concentration, to the average absolute difference in daily flow between the downstream and upstream pairs, expressed as a percent of the average downstream flow. The analysis showed that a reasonable spatial network would consist of including the most downstream sites in large basins first, followed by the next upstream site(s) that roughly bisect the downstream flows at the first sites, followed by the next upstream site(s) that roughly bisect flows for the second sites. Sampling sites to be included in a potential State-wide network were prioritized into 3 design levels: level 1 (highest priority), level 2 (second priority), and level 3 (third priority). Given the spatial distribution and priority designation (levels 1–3) of sites in the potential spatial network, the next consideration was to determine the appropriate temporal sampling frequency to use for monitoring future water-quality conditions. The time-series model used to detect concentration trends for this report also was used to evaluate sampling designs to monitor future water-quality trends. Sampling designs were evaluated with regard to their sensitivity to detect seasonal trends that occurred during three 4-month seasons—March through June, July through October, and November through February. For the 34 level-1 sites, samples would be collected for major ions, trace metals, nutrients, bacteria, and sediment eight times per year, with samples in January, April (2 samples),May, June, July, August, and October. For the 21 level-2 sites, samples would be collected for major ions, trace metals, and nutrients six times per year (January, April, May, June, August, and October), and for the 26 level-3 sites, samples would be collected for these constituents four times per year (April, June, August, and October).

Toxicity and bioavailability of metals in the Missouri River adjacent to a lead refinery

USGS Publications Warehouse

Chapman, Duane C.; Allert, Ann L.; Fairchild, James F.; May, Thomas W.; Schmitt, Christopher J.; Callahan, Edward V.

2001-01-01

This study is an evaluation of the potential environmental impacts of contaminated groundwater from the ASARCO metals refining facility adjacent to the Missouri River in Omaha, Nebraska. Surface waters, sediments, and sediment pore waters were collected from the Burt-Izard drain, which transects the facility, and from the Missouri River adjacent to the facility. Groundwater was also collected from the facility. Waters and sediments were analyzed for inorganic contaminants, and the toxicity of the waters was evaluated with the Ceriodaphnia dubia 7-day test. Concentrations of several elemental contaminants were highly elevated in the groundwater, but not in river sediment pore waters. Lead concentrations were moderately elevated in whole sediment at one site, but lead concentrations in pore waters were low due to apparent sequestration by acid-volatile sulfides. The groundwater sample was highly toxic to C. dubia, causing 100% mortality. Even at the lowest groundwater concentration tested (6.25%) C. dubia survival was reduced; however, at that concentration, reproduction was not significantly different from upstream porewater reference samples. Sediment pore waters were not toxic, except reproduction in pore water collected from one downstream site was somewhat reduced. The decrease in reproduction could not be attributed to measured elemental contaminants.

75 FR 65509 - Notice of Lodging of Consent Decree Under the Comprehensive Environmental Response, Compensation...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-25

... is hereby given that on October 14, 2010 a proposed Consent Decree with Georgia-Pacific Consumer... Green Bay Superfund Site in northeastern Wisconsin (the ``Site''). The proposed Consent Decree would... from a line across the River slightly upstream of the company's paper mill in the City of Green Bay...

Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny

PubMed Central

Orengo, Dorcas J.; Aguadé, Montserrat

2017-01-01

The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426

Freshwater mussel shells as environmental chronicles: Geochemical and taphonomic signatures of mercury-related extirpations in the North Fork Holston River, Virginia

USGS Publications Warehouse

Brown, M.E.; Kowalewski, M.; Neves, R.J.; Cherry, D.S.; Schreiber, M.E.

2005-01-01

This study utilized freshwater mussel shells to assess mercury (Hg) contamination in the North Fork Holston River that extirpated (caused local extinctions of) a diverse mussel fauna. Shells (n = 366) were collected from five sites situated upstream (two sites), just below (one site), and downstream (two sites) of the town of Saltville, Virginia, where Hg was used to produce chlorine and caustic soda from 1950 to 1972. Shell samples were used to test the (1) utility of geochemical signatures of shells for assessing the spatial variation in Hg levels in the river relative to the contamination source and (2) value of taphonomy (postmortem shell alteration) for distinguishing sites that differ in extirpation histories. Geochemical signatures of 40 shells, analyzed using atomic absorption spectroscopy, indicated a strong longitudinal pattern. All shells from the two upstream sites had low Hg concentrations (<5-31 ??g/kg), shells directly below Saltville had variable, but dramatically higher concentrations (23-4637 ??g/kg), and shells from the two downstream sites displayed intermediate Hg levels (<5-115 ??g/kg) that declined with distance from Saltville. Two pre-industrial shells, collected at Saltville in 1917, yielded very low Hg estimates (5-6 ??g/kg). Hg signatures were consistent among mussel species, suggesting that Hg concentrations were invariant to species type; most likely, highly variable Hg levels, both across sites and through time, overwhelmed any interspecific differences in Hg acquisition. Also, a notable postmortem incorporation of Hg in mussel shells seemed unlikely, as the Hg content was not correlated with shell taphonomy (r = 0.18; p = 0.28). The taphonomic analysis (n = 366) showed that the degree of shell alteration reliably distinguished sites with different extirpation histories. At Saltville, where live mussels have been absent for at least 30 years, shells were most heavily altered and fragmented. Conversely, fresh-looking shells abounded upstream, where reproducing mussel populations are still present. In summary, relic shells offered valuable spatiotemporal data on Hg concentrations in a polluted ecosystem, and shell taphonomic signatures discriminated sites with different extirpation histories. The shell-based strategies exemplified here do not require sampling live specimens and may augment more standard strategies applied to environmental monitoring. The approach should prove especially useful in areas with unknown extirpation and pollution histories. ?? 2005 American Chemical Society.

Rating Curve Estimation from Local Levels and Upstream Discharges

NASA Astrophysics Data System (ADS)

Franchini, M.; Mascellani, G.

2003-04-01

Current technology allows for low cost and easy level measurements while the discharge measurements are still difficult and expensive. Thus, these are rarely performed and usually not in flood conditions because of lack of safety and difficulty in activating the measurement team in due time. As a consequence, long series of levels are frequently available without the corresponding discharge values. However, for the purpose of planning, management of water resources and real time flood forecasting, discharge is needed and it is therefore essential to convert local levels into discharge values by using the appropriate rating curve. Over this last decade, several methods have been proposed to relate local levels at a site of interest to data recorded at a river section located upstream where a rating curve is available. Some of these methods are based on a routing approach which uses the Muskingum model structure in different ways; others are based on the entropy concepts. Lately, fuzzy logic has been applied more and more frequently in the framework of hydraulic and hydrologic problems and this has prompted to the authors to use it for synthesising the rating curves. A comparison between all these strategies is performed, highlighting the difficulties and advantages of each of them, with reference to a long reach of the Po river in Italy, where several hydrometers and the relevant rating curves are available, thus allowing for both a parameterization and validation of the different strategies.

Cumulative impacts of mountaintop mining on an Appalachian watershed

PubMed Central

Lindberg, T. Ty; Bernhardt, Emily S.; Bier, Raven; Helton, A. M.; Merola, R. Brittany; Vengosh, Avner; Di Giulio, Richard T.

2011-01-01

Mountaintop mining is the dominant form of coal mining and the largest driver of land cover change in the central Appalachians. The waste rock from these surface mines is disposed of in the adjacent river valleys, leading to a burial of headwater streams and dramatic increases in salinity and trace metal concentrations immediately downstream. In this synoptic study we document the cumulative impact of more than 100 mining discharge outlets and approximately 28 km2 of active and reclaimed surface coal mines on the Upper Mud River of West Virginia. We measured the concentrations of major and trace elements within the tributaries and the mainstem and found that upstream of the mines water quality was equivalent to state reference sites. However, as eight separate mining-impacted tributaries contributed their flow, conductivity and the concentrations of selenium, sulfate, magnesium, and other inorganic solutes increased at a rate directly proportional to the upstream areal extent of mining. We found strong linear correlations between the concentrations of these contaminants in the river and the proportion of the contributing watershed in surface mines. All tributaries draining mountaintop-mining-impacted catchments were characterized by high conductivity and increased sulfate concentration, while concentrations of some solutes such as Se, Sr, and N were lower in the two tributaries draining reclaimed mines. Our results demonstrate the cumulative impact of multiple mines within a single catchment and provide evidence that mines reclaimed nearly two decades ago continue to contribute significantly to water quality degradation within this watershed. PMID:22160676

Mrp--a new auxiliary gene essential for optimal expression of methicillin resistance in Staphylococcus aureus.

PubMed

Wu, S W; De Lencastre, H

1999-01-01

Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.

Water Quality of the Snake River and Five Eastern Tributaries in the Upper Snake River Basin, Grand Teton National Park, Wyoming, 1998-2002

USGS Publications Warehouse

Clark, Melanie L.; Sadler, Wilfrid J.; O'Ney, Susan E.

2004-01-01

To address water-resource management objectives of the National Park Service in Grand Teton National Park, the U.S. Geological Survey in cooperation with the National Park Service has conducted water-quality sampling in the upper Snake River Basin. Routine sampling of the Snake River was conducted during water years 1998-2002 to monitor the water quality of the Snake River through time. A synoptic study during 2002 was conducted to supplement the routine Snake River sampling and establish baseline water-quality conditions of five of its eastern tributaries?Pilgrim Creek, Pacific Creek, Buffalo Fork, Spread Creek, and Ditch Creek. Samples from the Snake River and the five tributaries were collected at 12 sites and analyzed for field measurements, major ions and dissolved solids, nutrients, selected trace metals, pesticides, and suspended sediment. In addition, the eastern tributaries were sampled for fecal-indicator bacteria by the National Park Service during the synoptic study. Major-ion chemistry of the Snake River varies between an upstream site above Jackson Lake near the northern boundary of Grand Teton National Park and a downstream site near the southern boundary of the Park, in part owing to the inputs from the eastern tributaries. Water type of the Snake River changes from sodium bicarbonate at the upstream site to calcium bicarbonate at the downstream site. The water type of the five eastern tributaries is calcium bicarbonate. Dissolved solids in samples collected from the Snake River were significantly higher at the upstream site (p-value<0.001), where concentrations in 43 samples ranged from 62 to 240 milligrams per liter, compared to the downstream site where concentrations in 33 samples ranged from 77 to 141 milligrams per liter. Major-ion chemistry of Pilgrim Creek, Pacific Creek, Buffalo Fork, Spread Creek, and Ditch Creek generally did not change substantially between the upstream sites near the National Park Service boundary with the National Forest and the downstream sites near the Snake River; however, variations in the major ions and dissolved solids existed between basins. Variations probably result from differences in geology between the tributary basins. Concentrations of dissolved ammonia, nitrite, and nitrate in all samples collected from the Snake River and the five eastern tributaries were less than water-quality criteria for surface waters in Wyoming. Concentrations of total nitrogen and total phosphorus in samples from the Snake River and the tributaries generally were less than median concentrations determined for undeveloped streams in the United States; however, concentrations in some samples did exceed ambient total-nitrogen and total-phosphorus criteria for forested mountain streams in the Middle Rockies ecoregion recommended by the U.S. Environmental Protection Agency to address cultural eutrophication. Sources for the excess nitrogen and phosphorus probably are natural because these basins have little development and cultivation. Concentrations of trace metals and pesticides were low and less than water-quality criteria for surface waters in Wyoming in samples collected from the Snake River and the five eastern tributaries. Atrazine, dieldrin, EPTC, or tebuthiuron were detected in estimated concentrations of 0.003 microgram per liter or less in 5 of 27 samples collected from the Snake River. An estimated concentration of 0.008 microgram per liter of metolachlor was detected in one sample from the Buffalo Fork. The estimated concentrations were less than the reporting levels for the pesticide analytical method. Suspended-sediment concentrations in 43 samples from the upstream site on the Snake River ranged from 1 to 604 milligrams per liter and were similar to suspended-sediment concentrations in 33 samples from the downstream site, which ranged from 1 to 648 milligrams per liter. Suspended-sediment concentrations in 38 samples collected from the tributary streams ranged from 1 t

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Ichthyoplankton use of a thermally influenced macrophyte bed in the New River, Virginia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeager, M.M.; Cherry, D.S.; Yeager, J.L.

The ichthyoplankton community of an extensive macrophyte bed in a thermally influenced reach of the New River, Virginia was compared with the ichthyoplankton communities in smaller macrophyte beds located upstream and downstream of the thermal effluent. Ichthyoplankton trapping was carried out biweekly between April and September, 1994, using wire mesh traps baited with bread and cylume light sticks. Qualitative dipnetting was conducted monthly in the macrophyte bed to check for trap bias. Temperature ranged from 16.1 C to 28 C in the reference areas and from 20.5 C to 34 C in the thermally influenced macrophyte bed. The lowest dissolvedmore » oxygen value (4.6 mg/L) was recorded in the effluent influenced area where the D.O. ranged from 4.6 to 8.8 mg/L. The D.O. in the reference macrophyte beds ranged from 5.8 to 12.3 mg/L. The smaller reference macrophyte beds had higher abundance and taxa richness than the thermally influenced macrophyte bed on 8 of the 10 trapping dates. In late May, the thermally influenced macrophyte bed had significantly higher ichthyoplankton abundance and richness (p < 0.05) than the reference areas. Significant differences occurred once more on September 21, 1994 when no fish were collected in the thermally influenced area resulting in significantly higher richness and abundance in the upstream reference area (p < 0.05). The communities were dominated by Centrarchidae of the genera Ambloplites, Micropterus and Lepomis. Catostomids and Cyprinids were collected at both the thermally influenced and reference stations. The sculpin, Cottus, was the only genus collected in a reference area that was not collected in the thermally influenced area. It appears that the macrophyte bed below the industrial facility was being utilized as a refugia for ichthyoplankton.« less

The IAU’s involvement in the Astronomy and World Heritage Initiative: achievements and challenges

NASA Astrophysics Data System (ADS)

Ruggles, Clive L. N.

2015-08-01

Since 2008 the IAU has worked with UNESCO and its advisory bodies to help recognise, promote and protect all types of astronomical heritage and to encourage nominations for World Heritage Sites relating to astronomy. I will review the main challenges and achievements so far, and suggest how the Astronomy and World Heritage Initiative is likely to develop in the future.Among the main milestones are the first two in a series of Thematic Studies (Ruggles and Cotte, 2010; 2015 in press), which help to establish broad principles for assessing the “value”, and ultimately the potential “outstanding universal value”, of different types of astronomical heritage, and the Portal to the Heritage of Astronomy, linked to the World Heritage Centre’s own website, which helps to raise awareness about important astronomical heritage sites and facilitates the comparative studies that form an essential part of any nomination dossier. Among the most challenging issues for the IAU has been how to recognise and protect the value of the dark night sky at places connected with astronomy—whether ancient sites, indigenous cultural landscapes, or modern observatories. A very significant development for the future is the IAU’s involvement in the “upstream process” whereby, along with UNESCO's advisory bodies, it can enter into discussion with, and give advice to, national authorities considering potential nominations.ReferencesRuggles, C. and Cotte, M., eds (2010) Heritage Sites of Astronomy and Archaeoastronomy: a Thematic Study. ICOMOS-IAU, Paris.

Trout density and health in a stream with variable water temperatures and trace element concentrations: does a cold-water source attract trout to increased metal exposure?

USGS Publications Warehouse

Harper, D.D.; Farag, A.M.; Hogstr, C.; MacConnell, Elizabeth

2009-01-01

A history of hard-rock mining has resulted in elevated concentrations of heavy metals in Prickly Pear Creek (MT. USA). Remediation has improved water quality; however, dissolved zinc and cadmium concentrations still exceed U.S. Environmental Protection Agency water-quality criteria. Physical habitat, salmonid density, fish health, and water quality were assessed, and metal concentrations in fish tissues, biofilm, and macroinvertebrates were determined to evaluate the existing condition in the watershed. Cadmium, zinc, and lead concentrations in fish tissues, biofilm, and invertebrates were significantly greater than those at the upstream reference site and an experimental site farther downstream of the confluence. Fish densities were greatest, and habitat quality for trout was better, downstream of the confluence, where water temperatures were relatively cool (16??C). Measures of fish health (tissue metal residues, histology, metallothionein concentrations, and necropsies), however, indicate that the health of trout at this site was negatively affected. Trout were in colder but more contaminated water and were subjected to increased trace element exposures and associated health effects. Maximum water temperatures in Prickly Pear Creek were significantly lower directly below Spring Creek (16??C) compared to those at an experimental site 10 km downstream (26??C). Trout will avoid dissolved metals at concentrations below those measured in Prickly Pear Creek; however, our results suggest that the preference of trout to use cool water temperatures may supersede behaviors to avoid heavy metals. ?? 2009 SETAC.

Spatial and temporal patterns of micropollutants in streams and effluent of 24 WWTPs across Switzerland

NASA Astrophysics Data System (ADS)

Schönenberger, Urs; Spycher, Barbara; Kistler, David; Burdon, Frank; Reyes, Marta; Eggen, Rik; Joss, Adriano; Singer, Heinz; Stamm, Christian

2016-04-01

Treated municipal wastewater is an important source of micropollutants entering the environment. Micropollutants are a diverse range of chemicals of which concentrations vary strongly in space and time. To better quantitatively understand the spatio-temporal patterns of micropollutants in streams, we compared upstream and downstream locations at 24 wastewater treatment plants (WWTPs) across the Swiss Plateau and Jura regions. Each site represents the most upstream treatment plant in the corresponding catchment. In 2013, a broad analytical screening was applied to samples collected at 12 sites during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 at 12 additional sites were analysed for a group of approximately 60 selected organic micropollutants. The screening results demonstrate that generally, pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest share of the organic micropollutants in wastewater. Pesticides including biocides and plant protection products are also regularly found, but at lower concentrations. The opposite holds true for the concentration variability: pesticides vary the most across time and space, while pharmaceuticals exhibit more stable concentrations. Heavy metals fluctuate to a similar degree as pharmaceuticals. Principal component analyses suggest that pesticide and pharmaceutical levels at both upstream locations and in the wastewater vary independently of each other. At the upstream locations, the pesticide levels increased with the proportion of arable land in the watershed, whilst decreasing with greater cover of pasture and forest. Interestingly, the same patterns hold true for the composition of wastewater when considering land use in the catchments of the WWTPs. This suggests that pesticide-intensive agricultural crops not only impact surface water quality via diffuse pollution but also increase levels of pesticides in wastewater discharged to the streams. As a consequence, catchment land uses and effluent composition appear to be inextricably bound.

Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

PubMed Central

González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina

2018-01-01

Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs from environmental hotspots such as discharge sites of pharmaceutical effluents. PMID:29387045

Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

PubMed Central

Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

1993-01-01

The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

Identification of American shad spawning sites and habitat use in the Pee Dee River, North Carolina and South Carolina

USGS Publications Warehouse

Harris, Julianne E.; Hightower, Joseph E.

2011-01-01

We examined spawning site selection and habitat use by American shad Alosa sapidissima in the Pee Dee River, North Carolina and South Carolina, to inform future management in this flow-regulated river. American shad eggs were collected in plankton tows, and the origin (spawning site) of each egg was estimated; relocations of radio-tagged adults on spawning grounds illustrated habitat use and movement in relation to changes in water discharge rates. Most spawning was estimated to occur in the Piedmont physiographic region within a 25-river-kilometer (rkm) section just below the lowermost dam in the system; however, some spawning also occurred downstream in the Coastal Plain. The Piedmont region has a higher gradient and is predicted to have slightly higher current velocities and shallower depths, on average, than the Coastal Plain. The Piedmont region is dominated by large substrates (e.g., boulders and gravel), whereas the Coastal Plain is dominated by sand. Sampling at night (the primary spawning period) resulted in the collection of young eggs (≤1.5 h old) that more precisely identified the spawning sites. In the Piedmont region, most radio-tagged American shad remained in discrete areas (average linear range = 3.6 rkm) during the spawning season and generally occupied water velocities between 0.20 and 0.69 m/s, depths between 1.0 and 2.9 m, and substrates dominated by boulder or bedrock and gravel. Tagged adults made only small-scale movements with changes in water discharge rates. Our results demonstrate that the upstream extent of migration and an area of concentrated spawning occur just below the lowermost dam. If upstream areas have similar habitat, facilitating upstream access for American shad could increase the spawning habitat available and increase the population's size.

Bedload entrainment in low-gradient paraglacial coastal rivers of Maine, U.S.A.: Implications for habitat restoration

NASA Astrophysics Data System (ADS)

Snyder, Noah P.; Castele, Michael R.; Wright, Jed R.

2009-02-01

The rivers of coastal Maine flow through mainstem lakes and long low-gradient reaches that break the continuum of bedload transport expected in nonparaglacial landscapes. Stream erosion of glacial deposits supplies coarse sediment to these systems. The land use history includes intensive timber harvest and associated dam construction, which may have altered the frequency of substrate-mobilizing events. These watersheds are vital habitat for the last remaining wild anadromous Atlantic salmon in the United States. Future adjustments in channel morphology and habitat quality (via natural stream processes or restoration projects) depend on erosion, transport, and deposition of coarse sediment. These factors motivate our study of competence at four sites in the Sheepscot and Narraguagus watersheds. Three of the four sites behaved roughly similarly, with particle entrainment during intervals that include winter ice and spring flood conditions, and relatively minor bed mobilization during moderate floods in the summer and fall (with a recurrence interval of 2-3 years). The fourth site, on the Sheepscot River mainstem, exhibits more vigorous entrainment of marked particles and more complex three-dimensional channel morphology. This contrast is partially due to local geomorphic conditions that favor high shear stresses (particularly relatively steep gradient), but also likely to nourishment of the bedload saltation system by recruitment from an eroding glacial deposit upstream. Our results suggest that the frequency and magnitude of bedload transport are reach specific, depending on factors including local channel geometry, upstream sediment supply and transport, and formation of anchor ice. This presents a challenge for stream practitioners in this region: different reaches may require contrasting management strategies. Our results underscore the importance of understanding channel processes at a given site and assessing conditions upstream and downstream as a prerequisite for conducting habitat restoration projects.

Bioavailability of Pb and Zn from mine tailings as indicated by erythrocyte aminolevulinic acid dehydratase (ALA-D) activity in suckers (Pisces: catostomidae)

USGS Publications Warehouse

Schmitt, Christopher J.; Dwyer, F. James; Finger, Susan E.

1984-01-01

The activity of the erythrocyte enzyme δ-aminolevulinic acid dehydratase (ALA-D) was measured in 35 catostomids (black redhorse, Moxostoma duquesnei; golden redhorse, M. erythrurum; northern hogsucker, Hypentelium nigricans) collected from three sites on a stream contaminated with Pb-, Cd-, and Zn-rich mine tailings and from an uncontaminated site upstream. Enzyme activity was expressed in terms of hemoglobin (Hb), DNA, and protein concentrations; these variables can be determined in the laboratory on once-frozen blood samples. Concentrations of Pb and Zn in blood and of Pb in edible tissues were significantly higher, and ALA-D activity was significantly lower, at all three contaminated sites than upstream. At the most contaminated site, ALA-D activity was 62–67% lower than upstream. Lead concentrations in the edible tissues and in blood were positively correlated (r = 0.80), whereas ALA-D activity was negatively correlated with Pb in blood (r = −0.70) and in edible tissues (r = −0.59). Five statistically significant relations between Pb and Zn in blood and ALA-D activity were determined. The two models that explained the highest percentage (> 74%) of the total variance also included factors related to Hb concentration. All five significant models included negative coefficients for variables that represented Pb in blood and positive coefficients for Zn in blood. The ALA-D assay with results standardized to Hb concentration represents an expedient alternative to the more traditional hematocrit standardization, and the measurement of ALA-D activity by this method can be used to document exposure of fish to environmental Pb.

Survival, transport, and sources of fecal bacteria in streams and survival in land-applied poultry litter in the upper Shoal Creek basin, southwestern Missouri, 2001-2002

USGS Publications Warehouse

Schumacher, John G.

2003-01-01

Densities of fecal coliform bacteria along a 5.7-mi (mile) reach of Shoal Creek extending upstream from State Highway 97 (site 3) to State Highway W (site 2) and in two tributaries along this reach exceeded the Missouri Department of Natural Resources (MDNR) standard of 200 col/100 mL (colonies per 100 milliliters) for whole-body contact recreation. A combination of techniques was used in this report to provide information on the source, transport, and survival of fecal bacteria along this reach of Shoal Creek. Results of water-quality samples collected during dye-trace and seepage studies indicated that at summer low base-flow conditions, pastured cattle likely were a substantial source of fecal bacteria in Shoal Creek at the MDNR monitoring site (site 3) at State Highway 97. Using repeat element Polymerase Chain Reaction (rep-PCR), cattle were the presumptive source of about 50 percent of the Escherichia coli (E. coli) isolates in water samples from site 3. Cattle, horses, and humans were the most common presumptive source of E. coli isolates at sites further upstream. Poultry was identified by rep-PCR as a major source of E. coli in Pogue Creek, a tributary in the upper part of the study area. Results of the rep-PCR were in general agreement with the detection and distribution of trace concentrations of organic compounds commonly associated with human wastewater, such as caffeine, the antimicrobial agent triclosan, and the pharmaceutical compounds acetaminophen and thiabendazole (a common cattle anthelmintic). Significant inputs of fecal bacteria to Shoal Creek occurred along a 1.6-mi reach of Shoal Creek immediately upstream from site 3. During a 36-hour period in July 2001, average densities of fecal coliform and E. coli bacteria increased from less than or equal to 500 col/100 mL upstream from this stream reach (sample site 2c) to 2,100 and 1,400 col/100 mL, respectively, at the MDNR sampling site. Fecal bacteria densities exhibited diurnal variability at all five sampling sites along the 5.7-mi study reach of Shoal Creek, but the trends at successive downstream sites were out of phase and could not be explained by simple advection and dispersion. At base-flow conditions, the travel time of bacteria in Shoal Creek along the 5.7-mi reach between State Highway W (site 2) and the MDNR sampling site (site 3) was about 26 hours. Substantial dispersion and dilution occurs along the upper 4.1 mi of this reach because of inflows from a number of springs and tributaries and the presence of several long pools and channel meanders. Minimal dispersion and dilution occurs along the 1.6-mi reach immediately upstream from the MDNR sampling site. Measurements of fecal bacteria decay in Shoal Creek during July 2001 indicated that about 8 percent of fecal coliform and E. coli bacteria decay each hour with an average first-order decay constant of 0.084 h-1 (per hour). Results of field test plots indicated that substantial numbers of fecal bacteria present in poul try litter can survive in fields for as much as 8 weeks after the application of the litter to the land surface. Median densities of fecal coliform and E. coli in slurry-water samples collected from fields increased from less than 60 col/100 mL before the application of turkey and broiler litter, to as large as 420,000 and 290,000 col/100 mL after the application of litter. Bacteria densities in the test plots generally decreased in a exponential manner over time with decay rates ranging from 0.085 to 0.185 d-1 (per day) for fecal coliform to between 0.100 and 0.250 d-1 for E. coli. The apparent survival of significant numbers of fecal bacteria on fields where poultry litter has been applied indicates that runoff from these fields is a potential source of fecal bacteria to vicinity streams for many weeks following litter application.

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

PubMed

Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

2003-04-01

Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

Assessment of biomarkers for contaminants of emerging concern on aquatic organisms downstream of a municipal wastewater discharge.

PubMed

Jasinska, Edyta J; Goss, Greg G; Gillis, Patricia L; Van Der Kraak, Glen J; Matsumoto, Jacqueline; de Souza Machado, Anderson A; Giacomin, Marina; Moon, Thomas W; Massarsky, Andrey; Gagné, Francois; Servos, Mark R; Wilson, Joanna; Sultana, Tamanna; Metcalfe, Chris D

2015-10-15

Contaminants of emerging concern (CECs), including pharmaceuticals, personal care products and estrogens, are detected in wastewater treatment plant (WWTP) discharges. However, analytical monitoring of wastewater and surface water does not indicate whether CECs are affecting the organisms downstream. In this study, fathead minnows (Pimephales promelas) and freshwater mussels Pyganodon grandis Say, 1829 (synonym: Anodonta grandis Say, 1829) were caged for 4 weeks in the North Saskatchewan River, upstream and downstream of the discharge from the WWTP that serves the Edmonton, AB, Canada. Passive samplers deployed indicated that concentrations of pharmaceuticals, personal care products, an estrogen (estrone) and an androgen (androstenedione) were elevated at sites downstream of the WWTP discharge. Several biomarkers of exposure were significantly altered in the tissues of caged fathead minnows and freshwater mussels relative to the upstream reference sites. Biomarkers altered in fish included induction of CYP3A metabolism, an increase in vitellogenin (Vtg) gene expression in male minnows, elevated ratios of oxidized to total glutathione (i.e. GSSG/TGSH), and an increase in the activity of antioxidant enzymes (i.e. glutathione reductase, glutathione-S-transferase). In mussels, there were no significant changes in biomarkers of oxidative stress and the levels of Vtg-like proteins were reduced, not elevated, indicating a generalized stress response. Immune function was altered in mussels, as indicated by elevated lysosomal activity per hemocyte in P. grandis caged closest to the wastewater discharge. This immune response may be due to exposure to bacterial pathogens in the wastewater. Multivariate analysis indicated a response to the CECs Carbamazepine (CBZ) and Trimethoprim (TPM). Overall, these data indicate that there is a 1 km zone of impact for aquatic organisms downstream of WWTP discharge. However, multiple stressors in municipal wastewater make measurement and interpretation of impact of CECs difficult since water temperature, conductivity and bacteria are also inducing biomarker responses in both fish and mussels. Copyright © 2015 Elsevier B.V. All rights reserved.

A data-mining framework for exploring the multi-relation between fish species and water quality through self-organizing map.

PubMed

Tsai, Wen-Ping; Huang, Shih-Pin; Cheng, Su-Ting; Shao, Kwang-Tsao; Chang, Fi-John

2017-02-01

The steep slopes of rivers can easily lead to large variations in river water quality during typhoon seasons in Taiwan, which may poses significant impacts on riverine eco-hydrological environments. This study aims to investigate the relationship between fish communities and water quality by using artificial neural networks (ANNs) for comprehending the upstream eco-hydrological system in northern Taiwan. We collected a total of 276 heterogeneous datasets with 8 water quality parameters and 25 fish species from 10 sampling sites. The self-organizing feature map (SOM) was used to cluster, analyze and visualize the heterogeneous datasets. Furthermore, the structuring index (SI) was adopted to determine the relative importance of each input variable of the SOM and identify the indicator factors. The clustering results showed that the SOM could suitably reflect the spatial characteristics of fishery sampling sites. Besides, the patterns of water quality parameters and fish species could be distinguishably (visually) classified into three eco-water quality groups: 1) typical upstream freshwater fishes that depended the most on dissolved oxygen (DO); 2) typical middle-lower reach riverine freshwater fishes that depended the most on total phosphorus (TP) and ammonia nitrogen; and 3) low lands or pond (reservoirs) freshwater fishes that depended the most on water temperature, suspended solids and chemical oxygen demand. According to the results of the SI, the representative indicators of water quality parameters and fish species consisted of DO, TP and Onychostoma barbatulum. This grouping result suggested that the methodology can be used as a guiding reference to comprehensively relate ecology to water quality. Our methods offer a cost-effective alternative to more traditional methods for identifying key water quality factors relating to fish species. In addition, visualizing the constructed topological maps of the SOM could produce detailed inter-relation between water quality and the fish species of stream habitat units. Copyright © 2016 Elsevier B.V. All rights reserved.

The possible influence of upstream upper-level baroclinic processes on the development of the QE II storm

NASA Technical Reports Server (NTRS)

Uccellini, L. W.

1986-01-01

An analysis of the QE II storm of September 9-11, 1978 presents evidence for the existence of upper-level baroclinic processes upstream of the rapidly developing cyclone. The analysis shows that a deepening shortwave trough was located 400 to 500 km upstream of the site of the storm 12 h prior to rapid cyclogenesis. The trough was associated with: (1) a polar jet marked by 65 m/s winds in its core and significant vertical and horizontal wind shear, (2) positive vorticity advection and divergence at the 300 mb level, and (3) an intense frontal zone that extended from 300 mb down to the surface. It also appears that a tropopause fold likely extruded stratospheric air down to the 700-800 mb level, 400-500 km upstream of the surface low and 12 h prior to the explosive development phase of the cyclone. These findings raise questions about Gyakum's (1983) assertion that the QE II storm developed in an area in which the baroclinic support was confined to the lower troposphere and the related assertion by Anthes et al. (1983) that upper-level forcing upstream of the area of rapid cyclogenesis was weak and apparently not important in this case.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

USDA-ARS?s Scientific Manuscript database

The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

PubMed

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

What’s Upstream? GIS’s critical role in developing nutrient reference conditions for estuaries

EPA Science Inventory

Eutrophication due to excess levels of nitrogen and phosphorus can seriously impair ecological function in estuaries. Protective criteria for nutrients are difficult to establish because the source can vary spatially and seasonally, originate either from the watershed or the oce...

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Analysis of ambient conditions and simulation of hydrodynamics and water-quality characteristics in Beaver Lake, Arkansas, 2001 through 2003

USGS Publications Warehouse

Galloway, Joel M.; Green, W. Reed

2006-01-01

Beaver Lake is a large, deep-storage reservoir located in the upper White River Basin in northwestern Arkansas. The purpose of this report is to describe the ambient hydrologic and water-quality conditions in Beaver Lake and its inflows and describe a two-dimensional model developed to simulate the hydrodynamics and water quality of Beaver Lake from 2001 through 2003. Water-quality samples were collected at the three main inflows to Beaver Lake; the White River near Fayetteville, Richland Creek at Goshen, and War Eagle Creek near Hindsville. Nutrient concentrations varied among the tributaries because of land use and contributions of nutrients from point sources. The median concentrations of total ammonia plus organic nitrogen were greater for the White River than Richland and War Eagle Creeks. The greatest concentrations of nitrite plus nitrate and total nitrogen, however, were observed at War Eagle Creek. Phosphorus concentrations were relatively low, with orthophosphorus and dissolved phosphorus concentrations mostly below the laboratory reporting limit at the three sites. War Eagle Creek had significantly greater median orthophosphorus and total phosphorus concentrations than the White River and Richland Creek. Dissolved organic-carbon concentrations were significantly greater at the White River than at War Eagle and Richland Creeks. The White River also had significantly greater turbidity than War Eagle Creek and Richland Creek. The temperature distribution in Beaver Lake exhibits the typical seasonal cycle of lakes and reservoirs located within similar latitudes. Beaver Lake is a monomictic system, in which thermal stratification occurs annually during the summer and fall and complete mixing occurs in the winter. Isothermal conditions exist throughout the winter and early spring. Nitrogen concentrations varied temporally, longitudinally, and vertically in Beaver Lake for 2001 through 2003. Nitrite plus nitrate concentrations generally decreased from the upstream portion of Beaver Lake to the downstream portion and generally were greater in the hypolimnion. Total ammonia plus organic nitrogen concentrations also decreased from the upstream end of Beaver Lake to the downstream end and were substantially greater in the hypolimnion of Beaver Lake. Phosphorus concentrations mostly were near or below laboratory detection limits in the epilimnion and metalimnion in Beaver Lake and were substantially greater in the hypolimnion in the upstream and middle parts of the reservoir. Measured total and dissolved organic carbon in Beaver Lake was relatively uniform spatially, longitudinally, and vertically in the reservoir from January 2001 through December 2003. Chlorophyll a concentrations measured at sites in the upstream portion of the lake were significantly greater than at the other sites in the downstream portion of Beaver Lake. During the study period, water clarity in Beaver Lake was significantly greater at the downstream end of the reservoir than at the upstream end. The greatest Secchi depths at the downstream end of the reservoir generally were observed in 2001 compared to 2002 and 2003, but did not have a seasonal pattern as observed at sites in the middle and upstream portion of the reservoir. Similar to Secchi depth results, turbidity results indicated greater water clarity in the downstream portion of Beaver Lake compared to the upstream portion. Turbidity also was greater in the hypolimnion than in the epilimnion in the reservoir during the stratification season. A two-dimensional, laterally averaged, hydrodynamic, and water-quality model using CE-QUAL-W2 Version 3.1 was developed for Beaver Lake and calibrated based on vertical profiles of temperature and dissolved oxygen, and water-quality constituent concentrations collected at various depths at four sites in the reservoir from April 2001 to April 2003. Simulated temperatures and dissolved-oxygen concentrations compared reasonably well with measured t

Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

PubMed Central

Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

2011-01-01

Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

Numerical simulation of vertical ground-water flux of the Rio Grande from ground-water temperature profiles, central New Mexico

USGS Publications Warehouse

Bartolino, James R.; Niswonger, Richard G.

1999-01-01

An important gap in the understanding of the hydrology of the Middle Rio Grande Basin, central New Mexico, is the rate at which water from the Rio Grande recharges the Santa Fe Group aquifer system. Several methodologies-including use of the Glover-Balmer equation, flood pulses, and channel permeameters- have been applied to this problem in the Middle Rio Grande Basin. In the work presented here, ground-water temperature profiles and ground-water levels beneath the Rio Grande were measured and numerically simulated at four sites. The direction and rate of vertical ground-water flux between the river and underlying aquifer was simulated and the effective vertical hydraulic conductivity of the sediments underlying the river was estimated through model calibration. Seven sets of nested piezometers were installed during July and August 1996 at four sites along the Rio Grande in the Albuquerque area, though only four of the piezometer nests were simulated. In downstream order, these four sites are (1) the Bernalillo site, upstream from the New Mexico State Highway 44 bridge in Bernalillo (piezometer nest BRN02); (2) the Corrales site, upstream from the Rio Rancho sewage treatment plant in Rio Rancho (COR01); (3) the Paseo del Norte site, upstream from the Paseo del Norte bridge in Albuquerque (PDN01); and (4) the Rio Bravo site, upstream from the Rio Bravo bridge in Albuquerque (RBR01). All piezometers were completed in the inner-valley alluvium of the Santa Fe Group aquifer system. Ground-water levels and temperatures were measured in the four piezometer nests a total of seven times in the 24-month period from September 1996 through August 1998. The flux between the surface- and ground-water systems at each of the field sites was quantified by one-dimensional numerical simulation of the water and heat exchange in the subsurface using the heat and water transport model VS2DH. Model calibration was aided by the use of PEST, a model-independent computer program that uses nonlinear parameter estimation. Mean vertical hydraulic conductivities were estimated by model calibration and range from 1.5x10-5 to 5.8x10-6 meters per second (m/s). Mean simulated vertical ground-water flux for the BRN02 piezometer nest is 3.30x10-7 m/s; for the COR01 piezometer nest is 3.58x10-7 m/s; for the PDN01 piezometer nest is 4.22x10- 7 m/s; and for the RBR01 piezometer nest is 2.05x10-7 m/s. Comparison of the simulated vertical fluxes and vertical hydraulic conductivities derived from this study with values from other studies in the Middle Rio Grande Basin indicate agreement between 1 and 3.5 orders of magnitude for hydraulic conductivity and within 1 order of magnitude for vertical flux.

The impact of on-site wastewater from high density cluster developments on groundwater quality

NASA Astrophysics Data System (ADS)

Morrissey, P. J.; Johnston, P. M.; Gill, L. W.

2015-11-01

The net impact on groundwater quality from high density clusters of unsewered housing across a range of hydro(geo)logical settings has been assessed. Four separate cluster development sites were selected, each representative of different aquifer vulnerability categories. Groundwater samples were collected on a monthly basis over a two year period for chemical and microbiological analysis from nested multi-horizon sampling boreholes upstream and downstream of the study sites. The field results showed no statistically significant difference between upstream and downstream water quality at any of the study areas, although there were higher breakthroughs in contaminants in the High and Extreme vulnerability sites linked to high intensity rainfall events; these however, could not be directly attributed to on-site effluent. Linked numerical models were then built for each site using HYDRUS 2D to simulate the attenuation of contaminants through the unsaturated zone from which the resulting hydraulic and contaminant fluxes at the water table were used as inputs into MODFLOW MT3D models to simulate the groundwater flows. The results of the simulations confirmed the field observations at each site, indicating that the existing clustered on-site wastewater discharges would only cause limited and very localised impacts on groundwater quality, with contaminant loads being quickly dispersed and diluted downstream due to the relatively high groundwater flow rates. Further simulations were then carried out using the calibrated models to assess the impact of increasing cluster densities revealing little impact at any of the study locations up to a density of 6 units/ha with the exception of the Extreme vulnerability site.

Occurrence of pharmaceuticals, hormones, and organic wastewater compounds in Pennsylvania waters, 2006-09

USGS Publications Warehouse

Reif, Andrew G.; Crawford, J. Kent; Loper, Connie A.; Proctor, Arianne; Manning, Rhonda; Titler, Robert

2012-01-01

Concern over the presence of contaminants of emerging concern, such as pharmaceutical compounds, hormones, and organic wastewater compounds (OWCs), in waters of the United States and elsewhere is growing. Laboratory techniques developed within the last decade or new techniques currently under development within the U.S. Geological Survey now allow these compounds to be measured at concentrations in nanograms per liter. These new laboratory techniques were used in a reconnaissance study conducted by the U.S. Geological Survey, in cooperation with the Pennsylvania Department of Environmental Protection, to determine the occurrence of contaminants of emerging concern in streams, streambed sediment, and groundwater of Pennsylvania. Compounds analyzed for in the study are pharmaceuticals (human and veterinary drugs), hormones (natural and synthetic), and OWCs (detergents, fragrances, pesticides, industrial compounds, disinfectants, polycyclic aromatic hydrocarbons, fire retardants and plasticizers). Reconnaissance sampling was conducted from 2006 to 2009 to identify contaminants of emerging concern in (1) groundwater from wells used to supply livestock, (2) streamwater upstream and downstream from animal feeding operations, (3) streamwater upstream from and streamwater and streambed sediment downstream from municipal wastewater effluent discharges, (4) streamwater from sites within 5 miles of drinking-water intakes, and (5) streamwater and streambed sediment where fish health assessments were conducted. Of the 44 pharmaceutical compounds analyzed in groundwater samples collected in 2006 from six wells used to supply livestock, only cotinine (a nicotine metabolite) and the antibiotics tylosin and sulfamethoxazole were detected. The maximum concentration of any contaminant of emerging concern was 24 nanograms per liter (ng/L) for cotinine, and was detected in a groundwater sample from a Lebanon County, Pa., well. Seven pharmaceutical compounds including acetaminophen, caffeine, carbamazepine, and the four antibiotics tylosin, sulfadimethoxine, sulfamethoxazole, and oxytetracycline were detected in streamwater samples collected in 2006 from six paired stream sampling sites located upstream and downstream from animal-feeding operations. The highest reported concentration of these seven compounds was for the antibiotic sulfamethoxazole (157 ng/L), in a sample from the downstream site on Snitz Creek in Lancaster County, Pa. Twenty-one pharmaceutical compounds were detected in streamwater samples collected in 2006 from five paired stream sampling sites located upstream or downstream from a municipal wastewater-effluent-discharge site. The most commonly detected compounds and maximum concentrations were the anticonvulsant carbamazepine, 276 ng/L; the antihistamine diphenhydramine, 135 ng/L; and the antibiotics ofloxacin, 329 ng/L; sulfamethoxazole, 1,340 ng/L; and trimethoprim, 256 ng/L. A total of 51 different contaminants of emerging concern were detected in streamwater samples collected from 2007 through 2009 at 13 stream sampling sites located downstream from a wastewater-effluent-discharge site. The concentrations and numbers of compounds detected were higher in stream sites downstream from a wastewater-effluent-discharge site than in stream sites upstream from a wastewater-effluent-discharge site. This finding indicates that wastewater-effluent discharges are a source of contaminants of emerging concern; these contaminants were present more frequently in the streambed-sediment samples than in streamwater samples. Antibiotic compounds were often present in both the streamwater and streambed-sediment samples, but many OWCs were present exclusively in the streambed-sediment samples. Compounds with endocrine disrupting potential including detergent metabolites, pesticides, and flame retardants, were present in the streamwater and streambed-sediment samples. Killinger Creek, a stream where wastewater-effluent discharges contribute a large percentage of the total flow, stands out as a stream with particularly high numbers of compounds detected and detected at the highest concentrations measured in the reconnaissance sampling. Nineteen contaminants of emerging concern were detected in streamwater samples collected quarterly from 2007 through 2009 at 27 stream sites within 5 miles of a drinking-water intake. The number of contaminants and the concentrations detected at the stream sites within 5 miles of drinking-water intakes were generally very low (concentrations less than 50 ng/L), much lower than those at sites downstream from a wastewater-effluent discharge. The most commonly detected compounds and maximum concentrations were caffeine, 517 ng/L; carbamazepine, 95 ng/L; sulfamethoxazole, 146 ng/L; and estrone, 3.15 ng/L. The concentrations and frequencies of detection of some of the contaminants of emerging concern appear to vary by season, which could be explained by compound use, flow regime, or differences in degradation rates. Concentrations of some contaminants were associated with lower flows as a result of decreased in-stream dilution of wastewater effluents or other contamination sources. Twenty-two contaminants of emerging concern were detected once each in streamwater samples collected in 2007 and 2008 from 16 fish-health stream sites located statewide. The highest concentrations were for the OWCs, including flame retardants tri(2-butoxyethyl)phosphate (604 ng/L) and tri(2-chloroethyl)phosphate (272 ng/L) and the fragrance isoquinoline (330 ng/L). Far fewer numbers of contaminants of emerging concern were detected at the fish-health sites than at the wastewater-effluent-discharge sites. Most of the fish-health sites were not located directly downstream from a wastewater-effluent discharge, but there were multiple wastewater-effluent discharges in the drainage basins upstream from the sampling sites. No distinct pattern of contaminant occurrence could be discerned for the fish-health stream sites

Quality of water and time of travel in Little Copiah Creek near Crystal Springs, Mississippi

USGS Publications Warehouse

Kalkhoff, S.J.

1981-01-01

An intensive quality of water study was conducted on Little Copiah Creek in the vicinity of Crystal Springs, Miss., from August 19 to August 21, 1980. The quality of water in Little Copiah Creek improved 7 miles downstream of a source of wastewater inflow. The mean total nitrogen concentration decreased from 17 to 1.1 milligrams per liter and the mean total phosphorus concentrations decreased from 5.8 to 0.39 milligrams per liter. The maximum five-day biochemical oxygen demand decreased from 14 to 1.4 milligrams per liter while the dissolved-oxygen concentration increased from 2.0 to 6.9 milligrams per liter. The maximum fecal coliform and fecal streptococcus densities at the upstream sampling site were 2,200 and 6,700 colonies per 100 milliliter, respectively, and were observed to decrease downstream to 160 and 1,500 colonies per 100 milliliters. The mean stream temperatures decreased downstream only slightly from 26.5 to 25.0 Celsius and the pH of the water ranged from 7.2 to 7.4 units upstream and 6.5 to 7.0 units at the downstream site. The average rate of dye travel through the upstream 2.3 mile reach was 0.08 miles per hour during the study. (USGS)

40 CFR 1054.625 - What requirements apply under the Transition Program for Equipment Manufacturers?

Code of Federal Regulations, 2011 CFR

2011-07-01

... number to contact for further information, or a Web site that includes this contact information. (5) The... configuration. Use good engineering judgment for these measurements, which may involve sampling exhaust upstream...

Mechanism of Promoter Melting by the Xeroderma Pigmentosum Complementation Group B Helicase of Transcription Factor IIH Revealed by Protein-DNA Photo-Cross-Linking

PubMed Central

Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit

2000-01-01

The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286

What’s Upstream? GIS’s critical role in developing nutrient reference conditions for estuaries - April 2, 2015

EPA Science Inventory

Eutrophication due to excess levels of nitrogen and phosphorus can seriously impair ecological function in estuaries. Protective criteria for nutrients are difficult to establish because the source can vary spatially and seasonally, originate either from the watershed or the oce...

Data on surface-water quality and quantity, lower Edgewood Creek basin, Douglas County, Nevada, 1984-85

USGS Publications Warehouse

La Camera, R. J.; Browning, S.B.

1988-01-01

Selected hydrologic data were collected from August 1984 through July 1985 at three sites on the lower part of Edgewood Creek, and at a recently constructed sediment-catchment basin that captures and retains runoff from developed areas in the lower Edgewood Creek drainage. The data were collected to quantify the discharge of selected constituents downstream from recent and planned watershed restoration projects, and to Lake Tahoe. Contained in this report are the results of quantitative analyses of 39 water samples for: total and dissolved ammonium, organic nitrogen, nitrite, nitrate, phosphorus, and orthophosphorus; suspended sediment; total iron, manganese, and zinc; and dissolved temperature, specific conductance, pH, and dissolved oxygen; summary statistics (means and standard deviations), and computations of instantaneous loads. On the basis of mean values, about 80% of the total nitrogen load at each of the three Edgewood Creek sites is in the form of organic nitrogen, 12% is in the form of nitrate nitrogen, 7% is in the form of ammonium nitrogen, and 1% is in the form of nitrite nitrogen. The percentage of total phosphorus load in the form of orthophosphorus at the three stream sites varies somewhat with time, but is generally greater at the two downstream sites than at the upstream site. In addition, the percentage of the total phosphorus load that is present in the dissolved state generally is greater at the two downstream sites than at the upstream site. (Lantz-PTT)

USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

PubMed

Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

1991-09-11

The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

Seasonal and diel movements of white sturgeon in the lower columbia river

USGS Publications Warehouse

Parsley, M.J.; Popoff, N.D.; Van Der Leeuw, B. K.; Wright, C.D.

2008-01-01

Continuous monitoring of the movements and depths used by white sturgeon Acipenser transmontanus with acoustic telemetry technologies in the lower Columbia River provided information on diel and seasonal migrations, local movements, and site fidelity. White sturgeon moved to shallower water at night and showed greater activity, inferred from rates of movement, than during daytime. The extent of local movement within a season was variable among fish; some fish readily moved among habitats while the movements of others were more constrained. White sturgeon were absent from the study area (river kilometers 45-52) during winter and returned from upstream during the spring, confirming an upstream seasonal migration in the fall and downstream migration in spring. The return of individual fish and reoccupation of areas previously inhabited showed that some white sturgeon exhibit site fidelity. This work shows that studies seeking to characterize habitat for white sturgeon need to be cognizant of diel migrations and site fidelity. We urge caution in the use of limited fish location data to describe habitats if diel activities and fine-scale movements are not known.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

A comparison of results from a hydrologic transport model (HSPF) with distributions of sulfate and mercury in a mine-impacted watershed in northeastern Minnesota.

PubMed

Berndt, Michael E; Rutelonis, Wes; Regan, Charles P

2016-10-01

The St. Louis River watershed in northeast Minnesota hosts a major iron mining district that has operated continuously since the 1890s. Concern exists that chemical reduction of sulfate that is released from mines enhances the methylation of mercury in the watershed, leading to increased mercury concentrations in St. Louis River fish. This study tests this idea by simulating the behavior of chemical tracers using a hydrologic flow model (Hydrologic Simulation Program FORTRAN; HSPF) and comparing the results with measured chemistry from several key sites located both upstream and downstream from the mining region. It was found that peaks in measured methylmercury (MeHg), total mercury (THg), dissolved organic carbon (DOC), and dissolved iron (Fe) concentrations correspond to periods in time when modeled recharge was dominated by active groundwater throughout the watershed. This helps explain why the timing and size of the MeHg peaks was nearly the same at sites located just upstream and downstream from the mining region. Both the modeled percentages of mine water and the measured sulfate concentrations were low and computed transit times were short for sites downstream from the mining region at times when measured MeHg reached its peak. Taken together, the data and flow model imply that MeHg is released into groundwater that recharges the river through riparian sediments following periods of elevated summer rainfall. The measured sulfate concentrations at the upstream site reached minimum concentrations of approximately 1 mg/L just as MeHg reached its peak, suggesting that reduction of sulfate from non-point sources exerts an important influence on MeHg concentrations at this site. While mines are the dominant source of sulfate to sites downstream from them, it appears that the background sulfate which is present at only 1-6 mg/L, has the largest influence on MeHg concentrations. This is because point sourced sulfate is transported generally under oxidized conditions and is not flushed through riparian sediments in a gaining stream watershed system. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Streamflow gain/loss in the Republican River basin, Nebraska, March 1989

USGS Publications Warehouse

Johnson, Michaela R.; Stanton, Jennifer S.; Cornwall, James F.; Landon, Matthew K.

2002-01-01

This arc and point data set contains streamflow measurement sites and reaches indicating streamflow gain or loss under base-flow conditions along the Republican River and tributaries in Nebraska during March 21 to 22, 1989 (Boohar and others, 1990). These measurements were made to obtain data on ground-water/surface-water interaction. Flow was visually observed to be zero, was measured, or was estimated at 136 sites. The measurements were made on the main stem of the Republican River and all flowing tributaries that enter the Republican River above Swanson Reservoir and parts of the Frenchman, Red Willow, and Medicine Creek drainages in the Nebraska part of the Republican River Basin. Tributaries were followed upstream until the first road crossing where zero flow was encountered. For selected streams, points of zero flow upstream of the first zero flow site were also checked. Streamflow gain or loss for each stream reach was calculated by subtracting the streamflow values measured at the upstream end of the reach and values for contributing tributaries from the downstream value. The data obtained reflected base-flow conditions suitable for estimating streamflow gains and losses for stream reaches between sites. This digital data set was created by manually plotting locations of streamflow measurements. These points were used to designate stream-reach segments to calculate gain/loss per river mile. Reach segments were created by manually splitting the lines from a 1:250,000 hydrography data set (Soenksen and others, 1999) at every location where the streams were measured. Each stream-reach segment between streamflow-measurement sites was assigned a unique reach number. All other lines in the hydrography data set without reach numbers were omitted. This data set was created to archive the calculated streamflow gains and losses of selected streams in part of the Republican River Basin, Nebraska in March 1989, and make the data available for use with geographic information systems (GIS). If measurement sites are used separately from reaches, the maximum scale of 1:100,000 should not be exceeded. When used in conjunction with the reach segments, the maximum scale should not exceed 1:250,000.

Population impacts in white sucker (Catostomus commersonii) exposed to oil sands-derived contaminants in the Athabasca River.

PubMed

Arens, Collin J; Arens, Jennifer C; Hogan, Natacha S; Kavanagh, Richard J; Berrue, Fabrice; Van Der Kraak, Glen J; van den Heuvel, Michael R

2017-08-01

Biological and chemical endpoints were measured in white sucker collected downstream of Athabasca oil sands developments (AB, Canada) and compared with those at Calling Lake (AB, Canada), a reference location upstream of the Athabasca oil sands deposit. Naphthenic acid concentrations were also measured at 14 sites in the Athabasca River watershed. Concentrations of naphthenic acids were elevated in tributaries adjacent to oil sands mining developments. Tributary naphthenic acid profiles were more similar to aged oil sands process water than samples from the Athabasca River, suggesting an influence of tailings in the tributaries. White sucker showed higher energy storage in the Athabasca River as indicated by significantly higher condition and liver size. White sucker were not investing that energy into reproductive effort as measured by gonad size and fecundity, which were significantly reduced relative to the reference location. White sucker showed increased exposure to polycyclic aromatic hydrocarbons as indicated by hepatic cytochrome P4501A (CYP1A) activity and fluorescent bile metabolites, as well as higher concentrations of naphthenic acids in bile. Cadmium, copper, nickel, and selenium were also elevated in white sucker liver tissue compared with the reference location. Based on the exposure profile and response pattern observed, effects on energy storage and utilization in white sucker from the Athabasca River most likely resulted from exposure to polycyclic aromatic hydrocarbons derived from petrogenic and pyrolytic sources. Environ Toxicol Chem 2017;36:2058-2067. © 2017 SETAC. © 2017 SETAC.

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

PubMed

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

PubMed

Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

2017-11-01

We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

PubMed

Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

2005-07-01

Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

Level II scour analysis for Bridge 41 (ANDOVT00110041) on State Route 11, crossing the Middle Branch Williams River, Andover, Vermont

USGS Publications Warehouse

Wild, Emily C.; Hammond, Robert E.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure ANDOVT00110041 on State Route 11 crossing the Middle Branch Williams River, Andover, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the Green Mountain section of the New England physiographic province in southeastern Vermont. The 12.1-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is grass on the upstream right overbank while the immediate banks have dense woody vegetation. The upstream left overbank and downstream right overbank are brushland. The downstream left overbank is forested. In the study area, the Middle Branch Williams River has an incised, sinuous channel with a slope of approximately 0.018 ft/ft, an average channel top width of 71 ft and an average bank height of 4 ft. The channel bed material ranges from gravel to boulders with a median grain size (D50) of 85.0 mm (0.279 ft). The geomorphic assessment at the time of the Level I and Level II site visit on September 10, 1996, indicated that the reach was laterally unstable due to a cut-bank present on the upstream right bank and a wide channel bar with vegetation in the upstream reach. The State Route 11 crossing of the Middle Branch Williams River is a 46-ft-long, two-lane bridge consisting of a concrete 44-foot tee-beam span (Vermont Agency of Transportation, written communication, March 29, 1995). The opening length of the structure parallel to the bridge face is 42 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 35 degrees to the opening while the opening-skew-toroadway is zero degrees. A scour hole 0.8 ft deeper than the mean thalweg depth was observed along the downstream end of the left abutment and downstream left wingwall during the Level I assessment. Type- 2 stone fill (less than 36 inches diameter) protects the upstream end of the upstream left wingwall, the downstream ends of the downstream left and right wingwalls and the downstream right road embankment. Type-3 stone fill protects the upstream end of the upstream right wingwall and the upstream right bank. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). In addition, the incipient roadway-overtopping discharge was determined and analyzed as another potential worst-case scour scenario. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 2.1 ft. The worst-case contraction scour occurred at the 500-year discharge. Abutment scour ranged from 11.1 to 18.7 ft. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

PubMed

Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

2011-09-26

HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

PubMed Central

2011-01-01

Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

A novel protein factor is required for use of distal alternative 5' splice sites in vitro.

PubMed Central

Harper, J E; Manley, J L

1991-01-01

Adenovirus E1A pre-mRNA was used as a model to examine alternative 5' splice site selection during in vitro splicing reactions. Strong preference for the downstream 13S 5' splice site over the upstream 12S or 9S 5' splice sites was observed. However, the 12S 5' splice site was used efficiently when a mutant pre-mRNA lacking the 13S 5' splice site was processed, and 12S splicing from this substrate was not reduced by 13S splicing from a separate pre-mRNA, demonstrating that 13S splicing reduced 12S 5' splice site selection through a bona fide cis-competition. DEAE-cellulose chromatography of nuclear extract yielded two fractions with different splicing activities. The bound fraction contained all components required for efficient splicing of simple substrates but was unable to utilize alternative 5' splice sites. In contrast, the flow-through fraction, which by itself was inactive, contained an activity required for alternative splicing and was shown to stimulate 12S and 9S splicing, while reducing 13S splicing, when added to reactions carried out by the bound fraction. Furthermore, the activity, which we have called distal splicing factor (DSF), enhanced utilization of an upstream 5' splice site on a simian virus 40 early pre-mRNA, suggesting that the factor acts in a position-dependent, substrate-independent fashion. Several lines of evidence are presented suggesting that DSF is a non-small nuclear ribonucleoprotein protein. Finally, we describe a functional interaction between DSF and ASF, a protein that enhances use of downstream 5' splice sites. Images PMID:1658620

Regulation of Dpp activity by tissue-specific cleavage of an upstream site within the prodomain

PubMed Central

Sopory, Shailaja; Kwon, Sunjong; Wehrli, Marcel; Christian, Jan L.

2010-01-01

BMP4 is synthesized as an inactive precursor that is cleaved at two sites during maturation: initially at a site (S1) adjacent to the ligand domain, and then at an upstream site (S2) within the prodomain. Cleavage at the second site regulates the stability of mature BMP4 and this in turn influences its signaling intensity and range of action. The Drosophila ortholog of BMP4, Dpp, functions as a long- or short-range signaling molecule in the wing disc or embryonic midgut, respectively but mechanisms that differentially regulate its bioactivity in these tissues have not been explored. In the current studies we demonstrate, by dpp mutant rescue, that cleavage at the S2 site of proDpp is required for development of the wing and leg imaginal discs, whereas cleavage at the S1 site is sufficient to rescue Dpp function in the midgut. Both the S1 and S2 site of proDpp are cleaved in the wing disc, and S2-cleavage is essential to generate sufficient ligand to exceed the threshold for pMAD activation at both short- and long-range in most cells. By contrast, proDpp is cleaved at the S1 site alone in the embryonic mesoderm and this generates sufficient ligand to activate physiological target genes in neighboring cells. These studies provide the first biochemical and genetic evidence that that selective cleavage of the S2 site of proDPP provides a tissue-specific mechanism for regulating Dpp activity, and that differential cleavage can contribute to, but is not an absolute determinant of signaling range. PMID:20659445

Restoring hydrological and biogeochemical ecosystem services in streams: how can science inform practice?

NASA Astrophysics Data System (ADS)

Lautz, L.; Gordon, R.; Daniluk, T.; Zimmer, M. A.; Endreny, T. A.; McGrath, K.

2014-12-01

Society is increasingly recognizing the value of stream ecosystem functions, as evidenced by the enormous economic investment being made in stream restoration across the United States. Stream restoration projects have a variety of goals, including improvement in water quality and in-stream habitat. Popular approaches to restoration (such as Natural Channel Design, or NCD) aim to move degraded streams along a trajectory toward a dynamic ecological endpoint that represents natural conditions. Project designs primarily focus on channel form and function, but stream-groundwater exchanges of water and solutes are not typically a design consideration, although a primary component of fully functioning stream ecosystems. Here, we synthesize results from field investigations of the impact of NCD stream restoration on stream-groundwater exchanges by (1) comparing restored sites to reference reaches, which serve as the basis for the restoration design, (2) characterizing multiple restored sites to determine universal characteristics of streams restored by NCD, and (3) monitoring a stream pre- and post- restoration. NCD restoration creates hot spots of rapid hyporheic exchange upstream of channel spanning structures, with water fluxes across the bed interface up to an order of magnitude higher than at pre-restoration or reference reaches. Elevated flux rates result in short hyporheic residence times, which are not sufficiently long to generate net changes in nutrient concentrations. Hot spots of biogeochemical transformations are instead located around secondary bedforms, such as pool-riffle sequences, where gross water exchange rates are more moderate. Reference reaches show greater evidence of groundwater discharge to the hyporheic zone relative to restored reaches, although observations before and after restoration suggest NCD can modify the spatial extent of groundwater discharge zones. Gross water exchange across the streambed interface along restored reaches is a small percentage of stream discharge, suggesting the primary impact of restoration on stream-groundwater exchange is promoting biochemical heterogeneity in the subsurface, rather than longitudinal net changes in stream solute concentrations. Results inform future design to achieve restoration goals.

Using Soluble Reactive Phosphorus and Ammonia to Identify Point Source Discharge from Large Livestock Facilities

NASA Astrophysics Data System (ADS)

Borrello, M. C.; Scribner, M.; Chessin, K.

2013-12-01

A growing body of research draws attention to the negative environmental impacts on surface water from large livestock facilities. These impacts are mostly in the form of excessive nutrient loading resulting in significantly decreased oxygen levels. Over-application of animal waste on fields as well as direct discharge into surface water from facilities themselves has been identified as the main contributor to the development of hypoxic zones in Lake Erie, Chesapeake Bay and the Gulf of Mexico. Some regulators claim enforcement of water quality laws is problematic because of the nature and pervasiveness of non-point source impacts. Any direct discharge by a facility is a violation of permits governed by the Clean Water Act, unless the facility has special dispensation for discharge. Previous research by the principal author and others has shown runoff and underdrain transport are the main mechanisms by which nutrients enter surface water. This study utilized previous work to determine if the effects of non-point source discharge can be distinguished from direct (point-source) discharge using simple nutrient analysis and dissolved oxygen (DO) parameters. Nutrient and DO parameters were measured from three sites: 1. A stream adjacent to a field receiving manure, upstream of a large livestock facility with a history of direct discharge, 2. The same stream downstream of the facility and 3. A stream in an area relatively unimpacted by large-scale agriculture (control site). Results show that calculating a simple Pearson correlation coefficient (r) of soluble reactive phosphorus (SRP) and ammonia over time as well as temperature and DO, distinguishes non-point source from point source discharge into surface water. The r value for SRP and ammonia for the upstream site was 0.01 while the r value for the downstream site was 0.92. The control site had an r value of 0.20. Likewise, r values were calculated on temperature and DO for each site. High negative correlations between temperature and DO are indicative of a relatively unimpacted stream. Results from this study are commensurate with nutrient correlations and are: r = -0.97 for the upstream site, r = -0.21 for the downstream site and r = -0.89 for the control site. Results from every site tested were statistically significant (p ≤ 0.05). These results support previous studies and demonstrate that the simple analytical techniques mentioned provide an effective means for regulatory agencies and community groups to monitor and identify point source discharge from large livestock facilities.

Water quality and benthic macroinvertebrate bioassessment of Gallinas Creek, San Miguel County, New Mexico, 1987-90

USGS Publications Warehouse

Garn, H.S.; Jacobi, G.Z.

1996-01-01

Upper Gallinas Creek in north-central New Mexico serves as the public water supply for the City of Las Vegas. The majority of this 84-square-mile watershed is within national forest lands managed by the U.S. Forest Service. In 1985, the Forest Service planned to conduct timber harvesting in the headwaters of Gallinas Creek. The City of Las Vegas was concerned about possible effects from logging on water quality and on water-supply treatment costs. The U.S. Geological Survey began a cooperative study in 1987 to (1) assess the baseline water-quality characteristics of Gallinas Creek upstream from the Las Vegas water-supply diversion, (2) relate water quality to State water- quality standards, and (3) determine possible causes for spatial differences in quality. During 1987-90, water-quality constituents and aquatic benthic macroinvertebrates were collected and analyzed at five sampling sites in the watershed. Specific conductance, pH, total hardness, total alkalinity, and calcium concentrations increased in a downstream direction, probably in response to differences in geology in the watershed. The water-quality standard for temperature was exceeded at the two most downstream sites probably due to a lack of riparian vegetation and low streamflow conditions. The standards for pH and turbidity were exceeded at all sites except the most upstream one. Concentrations of nitrogen species and phosphorus generally were small at all sites. The maximum total nitrogen concentration of 2.1 milligrams per liter was at the mouth of Porvenir Canyon; only one sample at this site exceeded the water-quality standard for total inorganic nitrogen. At each of the sites, 10 to 15 percent of the samples exceeded the total phosphorus standard of less than 0.1 milligram per liter. Except for aluminum and iron, almost all samples tested for trace elements contained concentrations less than the laboratory detection limit. No trace-element concentrations exceeded the State standard for domestic water supplies. Suspended-sediment concentrations appeared to increase with distance downstream; suspended sediment increased significantly from the uppermost site to the second site near the national forest boundary, most probably caused by runoff from the unpaved forest road adjacent to Gallinas Creek. The aquatic macroinvertebrate assessment indicated that the three upstream sites had good biological conditions and were nonimpaired, whereas the two downstream sites had lowered biological conditions and were slightly impaired. The water- quality and biological assessments provided similar results.

RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

PubMed

KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

2018-06-20

Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

[Residue Concentration and Distribution Characteristics of Perfluorinated Compounds in Surface Water from Qiantang River in Hangzhou Section].

PubMed

Zhang, Ming; Tang, Fang-liang; Yu, Ya-yun; Xu, Jian-fen; Li, Hua; Wu, Min-hua; Zhang, Wei; Pan, Jian-yang

2015-12-01

This study studied the pollution characteristics of perfluorinated compounds (PFCs) in Qiantang River in Hangzhou section (QR). Surface water samples, collected in July 2014 and January 2015 from 14 sites in QR were analyzed for 16 PFCs. All samples were prepared by solid-phase extraction with Oasis WAX cartridges and analyzed using the ultra performance liquid chromatography interfaced to tandem mass spectrometry ( UPLC-MS/MS). The results showed that 8 medium-and short-chain PFCs including C₄ and C₈ perfluorinated sulfonates (PFSAs) and C₄-C₉ perfluorinated carboxylic acids (PFCAs) were detected in the surface waters. The total concentrations of PFCs ranged from 0.98 to 609 ng · L⁻¹, while perfluorooctanoic acid (PFOA) dominated, with range of 0.59-538 ng L⁻¹, and perfluorooctane sulfonate (PFOS) was detected at lower levels, ranging from 0 to 2.48 ng · L⁻¹. The spatial distribution of PFCs varied, and the pollutant concentrations at the sampling sites located in upstream of the river such as Lanjiangkou and Jiangjunyan were relatively high, PFCs concentration showed a decreasing trend from the upstream to the downstream. According to the ratio of feature components, PFCs in surface water of QR originated largely from the input of direct sewage emissions. Taken together, the PFCs pollution was highly correlated with the upstream of Qiantang River valley's industry distribution, and most of the mass load in the investigated river was attributed to upstream running water with a minor influence from the wastewater discharges along the river basin. Overall, the results presented here indicated that greater attention should be given to the contamination of PFCs, especially for PFOA in water body of QR.

Contact sheet recording with a self-acting negative air bearing

NASA Technical Reports Server (NTRS)

Muftu , Sinan (Inventor); Hinteregger, Hans F (Inventor)

2000-01-01

A flat head and a tape transport arrangement impart a wrap angle to the tape at the upstream corner of the head. The wrap angle, corner sharpness and tape stiffness are sufficient to cause a moving tape to form a hollow bump at the upstream corner, thereby creating a hollow into which entrained air can expand, causing a subambient pressure within and downstream of the bump. This pressure keeps the tape in contact with the head. It is created without the need for a groove or complex pressure relief slot(s). No contact pressure arises at the signal exchange site due to media wrap. The highest contact pressures are developed at a wrapped upstream corner. For a tape drive, traveling in both forward and reverse, the wrap can be at both the upstream and downstream (which is the reverse upstream) corners. Heads that are not flat can also be used, if the wrap angle relative to a main surface is sufficient and not too large. The wrapped head can also be used with rotating media, such as disks (floppy and hard) and rotating heads, such as helical wound heads for video recording. Multiple flat tape bearing surfaces can be separated by grooves and/or angles. Each flat can carry heads along one or more gap lines. Multiple adjacent narrow tracks can thus be written for extreme high track density recording.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Water Quality, Fish Tissue, and Bed Sediment Monitoring in Waterbodies of Fort Chaffee Maneuver Training Center, Arkansas, 2002-2004

USGS Publications Warehouse

Justus, B.G.; Stanton, Gregory P.

2005-01-01

The Fort Chaffee Maneuver Training Center is a facility used to train as many as 50,000 Arkansas National Guardsmen each year. Due to the nature of ongoing training and also to a poor understanding of environmental procedures that were practiced in the World War II era, areas within Fort Chaffee have the potential to be sources of a large number of contaminants. Because some streams flow on to Fort Chaffee, there is also the potential for sources that are off post to affect environmental conditions on post. This study evaluates constituent concentrations in water, fish tissue, and bed sediment collected from waterbodies on Fort Chaffee between September 2002 and July 2004. Constituent concentrations detected in the three media and measured at nine stream sites and four lake sites were compared to national and regional criteria when available. Two of the larger streams, Big and Vache Grasse Creeks, were sampled at multiple sites. All three sampled media were analyzed for insecticides, PCBs, explosives, and trace elements. Additionally, water samples were analyzed for nutrients and herbicides. The different constituents detected in the three sample media (water, fish tissue, and bed sediment) indicate that land-use activities both on and off post are influencing environmental conditions. Contaminants such as explosives that were sometimes detected in water samples have an obvious relation to military training; however, the occurrence and locations of some nutrients, insecticides, and trace elements suggest that land use both on and off post also could be influencing environmental conditions to some degree. Constituent concentrations at sites on Vache Grasse Creek, and particularly the most upstream site, which was located immediately downstream from an off-post wastewater-treatment facility, indicate that environmental conditions were being influenced by an off-post source. The most upstream site on Vache Grasse Creek had both the highest number of detections and the highest concentrations detected of all sites sampled. Event-mean storm concentrations and storm loads calculated from storm-flow samples at two sites each for Big and Vache Grasse Creeks indicate that storm loads were highest at the two Vache Grasse Creek sites for 24 of the 25 constituents detected. Further evaluation by normalizing storm loads at Big Creek to storm loads at Vache Grasse Creek by stream flow indicate that event loads at Vache Grasse Creek were about two or more times higher than those on Big Creek for 15 of the 25 constituents measured. Low concentrations of arsenic and lead were detected in water samples, but all detections for the two trace elements occurred in samples collected at the upstream site on Vache Grasse Creek. The nickel concentration in fish livers collected from the upstream site on Vache Grasse Creek was 45 percent higher than the median of a national study of 145 sites. Mercury concentrations in edible fish tissue, which are a widespread concern in the United States, exceeded an USEPA criterion for methylmercury of 300 ?g/kg in four of nine samples; however, concentrations are typical of mercury concentrations in fish tissues for the State of Arkansas. Constituent concentrations at some sites indicate that environmental conditions are being influenced by on-post activities. Of the 55 (excluding total organic carbon) organic constituents analyzed in water samples, only 10 were detected above the minimum detection limit but four of those were explosives. Bed-sediment samples from one site located on Grayson Creek, and nearest the administrative and residential (cantonment) area, had detections for arsenic, copper, lead, manganese, nickel, and zinc that were above background concentrations, and concentrations for arsenic and nickel at this site exceeded lowest effect level criteria established by the U.S. Environmental Protection Agency. The site on Grayson Creek also had the only detections of DDT metabolites in bed sedi

Tumor Prevalence and Biomarkers of Exposure and Response in Brown Bullheads (Ameiurus nebulosus) from the Tidal Potomac River Watershed

USGS Publications Warehouse

Pinkney, A.E.; Harshbarger, J.C.; May, E.B.; Melancon, M.J.

2000-01-01

Four groups of thirty brown bullheads (Ameiurus nebulosus) were collected from the tidal Potomac River watershed to survey tumor prevalence in relation to contaminant exposure. Fish were obtained from the Quantico embayment, near a Superfund site that released polychlorinated biphenyls (PCBs) and DDT compounds; Neabsco Creek,.a tributary with petroleum inputs from upstream areas and marinas; and the Anacostia River (both in spring and fall),where sediment is contaminated with polynuclear aromatic hydrocarbons (PAHs), PCBs, and organochlorine pesticides. Fish were also collected from the Tuckahoe River, on the Eastern Shore of Maryland, as a reference. Fish were necropsied and examined grossly and histopathologically for skin and liver neoplasms. Cytochrome P450 activity, bile PAH metabolites, and muscle organochlorine pesticide/PCB concentrations were determined in randomly selected individuals. There were significant differences among sites in liver tumor prevalence: Anacostia (spring)-50%, Anacostia (fall)-60%, Neabsco-17%, Quantico-7%, Tuckahoe-10%. Skin tumor prevalences were also significantly different: Anacostia (spring)-37%, Anacostia (fall)-10%, Neabsco-3%, Quantico-3%, Tuckahoe-0%. Tumor prevalences in Anacostia fish were comparable to those at contaminated sites in the Great Lakes. PAH concentrations were higher in Anacostia sediments than at the other sites and there were significantly higher concentrations of PAH metabolites in bile of the Anacostia fish. At present, there are insufficient data, however, to establish a cause-effect linkage with a particular class of contaminants. Tumor surveys in selected species are recommended for monitoring the status and remediation of Regions of Concern and other areas in the Chesapeake Bay watershed.

Physiological changes in largemouth bass exposed to paper mill effluents under laboratory and field conditions

USGS Publications Warehouse

Sepulveda, M.S.; Gallagher, E.P.; Gross, T.S.

2004-01-01

We report here on studies designed to asses the effects of paper mill effluents on non-reproductive functions of free-ranging and captive Florida largemouth bass (Micropterus salmoides floridanus) This was accomplished by conducting an outdoor tank study, in which fish were exposed to well water or to 10%, 20%, 40%, and 80% full strength effluent for 28 or 56 days, and by sampling largemouth bass from sites within the St. Johns River, Florida, upstream and downstream from a paper mill plant. Blood and plasma samples from fish from the tank study and from fish sampled from the ambient sites were analyzed for over 20 variables. We also determined liver and spleen weights and examined them histologically. The most significant finding from the tank study was an increase in the concentration of albumin and hepatosomatic index for bass exposed to ???20% effluents for 56 days. Spleenosomatic index and number of melanomacrophage centers were decreased in bass from effluent-dominated sites (Palatka and Rice Creek), whereas concentrations of calcium, phosphorous, glucose, and creatinine were elevated in fish from these sites, compared to fish from reference streams. Fish from Rice Creek also had fewer red blood cells, and male bass from Palatka had lower concentrations of cholesterol. Plasma concentrations of albumin and hepatic concentrations of glutathione were elevated in males from Palatka, and both females and males from Rice Creek had higher concentrations of globulin. These results indicate a complex pattern of effects of paper mill effluents on several physiological functions. However, despite the myriad of treatment and site-related effects, most physiological parameters fell within normal ranges when compared to reports on largemouth bass and other freshwater species.

Field Evaluation of Detection-Control System

DOT National Transportation Integrated Search

2015-04-01

In this research, a field evaluation of the Detection-Control System (D-CS) was conducted at eight sites located in four States. D-CS is similar to a traditional advance detector system in that it uses information from detectors located upstream of t...

White sucker (Catostomus commersoni) growth and sexual maturation in pulp mill-contaminated and reference rivers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gagnon, M.M.; Bussieres, D.; Dodson, J.J.

1995-02-01

Induction of hepatic ethoxyresorufin-O-deethylase (EROD) activity and accumulation of chlorophenolic compounds typical of bleached-kraft mill effluent (BKME) in fish sampled downstream of a pulp mill on the St. Maurice River, Quebec, Canada, provided evidence of chemical exposure to BKME. In comparison, fish sampled over the same distances and in similar habitats in a noncontaminated reference river, the Gatineau River, demonstrated low EROD activity and contamination levels. Accelerated growth of white suckers occurred between 2 and 10 years of age in both rivers at downstream stations relative to upstream stations, suggesting the existence of gradients of nutrient enrichment independent of BKMEmore » contamination. The impact of BKME exposure was expressed as reduced investment in reproduction, as revealed by greater length at maturity, reduced gonad size, and more variable fecundity. These effects were not obvious in simple upstream-downstream comparisons, but became evident when fish from the uncontaminated Gatineau River showed increased gonadal development and reduced age and size at maturity in response to enhanced growth rates.« less

Pharmaceuticals and other organic chemicals in selected north-central and northwestern Arkansas streams

USGS Publications Warehouse

Haggard, B.E.; Galloway, J.M.; Green, W.R.; Meyer, M.T.

2006-01-01

Recently, our attention has focused on the low level detection of many antibiotics, pharmaceuticals, and other organic chemicals in water resources. The limited studies available suggest that urban or rural streams receiving wastewater effluent are more susceptible to contamination. The purpose of this study was to evaluate the occurrence of antibiotics, pharmaceuticals, and other organic chemicals at 18 sites on seven selected streams in Arkansas, USA, during March, April, and August 2004. Water samples were collected upstream and downstream from the influence of effluent discharges in northwestern Arkansas and at one site on a relatively undeveloped stream in north-central Arkansas. At least one antibiotic, pharmaceutical, or other organic chemical was detected at all sites, except at Spavinaw Creek near Mayesville, Arkansas. The greatest number of detections was observed at Mud Creek downstream from an effluent discharge, including 31 pharmaceuticals and other organic chemicals. The detection of these chemicals occurred in higher frequency at sites downstream from effluent discharges compared to those sites upstream from effluent discharges; total chemical concentration was also greater downstream. Wastewater effluent discharge increased the concentrations of detergent metabolites, fire retardants, fragrances and flavors, and steroids in these streams. Antibiotics and associated degradation products were only found at two streams downstream from effluent discharges. Overall, 42 of the 108 chemicals targeted in this study were found in water samples from at least one site, and the most frequently detected organic chemicals included caffeine, phenol, para-cresol, and acetyl hexamethyl tetrahydro naphthalene (AHTN). ?? ASA, CSSA, SSSA.

Stream channel responses and soil loss at off-highway vehicle stream crossings in the Ouachita National Forest

Treesearch

Daniel A. Marion; Jonathan D. Phillips; Chad Yocum; Stephanie H. Mehlhope

2014-01-01

This study investigates the geomorphic effects of ford-type stream crossings in an off-highway vehicle (OHV) trail complex in the Ouachita National Forest, Arkansas. At a total of 15 crossing sites, we used a disturbed vs. undisturbed study design to assess soil truncation and an upstream vs. downstream design to assess in-channel effects. The 15 sites ranged from OHV...

Migration Patterns, Densities, and Growth of Neritina punctulata Snails in Rio Espiritu Santo and Rio Mameyes, Northeastern Puerto Rico.

Treesearch

MARK PYRON; ALAN P. COVICH

2003-01-01

Snail size-frequency distributions in Rios Espiritu Santo and Mameyes, which drain the Luquillo Experimental Forest, Puerto Rico, showed that Neritina punctulata with shell lengths greater than 30 mm were the most abundant size class at upstream sites. The highest densities for all size classes were at the downstream sites. Growth rates were 0.015 mm/day for a large...

Prioritizing conservation activities using reserve site selection methods and population viability analysis.

PubMed

Newbold, Stephen C; Siikamäki, Juha

2009-10-01

In recent years a large literature on reserve site selection (RSS) has developed at the interface between ecology, operations research, and environmental economics. Reserve site selection models use numerical optimization techniques to select sites for a network of nature reserves for protecting biodiversity. In this paper, we develop a population viability analysis (PVA) model for salmon and incorporate it into an RSS framework for prioritizing conservation activities in upstream watersheds. We use spawner return data for three closely related salmon stocks in the upper Columbia River basin and estimates of the economic costs of watershed protection from NOAA to illustrate the framework. We compare the relative cost-effectiveness of five alternative watershed prioritization methods, based on various combinations of biological and economic information. Prioritization based on biological benefit-economic cost comparisons and accounting for spatial interdependencies among watersheds substantially outperforms other more heuristic methods. When using this best-performing prioritization method, spending 10% of the cost of protecting all upstream watersheds yields 79% of the biological benefits (increase in stock persistence) from protecting all watersheds, compared to between 20% and 64% for the alternative methods. We also find that prioritization based on either costs or benefits alone can lead to severe reductions in cost-effectiveness.

A new sampler design for measuring sedimentation in streams

USGS Publications Warehouse

Hedrick, Lara B.; Welsh, S.A.; Hedrick, J.D.

2005-01-01

Sedimentation alters aquatic habitats and negatively affects fish and invertebrate communities but is difficult to quantify. To monitor bed load sedimentation, we designed a sampler with a 10.16-cm polyvinyl chloride coupling and removable sediment trap. We conducted a trial study of our samplers in riffle and pool habitats upstream and downstream of highway construction on a first-order Appalachian stream. Sediment samples were collected over three 6-week intervals, dried, and separated into five size-classes by means of nested sieves (U.S. standard sieve numbers 4, 8, 14, and 20). Downstream sediment accumulated in size-classes 1 and 2, and the total amount accumulated was significantly greater during all three sampling periods. Size-classes 3 and 4 had significantly greater amounts of sediment for the first two sampling periods at the downstream site. Differences between upstream and downstream sites narrowed during the 5-month sampling period. This probably reflects changes in site conditions, including the addition of more effective sediment control measures after the first 6-week period of the study. The sediment sampler design allowed for long-term placement of traps without continual disturbance of the streambed and was successful at providing repeat measures of sediment at paired sites. ?? Copyright by the American Fisheries Society 2005.

Lateral movement and stability of channel banks near four highway crossings in southwestern Mississippi

USGS Publications Warehouse

Turnipseed, D. Phil

1994-01-01

Channel meandering in alluvial streams has caused localized channel instability that has resulted in bridge failure and loss of human life in Mississippi. The U.S. Geological Survey, in coopera- tion with the Mississippi Department of Transpor- tation, conducted a study to develop a better methodology for defining and estimating channel meandering. For this report, river reaches near four bridge sites with current lateral movement of channel banks were selected for study. The lateral movement of channel banks was studied by mapping meanders from aerial photographs taken at various times, evaluating available discharge measurements, and measuring existing channel geometry and soil strength properties at these sites. Rapid, unre- stricted meander cuts and sandy banks are charac- teristic of the sites. Lateral movement was signi- ficant upstream from all four sites, and only one bridge site did not have significant lateral channel-bank movement during the study period. The development of cutbanks and localized channel-bank erosion have caused unstable conditions at three of the sites. Maps of tops of channel indicate significant lateral movement of channel banks upstream and downstream of all four sites and near the bridges at three of four sites. No significant movement occurred at the U.S. Highway 98 crossing of the Bogue Chitto near Tylertown from 1941 to 1991 despite large floods in 1983 and 1990. Slope stability analyses indicated this site to be marginally stable. The maximum lateral movement indicated from maps of tops of channel banks was 680 feet of northward movement of the right (north) bank of the Homochitto River near the State Highway 33 crossing at Rosetta from 1941 to 1983.

Asymmetric connectivity of spawning aggregations of a commercially important marine fish using a multidisciplinary approach

PubMed Central

Jackson, Alexis; Marinone, Silvio Guido; Erisman, Brad; Moreno-Baez, Marcia; Girón-Nava, Alfredo; Pfister, Tad; Aburto-Oropeza, Octavio; Torre, Jorge

2014-01-01

Understanding patterns of larval dispersal is key in determining whether no-take marine reserves are self-sustaining, what will be protected inside reserves and where the benefits of reserves will be observed. We followed a multidisciplinary approach that merged detailed descriptions of fishing zones and spawning time at 17 sites distributed in the Midriff Island region of the Gulf of California with a biophysical oceanographic model that simulated larval transport at Pelagic Larval Duration (PLD) 14, 21 and 28 days for the most common and targeted predatory reef fish, (leopard grouper Mycteroperca rosacea). We tested the hypothesis that source–sink larval metapopulation dynamics describing the direction and frequency of larval dispersal according to an oceanographic model can help to explain empirical genetic data. We described modeled metapopulation dynamics using graph theory and employed empirical sequence data from a subset of 11 sites at two mitochondrial genes to verify the model predictions based on patterns of genetic diversity within sites and genetic structure between sites. We employed a population graph describing a network of genetic relationships among sites and contrasted it against modeled networks. While our results failed to explain genetic diversity within sites, they confirmed that ocean models summarized via graph and adjacency distances over modeled networks can explain seemingly chaotic patterns of genetic structure between sites. Empirical and modeled networks showed significant similarities in the clustering coefficients of each site and adjacency matrices between sites. Most of the connectivity patterns observed towards downstream sites (Sonora coast) were strictly asymmetric, while those between upstream sites (Baja and the Midriffs) were symmetric. The best-supported gene flow model and analyses of modularity of the modeled networks confirmed a pulse of larvae from the Baja Peninsula, across the Midriff Island region and towards the Sonoran coastline that acts like a larval sink, in agreement with the cyclonic gyre (anti-clockwise) present at the peak of spawning (May–June). Our approach provided a mechanistic explanation of the location of fishing zones: most of the largest areas where fishing takes place seem to be sustained simultaneously by high levels of local retention, contribution of larvae from upstream sites and oceanographic patterns that concentrate larval density from all over the region. The general asymmetry in marine connectivity observed highlights that benefits from reserves are biased towards particular directions, that no-take areas need to be located upstream of targeted fishing zones, and that some fishing localities might not directly benefit from avoiding fishing within reserves located adjacent to their communities. We discuss the implications of marine connectivity for the current network of marine protected areas and no-take zones, and identify ways of improving it. PMID:25165626

Level II scour analysis for Bridge 4 (DANVTH00010004) on Town Highway 1, crossing Joes Brook, Danville, Vermont

USGS Publications Warehouse

Flynn, Robert H.; Boehmler, Erick M.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure DANVTH00010004 on Town Highway 1 crossing Joes Brook, Danville, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the New England Upland section of the New England physiographic province in northeastern Vermont. The 42.5-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is pasture along the upstream and downstream left banks with trees and brush along the immediate banks. The upstream and downstream right banks are forested. In the study area, Joes Brook has an incised, sinuous channel with a slope of approximately 0.02 ft/ft, an average channel top width of 68 ft and an average bank height of 5 ft. The channel bed material ranges from gravel to bedrock with a median grain size (D50) of 80.1 mm (0.263 ft). The geomorphic assessment at the time of the Level I and Level II site visit on August 22, 1995, indicated that the reach was stable. The Town Highway 1 crossing of Joes Brook is a 49-ft-long, two-lane bridge consisting of one 45-foot steel-beam span (Vermont Agency of Transportation, written communication, March 17, 1995). The opening length of the structure parallel to the bridge face is 45 ft.The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 15 degrees to the opening and the computed opening-skew-to-roadway is 15 degrees. A scour hole 1.0 ft deeper than the mean thalweg depth was observed along the right abutment during the Level I assessment. The scour hole also extends upstream and downstream of the bridge, along the right side of the channel. The scour protection measures at the site include type-2 stone fill (less than 36 inches diameter) at the upstream end of the upstream left wingwall and along the entire base length of the downstream right wingwall. Type-3 stone fill (less than 48 inches diameter) is along the entire base length of the upstream right wingwall and type-5 protection (stone block wall) is along the upstream right bank. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995) for the 100- and 500-year discharges. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows was computed to be zero ft. Abutment scour ranged from 11.7 to 13.0 ft along the right abutment and from 6.6 to 9.4 ft along the left abutment. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich and Hire equations (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Multiple injected and natural conservative tracers quantify mixing in a stream confluence affected by acid mine drainage near Silverton, Colorado

NASA Astrophysics Data System (ADS)

Schemel, Laurence E.; Cox, Marisa H.; Runkel, Robert L.; Kimball, Briant A.

2006-08-01

The acidic discharge from Cement Creek, containing elevated concentrations of dissolved metals and sulphate, mixed with the circumneutral-pH Animas River over a several hundred metre reach (mixing zone) near Silverton, CO, during this study. Differences in concentrations of Ca, Mg, Si, Sr, and SO42- between the creek and the river were sufficiently large for these analytes to be used as natural tracers in the mixing zone. In addition, a sodium chloride (NaCl) tracer was injected into Cement Creek, which provided a Cl- reference tracer in the mixing zone. Conservative transport of the dissolved metals and sulphate through the mixing zone was verified by mass balances and by linear mixing plots relative to the injected reference tracer. At each of seven sites in the mixing zone, five samples were collected at evenly spaced increments of the observed across-channel gradients, as determined by specific conductance. This created sets of samples that adequately covered the ranges of mixtures (mixing ratios, in terms of the fraction of Animas River water, %AR). Concentratis measured in each mixing zone sample and in the upstream Animas River and Cement Creek were used to compute %AR for the reference and natural tracers. Values of %AR from natural tracers generally showed good agreement with values from the reference tracer, but variability in discharge and end-member concentrations and analytical errors contributed to unexpected outlier values for both injected and natural tracers. The median value (MV) %AR (calculated from all of the tracers) reduced scatter in the mixing plots for the dissolved metals, indicating that the MV estimate reduced the effects of various potential errors that could affect any tracer.

Streambed scour evaluations and conditions at selected bridge sites in Alaska, 2012

USGS Publications Warehouse

Beebee, Robin A.; Schauer, Paul V.

2015-11-19

Vertical contraction and pressure flow occurred during 1 percent or smaller annual exceedance probability floods at five sites, including three aggradation sites. Contraction scour exceeded 5 feet at two sites, and total scour at piers (pier scour plus contraction scour) exceeded 5 feet at two sites. Debris accumulation increased calculated pier scour at six sites by an average of 1.2 feet. Total scour at abutments including contraction scour exceeded 5 feet at seven sites. Scour estimates seemed excessive at aggradation sites where upstream sediment supply controls scour and deposition processes, at cohesive soil sites where conservative assumptions were made for soil strength and flood duration, and for abutment scour at sites where failure of the embankment and attendant channel widening would reduce scour.

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.)

PubMed Central

2012-01-01

Background Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication. PMID:23241244

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

PubMed

Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

2012-12-15

Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication.

Hydrologic, water-quality, and meteorologic data from selected sites in the Upper Catawba River Basin, North Carolina, January 1993 through March 1994

USGS Publications Warehouse

Jaynes, M.L.

1994-01-01

Hydrologic, water-quality, and meteorologic data were collected from January 1993 through March 1994 as part of a water-quality investigation of the Upper Catawba River Basin, North Carolina. Specific objectives of the investigation were to characterize the water quality of Rhodhiss Lake, Lake Hickory, and three tributary streams, and to calibrate hydrodynamic water-quality models for the two reservoirs. Sampling locations included 11 sites in Rhodhiss Lake, 14 sites in Lake Hickory, and 3 tributary sites. Tributary sites were located at Lower Creek upstream from Rhodhiss Lake and at Upper Little River and Middle Little River upstream from Lake Hickory. During 21 sampling visits, specific conductance, pH, water temperature, dissolved-oxygen concentration, and water transparency were measured at all sampling locations. Water samples were collected for analysis of biochemical oxygen demand, fecal coliform bacteria, hardness, alkalinity, total and volatile suspended solids, suspended sediment, nutrients, total organic carbon, chlorophyll, iron, calcium, and magnesium from three sites in each reservoir and from the three tributary sites. Chemical and particle-size analyses of bottom material from Rhodhiss Lake and Lake Hickory were performed once during the study. At selected locations, automated instruments recorded water level, streamflow, water temperature, solar radiation, and air temperature at 15-minute intervals throughout the study. Hydrologic data presented in the report include monthly water-level statistics and daily mean values of discharge. Diagrams, tables, and statistical summaries of water-quality data are provided. Meteorologic data in the report include monthly precipitation, and daily mean values of solar radiation and air temperature.

Effects of grade control structures on the macroinvertebrate assemblage of an agriculturally impacted stream

USGS Publications Warehouse

Litvan, M.E.; Stewart, T.W.; Pierce, C.L.; Larson, C.J.

2008-01-01

Nearly 400 rock rip-rap grade control structures (hereafter GCS) were recently placed in streams of western Iowa, USA to reduce streambank erosion and protect bridge infrastructure and farmland. In this region, streams are characterized by channelized reaches, highly incised banks and silt and sand substrates that normally support low macroinvertebrate abundance and diversity. Therefore, GCS composed of rip-rap provide the majority of coarse substrate habitat for benthic macroinvertebrates in these streams. We sampled 20 sites on Walnut Creek, Montgomery County, Iowa to quantify macroinvertebrate assemblage characteristics (1) on GCS rip-rap and at sites located (2) 5-50 m upstream of GCS, (3) 5-50 m downstream of GCS and (4) at least 1 km from any GCS (five sites each). Macroinvertebrate biomass, numerical densities and diversity were greatest at sites with coarse substrates, including GCS sites and one natural riffle site and relatively low at remaining sites with soft substrates. Densities of macroinvertebrates in the orders Ephemeroptera, Trichoptera, Diptera, Coleoptera and Acariformes were abundant on GCS rip-rap. Increases in macroinvertebrate biomass, density and diversity at GCS may improve local efficiency of breakdown of organic matter and nutrient and energy flow, and provide enhanced food resources for aquatic vertebrates. However, lack of positive macroinvertebrate responses immediately upstream and downstream of GCS suggest that positive effects might be restricted to the small areas of streambed covered by GCS. Improved understanding of GCS effects at both local and ecosystem scales is essential for stream management when these structures are present. Copyright ?? 2007 John Wiley & Sons, Ltd.

Characterization of organic composition in snow and surface waters in the Athabasca Oil Sands Region, using ultrahigh resolution Fourier transform mass spectrometry.

PubMed

Yi, Y; Birks, S J; Cho, S; Gibson, J J

2015-06-15

This study was conducted to characterize the composition of dissolved organic compounds present in snow and surface waters in the Athabasca Oil Sands Region (AOSR) with the goal of identifying whether atmospherically-derived organic compounds present in snow are a significant contributor to the compounds detected in surface waters (i.e., rivers and lakes). We used electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry (ESI-FTICR MS) to characterize the dissolved organic compound compositions of snow and surface water samples. The organic profiles obtained for the snow samples show compositional differences between samples from near-field sites (<5 km from oil sands activities) and those from more distant locations (i.e., far-field sites). There are also significant compositional differences between samples collected in near-field sites and surface water samples in the AOSR. The composition of dissolved organic compounds at the upstream Athabasca River site (i.e., Athabasca River at Athabasca) is found to be different from samples obtained from downstream sites in the vicinity of oil sands operations (i.e., Athabasca River at Fort McMurray and Athabasca River at Firebag confluence). The upstream Athabasca River sites tended to share some compositional similarities with far-field snow deposition, while the downstream Athabasca River sites are more similar to local lakes and tributaries. This contrast likely indicates the relative role of regional snowmelt contributions to the Athabasca River vs inputs from local catchments in the reach downstream of Fort McMurray. Copyright © 2015 Elsevier B.V. All rights reserved.

Fish assemblages in a western Iowa stream modified by grade control structures

USGS Publications Warehouse

Litvan, M.E.; Pierce, C.L.; Stewart, T.W.; Larson, C.J.

2008-01-01

Over 400 riprap grade control structures (GCSs) have been built in streams of western Iowa to reduce erosion and protect bridges, roads, and farmland. In conjunction with a companion study evaluating fish passage over GCSs in Turkey Creek, we evaluated the differences in fish assemblage and habitat characteristics in reaches immediately downstream from GCSs (GCS sites) and reaches at least 1 km from any GCS (non-GCS sites). The GCS sites were characterized by greater proportions of pool habitat, maximum depths, fish biomass, and abundance of juvenile largemouth bass Micropterus salmoides than were non-GCS sites. Index of biotic integrity (IBI) scores were poor or fair (<43 on a 0-100 scale) and not significantly different between the GCS and non-GCS sites. Additionally, we investigated both the longitudinal changes in fish assemblages in this GCS-fragmented stream and the changes in fish assemblages after slope modifications of three GCSs to facilitate fish passage. Thirteen fish species were present throughout the study area, whereas another 15 species exhibited truncated distributions not extending to the most upstream sampling location. After modification of the GCSs, IBI scores increased at seven of nine sites (mean increase =4.6 points). Also, channel catfish Ictalurus punctatus were detected 7.3 km upstream at sites where, 2 years before GCS modification, they had been absent from collections. Given the number and distribution of GCSs in western Iowa streams, understanding the effects of these structures is vital to the conservation and management of fish assemblages in this and other regions where GCSs or similar structures are used. ?? Copyright by the American Fisheries Society 2008.

Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

PubMed

Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

2015-09-01

The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

PubMed

Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

2004-09-01

Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

Potential Danger of Pre-Pump Clamping on Negative Pressure-Associated Gaseous Microemboli Generation During Extracorporeal Life Support--An In Vitro Study.

PubMed

Wang, Shigang; Chin, Brian J; Gentile, Frank; Kunselman, Allen R; Palanzo, David; Ündar, Akif

2016-01-01

The objectives of this study were to investigate the relationship between revolution speed of a conventional centrifugal pump and negative pressure at the inlet of the pump by clamping the tubing upstream of the pump, and to verify whether negative pressure leads to gaseous microemboli (GME) production in a simulated adult extracorporeal life support (ECLS) system. The experimental circuit, including a Maquet Rotaflow centrifugal pump and a Medos Hilite 7000 LT polymethyl-pentene membrane oxygenator, was primed with packed red blood cells (hematocrit 35%). Negative pressure was created in the circuit by clamping the tubing upstream of the pump for 10 s, and then releasing the clamp. An emboli detection and classification quantifier was used to record GME volume and count at pre-oxygenator and post-oxygenator sites, and pressure and flow rate data were collected using a custom-based data acquisition system. All trials were conducted at 36°C at revolution speeds of 2000-4000 rpm (500 rpm increment). The flow rates were 1092.5-4708.4 mL/min at the revolution speeds of 2000-4000 rpm. Higher revolution speed generated higher negative pressure at the pre-pump site when clamping the tubing upstream of the pump (-108.3 ± 0.1 to -462.0 ± 0.5 mm Hg at 2000-4000 rpm). Moreover, higher negative pressure was associated with a larger number and volume of GME at pre-oxygenator site after de-clamp (GME count 10,573 ± 271 at pre-oxygenator site at 4000 rpm). The results showed that there was a potential danger of delivering GME to the patient when clamping pre-pump tubing during ECLS using a centrifugal pump. Our results warrant further clinical studies to investigate this phenomenon. Copyright © 2015 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

High cancer-specific expression of mesothelin (MSLN) is attributable to an upstream enhancer containing a transcription enhancer factor dependent MCAT motif.

PubMed

Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E

2007-10-01

Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.

Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

PubMed Central

Lloyd, G S; Busby, S J; Savery, N J

1998-01-01

During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow.

PubMed

Suryawanshi, Gajendra W; Xu, Song; Xie, Yiming; Chou, Tom; Kim, Namshin; Chen, Irvin S Y; Kim, Sanggu

2017-06-14

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

Hydroecological monitoring in the headwaters of the Volga River

NASA Astrophysics Data System (ADS)

Kuzovlev, Viacheslav V.; Zhenikov, Yuri N.; Zhenikov, Kyrill Y.; Shaporenko, Sergey I.; Haun, Stefan; Füreder, Leopold; Schletterer, Martin

2016-04-01

Europe's largest river, the Volga (3551 km), has experienced multiple stressors from human activities (i.e. the Volga Basin comprises about 40 % of the Russian population, 45 % of the country's industry and more than 50 % of its agriculture). During the research expedition "Upper Volga 2005" an assessment of hydrological, limnochemical and biological parameters was carried out by scientists from the Russian Federation and from Austria. The extensive sampling in 2005 showed that the free-flowing section of the Volga River, located upstream of Tver, represents conditions which are either reference or least disturbed - thus it can be considered as a refugial system for freshwater biota of the European lowlands. Subsequently three stretches in the headwaters of the Volga River (Rzhev, Staritsa, Tver) were selected for the monitoring programme "REFCOND_VOLGA", which is in operation since 2006. These locations correspond also with the sampling sites of ROSHYDROMET, i.e. at Tver physic-chemical samples are taken monthly and at Rzhev samples are taken in the main hydrological periods. The laboratory ship "ROSHYDROMET 11" conducted monthly cruises between Tver and Kalyazin (Ivankovskoye and Uglichskoye reservoirs on Volga) in the headwaters during the navigation period (May - October). This also includes measurements with ADCP, which further allow the analyses of the spatial distribution of the suspended solids within cross sections. In addition sediment fluxes were derived by using the acoustic backscatter signal strength from the acoustic current Doppler profiler (ADCP). We exemplify at the monitoring sites the spatial distribution of different sediments, i.e. choriotope types, according the longitudinal profile of the river. We show that it is highly influenced by morphodynamics in the different river sections and this corresponds with the zoobenthos fauna accordingly. This interdisciplinary approach, including sediment conditions, limnochemistry, hydrology and hydrobiology, leads to a hydro-ecological reference for European lowland rivers.

Study on impact of habitat degradation on proximate composition and amino acid profile of Indian major carps from different habitats.

PubMed

Hussain, Bilal; Sultana, Tayyaba; Sultana, Salma; Ahmed, Z; Mahboob, Shahid

2018-05-01

This investigation is aimed to study an impact of habitat degradation on proximate composition and amino acid (AAs) profile of Catla catla, Labeo rohita and Cirrhinus mrigala collected from polluted, non-polluted area (upstream) and a commercial fish farm. The amino acid profile was estimated by the amino acid analyzer. C. catla collected from the polluted environment had highest lipid, protein and ash contents (12.04 ± 0.01, 13.45 ± 0.01 and 0.93 ± 0.03%, respectively). The high protein content (14.73 ± 0.01 and 14.12 ± 0. 01%) was recorded in C. catla procured from non-polluted (upstream) wild habitat of River Chenab and controlled commercial fish farm. Farmed fish species showed comparatively higher moisture contents followed by upstream and polluted area fishes. C. mrigala showed significant differences in amino acid and proximate composition collected from a polluted site of the river Chenab. C. catla collected from non-polluted site of the river showed an excellent nutrient profile, followed by L. rohita (wild and farmed) and C. mrigala (polluted area), respectively. All fishes from the polluted areas of the River Chenab indicated a significant decrease in the concentration of some AAs when compared to farmed and wild (upstream) major carps. Omitting of some important AAs was also observed in the meat of fish harvested from polluted habitat of this river. C. mrigala and L. rohita exhibited a significant increase in the concentration of some of non-essential amino acids such as cysteine in their meat. The results indicated that wild fish (upstream) and farmed fish species had highest protein contents and amino acid profile and hence appeared to be the best for human consumption. The proximate composition and AAs profiles of fish harvested from the polluted area of the river clearly indicated that efforts shall be made for the restoration of habitat to continue the requirement of high quality fish meat at a low cost to the human population.

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

PubMed Central

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Assessing distribution of migratory fishes and connectivity following complete and partial dam removals in a North Carolina River

USGS Publications Warehouse

Raabe, Joshua K.; Hightower, Joseph E.

2014-01-01

Fish, especially migratory species, are assumed to benefit from dam removals that restore connectivity and access to upstream habitat, but few studies have evaluated this assumption. Therefore, we assessed the movement of migratory fishes in the springs of 2008 through 2010 and surveyed available habitat in the Little River, North Carolina, a tributary to the Neuse River, after three complete dam removals and one partial (notched) dam removal. We tagged migratory fishes with PIT tags at a resistance-board weir located at a dam removal site (river kilometer [rkm] 3.7) and followed their movements with an array of PIT antennas. The river-wide distribution of fish following removals varied by species. For example, 24–31% of anadromous American Shad Alosa sapidissima, 45–49% of resident Gizzard Shad Dorosoma cepedianum, and 4–11% of nonnative Flathead CatfishPylodictis olivaris passed the dam removal site at rkm 56 in 2009 and 2010. No preremoval data were available for comparison, but reach connectivity appeared to increase as tagged individuals passed former dam sites and certain individuals moved extensively both upstream and downstream. However, 17–28% did not pass the partially removed dam at rkm 7.9, while 20–39% of those that passed remained downstream for more than a day before migrating upstream. Gizzard Shad required the deepest water to pass this notched structure, followed by American Shad then Flathead Catfish. Fish that passed the notched dam accessed more complex habitat (e.g., available substrate size-classes) in the middle and upper reaches. The results provide strong support for efforts to restore currently inaccessible habitat through complete removal of derelict dams.

Organochlorine chemical residues in bluegills and common carp from the irrigated San Joaquin Valley floor, California

USGS Publications Warehouse

Saiki, Michael K.; Schmitt, Christopher J.

1986-01-01

Samples of bluegills (Lepomis macrochirus) and common carp (Cyprinus carpio) collected from the San Joaquin River and two tributaries (Merced River and Salt Slough) in California were analyzed for 21 organochlorine chemical residues by gas chromatography to determine if pesticide contamination was confined to downstream sites exposed to irrigated agriculture, or if nonirrigated upstream sites were also contaminated. Residues ofp,p′-DDE were detected in all samples of both species. Six other contaminants were also present in both species at one or more of the collection sites: chlordane (cis-chlordane +trans-nonachlor);p,p′-DDD;o,p′-DDT;p,p′-DDT; DCPA (dimethyl tetrachloroterephthalate); and dieldrin. Concentrations of most of these residues were generally higher in carp than in bluegills; residues of other compounds were found only in carp: α-BHC (α-benzenehexachloride), Aroclor® 1260, and toxaphene. Concentrations of most organochlorines in fish increased from upstream to downstream. Water quality variables that are influenced by irrigation return flows (e.g., conductivity, turbidity, and total alkalinity) also increased from upstream to downstream and were significantly correlated (P < 0.05) with organochlorine residue levels in the fish. In carp, concentrations of two residues-⌆DDT (p,p′-DDD +p,p′-DDE + +p,p′-DDT; 1.43 to 2.21 mg/kg wet weight) and toxaphene (3.12 mg/kg wet weight)-approached the highest levels reported by the National Pesticide Monitoring Program for fish from other intensively farmed watersheds of the United States in 1980 to 1981, and surpassed criteria for whole-body residue concentrations recomended by the National Academy of Sciences and National Academy of Engineers for the protection of piscivorous wildlife.

Habitat and movement of lake sturgeon in the upper Mississippi River system, USA

USGS Publications Warehouse

Knights, Brent C.; Vallazza, Jonathon M.; Zigler, Steven J.; Dewey, Michael R.

2002-01-01

Lake sturgeon Acipenser fluvescens, which are now protected from harvest, are considered rare in the upper Mississippi River and little information is available on the remaining populations. Transmitters were implanted into 31 lake sturgeon from two sites in the upper Mississippi River to describe their habitats and movement. The areas surrounding the tagging sites were core areas for both groups of lake sturgeon based on the high use (about 50% of locations by group) and frequent return to these areas by many of the tagged fish. Core areas contained sites with unique hydraulic characteristics, such that depositional substrates were common yet flow was present; these areas probably provide important feeding habitat for lake sturgeon. Minimal geographical overlap in range occurred between groups, suggesting that river reaches and associated core areas were unique to groups or substocks of fish. Lake sturgeon exhibited complex movement behaviors and had ranges of 3-198 km (median, 56 km) during the study. Tagged fish moved both downstream and upstream through upper Mississippi River navigation dams. However, dams appeared to be intermittent barriers to upstream passage because upstream passage events (10 fish, 19 passages) were fewer than downstream events (13 fish, 35 passages). Extensive use of the Wisconsin River by one group of lake sturgeon tagged in the upper Mississippi River has implications regarding management of a threatened population that transcends regulatory boundaries. Our study indicates that lake sturgeon In the upper Mississippi River system share many movement and habitat use characteristics with populations in other systems. However, significant data gaps preclude development of cogent management strategies, including information on population numbers and dynamics, identification of spawning areas, relations between groups, and assessment of the effects of commercial navigation.

Influence of remediation in a mine-impacted river: Metal trends over large spatial and temporal scales

USGS Publications Warehouse

Hornberger, Michelle I.; Luoma, S.N.; Johnson, M.L.; Holyoak, M.

2009-01-01

The effectiveness of mine-waste remediation at the Clark Fork River Superfund site in western Montana, USA, was examined by monitoring metal concentrations in resident biota (caddisfly, Hydropsyche spp.) and bed sediment over a 19-year period. Remediation activities began in 1990 and are ongoing. In the upper 45 km, reduced Cu and Cd concentrations at some sites were coincident with remediation events. However, for a period of three years, the decline in Cu and Cd directly below the treatment ponds was offset by high arsenic concentrations, suggesting that remediation for cations (e.g., Cu and Cd) mobilized anions such as arsenic. The impact of remediation in the middle and lower reaches was confounded by a significant positive relationship between metal bioaccumulation and stream discharge. High flows did not dilute metals but redistributed contaminants throughout the river. The majority of clean-up efforts were focused on reducing metal-rich sediments in the most contaminated upstream reach, implicitly assuming that improvements upstream will positively impact the downstream stations. We tested this assumption by correlating temporal metal trends in sediment between and among stations. The strength of that association (r value) was our indicator of spatial connectivity. Connectivity for both Cu and Cd was strong at small spatial scales. Large-scale connectivity was strongest with Cu since similar temporal reductions were observed at most monitoring stations. The most upstream station, closest to remediation, had the lowest connectivity, but the next three downstream sites were strongly correlated to trends downstream. Targeted remediation in this reach would be an effective approach to positively influencing the downstream stations. ?? 2009 by the Ecological Society ot America.

Level II scour analysis for Bridge 39 (ANDOVT00110039) on State Route 11, crossing the Middle Branch Williams River, Andover, Vermont

USGS Publications Warehouse

Burns, Ronda L.; Wild, Emily C.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure ANDOVT00110039 on State Route 11 crossing the Middle Branch Williams River, Andover, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the Green Mountain section of the New England physiographic province in southern Vermont. The 5.75-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is forest on the upstream left bank and downstream right bank. The surface cover on the upstream right and downstream left banks is brush. In the study area, the Middle Branch Williams River has an incised, sinuous channel with a slope of approximately 0.01 ft/ft, an average channel top width of 58 ft and an average bank height of 8 ft. The channel bed material ranges from sand to boulder with a median grain size (D50) of 96.8 mm (0.317 ft). The geomorphic assessment at the time of the Level I and Level II site visit on September 9, 1996, indicated that the reach was laterally unstable. The State Route 11 crossing of the Middle Branch Williams River is a 43-ft-long, two-lane bridge consisting of one 41-foot concrete-beam span and two additional steel beams on the upstream face (Vermont Agency of Transportation, written communication, March 29, 1995). The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 45 degrees to the opening while the opening-skew-to-roadway is 45 degrees. The only scour protection measures at the site was type-2 stone fill (less than 36 inches diameter) at the upstream end of the upstream right wingwall and type-3 stone fill (less than 48 inches diameter) along the entire base length of the upstream left wingwall. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 0.8 ft. The worst-case contraction scour occurred at the 500-year discharge. Abutment scour ranged from 8.9 to 11.2 ft. The worst-case abutment scour occurred at the incipient-overtopping discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Occurrence and partitioning of antibiotic compounds found in the water column and bottom sediments from a stream receiving two wastewater treatment plant effluents in northern New Jersey, 2008.

PubMed

Gibs, Jacob; Heckathorn, Heather A; Meyer, Michael T; Klapinski, Frank R; Alebus, Marzooq; Lippincott, Robert L

2013-08-01

An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and ofloxacin. Generally, there was good agreement between the decreasing order of the pseudo-partition coefficients in this study and the order reported in the literature. Published by Elsevier B.V.

Evaluating the effectiveness of restoring longitudinal connectivity for stream fish communities: towards a more holistic approach.

PubMed

Tummers, Jeroen S; Hudson, Steve; Lucas, Martyn C

2016-11-01

A more holistic approach towards testing longitudinal connectivity restoration is needed in order to establish that intended ecological functions of such restoration are achieved. We illustrate the use of a multi-method scheme to evaluate the effectiveness of 'nature-like' connectivity restoration for stream fish communities in the River Deerness, NE England. Electric-fishing, capture-mark-recapture, PIT telemetry and radio-telemetry were used to measure fish community composition, dispersal, fishway efficiency and upstream migration respectively. For measuring passage and dispersal, our rationale was to evaluate a wide size range of strong swimmers (exemplified by brown trout Salmo trutta) and weak swimmers (exemplified by bullhead Cottus perifretum) in situ in the stream ecosystem. Radio-tracking of adult trout during the spawning migration showed that passage efficiency at each of five connectivity-restored sites was 81.3-100%. Unaltered (experimental control) structures on the migration route had a bottle-neck effect on upstream migration, especially during low flows. However, even during low flows, displaced PIT tagged juvenile trout (total n=153) exhibited a passage efficiency of 70.1-93.1% at two nature-like passes. In mark-recapture experiments juvenile brown trout and bullhead tagged (total n=5303) succeeded in dispersing upstream more often at most structures following obstacle modification, but not at the two control sites, based on a Laplace kernel modelling approach of observed dispersal distance and barrier traverses. Medium-term post-restoration data (2-3years) showed that the fish assemblage remained similar at five of six connectivity-restored sites and two control sites, but at one connectivity-restored headwater site previously inhabited by trout only, three native non-salmonid species colonized. We conclude that stream habitat reconnection should support free movement of a wide range of species and life stages, wherever retention of such obstacles is not needed to manage non-native invasive species. Evaluation of the effectiveness of fish community restoration in degraded streams benefits from a similarly holistic approach. Copyright © 2016 Elsevier B.V. All rights reserved.

Occurence of antibiotic compounds found in the water column and bottom sediments from a stream receiving two waste water treatment plant effluents in northern New Jersey, 2008

USGS Publications Warehouse

Gibs, Jacob; Heckathorn, Heather A.; Meyer, Michael T.; Klapinski, Frank R.; Alebus, Marzooq; Lippincott, Robert

2013-01-01

An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and ofloxacin. Generally, there was good agreement between the decreasing order of the pseudo-partition coefficients in this study and the order reported in the literature.

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Estimating the effects of land use at different scales on high ecological status in Irish rivers.

PubMed

Roberts, William M; Fealy, Reamonn M; Doody, Donnacha G; Jordan, Phil; Daly, Karen

2016-12-01

High ecological status at river sites is an indicator of minimal disturbance from anthropogenic activities and the presence of ecologically important species and communities. However, a lack of clarity on what factors cause sites to lose high ecological status is limiting the ability to maintain the quality of these sites. Examination of ecological status records at 508 high status river sites throughout the Republic of Ireland revealed that 337 had fallen below high status at some point between 2001 and 2012 due to changes in invertebrate communities. A geographical information system was used to characterise land use and environmental variables in the catchment, riparian and reach areas upstream of the sites. The relationships between these variables at the three spatial scales and whether or not river sites had maintained high ecological status were then estimated by multiple logistic regression and propensity modelling. The results indicated that grassland at either catchment or riparian scales had a greater negative impact on high ecological status than at the reach scale. This effect appeared to be strongest for upland, steeply sloping rivers that are subject to high rainfall, possibly due to the presence of sensitive biota and/or a greater potential for erosion. These results highlighted the need for better management of grassland upstream of the high status sites, with a focus on river alterations and critical source areas of nutrients, sediments and pesticides that are hydrologically connected to the river. Sustainable management practices and land use planning in those areas will need to be considered carefully if the aim of maintaining high ecological status at river sites is to be achieved. Copyright © 2016 Elsevier B.V. All rights reserved.

In Vivo Imaging of MDR1A Gene Expression

DTIC Science & Technology

2004-12-01

Engineer PGK-neo and Renilla luciferase cassettes, already available, with appropriate loxP sites, into mdrla locus. Repeat for HSV-tk reporter. The...of the gene-targeting vector. under the control of the PGK promoter. Luc: Renilla luciferase fused in- frame with the translated sequences of exon 2...between the two loxP sites, upstream of the Neo cassette. A cloning strategy was then devised to fuse Renilla luciferase in-frame with the translated

Reactive Oxygen Species in Planarian Regeneration: An Upstream Necessity for Correct Patterning and Brain Formation

PubMed Central

Pirotte, Nicky; Stevens, An-Sofie; Fraguas, Susanna; Plusquin, Michelle; Van Roten, Andromeda; Van Belleghem, Frank; Paesen, Rik; Ameloot, Marcel; Cebrià, Francesc; Artois, Tom; Smeets, Karen

2015-01-01

Recent research highlighted the impact of ROS as upstream regulators of tissue regeneration. We investigated their role and targeted processes during the regeneration of different body structures using the planarian Schmidtea mediterranea, an organism capable of regenerating its entire body, including its brain. The amputation of head and tail compartments induces a ROS burst at the wound site independently of the orientation. Inhibition of ROS production by diphenyleneiodonium (DPI) or apocynin (APO) causes regeneration defaults at both the anterior and posterior wound sites, resulting in reduced regeneration sites (blastemas) and improper tissue homeostasis. ROS signaling is necessary for early differentiation and inhibition of the ROS burst results in defects on the regeneration of the nervous system and on the patterning process. Stem cell proliferation was not affected, as indicated by histone H3-P immunostaining, fluorescence-activated cell sorting (FACS), in situ hybridization of smedwi-1, and transcript levels of proliferation-related genes. We showed for the first time that ROS modulate both anterior and posterior regeneration in a context where regeneration is not limited to certain body structures. Our results indicate that ROS are key players in neuroregeneration through interference with the differentiation and patterning processes. PMID:26180588

Methylmercury Modulation in Amazon Rivers Linked to Basin Characteristics and Seasonal Flood-Pulse.

PubMed

Kasper, Daniele; Forsberg, Bruce R; Amaral, João H F; Py-Daniel, Sarah S; Bastos, Wanderley R; Malm, Olaf

2017-12-19

We investigated the impact of the seasonal inundation of wetlands on methylmercury (MeHg) concentration dynamics in the Amazon river system. We sampled 38 sites along the Solimões/Amazon and Negro rivers and their tributaries during distinct phases of the annual flood-pulse. MeHg dynamics in both basins was contrasted to provide insight into the factors controlling export of MeHg to the Amazon system. The export of MeHg by rivers was substantially higher during high-water in both basins since elevated MeHg concentrations and discharge occurred during this time. MeHg concentration was positively correlated to %flooded area upstream of the sampling site in the Solimões/Amazon Basin with the best correlation obtained using 100 km buffers instead of whole basin areas. The lower correlations obtained with the whole basin apparently reflected variable losses of MeHg exported from upstream wetlands due to demethylation, absorption, deposition, and degradation before reaching the sampling site. A similar correlation between %flooded area and MeHg concentrations was not observed in the Negro Basin probably due to the variable export of MeHg from poorly drained soils that are abundant in this basin but not consistently flooded.

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

PubMed Central

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-01-01

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

PubMed

Kel, AlexanderE

2017-02-01

Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

1999-11-19

As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

A mechanism underlying position-specific regulation of alternative splicing

PubMed Central

Hamid, Fursham M.

2017-01-01

Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.

Abundance of three bacterial populations in selected streams

Treesearch

O.A. Olapade; X. Gao; L.G. LEff

2005-01-01

The population sizes of three bacterial species, Acinetobacter calcoaceticw, Burkholderia cepacia, and Pseudomonas putida, were examined in water and sediment from nine streams in different parts of the United States using fluorescent in situ hybridization (FISH). Population sizes were determined from three sites (upstream,...

Metal loading in Soda Butte Creek upstream of Yellowstone National Park, Montana and Wyoming; a retrospective analysis of previous research; and quantification of metal loading, August 1999

USGS Publications Warehouse

Boughton, G.K.

2001-01-01

Acid drainage from historic mining activities has affected the water quality and aquatic biota of Soda Butte Creek upstream of Yellowstone National Park. Numerous investigations focusing on metals contamination have been conducted in the Soda Butte Creek basin, but interpretations of how metals contamination is currently impacting Soda Butte Creek differ greatly. A retrospective analysis of previous research on metal loading in Soda Butte Creek was completed to provide summaries of studies pertinent to metal loading in Soda Butte Creek and to identify data gaps warranting further investigation. Identification and quantification of the sources of metal loading to Soda Butte Creek was recognized as a significant data gap. The McLaren Mine tailings impoundment and mill site has long been identified as a source of metals but its contribution relative to the total metal load entering Yellowstone National Park was unknown. A tracer-injection and synoptic-sampling study was designed to determine metal loads upstream of Yellowstone National Park.A tracer-injection and synoptic-sampling study was conducted on an 8,511-meter reach of Soda Butte Creek from upstream of the McLaren Mine tailings impoundment and mill site downstream to the Yellowstone National Park boundary in August 1999. Synoptic-sampling sites were selected to divide the creek into discrete segments. A lithium bromide tracer was injected continuously into Soda Butte Creek for 24.5 hours. Downstream dilution of the tracer and current-meter measurements were used to calculate the stream discharge. Stream discharge values, combined with constituent concentrations obtained by synoptic sampling, were used to quantify constituent loading in each segment of Soda Butte Creek.Loads were calculated for dissolved calcium, silica, and sulfate, as well as for dissolved and total-recoverable iron, aluminum, and manganese. Loads were not calculated for cadmium, copper, lead, and zinc because these elements were infrequently detected in mainstem synoptic samples. All of these elements were detected at high concentrations in the seeps draining the McLaren Mine tailings impoundment. The lack of detection of these elements in the downstream mainstem synoptic samples is probably because of sorption (coprecipitation and adsorption) to metal colloids in the stream.Most of the metal load that entered Soda Butte Creek was contributed by the inflows draining the McLaren Mine tailings impoundment (between 505 meters and 760 meters downstream from the tracer-injection site), Republic Creek (1,859 meters), and Unnamed Tributary (8,267 meters). Results indicate that treatment or removal of the McLaren Mine tailings impoundment would greatly reduce metal loading in Soda Butte Creek upstream of Yellowstone National Park. However, removing only that single source may not reduce metal loads to acceptable levels. The sources of metal loading in Republic Creek and Unnamed Tributary merit further investigation.

Digital flow model of the Chowan River estuary, North Carolina

USGS Publications Warehouse

Daniel, C.C.

1977-01-01

A one-dimensional deterministic flow model based on the continuity equation had been developed to provide estimates of daily flow past a number of points on the Chowan River estuary of northeast North Carolina. The digital model, programmed in Fortran IV, computes daily average discharge for nine sites; four of these represent inflow at the mouths of major tributaries, the five other sites are at stage stations along the estuary. Because flows within the Chowan River and the lower reaches of its tributaries are tidally affected, flows occur in both upstream and downstream directions. The period of record generated by the model extends from April 1, 1974, to March 31, 1976. During the two years of model operation the average discharge at Edenhouse near the mouth of the estuary was 5,830 cfs (cubic feet per second). Daily average flows during this period ranged from 55,900 cfs in the downstream direction on July 17, 1975, to 14,200 cfs in the upstream direction on November 30, 1974

Contribution of waste water treatment plants to pesticide toxicity in agriculture catchments.

PubMed

Le, Trong Dieu Hien; Scharmüller, Andreas; Kattwinkel, Mira; Kühne, Ralph; Schüürmann, Gerrit; Schäfer, Ralf B

2017-11-01

Pesticide residues are frequently found in water bodies and may threaten freshwater ecosystems and biodiversity. In addition to runoff or leaching from treated agricultural fields, pesticides may enter streams via effluents from wastewater treatment plants (WWTPs). We compared the pesticide toxicity in terms of log maximum Toxic Unit (log mTU) of sampling sites in small agricultural streams of Germany with and without WWTPs in the upstream catchments. We found an approximately half log unit higher pesticide toxicity for sampling sites with WWTPs (p < 0.001). Compared to fungicides and insecticides, herbicides contributed most to the total pesticide toxicity in streams with WWTPs. A few compounds (diuron, terbuthylazin, isoproturon, terbutryn and Metazachlor) dominated the herbicide toxicity. Pesticide toxicity was not correlated with upstream distance to WWTP (Spearman's rank correlation, rho = - 0.11, p > 0.05) suggesting that other context variables are more important to explain WWTP-driven pesticide toxicity. Our results suggest that WWTPs contribute to pesticide toxicity in German streams. Copyright © 2017 Elsevier Inc. All rights reserved.

Hydrology and water-quality characteristics of Muddy Creek and Wolford Mountain Reservoir near Kremmling, Colorado, 1990 through 2001

USGS Publications Warehouse

Stevens, Michael R.; Sprague, Lori A.

2003-01-01

A water-quality monitoring program was begun in March 1985 on Muddy Creek in anticipation of the construction of a reservoir water-storage project. Wolford Mountain Reservoir was constructed by the Colorado River Water Conservation District during 1992-94. The reservoir began to be filled in 1995. Water quality generally was good in Muddy Creek and Wolford Mountain Reservoir throughout the period of record (collectively, 1990 through 2001), with low concentrations of nutrients (median total nitrogen less than 0.6 and median total phosphorus less than 0.05 milligrams per liter) and trace elements (median dissolved copper less than 2, median dissolved lead less than 1, and median dissolved zinc less than 20 micrograms per liter). Specific conductance ranged from 99 to 1,720 microsiemens per centimeter. Cation compositions at Muddy Creek sites were mixed calcium-magnesium-sodium. Anion compositions were primarily bicarbonate and sulfate. Suspended-sediment concentrations ranged from less than 50 milligrams per liter during low-flow periods to hundreds of milligrams per liter during snowmelt. Turbidity in prereservoir Muddy Creek generally was measured at less than 10 nephelometric turbidity units during low-flow periods and ranged to more than 360 nephelometric turbidity units during snowmelt. Compared to prereservoir conditions, turbidity in Muddy Creek downstream from the reservoir was substantially reduced because the reservoir acted as a sediment trap. During most years, peak flows were slightly reduced by the reservoir or similar to peaks upstream from the reservoir. The upper first to fifteenth percentiles of flows were decreased by operation of the reservoir compared to prereservoir flows. Generally, the fifteenth to one-hundredth percentiles of flow were increased by operation of the reservoir outflow compared to prereservoir flows. Nutrient transport in the inflow is proportional to the amount of inflow-water discharge in a given year. Some nitrogen was stored in the water column and gain/loss patterns for total nitrogen were somewhat related to reservoir storage. Nitrogen tended to move through the reservoir, whereas phosphorus was mostly trapped within the reservoir in bottom sediments. The reservoir gained phosphorus every year (1996- 2001) and, as a percentage, more phosphorus was retained than nitrogen in years when both were retained in the reservoir due to stronger phosphorus tendencies for adsorption, coprecipitation, and settling. Only small amounts of phosphorus were available in the water column at the outflow, and reservoir water-column storage did not influence phosphorus outflowloading patterns as much as settling further upstream in the reservoir. From 1990 to 2001, upstream from the reservoir, concentrations and values of dissolved solids, turbidity, some major ions, and dissolved iron increased (p-value less than 0.10), and acid-neutralizing capacity decreased. From 1990 to 2001, there were no significant (p-value less than 0.10) trends in nutrient concentrations upstream from the reservoir. From 1990 to 2001, downstream from the reservoir, trends in concentrations and values of dissolved solids, turbidity, major ions, total ammonia plus organic nitrogen, dissolved and total-recoverable iron, and total-recoverable manganese were downward. Upstream and downstream water-quality constituents for the prereservoir (1990 to 1995) period were compared. Concentrations and values of dissolved solids, major ions, turbidity, and manganese were greater (p-value less than 0.10) at the downstream site. From 1995 to 2001 (postconstruction), upstream and downstream water-quality constituents also were compared. Concentrations of specific conductance and major ions increased at the downstream site when compared to the upstream site (p-value less than 0.10), except for acid-neutralizing capacity and silica, which decreased. Turbidity, concentrations of total-recoverable and dissolved manganese, and

Suspended-sediment and nutrient loads for Waiakea and Alenaio Streams, Hilo, Hawaii, 2003-2006

USGS Publications Warehouse

Presley, Todd K.; Jamison, Marcael T.J.; Nishimoto, Dale C.

2008-01-01

Suspended sediment and nutrient samples were collected during wet-weather conditions at three sites on two ephemeral streams in the vicinity of Hilo, Hawaii during March 2004 to March 2006. Two sites were sampled on Waiakea Stream at 80- and 860-foot altitudes during March 2004 to August 2005. One site was sampled on Alenaio Stream at 10-foot altitude during November 2005 to March 2006. The sites were selected to represent different land uses and land covers in the area. Most of the drainage area above the upper Waiakea Stream site is conservation land. The drainage areas above the lower site on Waiakea Stream, and the site on Alenaio Stream, are a combination of conservation land, agriculture, rural, and urban land uses. In addition to the sampling, continuous-record streamflow sites were established at the three sampling sites, as well as an additional site on Alenaio Stream at altitude of 75 feet and 0.47 miles upstream from the sampling site. Stage was measured continuously at 15-minute intervals at these sites. Discharge, for any particular instant, or for selected periods of time, were computed based on a stage-discharge relation determined from individual discharge measurements. Continuous records of discharge were computed at the two sites on Waiakea Stream and the upper site on Aleniao Stream. Due to non-ideal hydraulic conditions within the channel of Alenaio Stream, a continuous record of discharge was not computed at the lower site on Alenaio Stream where samples were taken. Samples were analyzed for suspended sediment, and the nutrients total nitrogen, dissolved nitrite plus nitrate, and total phosphorus. Concentration data were converted to instantaneous load values: loads are the product of discharge and concentration, and are presented as tons per day for suspended sediment or pounds per day for nutrients. Daily-mean loads were computed by estimating concentrations relative to discharge using graphical constituent loading analysis techniques. Daily-mean loads were computed at the two Waiakea Stream sampling sites for the analyzed constituents, during the period October 1, 2003 to September 30, 2005. No record of daily-mean load was computed for the Alenaio Stream sampling site due to the problems with computing a discharge record. The maximum daily-mean loads for the upper site on Waiakea Stream for suspended sediment was 79 tons per day, and the maximum daily-mean loads for total nitrogen, dissolved nitrite plus nitrate, and total phosphorus were 1,350, 13, and 300 pounds per day, respectively. The maximum daily-mean loads for the lower site on Waiakea Stream for suspended sediment was 468 tons per day, and the maximum daily-mean loads for total nitrogen, nitrite plus nitrate, and total phosphorus were 913, 8.5, and 176 pounds per day, respectively. From the estimated continuous daily-mean load record, all of the maximum daily-mean loads occurred during October 2003 and September 2004, except for suspended sediment load for the lower site, which occurred on September 15, 2005. Maximum values were not all caused by a single storm event. Overall, the record of daily-mean loads showed lower loads during storm events for suspended sediments and nutrients at the downstream site of Waiakea Stream during 2004 than at the upstream site. During 2005, however, the suspended sediment loads were higher at the downstream site than the upstream site. Construction of a flood control channel between the two sites in 2005 may have contributed to the change in relative suspended-sediment loads.

Responses of chub (Leuciscus cephalus) populations to chemical stress, assessed by genetic markers, DNA damage and cytochrome P4501A induction.

PubMed

Larno, V; Laroche, J; Launey, S; Flammarion, P; Devaux, A

2001-06-01

Indicators of effects at the population level (genetic variation using allozymes) and early indicators of pollution (EROD activity and DNA strand break formation) were analysed in chub (Leuciscus cephalus) living in weakly and heavily contaminated stations of the Rhône River watershed. The genetic erosion was mainly detected in a fish population living in a contaminated small river system, through modifications in allelic and genotypic frequencies for PGM-2 locus and could be linked to a genetic bottleneck and to the reduced gene flow from upstream unable to maintain or restore the genetic diversity. In a contaminated large river system, the genetic diversity for PGM-2 and other loci was maintained and was probably the consequence of a high gene flow from upstream, linked to a sustained drift of larvae and juveniles in the system. A convergent increase of the frequency of the 90 allele at PGM-2 was observed in two contaminated stations compared with the reference station, this trend being confirmed on a more extensive geographic scale over the Rhône River basin. A high level of EROD activity was detected in both contaminated sites but only the fish in the large river system showed a significant DNA damage level compared to the reference population. The low DNA damage level and high hepato-somatic ratio characterized the impacted population of the small river system and could be associated to a chronic high-level exposure of fish to pollutants which selected individuals exhibiting a high level of DNA damage repair. In the two contaminated systems, some genotypes at the PGM-2 and EST-2 loci showed a low level of DNA damage and/or a high EROD activity and may be considered as being tolerant to pollutants. A higher tolerance of the most heterozygous fish was also detected in the contaminated large system and confirmed that a high level of heterozygosity may be necessary for survival in such a system.

Interaction of upstream flow distortions with high Mach number cascades

NASA Technical Reports Server (NTRS)

Englert, G. W.

1981-01-01

Features of the interaction of flow distortions, such as gusts and wakes with blade rows of advance type fans and compressors having high tip Mach numbers are modeled. A typical disturbance was assumed to have harmonic time dependence and was described, at a far upstream location, in three orthogonal spatial coordinates by a double Fourier series. It was convected at supersonic relative to a linear cascade described as an unrolled annulus. Conditions were selected so that the component of this velocity parallel to the axis of the turbomachine was subsonic, permitting interaction between blades through the upstream as well as downstream flow media. A strong, nearly normal shock was considered in the blade passages which was allowed curvature and displacement. The flows before and after the shock were linearized relative to uniform mean velocities in their respective regions. Solution of the descriptive equations was by adaption of the Wiener-Hopf technique, enabling a determination of distortion patterns through and downstream of the cascade as well as pressure distributions on the blade and surfaces. Details of interaction of the disturbance with the in-passage shock were discussed. Infuences of amplitude, wave length, and phase of the disturbance on lifts and moments of cascade configurations are presented. Numerical results are clarified by reference to an especially orderly pattern of upstream vertical motion in relation to the cascade parameters.

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Functional elements in the minimal promoter of the human proton-coupled folate transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G., E-mail: assaraf@tx.technion.ac.il

2009-10-09

The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 andmore » AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.« less

COUP-TF1 antagonizes Nkx2.5-mediated activation of the calreticulin gene during cardiac development.

PubMed

Guo, L; Lynch, J; Nakamura, K; Fliegel, L; Kasahara, H; Izumo, S; Komuro, I; Agellon, L B; Michalak, M

2001-01-26

Calreticulin, a Ca(2+) binding chaperone of the endoplasmic reticulum, is also highly expressed in the embryonic heart, and knockout of the calreticulin gene is lethal during embryogenesis because of impaired cardiac development. The protein is down-regulated after birth, and elevated expression of calreticulin in newborn hearts is associated with severe cardiac pathology and death. Here we show that the transcription factor Nkx2.5 activates expression of the calreticulin gene in the heart. Binding of chicken ovalbumin upstream promoter-transcription factor 1 to the Nkx2.5 binding site suppresses transcription from the calreticulin promoter. Nkx2.5 and chicken ovalbumin upstream promoter-transcription factor 1 play antagonistic roles in regulating the expression of calreticulin during cardiac development. These studies indicate that cardiac-specific transcription factor Nkx2.5 plays a central role in activating calreticulin expression and that there is a cooperation between chicken ovalbumin upstream promoter-transcription factor 1 and Nkx2.5 at the calreticulin promoter.

Level II scour analysis for Bridge 26 (ROYATH00540026) on Town Highway 54, crossing Broad Brook, Royalton, Vermont

USGS Publications Warehouse

Burns, Ronda L.; Weber, Matthew A.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure ROYATH00540026 on Town Highway 54 crossing Broad Brook, Royalton, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the New England Upland section of the New England physiographic province in central Vermont. The 11.9-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover on the left bank upstream and downstream is pasture with trees and brush on the immediate banks. The right bank, upstream and downstream of the bridge, is forested. In the study area, Broad Brook has an incised, sinuous channel with a slope of approximately 0.01 ft/ft, an average channel top width of 37 ft and an average bank height of 4 ft. The channel bed material ranges from sand to boulders with a median grain size (D50) of 66.3 mm (0.218 ft). The geomorphic assessment at the time of the Level I site visit on April 13, 1995 and the Level II site visit on July 11, 1996, indicated that the reach was stable. The Town Highway 54 crossing of Broad Brook is a 29-ft-long, one-lane bridge consisting of one 24-foot steel-beam span with a timber deck (Vermont Agency of Transportation, written communication, March 23, 1995). The opening length of the structure parallel to the bridge face is 23.3 ft. The bridge is supported by a vertical, concrete face laid-up stone abutment with concrete wingwalls on the left and a laid-up stone abutment on the right. The channel is skewed approximately 20 degrees to the opening while the opening-skew-to-roadway is zero degrees. A scour hole 1.0 ft deeper than the mean thalweg depth was observed along the downstream end of the right abutment during the Level I assessment. Also, at the upstream end of the left abutment, the footing is exposed 0.5 ft. The scour protection measures at the site included type-2 stone fill (less than 36 inches diameter) along the upstream left bank, at the upstream end of the upstream left wingwall, along the entire length of the downstream left wingwall, and at the upstream end of the right abutment. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 1.4 ft. The worst-case contraction scour occurred at the incipient roadway-overtopping discharge, which was less than the 100-year discharge. Abutment scour ranged from 2.2 to 7.4 ft on the left and from 14.7 to 17.7 ft on the right. The worst-case abutment scour occurred at the incipient roadway-overtopping discharge for the left and at the 500-year discharge for the right. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

PubMed

DeVry, C G; Tsai, W; Clarke, S

1996-11-15

The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

Examining spatial patterns in polycyclic aromatic compounds measured in stream macroinvertebrates near a small subarctic oil and gas operation.

PubMed

Korosi, J B; Eickmeyer, D C; Chin, K S; Palmer, M J; Kimpe, L E; Blais, J M

2016-03-01

The Cameron River runs through a small, remote petrochemical development in the Cameron Hills (Northwest Territories, Canada). In order to evaluate the exposure of aquatic biota to contaminants from oil and gas activities, we measured polycyclic aromatic compounds (PACs) in macroinvertebrates collected from sites and tributaries along the Cameron River, including upstream and downstream of the development, and sites located near drilled wells (developed). Macroinvertebrate tissue PAC burdens ranged from 0.2-2.8 μg g(-1) lipid for unsubstituted compounds, and from 4.2-63.2 μg g(-1) lipid for alkylated compounds, relatively low compared to similar studies from more industrialized regions in North America. There was no significant difference in tissue PAC burdens between upstream, downstream, or developed sites (p = 0.12), although alkyl PACs in five out of seven developed sites were higher than the regional average. Petrogenic PACs were dominant in most samples, including alkyl fluorines, alkyl phenanthrene/anthracenes, and alkyl dibenzothiophenes. Minimal changes in PAC composition in macroinvertebrate tissues were detected along the Cameron River, with the exception of the two sites furthest downstream that had high concentrations of C3-C4 naphthalene. Overall, our results suggest that oil and gas development in the Cameron Hills has not resulted in substantial increases in PAC bioaccumulation in stream macroinvertebrates, although the potential that alkyl naphthalenes are being transported downstream from the development warrants further attention.

The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

PubMed Central

Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

1997-01-01

The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

PubMed

Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

2009-01-01

Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

Influence of rice field agrochemicals on the ecological status of a tropical stream.

PubMed

Rasmussen, Jes Jessen; Reiler, Emilie Marie; Carazo, Elizabeth; Matarrita, Jessie; Muñoz, Alejandro; Cedergreen, Nina

2016-01-15

Many tropical countries contain a high density of protected ecosystems, and these may often be bordered by intensive agricultural systems. We investigated the chemical and ecological status of a stream connecting an area with conventional rice production and a downstream protected nature reserve; Mata Redonda. Three sites were sampled: 1) an upstream control, 2) in the rice production area and 3) a downstream site in Mata Redonda. We sampled benthic macroinvertebrates and pesticides in water and sediments along with supporting physical and chemical data. Pesticide concentrations in water exceeded current safety thresholds at sites 2 and 3, especially during the rainy season, and sediment associated pesticide concentrations exceeded current safety thresholds in three of six samples. Importantly, the highest predicted pesticide toxicity in sediments was observed at site 3 in the Mata Redonda confirming that the nature reserve received critical levels of pesticide pollution from upstream sections. The currently used macroinvertebrate index in Costa Rica (BMWP-CR) and an adjusted version of the SPecies At Risk index (SPEAR) were not significantly correlated to any measure of anthropogenic stress, but the Average Score Per Taxon (ASPT) index was significantly correlated with the predicted pesticide toxicity (sumTUD.magna), oxygen concentrations and substrate composition. Our results suggest that pesticide pollution was likely involved in the impairment of the ecological status of the sampling sites, including site 3 in Mata Redonda. Based on our results, we give guidance to biomonitoring in Costa Rica and call for increased focus on pesticide transport from agricultural regions to protected areas. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Evaluation of stream flow effects on smolt survival in the Yakima River Basin, Washington, 2012-2014

USGS Publications Warehouse

Courter, Ian; Garrison, Tommy; Kock, Tobias J.; Perry, Russell W.

2015-01-01

The influence of stream flow on survival of emigrating juvenile (smolts) Pacific salmon Oncorhynchus spp. and steelhead trout O. mykiss is of key management interest. However, few studies have quantified flow effects on smolt migration survival, and available information does not indicate a consistent flow-survival relationship within the typical range of flows under management control. It is hypothesized that smolt migration and dam passage survival are positively correlated with stream flow because higher flows increase migration rates, potentially reducing exposure to predation, and reduce delays in reservoirs. However, available empirical data are somewhat equivocal concerning the influence of flow on smolt survival and the underlying mechanisms driving this relationship. Stream flow effects on survival of emigrating anadromous salmonids in the Yakima Basin have concerned water users and fisheries managers for over 20 years, and previous studies do not provide sufficient information at the resolution necessary to inform water operations, which typically occur on a small spatiotemporal scale. Using a series of controlled flow releases from 2012-2014, combined with radio telemetry, we quantified the relationship between flow and smolt survival from Roza Dam 208 km downstream to the Yakima River mouth, as well as for specific routes of passage at Roza Dam. A novel multistate mark-recapture model accounted for weekly variation in flow conditions experienced by radio-tagged fish. Groups of fish were captured and radio-tagged at Roza Dam and released at two locations, upstream at the Big Pines Campground (river kilometer [rkm] 211) and downstream in the Roza Dam tailrace (rkm 208). A total of 904 hatchery-origin yearling Chinook salmon O. tshawytscha were captured in the Roza Dam fish bypass, radio-tagged and released upstream of Roza Dam. Two hundred thirty seven fish were released in the tailrace of Roza Dam. Fish released in the tailrace of Roza Dam were tagged concurrently with fish released upstream of the dam using identical tagging methods. Tagging and release events were conducted to target a range of flow conditions indicative of flows observed during the typical migration period (March-May) for juvenile spring Chinook salmon in the Yakima River. Three, five and four separate upstream releases were conducted in 2012, 2013, and 2014 respectively, and at least 43 fish were released alive on each occasion. The release sample sizes in 2014 were much larger (~130) compared to previous years for the purpose of increasing precision of survival estimates across the range of flows tested. Migration movements of radio-tagged spring Chinook salmon smolts were monitored with an array of telemetry receiver stations (fixed sites) that extended 208 rkm downstream from the forebay of Roza Dam to the mouth of the Yakima River. Fixed monitoring sites included the forebay of Roza Dam (rkm 208), the tailrace of Roza Dam (rkm 207.9), the mouth of Wenas Creek (rkm 199.2), the mouth of the Naches River (two sites, rkm 189.4), Sunnyside Dam (two sites, rkm 169.1), Prosser Dam (rkm 77.2), and the mouth of the Yakima River (two sites, rkm2 3). This array segregated the study area into four discrete reaches in which survival of tagged fish was estimated. Aerial and underwater antennas were also used to monitor tagged fish at Roza Dam. Aerial antennas were located in the forebay, on the East gate, on the West gate, and in the tailrace of Roza Dam. Underwater antennas were located in the fish bypass, upstream of the East gate, and upstream of the West gate to collect route-specific passage data for tagged fish. Additional years of data collection and analysis could alter or improve our understanding of the influence of flow and other environmental factors on smolt survival in the Yakima River. Nevertheless, during 2012-2014, yearling hatchery Chinook salmon smolt emigration survival was significantly associated with stream flow in the

Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

PubMed

Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

2015-08-01

Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

Upstream open reading frames regulate the expression of the nuclear Wnt13 isoforms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang Tao; Rector, Kyle; Barnett, Corey D.

2008-02-22

Wnt proteins control cell survival and cell fate during development. Although Wnt expression is tightly regulated in a spatio-temporal manner, the mechanisms involved both at the transcriptional and translational levels are poorly defined. We have identified a downstream translation initiation codon, AUG(+74), in Wnt13B and Wnt13C mRNAs responsible for the expression of Wnt13 nuclear forms. In this report, we demonstrate that the expression of the nuclear Wnt13C form is translationally regulated in response to stress and apoptosis. Though the 5'-leaders of both Wnt13C and Wnt13B mRNAs have an inhibitory effect on translation, they did not display an internal ribosome entrymore » site activity as demonstrated by dicistronic reporter assays. However, mutations or deletions of the upstream AUG(-99) and AUG(+1) initiation codons abrogate these translation inhibitory effects, demonstrating that Wnt13C expression is controlled by upstream open reading frames. Since long 5'-untranslated region with short upstream open reading frames characterize other Wnt transcripts, our present data on the translational control of Wnt13 expression open the way to further studies on the translation control of Wnt expression as a modulator of their subcellular localization and activity.« less

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

Y-12 National Security Complex Biological Monitoring And Abatement Program 2008 Calendar Year Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peterson, M. J.; Greeley Jr., M. S.; Mathews, T. J.

2009-07-01

The National Pollutant Discharge Elimination System (NPDES) permit issued for the Oak Ridge Y-12 National Security Complex (Y-12 Complex) which became effective May 1, 2006, continued a requirement for a Biological Monitoring and Abatement Program (BMAP). The BMAP was originally developed in 1985 to demonstrate that the effluent limitations established for the Y-12 Complex protected the classified uses of the receiving stream (East Fork Poplar Creek: EFPC), in particular, the growth and propagation of aquatic life (Loar et al. 1989). The objectives of the current BMAP are similar, specifically to assess stream ecological conditions relative to regulatory limits and criteria,more » to assess ecological impacts as well as recovery in response to Y-12 operations, and to investigate the causes of continuing impacts. The BMAP consists of three tasks that reflect complementary approaches to evaluating the effects of the Y-12 Complex discharges on the biotic integrity of EFPC. These tasks include: (1) bioaccumulation monitoring, (2) benthic macroinvertebrate community monitoring, and (3) fish community monitoring. As required by the NPDES permit, the BMAP benthic macroinvertebrate community monitoring task includes studies to annually evaluate the receiving stream's biological integrity in comparison to TN Water Quality Criteria. BMAP monitoring is currently being conducted at five primary EFPC sites, although sites may be excluded or added depending upon the specific objectives of the various tasks. Criteria used in selecting the sites include: (1) location of sampling sites used in other studies, (2) known or suspected sources of downstream impacts, (3) proximity to U.S. Department of Energy (DOE) Oak Ridge Reservation (ORR) boundaries, (4) appropriate habitat distribution, and (5) access. The primary sampling sites include upper EFPC at kilometers (EFKs) 24.4 and 23.4 [upstream and downstream of Lake Reality (LR) respectively]; EFK 18.7 (also EFK 18.2 and 19), located off the ORR and below an area of intensive commercial and light industrial development; EFK 13.8, located upstream from the Oak Ridge Wastewater Treatment Facility (ORWTF); and EFK 6.3 located approximately 1.4 km below the ORR boundary (Fig. 1.1). Actual sampling locations on EFPC may differ slightly by task according to specific requirements of the task. Brushy Fork (BF) at kilometer (BFK) 7.6 and Hinds Creek at kilometer (HCK) 20.6 are the most commonly used reference sites for the Y-12 BMAP. Additional sites off the ORR are also occasionally used for reference, including Beaver Creek, Bull Run, Cox Creek, and Paint Rock Creek (Fig. 1.2). Summaries of the sampling designs for the three primary tasks of the Y-12 Complex BMAP for EFPC are presented in Tables 1.1-1.3. This report covers the 2008 period, although data collected outside this time period are included as appropriate. To address the biological monitoring requirements for Bear Creek and McCoy Branch, CERLCA-funded programs, data are summarized in Appendix A and Appendix B respectively. Data for these two watersheds are provided herein to address Section IX of the NPDES Permit for Y-12, where 'Results of these CERCLA programs can be used to meet the biological monitoring requirements of this permit...'. A summary of the toxicity testing results for Y-12 outfalls into upper EFPC is provided in Appendix C (these results have been previously reported) to provide a more thorough perspective of conditions in the stream. Data summarized in this report are available from the Oak Ridge Environmental Information system (OREIS) in an Arc-GIS usable format (http://www-oreis.bechteljacobs.org/oreis/help/oreishome.html). Per requirements specified in the NPDES permit, data collected following TDEC monitoring protocols (TDEC 2006) is also submitted directly to TDEC in Excel format.« less

In Vivo Imaging of mdrla Gene Expression

DTIC Science & Technology

2005-06-01

svImJ mouse strain, compatible with the ES cells used in our Transgenic Mouse Facility. b. Engineer PGK-neo and Renilla luciferase cassettes...inserted between the two loxP sites, upstream of the Neo cassette. A cloning strategy was then devised to fuse Renilla luciferase in-frame with the...sites: B, BamHI; E, EcoRI; S, ScaI. PGK-neo: neo under the control of the PGK promoter. Luc: Renilla luciferase fused in- frame with the translated

Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

PubMed Central

Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

2013-01-01

In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

Algal conditions in the Caloosahatchee River (1975-79), Lake Okeechobee to Franklin Lock, Florida

USGS Publications Warehouse

McPherson, Benjamin F.; La Rose, Henry R.

1982-01-01

Maximum numbers of suspended algae occurred in late spring and early summer, in each of the years 1975-79, in the Caloosahatchee River. Numbers exceeded 100,000 cells per milliliter at all stations sometime during the study. Concentrations decreased during late summer and autumn and were low during winter, except in January 1979 when numbers at most sites exceeded 100,000 cells per milliliter. The January 1979 bloom coincided with large discharges from Lake Okeechobee. During previous winters, discharges and algal numbers were lower. During other seasons, algal blooms occurred most frequently under low-flow or stagnant conditions. The upstream site at Moore Haven, which had the least discharge and was most stagnant, had consistently higher algal concentrations than downstream sites. Blue-green algae were dominant in the river during the summer at the upstream site throughout the year. The percentage of blue-green algae decreased downstream. Concentrations of nitrite plus nitrate nitrogen were inversely correlated with concentrations of algae and decreased to near zero during algal blooms. The low concentrations of these forms of inorganic nitrogen relative to other major nutrients probably favor blue-green algae and limit growth of other algae. Contributions by the basin tributaries to the nutritive condition of the river were small because concentrations of nutrients, algal growth potential, and algae in the tributaries were generally less than those in the river. (USGS)

Toxicity risk assessment of mercury, DDT and arsenic legacy pollution in sediments: A triad approach under low concentration conditions.

PubMed

Marziali, L; Rosignoli, F; Drago, A; Pascariello, S; Valsecchi, L; Rossaro, B; Guzzella, L

2017-09-01

The determination of sediment toxicity is challenging due to site-specific factors affecting pollutants distribution and bioavailability, especially when contamination levels are close to expected non-effect concentrations. Different lines of evidence and sensitive tools are necessary for a proper toxicity risk assessment. We examined the case study of the Toce River (Northern Italy), where past industrial activities determined Hg, DDT and As enrichment in sediments. A triad approach comprising chemical, ecotoxicological and ecological analyses (benthic invertebrates) was carried out for risk assessment of residual contamination in river sediments. A "blank" site upstream from the industrial site was selected to compare the other sites downstream. Sediment, water and benthic invertebrate samplings were carried out following standard protocols. Results emphasized that despite the emissions of the industrial site ceased about 20years ago, sediments in the downstream section of the river remain contaminated by Hg, DDT and As with concentrations exceeding Threshold Effect Concentrations. A chronic whole-sediment test with Chironomus riparius showed decreased development rate and a lower number of eggs per mass in the contaminated sediments. Benthic community was analyzed with the calculation of integrated (STAR_ICMi) and stressor-specific metrics (SPEAR pesticide and mean sensitivity to Hg), but no significant differences were found between upstream and downstream sites. On the other hand, multivariate analysis (partial Redundancy Analysis and variation partitioning) emphasized a slight impact on invertebrate community, accounting for 5% variation in taxa composition. Results show that legacy contaminants in sediments, even at low concentrations, may be bioavailable and possibly toxic for benthic invertebrates. At low concentration levels, sensitive and site-specific tools need to be developed for a proper risk analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Synthesis of natural flows at selected sites in and near the Milk River basin, Montana, 1928-89

USGS Publications Warehouse

Cary, L.E.; Parrett, Charles

1995-01-01

Natural monthly streamflows were synthesized for the years 1928-89 at 2 sites in the St. Mary River Basin and 11 sites in the Milk River Basin in north- central Montana. The sites are represented as nodes in a streamflow accounting model being developed by the Bureau of Reclamation for the Milk River Basin. Recorded flows at most sites have been affected by human activities, including reservoir storage and irrigation diversions. The flows at the model nodes were corrected for the effects of these activities to obtain synthesized flows. The synthesized flows at nodes with seasonal and short-term records were extended using a statistical technique. The methods of synthesis varied, depending on upstream activities and information available. Flows at sites in the St. Mary River Basin and at the Milk River at Eastern Crossing of International Boundary pre- viously had been synthesized. The flows at mainstem sites downstream from the Milk River at Eastern Crossing were synthesized by adding synthesized natural runoff from intervening drainage areas to natural flows for Milk River at Eastern Crossing. Natural runoff from intervening drainage areas was estimated by multiplying recorded flows at selected index gaging stations on tributary streams by the ratio of the intervening drainage area to the combined drainage area of the index stations. The recorded flows for Milk River at Western Crossing of International Boundary and for Peoples Creek near Dodson, Montana, were assumed to be natural flows. The synthesized annual flows at the mouth of the Milk River compared favorably with the recorded flows near the mouth when the effects of upstream irrigation were considered.

The 14alpha-Demethylasse(CYP51A1) Gene is Overexpressed in Venturia inaequalis Strains Resistant to Myclobutanil.

PubMed

Schnabel, G; Jones, A L

2001-01-01

ABSTRACT We identified the cytochrome P450 sterol 14alpha-demethylase (CYP51A1) gene from Venturia inaequalis and optional insertions located upstream from CYP51A1 and evaluated their potential role in conferring resistance to the sterol demethylation-inhibitor (DMI) fungicide my-clobutanil. The CYP51A1 gene was completely sequenced from one my-clobutanil sensitive (S) and two myclobutanil-resistant (R) strains. No nucleotide variation was found when the three sequences were aligned. Allele-specific polymerase chain reaction (PCR) analysis indicated that a previously described single base pair mutation that correlated with resistance to DMI fungicides in strains of other filamentous fungi was absent in 19 S and 32 R strains of V. inaequalis from Michigan and elsewhere. The sequencing results and PCR analyses suggest that resistance in these strains was not due to a mutation in the sterol demethylase target site for DMI fungicides. Expression of CYP51A1 was determined for strains from an orchard that had never been sprayed with DMI fungicides (baseline orchard), and the data provided a reference for evaluating the expression of strains collected from a research orchard and from three commercial Michigan apple orchards with a long history of DMI use and a high frequency of R strains. Overexpression of CYP51A1 was significantly higher in 9 of 11 R strains from the research orchard than in S strains from the baseline orchard. The high expression was correlated with the presence of a 553-bp insertion located upstream of CYP51A1. Overexpression of the CYP51A1 gene was also detected in eight of eight, five of nine, and nine of nine R strains from three commercial orchards, but the insertion was not detected in the majority of these strains. The results suggest that overexpression of the target-site CYP51A1 gene is an important mechanism of resistance in some field resistant strains of V. inaequalis, but other mechanisms of resistance also appear to exist.

Environmental impact of coal mining and coal seam gas production on surface water quality in the Sydney basin, Australia.

PubMed

Ali, A; Strezov, V; Davies, P; Wright, I

2017-08-01

The extraction of coal and coal seam gas (CSG) will generate produced water that, if not adequately treated, will pollute surface and groundwater systems. In Australia, the discharge of produced water from coal mining and related activities is regulated by the state environment agency through a pollution licence. This licence sets the discharge limits for a range of analytes to protect the environment into which the produced water is discharged. This study reports on the impact of produced water from coal mine activities located within or discharging into high conservation environments, such as National Parks, in the outer region of Sydney, Australia. The water samples upstream and downstream from the discharge points from six mines were taken, and 110 parameters were tested. The results were assessed against a water quality index (WQI) which accounts for pH, turbidity, dissolved oxygen, biochemical oxygen demand, total dissolved solids, total phosphorus, nitrate nitrogen and E .coli. The water quality assessment based on the trace metal contents against various national maximum admissible concentration (MAC) and their corresponding environmental impacts was also included in the study which also established a base value of water quality for further study. The study revealed that impacted water downstream of the mine discharge points contained higher metal content than the upstream reference locations. In many cases, the downstream water was above the Australia and New Zealand Environment Conservation Council and international water quality guidelines for freshwater stream. The major outliers to the guidelines were aluminium (Al), iron (Fe), manganese (Mn), nickel (Ni) and zinc (Zn). The WQI of surface water at and downstream of the discharge point was lower when compared to upstream or reference conditions in the majority of cases. Toxicology indices of metals present in industrial discharges were used as an additional tool to assess water quality, and the newly proposed environmental water quality index (EWQI) lead to better trend in the impact of coal and coal seam gas mining activities on surface water quality when compared to the upstream reference water samples. Metal content limits were based on the impact points assigned by the Agency for Toxic Substances and Disease Registry, USA. For environmental and health impact assessment, the approach used in this study can be applied as a model to provide a basis to assess the anthropogenic contribution from the industrial and mining activities on the environment.

Contaminants of emerging concern in tributaries to the Laurentian Great Lakes: II. Biological consequences of exposure

PubMed Central

Brigham, Mark E.; Choy, Steven J.; Moore, Jeremy N.; Banda, Jo A.; Gefell, Daniel J.; Minarik, Thomas A.

2017-01-01

The Laurentian Great Lakes contain one fifth of the world’s surface freshwater and have been impacted by human activity since the Industrial Revolution. In addition to legacy contaminants, nitrification and invasive species, this aquatic ecosystem is also the recipient of Contaminants of Emerging Concern (CECs) with poorly understood biological consequences. In the current study, we documented the presence, concentrations, and biological effects of CECs across 27 field sites in six Great Lakes tributaries by examining over 2250 resident and caged sunfish (Lepomis ssp.) for a variety of morphological and physiological endpoints and related these results to CEC occurrence. CEC were ubiquitous across studies sites and their presence and concentrations in water and sediment were highest in effluent dominated rivers and downstream of municipal wastewater treatment plant discharges. However, even putative upstream reference sites were not free of CEC presence and fish at these sites exhibited biological effects consistent with CEC exposure. Only the Fox River exhibited consistent adverse biological effects, including increased relative liver size, greater prominence of hepatocyte vacuoles and increased plasma glucose concentrations. Canonical Redundancy Analysis revealed consistent patterns of biological consequences of CEC exposure across all six tributaries. Increasing plasma glucose concentrations, likely as a result of pollutant-induced metabolic stress, were associated with increased relative liver size and greater prominence of hepatocyte vacuoles. These indicators of pollutant exposure were inversely correlated with indicators of reproductive potential including smaller gonad size and less mature gametes. The current study highlights the need for greater integration of chemical and biological studies and suggests that CECs in the Laurentian Great Lakes Basin may adversely affect the reproductive potential of exposed fish populations. PMID:28953953

Contaminants of emerging concern in tributaries to the Laurentian Great Lakes: II. Biological consequences of exposure.

PubMed

Thomas, Linnea M; Jorgenson, Zachary G; Brigham, Mark E; Choy, Steven J; Moore, Jeremy N; Banda, Jo A; Gefell, Daniel J; Minarik, Thomas A; Schoenfuss, Heiko L

2017-01-01

The Laurentian Great Lakes contain one fifth of the world's surface freshwater and have been impacted by human activity since the Industrial Revolution. In addition to legacy contaminants, nitrification and invasive species, this aquatic ecosystem is also the recipient of Contaminants of Emerging Concern (CECs) with poorly understood biological consequences. In the current study, we documented the presence, concentrations, and biological effects of CECs across 27 field sites in six Great Lakes tributaries by examining over 2250 resident and caged sunfish (Lepomis ssp.) for a variety of morphological and physiological endpoints and related these results to CEC occurrence. CEC were ubiquitous across studies sites and their presence and concentrations in water and sediment were highest in effluent dominated rivers and downstream of municipal wastewater treatment plant discharges. However, even putative upstream reference sites were not free of CEC presence and fish at these sites exhibited biological effects consistent with CEC exposure. Only the Fox River exhibited consistent adverse biological effects, including increased relative liver size, greater prominence of hepatocyte vacuoles and increased plasma glucose concentrations. Canonical Redundancy Analysis revealed consistent patterns of biological consequences of CEC exposure across all six tributaries. Increasing plasma glucose concentrations, likely as a result of pollutant-induced metabolic stress, were associated with increased relative liver size and greater prominence of hepatocyte vacuoles. These indicators of pollutant exposure were inversely correlated with indicators of reproductive potential including smaller gonad size and less mature gametes. The current study highlights the need for greater integration of chemical and biological studies and suggests that CECs in the Laurentian Great Lakes Basin may adversely affect the reproductive potential of exposed fish populations.

Contaminants of emerging concern in tributaries to the Laurentian Great Lakes: II. Biological consequences of exposure

USGS Publications Warehouse

Thomas, Linnea M.; Jorgenson, Zachary G.; Brigham, Mark E.; Choy, Steven J.; Moore, Jeremy N.; Banda, Jo A.; Gefell, D.J.; Minarik, Thomas A.; Schoenfuss, Heiko L.

2017-01-01

The Laurentian Great Lakes contain one fifth of the world’s surface freshwater and have been impacted by human activity since the Industrial Revolution. In addition to legacy contaminants, nitrification and invasive species, this aquatic ecosystem is also the recipient of Contaminants of Emerging Concern (CECs) with poorly understood biological consequences. In the current study, we documented the presence, concentrations, and biological effects of CECs across 27 field sites in six Great Lakes tributaries by examining over 2250 resident and caged sunfish (Lepomis ssp.) for a variety of morphological and physiological endpoints and related these results to CEC occurrence. CEC were ubiquitous across studies sites and their presence and concentrations in water and sediment were highest in effluent dominated rivers and downstream of municipal wastewater treatment plant discharges. However, even putative upstream reference sites were not free of CEC presence and fish at these sites exhibited biological effects consistent with CEC exposure. Only the Fox River exhibited consistent adverse biological effects, including increased relative liver size, greater prominence of hepatocyte vacuoles and increased plasma glucose concentrations. Canonical Redundancy Analysis revealed consistent patterns of biological consequences of CEC exposure across all six tributaries. Increasing plasma glucose concentrations, likely as a result of pollutant-induced metabolic stress, were associated with increased relative liver size and greater prominence of hepatocyte vacuoles. These indicators of pollutant exposure were inversely correlated with indicators of reproductive potential including smaller gonad size and less mature gametes. The current study highlights the need for greater integration of chemical and biological studies and suggests that CECs in the Laurentian Great Lakes Basin may adversely affect the reproductive potential of exposed fish populations.

Impact of heavy metal on activity of some microbial enzymes in the riverbed sediments: Ecotoxicological implications in the Ganga River (India).

PubMed

Jaiswal, Deepa; Pandey, Jitendra

2018-04-15

We studied the extracellular enzyme activity (EEA) in the riverbed sediment along a 518km gradient of the Ganga River receiving carbon and nutrient load from varied human sources. Also, we tested, together with substrate-driven stimulation, if the heavy metal accumulated in the sediment inhibits enzyme activities. Because pristine values are not available, we considered Dev Prayag, a least polluted site located 624km upstream to main study stretch, as a reference site. There were distinct increases in enzyme activities in the sediment along the study gradient from Dev Prayag, however, between-site differences were in concordance with sediment carbon(C), nitrogen (N) and phosphorus (P). Fluorescein diacetate hydrolysis (FDAase), β-glucosidase (Glu) and protease activities showed positive correlation with C, N and P while alkaline phosphatase was found negatively correlated with P. Enzyme activities were found negatively correlated with heavy metal, although ecological risk index (E R i ) varied with site and metal species. Dynamic fit curves showed significant positive correlation between heavy metal and microbial metabolic quotient (qCO 2 ) indicating a decrease in microbial activity in response to increasing heavy metal concentrations. This study forms the first report linking microbial enzyme activities to regional scale sediment heavy metal accumulation in the Ganga River, suggests that the microbial enzyme activities in the riverbed sediment were well associated with the proportion of C, N and P and appeared to be a sensitive indicator of C, N and P accumulation in the river. Heavy metal accumulated in the sediment inhibits enzyme activities, although C rich sediment showed relatively low toxicity due probably to reduced bioavailability of the metal. The study has relevance from ecotoxicological as well as from biomonitoring perspectives. Copyright © 2017 Elsevier Inc. All rights reserved.

Assessment of juvenile coho salmon movement and behavior in relation to rehabilitation efforts in the Trinity River, California, using PIT tags and radiotelemetry

USGS Publications Warehouse

Chase, Robert; Hemphill, Nina; Beeman, John; Juhnke, Steve; Hannon, John; Jenkins, Amy M.

2013-01-01

Coho salmon (Oncorhynchus kisutch) of the Southern Oregon/Northern California Coast (SONCC) Evolutionarily Significant Unit (ESU) is federally listed as a threatened species. The Trinity River Restoration Program (TRRP) is rehabilitating the Trinity River to restore coho salmon (coho) and other salmonid populations. In order to evaluate the program’s actions, several studies of movements and behavior of coho in the Trinity River were conducted from 2006 to 2009, including snorkel surveys and mark-recapture techniques based on Passive Integrated Transponder (PIT) tags, elastomer tags, and radio transmitters. Catch, recapture, and condition of natural sub-yearlings, along with site fidelity and emigration of hatchery-reared yearlings in rehabilitated and reference habitats, were studied. Location was important because coho were absent from the lower controlled and rehabilitated sites most of the time. However, rehabilitation did not have a significant effect on natural coho salmon at the site level. Apparent survival of radio-tagged, hatchery-reared yearling coho released downstream from Lewiston Dam was much lower in the first 10 km downstream from the release site than in other areas between Lewiston Dam and the Klamath River estuary. Estimated survival of yearling hatchery coho salmon per 100 km down to Blake’s Riffle was estimated at 64 % over the distance of the 239 km study area. Migration primarily occurred at night in the upper Trinity River; however, as yearlings moved through the lower Trinity River towards the Klamath River, estuary nocturnal migration became less. Apparent survival was generally lowest in areas upstream from the North Fork of the Trinity River.

A novel protocol for the production of recombinant LL-37 expressed as a thioredoxin fusion protein.

PubMed

Li, Yifeng

2012-02-01

LL-37 is the only cathelicidin-derived antimicrobial peptide found in humans and it has a multifunctional role in host defense. The peptide has been shown to possess immunomodulatory functions in addition to antimicrobial activity. To provide sufficient material for biological and structural characterization of this important peptide, various systems were developed to produce recombinant LL-37 in Escherichia coli. In one previous approach, LL-37 coding sequence was cloned into vector pET-32a, allowing the peptide to be expressed as a thioredoxin fusion. The fusion protein contains two thrombin cleavage sites: a vector-encoded one that is 30-residue upstream of the insert and an engineered one that is immediately adjacent to LL-37. Cleavage at these two sites shall generate three fragments, one of which is the target peptide. However, when the fusion protein was treated with thrombin, cleavage only occurred at the remote upstream site. A plausible explanation is that the thrombin site adjacent to LL-37 is less accessible due to the peptide's aggregation tendency and cleavage at the remote site generates a fragment, which forms a large aggregate that buries the intended site. In this study, I deleted the vector-encoded thrombin site and S tag in pET-32a, and then inserted the coding sequence for LL-37 plus a thrombin site into the modified vector. Although removing the S tag did not change the oligomeric state of the fusion protein, deletion of the vector-encoded thrombin site allowed the fusion to be cleaved at the engineered site to release LL-37. The released peptide was separated from the carrier and cleavage enzyme by size-exclusion chromatography. This new approach enables a quick production of high quality active LL-37 with a decent amount. Copyright © 2011 Elsevier Inc. All rights reserved.

Characterization of streamflow, suspended sediment, and nutrients entering Galveston Bay from the Trinity River, Texas, May 2014–December 2015

USGS Publications Warehouse

Lucena, Zulimar; Lee, Michael T.

2017-02-21

The U.S. Geological Survey (USGS), in cooperation with the Texas Water Development Board and the Galveston Bay Estuary Program, collected streamflow and water-quality data at USGS streamflow-gaging stations in the lower Trinity River watershed from May 2014 to December 2015 to characterize and improve the current understanding of the quantity and quality of freshwater inflow entering Galveston Bay from the Trinity River. Continuous streamflow records at four USGS streamflow-gaging stations were compared to quantify differences in streamflow magnitude between upstream and downstream reaches of the lower Trinity River. Water-quality conditions were characterized from discrete nutrient and sedi­ment samples collected over a range of hydrologic conditions at USGS streamflow-gaging station 08067252 Trinity River at Wallisville, Tex. (hereinafter referred to as the “Wallisville site”), approximately 4 river miles upstream from where the Trinity River enters Galveston Bay.Based on streamflow records, annual mean outflow from Livingston Dam into the lower Trinity River was 2,240 cubic feet per second (ft3/s) in 2014 and 22,400 ft3/s in 2015, the second lowest and the highest, respectively, during the entire period of record (1966–2015). During this study, only about 54 percent of the total volume measured at upstream sites was accounted for at the Wallisville site as the Trinity River enters Galveston Bay. This difference in water volumes between upstream sites and the Wallisville site indicates that at high flows a large part of the volume released from Lake Livingston does not reach Galveston Bay through the main channel of the Trinity River. These findings indicate that water likely flows into wetlands and water bodies surrounding the main channel of the Trinity River before reaching the Wallisville site and is being stored or discharged through other channels that flow directly into Galveston Bay.To characterize suspended-sediment concentrations and loads in Trinity River inflow to Galveston Bay, a regression model was developed to estimate suspended-sediment concentrations by using acoustic backscatter data as a surrogate. The model yielded an adjusted coefficient of determination value of 0.92 and a root mean square error of 1.65 milligrams per liter (mg/L). The mean absolute percentage error between measured and estimated suspended-sediment concentration was 35 percent. During this study, estimated suspended-sediment concentrations ranged from 2 to 701 mg/L, with a mean of 97 mg/L. Suspended-sediment concentrations varied in response to changes in discharge, with peak suspended-sediment concentrations occurring 1 to 2 days before the peak discharge for each event. The total suspended-sediment load at the Wallisville site during May 2014–December 2015 was approximately 2,200,000 tons, with a minimum monthly suspended-sediment load of 100 tons in October 2014 and a maximum monthly load of 441,000 tons in November 2015.Results from nutrient samples collected at the Wallisville site indicate that total nitrogen and total phosphorus concen­trations fluctuated at a similar rate, with the highest nutrient concentrations occurring during periods of high flow corresponding to releases from Lake Livingston. The mean concen­trations of total nitrogen and total phosphorus were approxi­mately 75 percent higher during high flow releases than during periods of low flow, overshadowing variations in nutrient concentrations caused by seasonality at the Wallisville site.Results from the study indicate nutrient delivery to Galveston Bay from the main channel of the Trinity River is likely controlled primarily by high-flow releases from Lake Livingston. For most samples collected at the Wallisville site, organic nitrogen was the predominant form of nitrogen; however, when discharge increased because of releases from Lake Livingston, the percentage of organic nitrogen typically decreased and the percentage of nitrate increased. The concentrations of total phosphorus also increased during high-flow events, likely as a result of suspended sediment within Lake Livingston releases and mobilization of sediment particles in the river channel and flood plain during these periods of high flow. The predominant source of phosphorous to Galveston Bay from the Trinity River is in particulate form closely tied to suspended-sediment concentrations. The changes in nutrient concentration and composition caused by releases from Lake Livingston during this study indicate the reservoir may play an important role in the delivery of nutrients into Galveston Bay. Further study is required to better understand the processes in Lake Livingston influencing the characteristics of nutrient and sediment inflow to Galveston Bay. With phosphorous concentrations correlated to suspended-sediment concentra­tions (coefficient of determination value of 0.75) and with the concentrations of nutrients changing as the discharge changes, the diversion of water and suspended sediment into surround­ing wetlands and channels outside of the main channel of the Trinity River may play a large role in regulating nutrient inputs into Galveston Bay.

Flooding and arsenic contamination: Influences on ecosystem structure and function in an Appalachian headwater stream

Treesearch

Noah R. Lottig; H. Maurice Valett; Madeline E. Schreiber; Jackson R. Webster

2007-01-01

We investigated the influence of flooding and chronic arsenic contamination on ecosystem structure and function in a headwater stream adjacent to an abandoned arsenic (As) mine using an upstream (reference) and downstream (mine-influenced) comparative reach approach. In this study, floods were addressed as a pulse disturbance, and the abandoned As mine was...

40 CFR 1065.202 - Data updating, recording, and control.

Code of Federal Regulations, 2010 CFR

2010-07-01

... means. § 1065.514, § 1065.530 Steady-state and ramped-modal duty cycle reference and feedback speeds and... mean value per test interval. § 1065.530, § 1065.545 Diluted exhaust flow rate from a CVS with a heat exchanger upstream of the flow measurement N/A 1 Hz. § 1065.530, § 1065.545 Diluted exhaust flow rate from a...

Health status of Largescale Sucker (Catostomus macrocheilus) collected along an organic contaminant gradient in the lower Columbia River, Oregon and Washington, USA

USGS Publications Warehouse

Torres, Leticia; Nilsen, Elena B.; Grove, Robert A.; Patino, Reynaldo

2014-01-01

The health of Largescale Sucker (Catostomus macrocheilus) in the lower Columbia River (USA) was evaluated using morphometric and histopathological approaches, and its association with organic contaminants accumulated in liver was evaluated in males. Fish were sampled from three sites along a contaminant gradient In 2009, body length and mass, condition factor, gonadosomatic index, and hematocrit were measured in males and females; liver and gonad tissue were collected from males for histological analyses; and organ composites were analyzed for contaminant content in males. In 2010, additional data were collected for males and females, including external fish condition assessment, histopathologies of spleen, kidney and gill and, for males, liver contaminant content. Multivariate analysis of variance indicated that biological traits in males, but not females, differed among sites in 2009 and 2010. Discriminant function analysis indicated that site-related differences among male populations were relatively small in 2009, but in 2010, when more variables were analyzed, males differed among sites in regards to kidney, spleen, and liver histopathologies and gill parasites. Kidney tubular hyperplasia, liver and spleen macrophage aggregations, and gill parasites were generally more severe in the downstream sites compared to the reference location. The contaminant content of male livers was also generally higher downstream, and the legacy pesticide hexachlorobenzene and flame retardants BDE-47 and BDE-154 were the primary drivers for site discrimination. However, bivariate correlations between biological variables and liver contaminants retained in the discriminant models failed to reveal associations between the two variable sets. In conclusion, whereas certain non-reproductive biological traits and liver contaminant contents of male Largescale Sucker differed according to an upstream-downstream gradient in the lower Columbia River, results from this study did not reveal the specific environmental factors responsible for the differences in health status among fish populations.

Health status of Largescale Sucker (Catostomus macrocheilus) collected along an organic contaminant gradient in the lower Columbia River, Oregon and Washington, USA.

PubMed

Torres, Leticia; Nilsen, Elena; Grove, Robert; Patiño, Reynaldo

2014-06-15

The health of Largescale Sucker (Catostomus macrocheilus) in the lower Columbia River (USA) was evaluated using morphometric and histopathological approaches, and its association with organic contaminants accumulated in liver was evaluated in males. Fish were sampled from three sites along a contaminant gradient. In 2009, body length and mass, condition factor, gonadosomatic index, and hematocrit were measured in males and females; liver and gonad tissue were collected from males for histological analyses; and organ composites were analyzed for contaminant content in males. In 2010, additional data were collected for males and females, including external fish condition assessment, histopathologies of spleen, kidney and gill and, for males, liver contaminant content. Multivariate analysis of variance indicated that biological traits in males, but not females, differed among sites in 2009 and 2010. Discriminant function analysis indicated that site-related differences among male populations were relatively small in 2009, but in 2010, when more variables were analyzed, males differed among sites in regards to kidney, spleen, and liver histopathologies and gill parasites. Kidney tubular hyperplasia, liver and spleen macrophage aggregations, and gill parasites were generally more severe in the downstream sites compared to the reference location. The contaminant content of male livers was also generally higher downstream, and the legacy pesticide hexachlorobenzene and flame retardants BDE-47 and BDE-154 were the primary drivers for site discrimination. However, bivariate correlations between biological variables and liver contaminants retained in the discriminant models failed to reveal associations between the two variable sets. In conclusion, whereas certain non-reproductive biological traits and liver contaminant contents of male Largescale Sucker differed according to an upstream-downstream gradient in the lower Columbia River, results from this study did not reveal the specific environmental factors responsible for the differences in health status among fish populations. Published by Elsevier B.V.

TEMPORAL VARIABILITY IN PHYSICAL SPECIATION OF METALS DURING A WINTER RAIN-ON-SNOW EVENT

EPA Science Inventory

Particulate matter in urban rivers transports a significant fraction of pollutants, changes rapidly during storm events and is difficult to characterize. In this study, the physical speciation of trace metals and organic carbon in an urban river and upstream headwaters site in To...

Application of a Depositional Facies Model to an Acid Mine Drainage Site▿ †

PubMed Central

Brown, Juliana F.; Jones, Daniel S.; Mills, Daniel B.; Macalady, Jennifer L.; Burgos, William D.

2011-01-01

Lower Red Eyes is an acid mine drainage site in Pennsylvania where low-pH Fe(II) oxidation has created a large, terraced iron mound downstream of an anoxic, acidic, metal-rich spring. Aqueous chemistry, mineral precipitates, microbial communities, and laboratory-based Fe(II) oxidation rates for this site were analyzed in the context of a depositional facies model. Depositional facies were defined as pools, terraces, or microterracettes based on cm-scale sediment morphology, irrespective of the distance downstream from the spring. The sediments were composed entirely of Fe precipitates and cemented organic matter. The Fe precipitates were identified as schwertmannite at all locations, regardless of facies. Microbial composition was studied with fluorescence in situ hybridization (FISH) and transitioned from a microaerophilic, Euglena-dominated community at the spring, to a Betaproteobacteria (primarily Ferrovum spp.)-dominated community at the upstream end of the iron mound, to a Gammaproteobacteria (primarily Acidithiobacillus)-dominated community at the downstream end of the iron mound. Microbial community structure was more strongly correlated with pH and geochemical conditions than depositional facies. Intact pieces of terrace and pool sediments from upstream and downstream locations were used in flowthrough laboratory reactors to measure the rate and extent of low-pH Fe(II) oxidation. No change in Fe(II) concentration was observed with 60Co-irradiated sediments or with no-sediment controls, indicating that abiotic Fe(II) oxidation was negligible. Upstream sediments attained lower effluent Fe(II) concentrations compared to downstream sediments, regardless of depositional facies. PMID:21097582

Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

PubMed

Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

2015-03-20

Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

Stochastic empirical loading and dilution model for analysis of flows, concentrations, and loads of highway runoff constituents

USGS Publications Warehouse

Granato, Gregory E.; Jones, Susan C.

2014-01-01

In cooperation with FHWA, the U.S. Geological Survey developed the stochastic empirical loading and dilution model (SELDM) to supersede the 1990 FHWA runoff quality model. The SELDM tool is designed to transform disparate and complex scientific data into meaningful information about the adverse risks of runoff on receiving waters, the potential need for mitigation measures, and the potential effectiveness of such measures for reducing such risks. The SELDM tool is easy to use because much of the information and data needed to run it are embedded in the model and obtained by defining the site location and five simple basin properties. Information and data from thousands of sites across the country were compiled to facilitate the use of the SELDM tool. A case study illustrates how to use the SELDM tool for conducting the types of sensitivity analyses needed to properly assess water quality risks. For example, the use of deterministic values to model upstream stormflows instead of representative variations in prestorm flow and runoff may substantially overestimate the proportion of highway runoff in downstream flows. Also, the risks for total phosphorus excursions are substantially affected by the selected criteria and the modeling methods used. For example, if a single deterministic concentration is used rather than a stochastic population of values to model upstream concentrations, then the percentage of water quality excursions in the downstream receiving waters may depend entirely on the selected upstream concentration.

Logistic model of nitrate in streams of the upper-midwestern United States

USGS Publications Warehouse

Mueller, D.K.; Ruddy, B.C.; Battaglin, W.A.

1997-01-01

Nitrate in surface water can have adverse effects on aquatic life and, in drinking-water supplies, can be a risk to human health. As part of a regional study, nitrates as N (NO3-N) was analyzed in water samples collected from streams throughout 10 Midwestern states during synoptic surveys in 1989, 1990, and 1994. Data from the period immediately following crop planting at 124 sites were analyzed during logistic regression to relate discrete categories of NO3-N concentrations to characteristics of the basins upstream from the sites. The NO3-N data were divided into three categories representing probable background concentrations (10 mg L-1). Nitrate-N concentrations were positively correlated to streamflow, upstream area planted in corn (Zea mays L.), and upstream N- fertilizers application rates. Elevated NO3-N concentrations were associated with poorly drained soils and were weakly correlated with population density. Nitrate-N and streamflow data collected during 1989 and 1990 were used to calibrate the model, and data collected during 1994 were used for verification. The model correctly estimated NO3-N concentration categories for 79% of the samples in the calibration data set and 60% of the samples in the verification data set. The model was used to indicate where NO3-N concentrations might be elevated or exceed the NO3-N MCL in streams throughout the study area. The potential for elevated NO3-N concentrations was predicted to be greatest for streams in Illinois, Indiana, Iowa, and western Ohio.

Effects of water-control structures on hydrologic and water-quality characteristics in selected agricultural drainage canals in eastern North Carolina

USGS Publications Warehouse

Treece, M.W.; Jaynes, M.L.

1994-01-01

November of water into and out of tidally affected canals in eastern North Carolina was documented before and after the installation of water-control structures. Water levels in five of the canals downstream from the water-control structures were controlled primarily by water-level fluctuations in estuarine receiving waters. Water-control structures also altered upstream water levels in all canals. Water levels were lowered upstream from tide gates, but increased upstream from flashboard risers. Both types of water-control structures attenuated the release of runoff following rainfall events, but in slightly different ways. Tide gates appeared to reduce peak discharge rates associated with rainfall, and flashboard risers lengthened the duration of runoff release. Tide gates had no apparent effect on pH, dissolved oxygen, suspended-sediment, or total phosphorus concentrations downstream from the structures. Specific conductance measured from composite samples collected with automatic samples increased downstream of tide gates after installation. Median concentrations of nitrite plus nitrate nitrogen were near the minimum detection level throughout the study; however, the number of observations of concentrations exceeding 0.1 milligram per liter dropped significantly after tide gates were installed. Following tide-gate installation, instantaneous loadings of nitrite plus nitrate nitrogen were significantly reduced at one test site, but this reduction was not observed at the other test site. Loadings of other nutrient species and suspended sediment did not change at the tide-gate test sites after tide-gate installation. Specific conductance was lower in the Beaufort County canals than in the Hyde County canals. Although there was a slight increase in median values at the flashboard-riser sites, the mean and maximum values declined substantially downstream from the risers following installation. This decline of specific conductance in the canals occurred despite a large increase of specific conductance in the tidal creek. Flashboard risers had no significant effect on concentrations of dissolved oxygen, suspended sediment, total ammonia plus organic nitrogen, or phosphorus. Maximum concentrations of ammonia nitrogen were smaller at both test sites after riser installation. In addition, concentrations of nitrite plus nitrate nitrogen exceeding 1.0 milligram per liter rarely occurred at the flashboard-riser test sites following installation of the risers. Median loadings of nitrite plus nitrate nitrogen and total nitrogen decreased at one riser test site following flashboard-riser installation. Tide gates and flashboard risers were associated with reductions in concentrations and export of nitrite plus nitrate nitrogen; however, these changes should be interpreted cautiously because reductions were not observed consistently at every site. The hydrology and baseline water-quality characteristics of the two study areas differ, making comparisons of the effectiveness of the two types of water-control structures difficult to interpret. The effects of water-control structures on the hydrology of the drainage canals are more meaningful than the changes in water quality. Tide gates and flashboard risers altered the hydrologic characteristics of the drainage canals and created an environment favorable for nutrient loss or transformation. Both structures retained agricultural drainage upstream, which increased potential storage for infiltration and reduced the potential for surface runoff, sediment, and nutrient transport, and higher peak outflow rates.

Transcription Factor Stat5, A Novel Therapeutic Protein, Inhibits Metastatic Potential and Invasive Characteristics of Human Breast Cancer Cells

DTIC Science & Technology

2004-10-01

digestion and cloned into pLoxpNeo upstream of the PGK-neomycin cassette. A 1.3 kb fragment with the first coding exon was amplified by Pfx polymerase ...introducing a XhoI site on the 5’-end of the amplification product. The PCR fragment was cloned blunt into the HinDIII(blunt) site 5’ of the single...functionality of each of the loxP sites was tested in AM-1 cells (Invitrogen) that express Cre recombinase . Step 2: Gene targeting in embryonic stem

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

PubMed

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

Black liquor and the hangover effect: fish assemblage recovery dynamics following a pulse disturbance

PubMed Central

Piller, Kyle R; Geheber, Aaron D

2015-01-01

Anthropogenic perturbations impact aquatic systems causing wide-ranging responses, from assemblage restructuring to assemblage recovery. Previous studies indicate the duration and intensity of disturbances play a role in the dynamics of assemblage recovery. In August 2011, the Pearl River, United States, was subjected to a weak black liquor spill from a paper mill which resulted in substantial loss of fish in a large stretch of the main channel. We quantified resilience and recovery of fish assemblage structure in the impacted area following the event. We compared downstream (impacted) assemblages to upstream (unimpacted) assemblages to determine initial impacts on structure. Additionally, we incorporated historic fish collections (1988–2011) to examine impacts on assemblage structure across broad temporal scales. Based on NMDS, upstream and downstream sites generally showed similar assemblage structure across sample periods with the exception of the 2 months postdischarge, where upstream and downstream sites visually differed. Multivariate analysis of variance (PERMANOVA) indicated significant seasonal variation among samples, but found no significant interaction between impacted and unimpacted assemblages following the discharge event. However, multivariate dispersion (MVDISP) showed greater variance among assemblage structure following the discharge event. These results suggest that 2 months following the disturbance represent a time period of stochasticity in regard to assemblage structure dynamics, and this was followed by rapid recovery. We term this dynamic the “hangover effect” as it represents the time frame from the cessation of the perturbation to the assemblage's return to predisturbance conditions. The availability and proximity of tributaries and upstream refugia, which were not affected by the disturbance, as well as the rapid recovery of abiotic parameters likely played a substantial role in assemblage recovery. This study not only demonstrates rapid recovery in an aquatic system, but further demonstrates the value of continuous, long-term, data collections which enhance our understanding of assemblage dynamics. PMID:26120432

Delineation of potential deep seated landslides in a watershed using environmental index

NASA Astrophysics Data System (ADS)

Lai, Siao Ying; Lin, Chao Yuan; Lin, Cheng Yu

2016-04-01

The extreme rainfall induced deep seated landslides cause more attentions recently. Extreme rainfall can accelerate soil moisture content and surface runoff in slopeland which usually results in severe headward erosion and slope failures in an upstream watershed. It's a crucial issue for disaster prevention to extract the sites of potential deep seated landslide dynamically. Landslide risk and scale in a watershed were well discussed in this study. Risk of landslide occurrence in a watershed can be calculated from the multiplication of hazard and vulnerability for a certain event. A synthesis indicator derived from the indices of inverted extreme rainfall, road development and inverted normalized difference vegetation index can be effectively used as vulnerability for a watershed before the event. Landslide scale estimated from the indices of soil depth, headward erosion, river concave and dip slope could be applied to locate the hotspots of deep seated landslide in a watershed. The events of Typhoon Morakot in 2009 and Soudelor in 2015 were also selected in this study to verify the delineation accuracy of the model for the references of related authorities.

Changes and variations of polycyclic aromatic hydrocarbon concentrations in fish, barnacles and crabs following an oil spill in a mangrove of Guanabara Bay, Southeast Brazil.

PubMed

Soares-Gomes, Abílio; Neves, Roberta L; Aucélio, Ricardo; Van Der Ven, Paulo H; Pitombo, Fábio B; Mendes, Carla L T; Ziolli, Roberta L

2010-08-01

On April 26th, 2005, an accident caused a leak of 60,000L of Diesel Oil Type "B", freighted by train wagons upstream on a mangrove area within Guanabara Bay, Southeast Brazil. After the accident, samples from animals with different biological requirements were collected in order to monitor polycyclic aromatic hydrocarbons concentrations for the following 12months. Sessile, mobile, carnivorous, omnivorous, organic detritus feeders, planktivorous and suspension feeders were some of the attributes compared. Concentrations of PAHs did not vary in relation to different dietary habits and the best response was from the sessile suspensivorous barnacles. A background level of <50microgkg(-1) was suggested based on the reference site and on values observed in the following months after the accident. The highest values of PAH concentrations were observed in barnacles in the first month immediately after the spill, decreasing to background levels after few months. Barnacles are suggested as a sentinel species. Copyright 2010 Elsevier Ltd. All rights reserved.

Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

PubMed Central

Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

2015-01-01

Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

Changes to channel sediments resulting from complex human impacts in a gravel-bed river, Polish Carpathians

NASA Astrophysics Data System (ADS)

Zawiejska, Joanna; Wyżga, Bartłomiej; Hajdukiewicz, Hanna; Radecki-Pawlik, Artur; Mikuś, Paweł

2016-04-01

During the second half of the twentieth century, many sections of the Czarny Dunajec River, Polish Carpathians, were considerably modified by channelization as well as gravel-mining and the resultant channel incision (up to 3.5 m). This paper examines changes to the longitudinal pattern of grain size and sorting of bed material in an 18-km-long river reach. Surface bed-material grain size was established on 47 gravel bars and compared with a reference downstream fining trend of bar sediments derived from the sites with average river width and a vertically stable channel. Contrary to expectations, the extraction of cobbles from the channel bed in the upper part of the study reach, conducted in the past decades, has resulted in the marked coarsening of bed material in this river section. The extraction facilitated entrainment of exposed finer grains and has led to rapid bed degradation, whereas the concentration of flood flows in the increasingly deep and narrow channel has increased their competence and enabled a delivery of the coarse particles previously typical of the upstream reach. The middle section of the study reach, channelized to prevent sediment delivery to a downstream reservoir, now transfers the bed material flushed out from the incising upstream section. With considerably increased transport capacity of the river and with sediment delivery from bank erosion eliminated by bank reinforcements, bar sediments in the channelized section are typified by increased size of the finer fraction and better-than-average sorting. In the wide, multi-thread channel in the lower part of the reach, low unit stream power and high channel-form roughness facilitate sediment deposition and are reflected in relatively fine grades of bar gravels. The study showed that selective extraction of larger particles from the channel bed leads to channel incision at and upstream of the mining site. However, unlike bulk gravel mining, selective extraction does not result in sediment deficit downstream as large volumes of finer bed material are flushed out from the incising channel section. Grain-size analyses of bulk gravels and measurements of 100 coarsest particles within the channel sediment ranging in age from 5200 years BP to the present, performed in this deeply incised section, indicated that grain size of channel sediments changed relatively little since mid-Holocene to the 1960s, but has increased rapidly over the last half-century as a result of human interventions and rapidly progressing channel incision. This study was performed within the scope of the Research Project DEC-2013/09/B/ST10/00056 financed by the National Science Centre of Poland.

Evaluating the adequacy of a reference site pool for ecological assessments in environmentally complex regions

USGS Publications Warehouse

Ode, Peter R.; Rehn, Andrew C.; Mazor, Raphael D.; Schiff, Kenneth C.; Stein, Eric D.; May, Jason; Brown, Larry R.; Herbst, David B.; Gillette, D.D.; Lunde, Kevin; Hawkins, Charles P.

2016-01-01

Many advances in the field of bioassessment have focused on approaches for objectively selecting the pool of reference sites used to establish expectations for healthy waterbodies, but little emphasis has been placed on ways to evaluate the suitability of the reference-site pool for its intended applications (e.g., compliance assessment vs ambient monitoring). These evaluations are critical because an inadequately evaluated reference pool may bias assessments in some settings. We present an approach for evaluating the adequacy of a reference-site pool for supporting biotic-index development in environmentally heterogeneous and pervasively altered regions. We followed common approaches for selecting sites with low levels of anthropogenic stress to screen 1985 candidate stream reaches to create a pool of 590 reference sites for assessing the biological integrity of streams in California, USA. We assessed the resulting pool of reference sites against 2 performance criteria. First, we evaluated how well the reference-site pool represented the range of natural gradients present in the entire population of streams as estimated by sites sampled through probabilistic surveys. Second, we evaluated the degree to which we were successful in rejecting sites influenced by anthropogenic stress by comparing biological metric scores at reference sites with the most vs fewest potential sources of stress. Using this approach, we established a reference-site pool with low levels of human-associated stress and broad coverage of environmental heterogeneity. This approach should be widely applicable and customizable to particular regional or programmatic needs.

An evaluation of climate change effects in estuarine salinity patterns: Application to Ria de Aveiro shallow water system

NASA Astrophysics Data System (ADS)

Vargas, Catarina I. C.; Vaz, Nuno; Dias, João M.

2017-04-01

It is of global interest, for the definition of effective adaptation strategies, to make an assessment of climate change impacts in coastal environments. In this study, the salinity patterns adjustments and the correspondent Venice System zonations adaptations are evaluated through numerical modelling for Ria de Aveiro, a mesotidal shallow water lagoon located in the Portuguese coast, for the end of the 21st century in a climate change context. A reference (equivalent to present conditions) and three future scenarios are defined and simulated, both for wet and dry conditions. The future scenarios are designed with the following changes to the reference: scenario 1) projected mean sea level (MSL) rise; scenario 2) projected river flow discharges; and scenario 3) projections for both MSL and river flow discharges. The projections imposed are: a MSL rise of 0.42 m; a freshwater flow reduction of ∼22% for the wet season and a reduction of ∼87% for the dry season. Modelling results are analyzed for different tidal ranges. Results indicate: a) a salinity upstream intrusion and a generalized salinity increase for sea level rise scenario, with higher significance in middle-to-upper lagoon zones; b) a maximum salinity increase of ∼12 in scenario 3 and wet conditions for Espinheiro channel, the one with higher freshwater contribution; c) an upstream displacement of the saline fronts occurring in wet conditions for all future scenarios, with stronger expression for scenario 3, of ∼2 km in Espinheiro channel; and d) a landward progression of the saltier physical zones established in the Venice System scheme. The adaptation of the ecosystem to the upstream relocation of physical zones may be blocked by human settlements and other artificial barriers surrounding the estuarine environment.

Effects of Chiloquin Dam on spawning distribution and larval emigration of Lost River, shortnose, and Klamath largescale suckers in the Williamson and Sprague Rivers, Oregon

USGS Publications Warehouse

Martin, Barbara A.; Hewitt, David A.; Ellsworth, Craig M.

2013-01-01

Chiloquin Dam was constructed in 1914 on the Sprague River near the town of Chiloquin, Oregon. The dam was identified as a barrier that potentially inhibited or prevented the upstream spawning migrations and other movements of endangered Lost River (Deltistes luxatusChasmistes brevirostris) suckers, as well as other fish species. In 2002, the Bureau of Reclamation led a working group that examined several alternatives to improve fish passage at Chiloquin Dam. Ultimately it was decided that dam removal was the best alternative and the dam was removed in the summer of 2008. The U.S. Geological Survey conducted a long-term study on the spawning ecology of Lost River, shortnose, and Klamath largescale suckers (Catostomus snyderi) in the Sprague and lower Williamson Rivers from 2004 to 2010. The objective of this study was to evaluate shifts in spawning distribution following the removal of Chiloquin Dam. Radio telemetry was used in conjunction with larval production data and detections of fish tagged with passive integrated transponders (PIT tags) to evaluate whether dam removal resulted in increased utilization of spawning habitat farther upstream in the Sprague River. Increased densities of drifting larvae were observed at a site in the lower Williamson River after the dam was removed, but no substantial changes occurred upstream of the former dam site. Adult spawning migrations primarily were influenced by water temperature and did not change with the removal of the dam. Emigration of larvae consistently occurred about 3-4 weeks after adults migrated into a section of river. Detections of PIT-tagged fish showed increases in the numbers of all three suckers that migrated upstream of the dam site following removal, but the increases for Lost River and shortnose suckers were relatively small compared to the total number of fish that made a spawning migration in a given season. Increases for Klamath largescale suckers were more substantial. Post-dam removal monitoring only included 2 years with below average river discharge during the spawning season; data from years with higher flows may provide a different perspective on the effects of dam removal on the spawning migrations of the two endangered sucker species.

Geomorphological and ecological effects of check dams in mountain torrents of Southern Italy

NASA Astrophysics Data System (ADS)

Zema, Demetrio Antonio; Bombino, Giuseppe; Denisi, Pietro; Tamburino, Vincenzo; Marcello Zimbone, Santo

2017-04-01

It is known that installation of check dams noticeably influences torrent morphology and ecology. However, the effects of check dams on channel section and riparian vegetation of torrents are not yet completely understood. This paper provides a further contribution to a better comprehension of the actions played by check dams on hydrological and geomorphological processes in headwaters and their effects on riparian ecosystem. Field surveys on channel morphology, bed material and riparian vegetation were carried out close to five check dams in each of four mountain reaches of Calabria (Southern Italy). For each check dam three transects (one upstream, one downstream and one far from the check dam, located in the undisturbed zone and adopted as control) were identified; at each transect, a set of geomorphological and ecological indicators were surveyed as follows. Channel section morphology was assessed by the width/depth ratio (w/d); the median particle size (D50) and the finer sediment fraction (%fines) were chosen to characterize channel bed material; the specific discharge (q, the discharge per channel unit width) was assumed as measure of the flow regime. Vegetation cover and structure were evaluated by Global Canopy Cover (GCC) and Weighted Canopy Height (WCH) respectively (Bombino et al., 2008); the index of alpha-diversity (H-alpha, Hill, 1973) and the ratio between the number of alien species and the number of native species (NSA/NSN) were chosen as indicators of species richness/abundance and degree of vegetation integrity, respectively. Compared to the control transects, the values of w/d were higher upstream of check dams and lower downstream; conversely, q was lower upstream and higher in downstream sites. Upstream of the check dams D50 of bed material was lower and %fines was higher compared to the control transects; vice versa, the downstream transects showed higher D50 and lower %fines. The differences in the riparian vegetation among transects were found as the torrent ecological response to the strong contrasts surveyed in hydrological (q) and geomorphological (w/d, D50 and %fines) characteristics. Compared to control transects, vegetation was more extensive (higher GCC) and developed (higher WCH) in the upstream zones; the reverse pattern was noticed in the downstream transects (lower GCC and WCH). The indexes H-alpha and NSA/NSN were higher upstream of check dams: the presence of the check dams induced higher species richness and evenness, with alien species prevailing over native ones in the sedimentation wedge. Conversely, downstream of check dams H-alpha and NSA/NSN were lower: here, riparian vegetation lost some herbaceous species and assumed a terrestrial character. Overall, this study confirms on a quantitative approach that check dams have far reaching effects on geomorphology and ecology of mountain torrent channels; as a consequence, important and complex changes occur not only in the extent and development of riparian vegetation, but also in the species diversity and distribution. REFERENCES - Bombino G., Gurnell A.M., Tamburino V., Zema D.A., Zimbone S.M. 2008. Sediment size variation in torrents with check-dams: effects on riparian vegetation. Ecological Engineering 32(2), 166-177. - Hill MO. 1973. Diversity and evenness: a unifying notation and its consequences. Ecology 54: 427-431.

Fish Assemblage Response to a Small Dam Removal in the Eightmile River System, Connecticut, USA

NASA Astrophysics Data System (ADS)

Poulos, Helen M.; Miller, Kate E.; Kraczkowski, Michelle L.; Welchel, Adam W.; Heineman, Ross; Chernoff, Barry

2014-11-01

We examined the effects of the Zemko Dam removal on the Eightmile River system in Salem, Connecticut, USA. The objective of this research was to quantify spatiotemporal variation in fish community composition in response to small dam removal. We sampled fish abundance over a 6-year period (2005-2010) to quantify changes in fish assemblages prior to dam removal, during drawdown, and for three years following dam removal. Fish population dynamics were examined above the dam, below the dam, and at two reference sites by indicator species analysis, mixed models, non-metric multidimensional scaling, and analysis of similarity. We observed significant shifts in fish relative abundance over time in response to dam removal. Changes in fish species composition were variable, and they occurred within 1 year of drawdown. A complete shift from lentic to lotic fishes failed to occur within 3 years after the dam was removed. However, we did observe increases in fluvial and transition (i.e., pool head, pool tail, or run) specialist fishes both upstream and downstream from the former dam site. Our results demonstrate the importance of dam removal for restoring river connectivity for fish movement. While the long-term effects of dam removal remain uncertain, we conclude that dam removals can have positive benefits on fish assemblages by enhancing river connectivity and fluvial habitat availability.

Fish assemblage response to a small dam removal in the Eightmile River system, Connecticut, USA.

PubMed

Poulos, Helen M; Miller, Kate E; Kraczkowski, Michelle L; Welchel, Adam W; Heineman, Ross; Chernoff, Barry

2014-11-01

We examined the effects of the Zemko Dam removal on the Eightmile River system in Salem, Connecticut, USA. The objective of this research was to quantify spatiotemporal variation in fish community composition in response to small dam removal. We sampled fish abundance over a 6-year period (2005-2010) to quantify changes in fish assemblages prior to dam removal, during drawdown, and for three years following dam removal. Fish population dynamics were examined above the dam, below the dam, and at two reference sites by indicator species analysis, mixed models, non-metric multidimensional scaling, and analysis of similarity. We observed significant shifts in fish relative abundance over time in response to dam removal. Changes in fish species composition were variable, and they occurred within 1 year of drawdown. A complete shift from lentic to lotic fishes failed to occur within 3 years after the dam was removed. However, we did observe increases in fluvial and transition (i.e., pool head, pool tail, or run) specialist fishes both upstream and downstream from the former dam site. Our results demonstrate the importance of dam removal for restoring river connectivity for fish movement. While the long-term effects of dam removal remain uncertain, we conclude that dam removals can have positive benefits on fish assemblages by enhancing river connectivity and fluvial habitat availability.

Establishing physico-chemical reference conditions in Mediterranean streams according to the European Water Framework Directive.

PubMed

Sánchez-Montoya, María del Mar; Arce, Maria Isabel; Vidal-Abarca, María Rosario; Suárez, María Luisa; Prat, Narcís; Gómez, Rosa

2012-05-01

Type-specific physico-chemical reference conditions are required for the assessment of ecological status in the Water Framework Directive context, similarly to the biological and hydro-morphological elements. This directive emphasises that natural variability of quality elements in high status (reference condition) needs to be quantified. Mediterranean streams often present a marked seasonal pattern in hydrological, biological and geochemical processes which could affect physico-chemical reference conditions. This study establishes general physico-chemical reference conditions (oxygenation, nutrient, salinity and acidification conditions) for different Mediterranean stream types. 116 potential reference sites located in 23 Mediterranean catchments in Spain were sampled in spring, summer and autumn in 2003. All sites were subjected to a screening method for the selection of reference sites in Mediterranean streams (Mediterranean Reference Criteria) and classified using a pre-established stream typology that establishes five different stream types (temporary streams, evaporite-calcareous at medium altitude, siliceous headwaters, calcareous headwaters and large watercourses). Reference conditions (reference value and reference threshold equivalents to high-good class boundary) were calculated using two different methods according to the availability of reference sites: the reference site 75th percentile approach of all reference sites and the 25th percentile of the population approach. The majority of the studied potential reference sites (76 out of 116) were selected as reference sites. Regarding type-specific reference conditions, only siliceous headwaters could be considered different from the rest of stream types because lower conductivity and pH. All reference stream types presented seasonal differences as regards some parameters, except for temporary streams due to the high natural variation of this stream type. For those parameters which presented seasonal differences in a specific stream type, the least restrictive values were proposed as reference conditions. Copyright © 2012 Elsevier Ltd. All rights reserved.

Level II scour analysis for Bridge 25 (REDSTH00360025) on Town Highway 36, crossing the West Branch Deerfield River, Readsboro, Vermont

USGS Publications Warehouse

Flynn, Robert H.; Burns, Ronda L.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure REDSTH00360025 on Town Highway 36 crossing the West Branch Deerfield River, Readsboro, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the Green Mountain section of the New England physiographic province in south-central Vermont. The 14.5-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is pasture on the upstream right bank and forest on the upstream left bank. The surface cover on the downstream right and left banks is primarily grass, shrubs and brush. In the study area, the West Branch Deerfield River has an incised, sinuous channel with a slope of approximately 0.02 ft/ft, an average channel top width of 65 ft and an average bank height of 4 ft. The channel bed material ranges from gravel to boulders, with a median grain size (D50) of 117 mm (0.383 ft). The geomorphic assessment at the time of the Level I and Level II site visit on August 1, 1996, indicated that the reach was stable. The Town Highway 36 crossing of the West Branch Deerfield River is a 59-ft-long, two-lane bridge consisting of one 57-foot concrete T-beam span (Vermont Agency of Transportation, written communication, September 28, 1995). The opening length of the structure parallel to the bridge face is 54 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 50 degrees to the opening while the opening-skew-to-roadway is 30 degrees. During the Level I assessment, a scour hole approximately 2 ft deeper than the mean thalweg depth was observed along the upstream right wingwall and a scour hole approximately 1 ft deeper than the mean thalweg depth was observed along the downstream left wingwall. The scour protection measure at the site was type-2 stone fill (less than 36 inches diameter) at the downstream end of the downstream left wingwall, at the upstream end of the upstream right wingwall, at the downstream end of the right abutment, along the entire base length of the downstream right wingwall, along the upstream right bank and along the downstream left bank. A stone wall was noted along the upstream left bank. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 0.6 ft. The worst-case contraction scour occurred at the incipient-overtopping discharge. Abutment scour ranged from 15.1 to 16.3 ft along the left abutment and from 7.4 to 9.2 ft along the right abutment. The worst-case abutment scour occurred at the incipient-overtopping and 500-year discharges for the left abutment and at the 500-year discharge for the right abutment. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Level II scour analysis for Bridge 16 (BURKTH00070016) on Town Highway 7, crossing Dish Mill Brook, Burke, Vermont

USGS Publications Warehouse

Burns, Ronda L.; Severance, Tim

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure BURKTH00070016 on Town Highway 7 crossing Dish Mill Brook, Burke, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the White Mountain section of the New England physiographic province in northeastern Vermont. The 6.0-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is forest except on the left bank upstream which is brushland. In the study area, Dish Mill Brook has an incised, sinuous channel with a slope of approximately 0.04 ft/ft, an average channel top width of 40 ft and an average bank height of 6 ft. The channel bed material ranges from sand to boulder with a median grain size (D50) of 94.1 mm (0.309 ft). The geomorphic assessment at the time of the Level I and Level II site visit on August 7, 1995, indicated that the reach was stable. The Town Highway 7 crossing of Dish Mill Brook is a 28-ft-long, two-lane bridge consisting of one 24-foot steel-beam span (Vermont Agency of Transportation, written communication, March 24, 1995). The opening length of the structure parallel to the bridge face is 24.8 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 35 degrees to the opening while the computed opening-skew-to-roadway is 35 degrees. A scour hole 1.0 ft deeper than the mean thalweg depth was observed along the left and right abutments during the Level I assessment. In front of the upstream and downstream left wingwalls the scour depth was only 0.5 ft, while in front of the downstream right wingwall it was 0.75 ft and in front of the upstream right wingwall it was 0.3 ft. The scour countermeasures at the site include type-1 stone fill (less than 12 inches diameter) at the downstream end of the right abutment and along the downstream right wingwall. Type-2 stone fill (less than 36 inches diameter) is along the upstream left bank, the upstream and downstream left wingwalls, and at the upstream end of the upstream right wingwall. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995) for the 100- and 500-year discharges. In addition, the incipient roadway-overtopping discharge is determined and analyzed as another potential worst-case scour scenario. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.0 to 0.5 ft. The worst-case contraction scour occurred at the 500-year discharge. Abutment scour ranged from 6.7 to 9.3 ft. The worst-case abutment scour occurred at the 500-year discharge for the left abutment and at the incipient road-overtopping discharge for the right abutment. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Level II scour analysis for Bridge 15 (BOLTTH00150015) on Town Highway 15, crossing Joiner Brook, Bolton, Vermont

USGS Publications Warehouse

Burns, Ronda L.; Wild, Emily C.

1998-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure BOLTTH00150015 on Town Highway 15 crossing Joiner Brook, Bolton, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (FHWA, 1993). Results of a Level I scour investigation also are included in appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in appendix D. The site is in the Green Mountain section of the New England physiographic province in north central Vermont. The 9.6-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is pasture (lawn) downstream of the bridge and on the upstream right bank. The surface cover on the upstream left bank is shrub and brushland. In the study area, Joiner Brook has an incised, straight channel with a slope of approximately 0.01 ft/ft, an average channel top width of 61 ft and an average bank height of 7 ft. The channel bed material ranges from gravel to cobble with a median grain size (D50) of 43.6 mm (0.143 ft). The geomorphic assessment at the time of the Level I and Level II site visit on June 27, 1996, indicated that the reach was stable. The Town Highway 15 crossing of Joiner Brook is a 39-ft-long, two-lane bridge consisting of one 36-foot concrete tee-beam span (Vermont Agency of Transportation, written communication, November 3, 1995). The opening length of the structure parallel to the bridge face is 34.6 ft. The bridge is supported by nearly vertical, concrete abutments with wingwalls. The channel is skewed approximately 10 degrees to the opening while the opening-skew-to-roadway is zero degrees. A scour hole 1.5 ft deeper than the mean thalweg depth was observed at the downstream end of the right abutment and along the downstream right wingwall during the Level I assessment. A second scour hole 1.2 ft deeper than the mean thalweg depth was observed at the upstream end of the left abutment and along the upstream left wingwall. The left abutment footing is exposed in the area of the scour hole. Scour protection measures at the site included type-1 stone fill (less than 12 inches diameter) at the upstream end of the upstream left wingwall and at the downstream end of the downstream right wingwall and type-2 stone fill (less than 36 inches diameter) along the downstream left bank. There is also type-3 stone fill (less than 48 inches diameter) along the upstream left and right banks. Additional details describing conditions at the site are included in the Level II Summary and appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and Davis, 1995) for the 100- and 500-year discharges. In addition, the incipient roadway-overtopping discharge was determined and analyzed as another potential worst-case scour scenario. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.8 to 3.5 ft. The worst-case contraction scour occurred at the 500-year discharge. Abutment scour ranged from 6.9 to 15.1 ft. The worst-case abutment scour occurred at the incipient roadway-overtopping discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results.” Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and Davis, 1995, p. 46). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Effects of benthic flora on arsenic transport

USGS Publications Warehouse

Kuwabara, James S.; Chang, Cecily C.Y.; Pasilis, Sofie P.

1990-01-01

Chemical and biological interactions involving arsenic (As) and phosphorus (P) appear to affect significantly As transport and distribution in Whitewood Creek, South Dakota. Data (first‐order uptake rate constants, standing crop, and accumulation factors) that can be used to predict As transport have been determined using algae collected in the creek along a transect from upstream of mine discharge down gradient through a 57‐km impacted reach. Cultures of Achnanthes minutissima (Bacillariophyceae) were isolated from four sites along a longitudinal gradient of dissolved As within the study reach and were maintained at ambient dissolved‐As concentrations. Arsenic sorption‐rate constants for cell surfaces of these isolates were estimated as a function of dissolved arsenate and orthophosphate. All isolates sorbed orthophosphate preferentially over arsenate. Initial sorption of both arsenate and orthophosphate appeared to follow a first‐order equation within media formulations but did not adequately describe other observed effects among formulations or between isolates. Although estimated sorption‐rate constants increased slightly with increased dissolved arsenate concentration, algae isolated from a site with elevated dissolved As had a significantly slower rate of As uptake compared with the same species isolated from an uncontaminated site upstream. Field and laboratory results indicate that the benthic flora represent a significant As pool, which may episodically affect water‐column concentrations. 

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

PubMed

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-07-27

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

PubMed Central

Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

2012-01-01

Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

Mercury Speciation and Trophic Magnification Slopes in Giant Salamander Larvae from the Pacific Northwest, USA

NASA Astrophysics Data System (ADS)

Bank, M. S.; Crocker, J.; Wachtl, J.; Kleeman, P.; Fellers, G.; Currens, C.; Hothem, R.; Madej, M. A.

2014-12-01

Mercury (Hg) contamination of stream salamanders in the Pacific Northwest region of the United States has received little attention. Here we report total Hg (HgT) and methyl mercury (MeHg) concentrations in larval giant salamanders (Dicamptodon spp.) and surface water from forested and chaparral lotic ecosystems distributed along a latitudinal gradient throughout Northern California and Washington. To test hypotheses related to potential effects from mining land-use activities, salamander larvae were also sampled from a reference site at Whiskeytown National Recreation Area, California, and at a nearby, upstream site (Shasta county) on Bureau of Land Management land where Hg contamination from gold mining activities has been documented. HgT concentrations in whole body larvae ranged from 4.6 to 74.5 ng/g wet wt. and percent MeHg ranged from 67% to 86%. Both HgT and MeHg larval tissue concentrations were significantly higher at the mining site in comparison to measured background levels (P < 0.001). We conclude that salamander larvae in remote stream ecosystems, where Hg sources were dominated by atmospheric deposition, were generally low in HgT and MeHg and, in comparison, watersheds with a legacy of land-use practices (i.e., mining operations) had approximately 4.5 - 5.5 times the level of HgT bioaccumulation. Moreover, trophic magnification slopes were highest in the Shasta county region where mining was present. These findings suggest that mining activities increase HgT and MeHg exposure to salamander larvae in the region and may present a threat to other higher trophically positioned organisms, and their associated food webs.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen P.

2006-10-17

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen

2000-01-01

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

Novel Strategies for Upstream and Downstream Processing of Tannin Acyl Hydrolase

PubMed Central

Rodríguez-Durán, Luis V.; Valdivia-Urdiales, Blanca; Contreras-Esquivel, Juan C.; Rodríguez-Herrera, Raúl; Aguilar, Cristóbal N.

2011-01-01

Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme. PMID:21941633

Protein-Protein Interactions, Not Substrate Recognition, Dominate the Turnover of Chimeric Assembly Line Polyketide Synthases*

PubMed Central

Klaus, Maja; Ostrowski, Matthew P.; Austerjost, Jonas; Robbins, Thomas; Lowry, Brian; Cane, David E.; Khosla, Chaitan

2016-01-01

The potential for recombining intact polyketide synthase (PKS) modules has been extensively explored. Both enzyme-substrate and protein-protein interactions influence chimeric PKS activity, but their relative contributions are unclear. We now address this issue by studying a library of 11 bimodular and 8 trimodular chimeric PKSs harboring modules from the erythromycin, rifamycin, and rapamycin synthases. Although many chimeras yielded detectable products, nearly all had specific activities below 10% of the reference natural PKSs. Analysis of selected bimodular chimeras, each with the same upstream module, revealed that turnover correlated with the efficiency of intermodular chain translocation. Mutation of the acyl carrier protein (ACP) domain of the upstream module in one chimera at a residue predicted to influence ketosynthase-ACP recognition led to improved turnover. In contrast, replacement of the ketoreductase domain of the upstream module by a paralog that produced the enantiomeric ACP-bound diketide caused no changes in processing rates for each of six heterologous downstream modules compared with those of the native diketide. Taken together, these results demonstrate that protein-protein interactions play a larger role than enzyme-substrate recognition in the evolution or design of catalytically efficient chimeric PKSs. PMID:27246853

Hydrologic Data Summary for the Northeast Creek/Fresh Meadow Estuary, Acadia National Park, Maine, 2000-2001

USGS Publications Warehouse

Caldwell, James M.; Culbertson, Charles W.

2007-01-01

The U.S. Geological Survey, in cooperation with the National Park Service, collected data in Northeast Creek estuary, Mt. Desert Island, Maine, to establish baseline water-quality conditions including estuarine nutrient concentrations. Five sampling sites in Northeast Creek were established and monitored continuously for temperature and specific conductance during May to November, 2000 and 2001. Stream stage, which was affected by ocean tidal dynamics, was recorded at the most downstream site and at one upstream site. Discrete water samples for nutrient concentrations were collected biweekly during May to November, 2000 and 2001, at the five sampling sites, and an additional site seaward of the estuary mouth. Results indicated that the salinity regime of Northeast Creek estuary is dynamic and highly regulated by strong seasonal variations in freshwater runoff, as well as limited seawater exchange caused by a constriction at the bridge, at the downstream end of the estuary. Oligohaline conditions (0.5-5 practical salinity units) occasionally extend to the estuary mouth. During other periods oligohaline and mesohaline (5-20 practical salinity units) conditions exist in some areas of the estuary; polyhaline/marine (20-35 practical salinity units) conditions occasionally exist near the mouth. A saltwater wedge in the bottom water, due to density stratification, was observed to migrate upstream as fresh surface-water inputs diminished during the onset of summer low-flow conditions. Although specific conductance ranged widely at most sites because of tidal influences, other water-quality constituents, including nutrient and chlorophyll-a concentrations, exhibited seasonal distribution patterns in which maximum levels generally occurred in early to mid-summer and again in the fall over both field seasons.

Didymosphenia geminata in the Upper Esopus Creek: Current Status, Variability, and Controlling Factors

PubMed Central

George, Scott Daniel; Baldigo, Barry Paul

2015-01-01

In May of 2009, the bloom-forming diatom Didymosphenia geminata was first identified in the Upper Esopus Creek, a key tributary to the New York City water-supply and a popular recreational stream. The Upper Esopus receives supplemental flows from the Shandaken Portal, an underground aqueduct delivering waters from a nearby basin. The presence of D. geminata is a concern for the local economy, water supply, and aquatic ecosystem because nuisance blooms have been linked to degraded stream condition in other regions. Here we ascertain the extent and severity of the D. geminata invasion, determine the impact of supplemental flows from the Portal on D. geminata, and identify potential factors that may limit D. geminata in the watershed. Stream temperature, discharge, and water quality were characterized at select sites and periphyton samples were collected five times at 6 to 20 study sites between 2009 and 2010 to assess standing crop, diatom community structure, and density of D. geminata and all diatoms. Density of D. geminata ranged from 0–12 cells cm-2 at tributary sites, 0–781 cells cm-2 at sites upstream of the Portal, and 0–2,574 cells cm-2 at sites downstream of the Portal. Survey period and Portal (upstream or downstream) each significantly affected D. geminata cell density. In general, D. geminata was most abundant during the November 2009 and June 2010 surveys and at sites immediately downstream of the Portal. We found that D. geminata did not reach nuisance levels or strongly affect the periphyton community. Similarly, companion studies showed that local macroinvertebrate and fish communities were generally unaffected. A number of abiotic factors including variable flows and moderate levels of phosphorous and suspended sediment may limit blooms of D. geminata in this watershed. PMID:26148184

Sources and compositional distribution of organic carbon in surface sediments from the lower Pearl River to the coastal South China Sea

NASA Astrophysics Data System (ADS)

Li, X.; Zhang, Z.; Wade, T.; Knap, A. H.; Zhang, C.

2017-12-01

The Pearl River plays an important role in transporting terrestrial organic carbon (OC) to the South China Sea (SCS). However, the sources and compositional distribution of OC in the system are poorly understood. This study focused on delineating the sources and determining the fate of surface sedimentary OC from the Feilaixia Hydro-power Station to the coastal SCS. Elemental, stable carbon/nitrogen isotope (δ13C, δ15N) and lignin-phenol analyses have been conducted. The total OC (TOC) from the up-stream sites were generally derived from vascular plants (higher C/N, and depleted δ13C) and soils. Additional input was attributed to riverine primary production (lower C/N and enriched δ13C), which was enhanced near the dam-created reservoir. The C/N and δ13C values were not significantly different among sites in the mid-stream. The estuary/coastal sites witnessed hydrodynamically sorted riverine OC, which was diluted by marine primary production (lower C/N and more enriched δ13C). The lignin concentration was the highest in the up-stream sites, remained relatively unchanged in the mid-stream sites and decreased significantly along the estuary/coastal sites, which was corroborated by variation in TOC. A comprehensive five-endmember Monte Carlo simulation suggested that previous studies had underestimated the C4 plant input by 14 ± 11% and overestimated the riverbank soil input by 21 ± 17%. Thus, our study provided valuable information for more accurate source and mass balance studies of terrestrial OC transported to the SCS, which helped to further understand the carbon cycling in the large river-ocean continuum.

Sources and compositional distribution of organic carbon in surface sediments from the lower Pearl River to the coastal South China Sea

NASA Astrophysics Data System (ADS)

Li, Xinxin; Zhang, Zhaoru; Wade, Terry L.; Knap, Anthony H.; Zhang, Chuanlun L.

2017-08-01

The Pearl River plays an important role in transporting terrestrial organic carbon (OC) to the South China Sea (SCS). However, the sources and compositional distribution of OC in the system are poorly understood. This study focused on delineating the sources and determining the fate of surface sedimentary OC from the Feilaixia Hydropower Station to the coastal SCS. Elemental, stable carbon/nitrogen isotope (δ13C and δ15N), and lignin-phenol analyses have been conducted. The total OC (TOC) from the upstream sites were generally derived from vascular plants (higher C/N and and depleted δ13C) and soils. Additional input was attributed to riverine primary production (lower C/N and enriched δ13C), which was enhanced near the dam-created reservoir. The C/N and δ13C values were not significantly different among sites in the midstream. The estuary/coastal sites witnessed hydrodynamically sorted riverine OC, which was diluted by marine primary production (lower C/N and more enriched δ13C). The lignin concentration was the highest in the upstream sites, remained relatively unchanged in the midstream sites, and decreased significantly along the estuary/coastal sites, which was corroborated by variation in TOC. A comprehensive five-end-member Monte Carlo simulation suggested that previous studies had underestimated the C4 plant input by 14 ± 11% and overestimated the riverbank soil input by 21 ± 17%. Thus, our study provided valuable information for more accurate source and mass balance studies of terrestrial OC transported to the SCS, which helped to further understand the carbon cycling in the large river-ocean continuum.

Water Quality in the Blue River Basin, Kansas City Metropolitan Area, Missouri and Kansas, July 1998 to October 2004

USGS Publications Warehouse

Wilkison, Donald H.; Armstrong, Daniel J.; Norman, Richard D.; Polton, Barry C.; Furlong, Edward T.; Zaugg, Steven D.

2006-01-01

Water-quality data were collected from sites in the Blue River Basin from July 1998 to October. Sites upstream from wastewater-treatment plants or the combined sewer system area had lower concentrations of total nitrogen, phosphorus, organic wastewater compounds, and pharmaceuticals, and more diverse aquatic communities. Sites downstream from wastewater-treatment plants had the largest concentrations and loads of nutrients, organic wastewater compounds, and pharmaceuticals. Approximately 60 percent of the total nitrogen and phosphorus in Blue River originated from the Indian Creek, smaller amounts from the upper Blue River (from 28 to 16 percent), and less than 5 percent from Brush Creek. Nutrient yields from the Indian Creek and the middle Blue River were significantly greater than yields from the upper Blue River, lower Brush Creek, the outside control site, and other U.S. urban sites. Large concentrations of nutrients led to eutrophication of impounded Brush Creek reaches. Bottom sediment samples collected from impoundments generally had concentrations of organic wastewater and pharmaceutical compounds equivalent to or greater than, concentrations observed in streambed sediments downstream from wastewater-treatment plants. Bacteria in streams largely was the result of nonpoint-source contributions during storms. Based on genetic source-tracking, average contributions of in-stream Esherichia coli bacteria in the basin from dogs ranged from 26-32 percent of the total concentration, and human sources ranged from 28-42 percent. Macro invertebrate diversity was highest at sites with the largest percentage of upstream land use devoted to forests and grasslands. Declines in macro invertebrate community metrics were correlated strongly with increases in several, inter-related urbanization factors.

Water quality in the Blue River basin, Kansas City metropolitan area, Missouri and Kansas, July 1998 to October 2004

USGS Publications Warehouse

Wilkison, Donald H.; Armstrong, Daniel J.; Norman, Richard D.; Poulton, Barry C.; Furlong, Edward T.; Zaugg, Steven D.

2006-01-01

Water-quality data were collected from sites in the Blue River Basin from July 1998 to October. Sites upstream from wastewater-treatment plants or the combined sewer system area had lower concentrations of total nitrogen, phosphorus, organic wastewater compounds, and pharmaceuticals, and more diverse aquatic communities. Sites downstream from wastewater-treatment plants had the largest concentrations and loads of nutrients, organic wastewater compounds, and pharmaceuticals. Approximately 60 percent of the total nitrogen and phosphorus in Blue River originated from the Indian Creek, smaller amounts from the upper Blue River (from 28 to 16 percent), and less than 5 percent from Brush Creek. Nutrient yields from the Indian Creek and the middle Blue River were significantly greater than yields from the upper Blue River, lower Brush Creek, the outside control site, and other U.S. urban sites. Large concentrations of nutrients led to eutrophication of impounded Brush Creek reaches. Bottom sediment samples collected from impoundments generally had concentrations of organic wastewater and pharmaceutical compounds equivalent to or greater than, concentrations observed in streambed sediments downstream from wastewater-treatment plants. Bacteria in streams largely was the result of nonpoint-source contributions during storms. Based on genetic source-tracking, average contributions of in-stream Esherichia coli bacteria in the basin from dogs ranged from 26-32 percent of the total concentration, and human sources ranged from 28-42 percent. Macro invertebrate diversity was highest at sites with the largest percentage of upstream land use devoted to forests and grasslands. Declines in macro invertebrate community metrics were correlated strongly with increases in several, inter-related urbanization factors.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

PubMed

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Bedload transport over run-of-river dams, Delaware, U.S.A.

NASA Astrophysics Data System (ADS)

Pearson, Adam J.; Pizzuto, Jim

2015-11-01

We document the detailed morphology and bed sediment size distribution of a stream channel upstream and downstream of a 200-year-old run-of-river dam on the Red Clay Creek, a fifth order stream in the Piedmont of northern Delaware, and combine these data with HEC-RAS modeling and bedload transport computations. We hypothesize that coarse bed material can be carried through run-of-river impoundments before they completely fill with sediment, and we explore mechanisms to facilitate this transport. Only 25% of the accommodation space in our study site is filled with sediment, and maximum water depths are approximately equal to the dam height. All grain-size fractions present upstream of the impoundment are also present throughout the impoundment. A characteristic coarse-grained sloping ramp leads from the floor of the impoundment to the crest of the dam. A 2.3-m-deep plunge pool has been excavated below the dam, followed immediately downstream by a mid-channel bar composed of coarse bed material similar in size distribution to the bed material of the impoundment. The mid-channel bar stores 1472 m3 of sediment, exceeding the volume excavated from the plunge pool by a factor of 2.8. These field observations are typical of five other sites nearby and suggest that all bed material grain-size fractions supplied from upstream can be transported through the impoundment, up the sloping ramp, and over the top of the dam. Sediment transport computations suggest that all grain sizes are in transport upstream and within the impoundment at all discharges with return periods from 1 to 50 years. Our computations suggest that transport of coarse bed material through the impoundment is facilitated by its smooth, sandy bed. Model results suggest that the impoundment is currently aggrading at 0.26 m/year, but bed elevations may be recovering after recent scour from a series of large floods during water year 2011-2012. We propose that impoundments upstream of these run-of-river dams behave as long pools that adjust their bed elevation and texture to transport the load supplied by the watershed, rather than as impounded reservoirs with little bed material transport capacity. Scour may only occur during episodic high flows, followed by aggradation during periods of low flow.

Polychlorinated biphenyls in adult black bass and yellow perch were not associated with their reproductive success in the upper Hudson River, New York, USA.

PubMed

Maceina, Michael J; Sammons, Steven M

2013-07-01

Although production and use of polychlorinated biphenyls (PCBs) ceased nearly 35 yr ago, questions still remain concerning the potential chronic effects these compounds may have on wild fish, including their reproductive success. In the upper Hudson River, New York, USA, fish were exposed to PCBs primarily from 2 manufacturing plants located approximately 320 km upstream of New York City, New York, from the 1940s to 1977. The authors collected yellow perch (Perca flavescens), smallmouth bass (Micropterus dolomieu), and largemouth bass (M. salmoides) using electrofishing, measured PCBs in these adults, and estimated abundance and size of their offspring at age 1 yr (age-1 fish). Fish were collected annually from 2004 to 2009 from 1 control site upstream of the PCB discharge sites and from 2 sites downstream from where PCBs were released. These sites (pools) are separated by a series of dams, locks, and canals. Muscle tissue wet weight PCB and lipid-based PCB concentrations in adults in the 2 PCB exposure pools averaged approximately 1 to 3 µg/g and 100 to 500 µg/g, respectively. Age-1 abundances were not related to adult PCB concentrations but were inversely related to river flow. Size of age-1 fish was slightly greater at the PCB-exposure sites. Levels of PCBs in yellow perch, largemouth bass, and smallmouth bass in the upper Hudson River did not impair or reduce recruitment or reproductive success. Copyright © 2013 SETAC.

Stress and recovery of aquatic organisms as related to highway construction along Turtle Creek, Boone County, West Virginia

USGS Publications Warehouse

Chisholm, James L.; Downs, Sanford C.

1978-01-01

During and after construction of Appalachian Corridor G, a divided, four-lane highway, five benthic invertebrate samples were collected at each of four sites on Turtle Creek, and, for comparative purposes, three samples were collected at each of two sites on Lick Creek, an adjacent undisturbed stream. Diversity index, generic count, and total count initially indicated severe depletion or destruction of the benthos of Turtle Creek, but, within 1 year after highway construction was completed, the benthic community of Turtle Creek was similar to that of Lick Creek. The greatest degradation occurred near the headwaters of Turtle Creek because of erratic movement of sediment resulting from high streamflow velocity. Diversity indices ranged from 0 to 3.41 near the headwaters in the original channel, but only from 0.94 to 2.42 farther downstream in a freshly cut channel. The final samples from Turtle Creek, which were similar to those taken from Lick Creek at the same time, had generic counts of 10 at the most upstream site and 16 near the mouth. A total of 147 organisms was found near the headwaters, whereas a total of 668 was found near the mouth of the stream. The total number of organisms collected at each site was proportional to the drainage area upstream from the site. As a result of tributary inflow from unaltered drainage areas and organism drift, rapid repopulation and stabilization of the benthic community occurred. Channel relocation, bank recontouring, and reseeding also accelerated the recovery of the benthic community.

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

Upstream Passage, Spawning, and Stock Identification of Fall Chinook in the Snake River, 1992 and 1993 : Final Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, H. Lee; Mendel, Glen W.

This final report of the 3-year study summarizes activities and results for 1993. Study objectives were to: (1) determine the source of losses (or accounting errors) for adult chinook salmon between Ice Harbor Dam (IHR) and Lower Granite Dam (LGR), and upstream of LGR in the Snake River; (2) identify spawning locations upstream of LGR for calibration of aerial redd surveys, redd habitat mapping, carcass recovery for genetic stock profile analysis, and correction of estimated adult/redd ratios; and (3) estimate passage and migration times at Snake River. 200 fall chinook salmon were radio tagged and tracked with aerial, fixed-site, andmore » ground mobile tracking. Fish were released upstream of IHR at Charbonneau Park (CHAR). 190 of the fish were tracked or relocated away from CHAR. 59 fish descended to below IHR without crossing Lower Monumental Dam (LMO). Another 128 salmon passed upstream of LMO without falling back at IHR. Only 80 salmon passed Little Goose Dam (LGO) without falling back at a downstream dam; 66 of these fish passed LGR. Many fish that fell back reascended the dams. A total of 72 salmon released at CHAR passed upstream of LGR, including fish that had fallen back and reascended a dam. Over 80 percent of the salmon that entered Lyons Ferry Hatchery each year had reached LGO before descending to the hatchery. Extensive wandering was documented between LMO and upstream of LGR before salmon entered Lyons Ferry Hatchery or the Tucannon River. In 1993, 41 salmon were found to be of hatchery origin when recovered. These fish entered Lyons Ferry Hatchery with similar movements to unmarked salmon. Each year a few salmon have remained near the hatchery without entering, which suggests the hatchery may have inadequate attraction flows. Fall chinook passed lower Snake River dams in 2-5 days each on average. Median travel times through LMO and LGO were 1.0-1.3 days each, which was slower than for spring chinook or steelhead in 1993. 5 refs., 21 figs., 20 tabs.« less

Toxicity assessment of sediments collected upstream and downstream from the White Dam in Clarke County, Georgia

USGS Publications Warehouse

Lasier, Peter J.

2018-06-06

The White Dam in Clarke County, Georgia, has been proposed for breaching. Efforts to determine potential risks to downstream biota included assessments of sediment collected in the vicinity of the dam. Sediments collected from sites upstream and downstream from the dam were evaluated for toxicity in 42-day exposures using the freshwater amphipod Hyalella azteca. Endpoints of the study were survival, growth, and reproduction of H. azteca. Results indicated no significant differences between the collected sediments and the water-only treatment used for comparison of the test endpoints. Therefore, based on the laboratory experiments in this study, sediment migration downstream from a breach of the Dam may not pose a toxicity risk to downstream biota.

Recruiting Human Microbiome Shotgun Data to Site-Specific Reference Genomes

PubMed Central

Xie, Gary; Lo, Chien-Chi; Scholz, Matthew; Chain, Patrick S. G.

2014-01-01

The human body consists of innumerable multifaceted environments that predispose colonization by a number of distinct microbial communities, which play fundamental roles in human health and disease. In addition to community surveys and shotgun metagenomes that seek to explore the composition and diversity of these microbiomes, there are significant efforts to sequence reference microbial genomes from many body sites of healthy adults. To illustrate the utility of reference genomes when studying more complex metagenomes, we present a reference-based analysis of sequence reads generated from 55 shotgun metagenomes, selected from 5 major body sites, including 16 sub-sites. Interestingly, between 13% and 92% (62.3% average) of these shotgun reads were aligned to a then-complete list of 2780 reference genomes, including 1583 references for the human microbiome. However, no reference genome was universally found in all body sites. For any given metagenome, the body site-specific reference genomes, derived from the same body site as the sample, accounted for an average of 58.8% of the mapped reads. While different body sites did differ in abundant genera, proximal or symmetrical body sites were found to be most similar to one another. The extent of variation observed, both between individuals sampled within the same microenvironment, or at the same site within the same individual over time, calls into question comparative studies across individuals even if sampled at the same body site. This study illustrates the high utility of reference genomes and the need for further site-specific reference microbial genome sequencing, even within the already well-sampled human microbiome. PMID:24454771

Fecal-indicator bacteria in the Allegheny, Monongahela, and Ohio Rivers and selected tributaries, Allegheny County, Pennsylvania, 2001-2005

USGS Publications Warehouse

Buckwalter, Theodore F.; Zimmerman, Tammy M.; Fulton, John W.

2006-01-01

Concentrations of fecal-indicator bacteria were determined in 1,027 water-quality samples collected from July 2001 through August 2005 during dry- (72-hour dry antecedent period) and wet-weather (48-hour dry antecedent period and at least 0.3 inch of rain in a 24-hour period) conditions in the Allegheny, Monongahela, and Ohio Rivers (locally referred to as the Three Rivers) and selected tributaries in Allegheny County. Samples were collected at five sampling sites on the Three Rivers and at eight sites on four tributaries to the Three Rivers having combined sewer overflows. Water samples were analyzed for three fecal-indicator organisms fecal coliform, Escherichia coli (E. coli), and enterococci bacteria. Left-bank and right-bank surface-water samples were collected in addition to a cross-section composite sample at each site. Concentrations of fecal coliform, E. coli, and enterococci were detected in 98.6, 98.5, and 87.7 percent of all samples, respectively. The maximum fecal-indicator bacteria concentrations were collected from Sawmill Run, a tributary to the Ohio River; Sawmill Run at Duquesne Heights had concentrations of fecal coliform, E. coli, and enterococci of 410,000, 510,000, and 180,000 col/100 mL, respectively, following a large storm. The samples collected in the Three Rivers and selected tributaries frequently exceeded established recreational standards and criteria for bacteria. Concentrations of fecal coliform exceeded the Pennsylvania water-quality standard (200 col/100 mL) in approximately 63 percent of the samples. Sample concentrations of E. coli and enterococci exceeded the U.S. Environmental Protection Agency (USEPA) water-quality criteria (235 and 61 col/100 mL, respectively) in about 53 and 47 percent, respectively, of the samples. Fecal-indicator bacteria were most strongly correlated with streamflow, specific conductance, and turbidity. These correlations most frequently were observed in samples collected from tributary sites. Fecal-indicator bacteria concentrations and turbidity were correlated to the location of sample collection in the cross section. Most differences were between bank and composite samples; differences between right-bank and left-bank samples were rarely observed. The Allegheny River sites had more significant correlations than the Monongahela or Ohio River sites. Comparisons were made between fecal-indicator bacteria in composite samples collected during dry-weather, wet-weather day-one, wet-weather day-two (tributary sites only), and wet-weather day-three (Three Rivers sites only) events in the Three Rivers and selected tributary sites. The lowest median bacteria concentrations generally were observed in the dry-weather composite samples. All median bacteria concentrations in dry-weather composite samples in the five Three Rivers sites were below water-quality standards and criteria; bacteria concentrations in the upstream tributary sites rarely met all standards or criteria. Only Turtle Creek, Thompson Run, and Chartiers Creek had at least one median bacteria concentration below water-quality standards or criteria. Median bacteria concentrations in the composite samples generally were higher the day after a wet-weather event compared to dry-weather composite samples and other wet-weather composite samples collected. In the five Three Rivers sites, median bacteria concentrations 3 days after a wet-weather event in composite samples tended to fall below the water-quality standards and criteria; in the eight tributary sites, median bacteria concentrations in the dry-weather and wet-weather composite samples generally were above the water-quality standards or criteria. Composite samples collected at the upstream sites on the Three Rivers and selected tributaries generally had lower median bacteria concentrations than composite samples collected at the downstream sites during dry- and wet-weather events. Higher concentrations downstream may be because o

Trace element, semivolatile organic, and chlorinated organic compound concentrations in bed sediments of selected streams at Fort Gordon, Georgia, February-April 2010

USGS Publications Warehouse

Thomas, Lashun K.; Journey, Celeste A.; Stringfield, Whitney J.; Clark, Jimmy M.; Bradley, Paul M.; Wellborn, John B.; Ratliff, Hagan; Abrahamsen, Thomas A.

2011-01-01

A spatial survey of streams was conducted from February to April 2010 to assess the concentrations of major ions, selected trace elements, semivolatile organic compounds, organochlorine pesticides, and polychlorinated biphenyls associated with the bed sediments of surface waters at Fort Gordon military installation near Augusta, Georgia. This investigation expanded a previous study conducted in May 1998 by the U.S. Geological Survey, in cooperation with the U.S. Department of the Army Environmental and Natural Resources Management Office of the U.S. Army Signal Center and Fort Gordon, that evaluated the streambed sediment quality of selected surface waters at Fort Gordon. The data presented in this report are intended to help evaluate bed sediment quality in relation to guidelines for the protection of aquatic life, and identify temporal trends in trace elements and semivolatile organic compound concentrations at streambed sites previously sampled. Concentrations of 34 major ions and trace elements and 102 semivolatile organic, organochlorine pesticide, and polychlorinated biphenyl compounds were determined in the fine-grained fraction of bed sediment samples collected from 13 of the original 29 sites in the previous study, and 22 additional sites at Fort Gordon. Three of the sites were considered reference sites as they were presumed to be located away from potential sources of contaminants and were selected to represent surface waters flowing onto the fort, and the remaining 32 nonreference sites were presumed to be located within the contamination area at the fort. Temporal trends in trace elements and semivolatile organic compound concentrations also were evaluated at 13 of the 32 nonreference sites to provide an assessment of the variability in the number of detections and concentrations of constituents in bed sediment associated with potential sources, accumulation, and attenuation processes. Major ion and trace element concentrations in fine-grained bed sediment samples from most nonreference sites exceeded concentrations in samples from reference sites at Fort Gordon. Bed sediments from one of the nonreference sites sampled contained the highest concentrations of copper and lead with elevated levels of zinc and chromium relative to reference sites. The percentage change of major ions, trace elements, and total organic carbon that had been detected at sites previously sampled in May 1998 and current bed sediment sites ranged from -4 to 8 percent with an average percentage change of less than 1 percent. Concentrations of major ions and trace elements in bed sediments exceeded probable effect levels for aquatic life (based on the amphipod Hyalella azteca) established by the U.S. Environmental Protection Agency at 46 and 69 percent of the current and previously sampled locations, respectively. The greatest frequency of exceedances for major ions and trace elements in bed sediments was observed for lead. Concentrations of semivolatile organic compounds, organochlorine pesticides, and polychlorinated biphenyls were detected in bed sediment samples at 94 percent of the sites currently sampled. Detections of these organic compounds were reported with greater frequency in bed sediments at upstream sampling locations, when compared to downstream locations. The greatest number of detections of these compounds was reported for bed sediment samples collected from two creeks above a lake. The percentage change of semivolatile organic compounds detected at previously sampled and current bed sediment sites ranged from -68 to 100 percent with the greatest percentage increase reported for one of the creeks above the lake. Concentrations of semivolatile organic compounds and polychlorinated biphenyls in bed sediments exceeded aquatic life criteria established by the U.S. Environmental Protection Agency at three sites. Contaminant compounds exceeding aquatic life criteria included fluoranthene, phenanthrene, anthracene, benzo(a)anthracene

Modeling Air Temperature/Water Temperature Relations Along a Small Mountain Stream Under Increasing Urban Influence

NASA Astrophysics Data System (ADS)

Fedders, E. R.; Anderson, W. P., Jr.; Hengst, A. M.; Gu, C.

2017-12-01

Boone Creek is a headwater stream of low to moderate gradient located in Boone, North Carolina, USA. Total impervious surface coverage in the 5.2 km2 catchment drained by the 1.9 km study reach increases from 13.4% in the upstream half of the reach to 24.3% in the downstream half. Other markers of urbanization, including culverting, lack of riparian shade vegetation, and bank armoring also increase downstream. Previous studies have shown the stream to be prone to temperature surges on short timescales (minutes to hours) caused by summer runoff from the urban hardscaping. This study investigates the effects of urbanization on the stream's thermal regime at daily to yearly timescales. To do this, we developed an analytical model of daily average stream temperatures based on daily average air temperatures. We utilized a two-part model comprising annual and biannual components and a daily component consisting of a 3rd-order Markov process in order to fit the thermal dynamics of our small, gaining stream. Optimizing this model at each of our study sites in each studied year (78 total site-years of data) yielded annual thermal exchange coefficients (K) for each site. These K values quantify the strength of the relationship between stream and air temperature, or inverse thermal stability. In a uniform, pristine catchment environment, K values are expected to decrease downstream as the stream gains discharge volume and, therefore, thermal inertia. Interannual average K values for our study reach, however, show an overall increase from 0.112 furthest upstream to 0.149 furthest downstream, despite a near doubling of stream discharge between these monitoring points. K values increase only slightly in the upstream, less urban, half of the reach. A line of best fit through these points on a plot of reach distance versus K value has a slope of 2E-6. But the K values of downstream, more urbanized sites increase at a rate of 2E-5 per meter of reach distance, an order of magnitude greater. This indicates a possible tipping point in the stream temperature-water temperature relationship at which increased urbanization overpowers increasing stream thermal inertia.

Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

PubMed Central

Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

1994-01-01

Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

Microbial Community Response to Carbon Substrate Amendment in Mercury Impacted Sediments: Implications on Microbial Methylation of Mercury.

NASA Astrophysics Data System (ADS)

Elias, D. A.; Somenahally, A. C.; Moberly, J. G.; Hurt, R. A., Jr.; Brown, S. D.; Podar, M.; Palumbo, A. V.; Gilmour, C. C.

2015-12-01

Methylmercury (MeHg) is a neurotoxic and bio-accumulative product of the microbial methylation of inorganic mercury (Hg(II)). Methylating organisms are now known to exist in almost all anaerobic niches including fermentation, Fe(III)- and sulfate- reduction as well as methanogenesis. The study objective was to determine the effect of different carbon sources on the microbial community and methylating populations in particular along a Hg contaminated creek. Sediment cores from upstream and downstream at the Hg contaminated East Fork Poplar Creek (EFPC), Oak Ridge TN, and a background site were sectioned by depth, and Hg-methylation potential (HgMP) assays were performed using stable isotope spikes. Sediments from the lowest depth possessed the highest in-situ activity. Replicate samples were amended with different carbon substrates (cellulose, acetate, propionate, lactate, ethanol and methanol), spiked with stable isotopes for HgMP assays and incubated for 24hrs. Sequencing of the 16S rRNA gene was performed to determine alterations in Bacterial and Archaeal population dynamics. Additionally, bioinformatics and our new qualitative and quantitative hgcAB primers were utilized to determine microbial community structure alterations and correlate organism and gene abundance with altered MeHg generation. HgMP was significantly reduced in cellulose amended sediments while acetate and propionate slightly decreased HgMP in both sites. Methanol, ethanol and lactate increased the HgMP in EFPC downstream while cellulose amendment significantly decreased the Proteobacteria, and the Firmicutes increased but none are currently known to produce MeHg. Geobacter bemidjiensis in particular significantly decreased in cellulose amended sediments in all three sites from being predominant in-situ. This suggests that in EFPC downstream and background sites, the prevalent Hg-methyaltors might be Deltaprotebacteria, since upstream, cellulose amendment did not reduce HgMP even though relative composition of Deltaproteobacteria decreased significantly. Hence the phylogenetic distribution of Hg-methylating bacteria upstream may be much broader. Most Archaea belonged to either Euryarchaeota or Crenarchaeota, but there were no consistent trends with specific groups among the treatments.

Water-quality data for the Ohio River from New Cumberland Dam to Pike Island Dam, West Virginia and Ohio, May-October 1993

USGS Publications Warehouse

Miller, K.F.; Messinger, Terence; Waldron, M.C.; Faulkenburg, C.W.

1996-01-01

This report contains water-quality data for the Ohio River from river mile 51.1 (3.3 miles upstream from New Cumberland Dam) to river mile 84.0 (0.2 miles upstream from Pike Island Dam) that were collected during the summer and fall of 1993. The data were collected to establish the water quality of the Ohio River and to use in assessing the proposed effects of hydropower development on the water quality of the Ohio River. Water quality was determined by a combination of repeated synoptic field measurements, continuous-record monitoring, and laboratory analyses. Synoptic measurements were made along a longitudinal transect with 18 mid-channel sampling sites; cross-sectional transects of water-quality measurements were made at 5 of these sites. Water-quality measurements also were made at two sites located on the back-channel (Ohio) side of Browns Island. At each longitudinal-transect and back-channel sampling site, measurements were made of specific conductance, pH, water temperature, and dissolved oxygen conentration. Longitudinal-transect and back-channel stations were sampled at four depths (at the surface, about 3.3 feet below the surface, middle of the water column, and near the bottom of the river). Cross-sectional transects consisted of three to four detailed vertical profiles of the same characteristics. Water samples were collected from three depths at the mid-channel vertical profile in each cross-sectional transect and were analyzed for concentrations of phytoplankton photosynthetic pigments chlorophyll a and chlorophyll b. Estimates of the depth of light penetration (Secchi-disk transparency) were made at pigment-sampling locations whenever light and river-surface conditions were appropriate. Synoptic sampling usually was completed in 12 hours or less and was repeated 10 times from May through October 1993. Continuous-record monitoring of water quality consisted of hourly measurements of specific conductance, pH, water temperature, and dissolved oxygen concentration, made at a depth of 6.6 feet upstream and downstream of New Cumberland Dam. Continuous monitors were operated from May through October 1993.

Water-quality data for the Ohio River from Willow Island Dam to Belleville Dam, West Virginia and Ohio, May-October 1993

USGS Publications Warehouse

Miller, K.F.

1996-01-01

This report contains water-quality data for the Ohio River from river mile 160.6 (1.1 mile upstream from Willow Island Dam) to river mile 203.6 (0.3 mile upstream from Belleville Dam) that were collected during the summer and fall of 1993. The data were collected to establish the water quality of the Ohio River and to use in assessing the proposed effects of hydropower development on the water quality of the Ohio River. Water quality was monitored by a combination of synoptic field measurements, laboratory analyses, and continuous- record monitoring. Field measurements of water- quality characteristics were made along a longitudinal transect with 24 mid-channel sampling sites; cross-sectional transects of water-quality measurements were made at six of these sites. Water-quality measurements also were made at six sites located on the back-channel (West Virginia) sides of Marietta, Muskingum, and Blennerhassett Islands. At each longitudinal-transect and back- channel sampling site, measurements of specific conductance, pH, water temperature, and dissolved oxygen concentration were made at three depths (about 3.3 feet below the surface of the water, middle of the water column, and near the bottom of the river). Cross-sectional transects consisted of three to four detailed vertical profiles of the same characteristics. Water samples were collected at three depths in the mid-channel vertical profile in each cross-sectional transect and were analyzed for concentrations of phytoplankton chlorophyll a and chlorophyll b. Estimates of the depth of light penetration (Secchi disk transparency) were made at phytoplankton- pigment-sampling locations whenever light and river-surface conditions were appropriate. Each synoptic sampling event was completed in 2 days or less. The entire network was sampled 10 times from May 24 to October 27, 1993. Continuous-record monitoring of water quality consisted of hourly measurments of specific conductance, pH, water temperature, and dissolved oxygen concentration that were made at a depth of 6.6 feet at the ends of the upstream and downstream wingwalls at Willow Island Dam. Continuous-record monitors were operated from May through October 1993.

ARSENIC TRANSPORT ACROSS THE GROUNDWATER – SURFACE WATER INTERFACE AT A SITE IN CENTRAL MASSACHUSETTS

EPA Science Inventory

Plow Shop Pond, located in central Massachusetts within the New England ‘arsenic belt,’ receives water from a series of interconnected upstream ponds as well as from upward-discharging groundwater. A small, shallow embayment on the southwest side of the pond is known as Red Cove...

EVALUATION OF MICROSOMAL AND CYTOSOLIC BIOMARKERS IN A SEVEN-DAY LARVAL TROUT SEIMENT TOXICITY TEST

EPA Science Inventory

Rainbow trout (Oncorhynclus mykiss) sac fry (larvae) were exposed to River Po sediments for 7 days. The sediments were collected in the River Po at two sites located upstream and downstream of the confluence of a polluted tributary, the River Lambro. An additional sediment treatm...

Identification of regulatory targets for the bacterial Nus factor complex.

PubMed

Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

2017-12-11

Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

Spread of hybridization between native westslope cutthroat trout, Oncorhynchus clarki lewisi, and nonnative rainbow trout, Oncorhynchus mykiss

USGS Publications Warehouse

Hitt, Nathaniel P.; Frissell, Christopher A.; Muhlfeld, Clint C.; Fred W. Allendorf,

2003-01-01

We examined spatial and temporal patterns of hybridization between native westslope cutthroat trout, Oncorhynchus clarki lewisi, and nonnative rainbow trout, O. mykiss, in streams of the Flathead River system in Montana, U.S.A. We detected hybridization in 24 of 42 sites sampled from 1998 to 2001. We found new Oncorhynchus mykiss introgression in seven of 11 sample populations that were determined to be nonhybridized in 1984. Patterns of spatial autocorrelation and linkage disequilibrium indicated that hybridization is spreading among sites and is advancing primarily via post-F1 hybrids. Although hybridized populations were distributed widely throughout the study area, the genetic contribution from O. mykiss decreased with increasing upstream distance from the Flathead River mainstem, suggesting that O. mykiss introgression is spreading in an upstream direction. The spread of hybridization may be constrained more by demographic than by environmental factors, given that (i) hybridized populations generally encompassed the range of environmental variability in nonhybridized populations, and (ii) hybridization status was more strongly associated with neighborhood statistics than measured environmental gradients.

Video evaluation of passage efficiency of American shad and sea lamprey in a modified Ice Harbor fishway

USGS Publications Warehouse

Haro, A.; Kynard, B.

1997-01-01

Movement and behavior of adult American shad Alosa sapidissima and sea lamprey Petromyzon marinus were monitored by closed-circuit video at several locations within a modified Ice Harbor fishway. American shad ascended and descended the fishway exclusively by surface weirs, while sea lampreys used both surface weirs and submerged orifices. Upstream movement of American shad during the day was higher than at night at both lower and middle fishway observation sites. Peak downstream movement of American shad at both locations was associated with decreasing light levels in the evening. Sea lampreys moved primarily at night at the lower and middle fishway sites. Mean daily passage efficiency was low (1% for American shad, -2% for sea lamprey) at the lower fishway surface weir, but passage efficiency at the middle fishway surface weir was moderate (70% for American shad, 35% for sea lamprey). High water velocity, air entrainment, and turbulence of the modified Ice Harbor fishway design appeared to inhibit American shad and sea lamprey passage by disrupting upstream migratory motivation and visual and rheotactic orientation.

Legacy effects of colonial millponds on floodplain sedimentation, bank erosion, and channel morphology, MID-Atlantic, USA

USGS Publications Warehouse

Schenk, E.R.; Hupp, C.R.

2009-01-01

Many rivers and streams of the Mid-Atlantic Region, United States (U.S.) have been altered by postcolonial floodplain sedimentation (legacy sediment) associated with numerous milldams. Little Conestoga Creek, Pennsylvania, a tributary to the Susquehanna River and the Chesapeake Bay, is one of these streams. Floodplain sedimentation rates, bank erosion rates, and channel morphology were measured annually during 2004-2007 at five sites along a 28-km length of Little Conestoga Creek with nine colonial era milldams (one dam was still in place in 2007). This study was part of a larger cooperative effort to quantify floodplain sedimentation, bank erosion, and channel morphology in a high sediment yielding region of the Chesapeake Bay watershed. Data from the five sites were used to estimate the annual volume and mass of sediment stored on the floodplain and eroded from the banks for 14 segments along the 28-km length of creek. A bank and floodplain reach based sediment budget (sediment budget) was constructed for the 28 km by summing the net volume of sediment deposited and eroded from each segment. Mean floodplain sedimentation rates for Little Conestoga Creek were variable, with erosion at one upstream site (-5 mm/year) to deposition at the other four sites (highest = 11 mm/year) despite over a meter of floodplain aggradation from postcolonial sedimentation. Mean bank erosion rates range between 29 and 163 mm/year among the five sites. Bank height increased 1 m for every 10.6 m of channel width, from upstream to downstream (R2 = 0.79, p < 0.0001) resulting in progressively lowered hydraulic connectivity between the channel and the floodplain. Floodplain sedimentation and bank erosion rates also appear to be affected by the proximity of the segments to one existing milldam, which promotes deposition upstream and scouring downstream. The floodplain and bank along the 28-km reach produced a net mean sediment loss of 5,634 Mg/year for 2004-2007, indicating that bank erosion was exceeding floodplain sedimentation. In particular, the three segments between the existing dam and the confluence with the Conestoga River (32% of the studied reach) account for 97% of the measured net sediment budget. Future research directed at understanding channel equilibria should facilitate efforts to reduce the sediment impacts of dam removal and legacy sediment. ?? 2009 American Water Resources Association.

Moving further upstream: from toxics reduction to the precautionary principle.

PubMed

Mayer, Brian; Brown, Phil; Linder, Meadow

2002-01-01

Early policies to reduce the amount of toxic waste in the environment focused on cleaning up downstream sources of pollution, such as toxic disposal sites. Public attention in the 1980s encouraged both industry and government to develop an alternative to this command-and-control approach. This article describes the emergence of that alternative-pollution prevention-and its application in Massachusetts through the 1989 Toxics Use Reduction Act. Pollution prevention focuses on the sources of pollution, both metaphorically and physically, more upstream than its predecessors. The success of the Toxics Use Reduction Act in Massachusetts helped create an opportunity where an alternative pollution prevention paradigm could develop. That paradigm, the precautionary principle, is popular among environment activists because it focuses further upstream than pollution prevention by calling attention to the role the social construction of risk plays in decisions regarding the use of hazardous substances. The authors examine the evolution of the precautionary principle through an investigation of three major pathways in its development and expansion. The article concludes with a discussion of the increased potential for protecting public health and the environment afforded by this new perspective.

Road crossing designs and their impact on fish assemblages of Great Plains streams

USGS Publications Warehouse

Bouska, Wesley W.; Paukert, Craig P.

2010-01-01

A mark-recapture field study was conducted to determine fish passage at 5 concrete box culverts and 5 low-water crossings (concrete slabs vented by culverts) as well as 10 control sites (below a natural riffle) in Flint Hills streams of northeastern Kansas. Additionally, we tested the upstream passage of four fish species native to Great Plains streams (Topeka shiner Notropis topeka, green sunfish Lepomis cyanellus, red shiner Cyprinella lutrensis, and southern redbelly dace Phoxinus erythrogaster) through three simulated crossing designs (box culverts, round corrugated culverts, and natural rock riffles) at water velocities of 0.1 to 1.1 m/s in an experimental stream. The field study indicated that cyprinids were twice as likely to move upstream of box culverts than low-water crossings and 1.4 times as likely to move upstream of control reaches than any crossing type. The best models indicated that the proportion of cyprinids that moved upstream increased with decreased culvert slope and length, perching, and increased culvert width. Our controlled experiment indicated that fish can move through velocities up to 1.1 m/s in a 1.86-m simulated stream and that the proportion of fish that moved upstream did not differ among crossing designs for southern redbelly dace, green sunfish, or Topeka shiner; however, natural rock riffles had lower proportional movements (mean = 0.19) than the box (0.38) or corrugated culvert designs (0.43) for red shiners. Water velocity did not affect the proportional upstream movement of any species except that of Topeka shiners, which increased with water velocity. Crossing design alone may not determine fish passage, and water velocities up to 1.1 m/s may not affect the passage of many Great Plains fishes. Barriers to fish movement may be the result of other factors (e.g., perching, slope, and crossing length). The use of properly designed and installed crossings has promise in conserving Great Plains stream fishes.

How to Be a Male at Different Elevations: Ecology of Intra-Sexual Segregation in the Trawling Bat Myotis daubentonii

PubMed Central

Nardone, Valentina; Cistrone, Luca; Di Salvo, Ivy; Ariano, Alessandro; Migliozzi, Antonello; Allegrini, Claudia; Ancillotto, Leonardo; Fulco, Antonio; Russo, Danilo

2015-01-01

Intra-sexual segregation is a form of social segregation widespread among vertebrates. In the bat Myotis daubentonii, males are disproportionately abundant at higher elevations, while females are restricted to lower altitude. Intra-male segregation is also known to occur yet its ecological and behavioural determinants are unclear. We studied male segregation along a river in Central Italy where we tested the following predictions: 1. Upstream ( > 1000 m a.s.l.) males will rely on scarcer prey; 2. To deal with this limitation and exploit a cooler roosting environment, they will employ more prolonged and deeper torpor than downstream (< 900 m a.s.l.) males; 3. Body condition will be better in downstream males as they forage in more productive areas; 4. To cope with less predictable foraging opportunities, upstream males will use more habitat types. Consistent with our predictions, we found that prey were less common at higher altitudes, where bats exhibited prolonged and deeper torpor. Body condition was better in downstream males than in upstream males but not in all summer months. This result reflected a decrease in downstream males’ body condition over the season, perhaps due to the energy costs of reduced opportunities to use torpor and/or intraspecific competition. Downstream males mainly foraged over selected riparian vegetation whereas upstream males used a greater variety of habitats. One controversial issue is whether upstream males are excluded from lower elevations by resident bats. We tested this by translocating 10 upstream males to a downstream roost: eight returned to the high elevation site in 1-2 nights, two persisted at low altitude but did not roost with resident bats. These results are consistent with the idea of segregation due to competition. Living at high altitude allows for more effective heterothermy and may thus be not detrimental for survival, but by staying at lower altitude males increase proximity to females and potentially benefit from summer mating opportunities. PMID:26230548

Functional Architecture of T7 RNA Polymerase Transcription Complexes

PubMed Central

Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

2007-01-01

Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

Upstream mononucleotide A-repeats play a cis-regulatory role in mammals through the DICER1 and Ago proteins.

PubMed

Aporntewan, Chatchawit; Pin-on, Piyapat; Chaiyaratana, Nachol; Pongpanich, Monnat; Boonyaratanakornkit, Viroj; Mutirangura, Apiwat

2013-10-01

A-repeats are the simplest form of tandem repeats and are found ubiquitously throughout genomes. These mononucleotide repeats have been widely believed to be non-functional 'junk' DNA. However, studies in yeasts suggest that A-repeats play crucial biological functions, and their role in humans remains largely unknown. Here, we showed a non-random pattern of distribution of sense A- and T-repeats within 20 kb around transcription start sites (TSSs) in the human genome. Different distributions of these repeats are observed upstream and downstream of TSSs. Sense A-repeats are enriched upstream, whereas sense T-repeats are enriched downstream of TSSs. This enrichment directly correlates with repeat size. Genes with different functions contain different lengths of repeats. In humans, tissue-specific genes are enriched for short repeats of <10 bp, whereas housekeeping genes are enriched for long repeats of ≥10 bp. We demonstrated that DICER1 and Argonaute proteins are required for the cis-regulatory role of A-repeats. Moreover, in the presence of a synthetic polymer that mimics an A-repeat, protein binding to A-repeats was blocked, resulting in a dramatic change in the expression of genes containing upstream A-repeats. Our findings suggest a length-dependent cis-regulatory function of A-repeats and that Argonaute proteins serve as trans-acting factors, binding to A-repeats.

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.

PubMed

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong

2012-09-01

The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.

Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

PubMed Central

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

2004-01-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

PubMed

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

2004-05-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

Streambed stresses and flow around bridge piers

USGS Publications Warehouse

Parola, A.C.; Ruhl, K.J.; Hagerty, D.J.; Brown, B.M.; Ford, D.L.; Korves, A.A.

1996-01-01

Scour of streambed material around bridge foundations by floodwaters is the leading cause of catastrophic bridge failure in the United States. The potential for scour and the stability of riprap used to protect the streambed from scour during extreme flood events must be known to evaluate the likelihood of bridge failure. A parameter used in estimating the potential for scour and removal of riprap protection is the time-averaged shear stress on the streambed often referred to as boundary stress. Bridge components, such as bridge piers and abutments, obstruct flow and induce strong vortex systems that create streambed or boundary stresses significantly higher than those in unobstructed flow. These locally high stresses can erode the streambed around pier and abutment foundations to the extent that the foundation is undermined, resulting in settlement or collapse of bridge spans. The purpose of this study was to estimate streambed stresses at a bridge pier under full-scale flow conditions and to compare these stresses with those obtained previously in small-scale model studies. Two-dimensional velocity data were collected for three flow conditions around a bridge pier at the Kentucky State Highway 417 bridge over the Green River at Greensburg in Green County, Ky. Velocity vector plots and the horizontal component of streambed stress contour plots were developed from the velocity data. The streambed stress contours were developed using both a near-bed velocity and velocity gradient method. Maximum near-bed velocities measured at the pier for the three flow conditions were 1.5, 1.6, and 2.0 times the average near-bed velocities measured in the upstream approach flow. Maximum streambed stresses for the three flow conditions were determined to be 10, 15, and 36 times the streambed stresses of the upstream approach flow. Both the near-bed velocity measurements and approximate maximum streambed stresses at the full-scale pier were consistent with those observed in experiments using small-scale models in which similar data were collected, except for a single observation of the near-bed velocity data and the corresponding streambed stress determination. The location of the maximum streambed stress was immediately downstream of a 90 degree radial of the upstream cylinder (with the center of the upstream cylinder being the origin) for the three flow conditions. This location was close to the flow wake separation point at the upstream cylinder. Other researchers have observed the maximum streambed stress around circular cylinders at this location or at a location immediately upstream of the wake separation point. Although the magnitudes of the estimated streambed stresses measured at the full-scale pier were consistent with those measured in small-scale model studies, the stress distributions were significantly different than those measured in small-scale models. The most significant discrepancies between stress contours developed in this study and those developed in the small-scale studies for flow around cylindrical piers on a flat streambed were associated with the shape of the stress contours. The extent of the high stress region of the streambed around the full-scale pier was substantially larger than the diameter of the upstream cylinder, while small-scale models had small regions compared to the diameter of the model cylinders. In addition, considerable asymmetry in the stress contours was observed. The large region of high stress and asymmetry was attributed to several factors including (1) the geometry of the full-scale pier, (2) the non-planar topography of the streambed, (3) the 20 degree skew of the pier to the approaching flow, and (4) the non-uniformity of the approach flow. The extent of effect of the pier on streambed stresses was found to be larger for the full-scale site than for model studies. The results from the model studies indicated that the streambed stresses created by the obstruction of flow by the 3-foot wide pi

Characterization of water quality and suspended sediment during cold-season flows, warm-season flows, and stormflows in the Fountain and Monument Creek watersheds, Colorado, 2007–2015

USGS Publications Warehouse

Miller, Lisa D.; Stogner, Sr., Robert W.

2017-09-01

From 2007 through 2015, the U.S. Geological Survey, in cooperation with Colorado Springs City Engineering, conducted a study in the Fountain and Monument Creek watersheds, Colorado, to characterize surface-water quality and suspended-sediment conditions for three different streamflow regimes with an emphasis on characterizing water quality during storm runoff. Data collected during this study were used to evaluate the effects of stormflows and wastewater-treatment effluent discharge on Fountain and Monument Creeks in the Colorado Springs, Colorado, area. Water-quality samples were collected at 2 sites on Upper Fountain Creek, 2 sites on Monument Creek, 3 sites on Lower Fountain Creek, and 13 tributary sites during 3 flow regimes: cold-season flow (November–April), warm-season flow (May–October), and stormflow from 2007 through 2015. During 2015, additional samples were collected and analyzed for Escherichia coli (E. coli) during dry weather conditions at 41 sites, located in E. coli impaired stream reaches, to help identify source areas and scope of the impairment.Concentrations of E. coli, total arsenic, and dissolved copper, selenium, and zinc in surface-water samples were compared to Colorado in-stream standards. Stormflow concentrations of E. coli frequently exceeded the recreational use standard of 126 colonies per 100 milliliters at main-stem and tributary sites by more than an order of magnitude. Even though median E. coli concentrations in warm-season flow samples were lower than median concentrations in storm-flow samples, the water quality standard for E. coli was still exceeded at most main-stem sites and many tributary sites during warm-season flows. Six samples (three warm-season flow and three stormflow samples) collected from Upper Fountain Creek, upstream from the confluence of Monument Creek, and two stormflow samples collected from Lower Fountain Creek, downstream from the confluence with Monument Creek, exceeded the acute water-quality standard for total arsenic of 50 micrograms per liter. All concentrations of dissolved copper, selenium, and zinc measured in samples were below the water-quality standard.Concentrations of dissolved nitrate plus nitrite generally increased from upstream to downstream during all flow periods. The largest downstream increase in dissolved nitrate plus nitrite concentration was measured between sites 07103970 and 07104905 on Monument Creek. All but one tributary that drain into Monument Creek between the two sites had higher median nitrate plus nitrite concentrations than the nearest upstream site on Monument Creek, site 07103970 (MoCr_Woodmen). Increases in the concentration of dissolved nitrate plus nitrite were also evident below wastewater treatment plants located on Fountain Creek.Most stormflow concentrations of dissolved trace elements were smaller than concentrations from cold-season flow or warm-season samples. However, median concentrations of total arsenic, lead, manganese, nickel, and zinc generally were much larger during periods of stormflow than during cold-season flow or warm-season fl. Median concentrations of total arsenic, total copper, total lead, dissolved and total manganese, total nickel, dissolved and total selenium, and dissolved and total zinc concentrations increased from 1.5 to 28.5 times from site 07103700 (FoCr_Manitou) to 07103707 (FoCr_8th) during cold-season and warm-season flows, indicating a large source of trace elements between these two sites. Both of these sites are located on Fountain Creek, upstream from the confluence with Monument Creek.Median suspended-sediment concentrations and median suspended-sediment loads increased in the downstream direction during all streamflow regimes between Monument Creek sites 07103970 (MoCr_Woodmen) and 07104905 (MoCr_Bijou); however, statistically significant increase (p-value less than 0.05) were only present during warm-season flow and stormflow. Significant increases in median suspended sediment concentrations were measured during cold-season flow and warm-season flow between Upper Fountain Creek site 07103707 (FoCr_8th) and Lower Fountain Creek site 07105500 (FoCr_Nevada) because of inflows from Monument Creek with higher suspended-sediment concentrations. Median suspended-sediment concentrations between sites 07104905 (MoCr_Bijou) and 07105500 (FoCr_Nevada) increased significantly during warm-season flow but showed no significant differences during cold-season flow and stormflow. Significant decreases in median suspended-sediment concentrations were measured between sites 07105500 (FoCr_Nevada) and 07105530 (FoCr_Janitell) during all flow regimes.Suspended-sediment concentrations, discharges, and yields associated with stormflow were significantly larger than those associated with warm-season flow. Although large spatial variations in suspended-sediment yields occurred during warm-season flows, the suspended-sediment yield associated with stormflow were as much as 1,000 times larger than the suspended-sediment yields that occurred during warm-season flow. 

Level II scour analysis for Bridge 34 (ROCHTH00210034) on Town Highway 21, crossing the White River, Rochester, Vermont

USGS Publications Warehouse

Wild, Emily C.; Degnan, James

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure ROCHTH00210034 on Town Highway 21 crossing the White River, Rochester, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, obtained from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D.The site is in the Green Mountain section of the New England physiographic province in central Vermont. The 74.8-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is suburban on the upstream and downstream left overbanks, though brush prevails along the immediate banks. On the upstream and downstream right overbanks, the surface cover is pasture with brush and trees along the immediate banks.In the study area, the White River has an incised, straight channel with a slope of approximately 0.002 ft/ft, an average channel top width of 102 ft and an average bank height of 5 ft. The channel bed material ranges from sand to cobble with a median grain size (D50) of 74.4 mm (0.244 ft). The geomorphic assessment at the time of the Level I and Level II site visit on July 23, 1996, indicated that the reach was stable.The Town Highway 21 crossing of the White River is a 72-ft-long, two-lane bridge consisting of 70-foot steel stringer span (Vermont Agency of Transportation, written communication, March 22, 1995). The opening length of the structure parallel to the bridge face is 67.0 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 15 degrees to the opening while the opening-skew-to-roadway is zero degrees.Channel scour, 1.5 ft deeper than the mean thalweg depth was observed along the left abutment and wingwalls during the Level I assessment. Scour countermeasures at the site includes type-1 stone fill (less than 12 inches diameter) along the upstream left bank and the upstream and downstream left road embankments, type-2 (less than 36 inches diameter) along the upstream end of the upstream left wingwall and downstream left bank, and type-3 (less than 48 inches diameter) along the downstream end of the downstream left wingwall. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E.Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). In addition, the incipient roadway-overtopping discharge is analyzed since it has the potential of being the worst-case scour scenario. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows.Contraction scour for all modelled discharges was zero. Left abutment scour ranged from 6.8 to 21.2 ft. Right abutment scour ranged from 13.9 to 18.4 ft. The worst-case abutment scour occurred at the 500-year discharge at the left and right abutments. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution.It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Level II scour analysis for Bridge 8 (NEWFTH00010008) on Town Highway 1, crossing Wardsboro Brook, Newfane, Vermont

USGS Publications Warehouse

Wild, Emily C.; Degnan, James

1998-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure NEWFTH00010008 on Town Highway 1 crossing Wardsboro Brook, Newfane, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (Federal Highway Administration, 1993). Results of a Level I scour investigation also are included in appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in appendix D. The site is in the New England Upland section of the New England physiographic province in southestern Vermont. The 6.91-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is forest on the upstream right overbank and downstream left and right overbanks. The surface cover on the upstream left overbank is pasture. In the study area, Wardsboro Brook has an incised, sinuous channel with a slope of approximately 0.02 ft/ft, an average channel top width of 63 ft and an average bank height of 9 ft. The channel bed material ranges from gravel to boulders with a median grain size (D50) of 95.4 mm (0.313 ft). The geomorphic assessment at the time of the Level I and Level II site visit on August 21, 1996, indicated that the reach was stable. The Town Highway 1 crossing of the Wardsboro Brook is a 32-ft-long, two-lane bridge consisting of a 26-foot concrete tee-beam span (Vermont Agency of Transportation, written communication, April 6, 1995). The opening length of the structure parallel to the bridge face is 26.7 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 45 degrees to the computed opening while the openingskew-to-roadway is 45 degrees. A scour hole 1.0 ft deeper than the mean thalweg depth was observed along the right abutment during the Level I assessment. Scour protection measures at the site included type-1 stone fill (less than 12 inches diameter) along the upstream right bank, and type-2 stone fill (less than 36 inches diameter) along the upstream left bank and the upstream ends of the upstream left and right wingwalls. A stone wall extends along the downstream right bank from the end of the downstream right wingwall. Additional details describing conditions at the site are included in the Level II Summary and appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and Davis, 1995) for the 100- and 500-year discharges. In addition, the incipient roadway-overtopping discharge was determined and analyzed as another potential worst-case scour scenario. Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows ranged from 0.1 to 3.9 ft. The worst-case contraction scour occurred at the 500-year discharge. Left abutment scour ranged from 11.1 to 12.9 ft. Right abutment scour ranged from 4.3 to 4.8 ft. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and Davis, 1995, p. 46). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Level II scour analysis for Bridge 36 (DUXBTH00040036) on Town Highway 4, crossing Crossett Brook, Duxbury, Vermont

USGS Publications Warehouse

Wild, Emily C.; Degnan, James R.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure DUXBTH00040036 on Town Highway 4 crossing the Crossett Brook, Duxbury, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D.The site is in the Green Mountain section of the New England physiographic province in north-central Vermont. The 4.9-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover on the upstream left overbank is pasture. The upstream and downstream right overbanks are forested. The downstream left overbank is brushland, while the immediate banks have dense woody vegetation.In the study area, the Crossett Brook has an incised, sinuous channel with a slope of approximately 0.006 ft/ft, an average channel top width of 55 ft and an average bank height of 9 ft. The channel bed material ranges from gravel to bedrock with a median grain size (D50) of 51.6 mm (0.169 ft). The geomorphic assessment at the time of the Level I and Level II site visit on July 1, 1996, indicated that the reach was stable.The Town Highway 4 crossing of the Crossett Brook is a 29-ft-long, two-lane bridge consisting of a 26-foot concrete slab span (Vermont Agency of Transportation, written communication, October 13, 1995). The opening length of the structure parallel to the bridge face is 26 ft. The bridge is supported by vertical, concrete abutments with wingwalls. The channel is skewed approximately 35 degrees to the opening while the computed opening-skew-to-roadway is 5 degrees.A scour hole 1.5 ft deeper than the mean thalweg depth was observed along the upstream left wingwall and the right abutment during the Level I assessment. Scour countermeasures at the site includes type-2 stone fill (less than 36 inches diameter) at the upstream end of the upstream left and right wingwalls and the upstream left and right banks and road embankments. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E.Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows.Contraction scour for all modelled flows ranged from 0.0 to 1.7 ft. The worst-case contraction scour occurred at the 500-year discharge. Left abutment scour ranged from 6.4 to 8.3 ft. Right abutment scour ranged from 6.0 to 7.0 ft. The worst-case left and right abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution.It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Level II scour analysis for Bridge 29 (HUNTTH00290029) on Town Highway 29, crossing Cobb Brook, Huntington, Vermont

USGS Publications Warehouse

Flynn, Robert H.

1997-01-01

This report provides the results of a detailed Level II analysis of scour potential at structure HUNTTH00290029 on Town Highway 29 crossing Cobb Brook, Huntington, Vermont (figures 1–8). A Level II study is a basic engineering analysis of the site, including a quantitative analysis of stream stability and scour (U.S. Department of Transportation, 1993). Results of a Level I scour investigation also are included in Appendix E of this report. A Level I investigation provides a qualitative geomorphic characterization of the study site. Information on the bridge, gleaned from Vermont Agency of Transportation (VTAOT) files, was compiled prior to conducting Level I and Level II analyses and is found in Appendix D. The site is in the Green Mountain section of the New England physiographic province in northwestern Vermont. The 4.16-mi2 drainage area is in a predominantly rural and forested basin. In the vicinity of the study site, the surface cover is forest upstream and downstream of the bridge. In the study area, Cobb Brook has an incised, straight channel with a slope of approximately 0.024 ft/ft, an average channel top width of 53 ft and an average bank height of 4 ft. The channel bed material ranges from gravel to bedrock with a median grain size (D50) of 112.0 mm (0.367 ft). The geomorphic assessment at the time of the Level I and Level II site visit on June 25, 1996, indicated that the reach was stable. The Town Highway 29 crossing of Cobb Brook is a 36-ft-long, one-lane bridge consisting of one 30-foot steel-beam span (Vermont Agency of Transportation, written communication, December 11, 1995) and a wooden deck. The opening length of the structure parallel to the bridge face is 27 ft.The bridge is supported by vertical, concrete abutments. The channel is skewed approximately 25 degrees to the opening while the opening-skew-to-roadway was measured to be 20 degrees. VTAOT records indicate an opening-skew-to-roadway of zero degrees. A scour hole 1.5 ft deeper than the mean thalweg depth was observed extending from 12 ft upstream of the upstream end of the left abutment to 10 ft under the bridge in the center of the channel during the Level I assessment. Another scour hole approximately 1.2 ft deeper than the mean thalweg depth was observed along the downstream end of the right abutment during the Level I assessment. The scour protection measures at the site included type-2 stone fill (less than 36 inches diameter) along the upstream end of the right abutment and type-3 stone fill (less than 48 inches diameter) along the upstream end of the upstream left retaining wall. Additional details describing conditions at the site are included in the Level II Summary and Appendices D and E. Scour depths and recommended rock rip-rap sizes were computed using the general guidelines described in Hydraulic Engineering Circular 18 (Richardson and others, 1995). Total scour at a highway crossing is comprised of three components: 1) long-term streambed degradation; 2) contraction scour (due to accelerated flow caused by a reduction in flow area at a bridge) and; 3) local scour (caused by accelerated flow around piers and abutments). Total scour is the sum of the three components. Equations are available to compute depths for contraction and local scour and a summary of the results of these computations follows. Contraction scour for all modelled flows was computed to be zero ft. Abutment scour ranged from 9.9 to 12.5 ft along the left abutment and from 6.2 to 8.6 ft along the right abutment. The worst-case abutment scour occurred at the 500-year discharge. Additional information on scour depths and depths to armoring are included in the section titled “Scour Results”. Scoured-streambed elevations, based on the calculated scour depths, are presented in tables 1 and 2. A cross-section of the scour computed at the bridge is presented in figure 8. Scour depths were calculated assuming an infinite depth of erosive material and a homogeneous particle-size distribution. It is generally accepted that the Froehlich equation (abutment scour) gives “excessively conservative estimates of scour depths” (Richardson and others, 1995, p. 47). Usually, computed scour depths are evaluated in combination with other information including (but not limited to) historical performance during flood events, the geomorphic stability assessment, existing scour protection measures, and the results of the hydraulic analyses. Therefore, scour depths adopted by VTAOT may differ from the computed values documented herein.

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

Suspended sediments from upstream tributaries as the source of downstream river sites

NASA Astrophysics Data System (ADS)

Haddadchi, Arman; Olley, Jon

2014-05-01

Understanding the efficiency with which sediment eroded from different sources is transported to the catchment outlet is a key knowledge gap that is critical to our ability to accurately target and prioritise management actions to reduce sediment delivery. Sediment fingerprinting has proven to be an efficient approach to determine the sources of sediment. This study examines the suspended sediment sources from Emu Creek catchment, south eastern Queensland, Australia. In addition to collect suspended sediments from different sites of the streams after the confluence of tributaries and outlet of the catchment, time integrated suspended samples from upper tributaries were used as the source of sediment, instead of using hillslope and channel bank samples. Totally, 35 time-integrated samplers were used to compute the contribution of suspended sediments from different upstream waterways to the downstream sediment sites. Three size fractions of materials including fine sand (63-210 μm), silt (10-63 μm) and fine silt and clay (<10 μm) were used to find the effect of particle size on the contribution of upper sediments as the sources of sediment after river confluences. And then samples were analysed by ICP-MS and -OES to find 41 sediment fingerprints. According to the results of Student's T-distribution mixing model, small creeks in the middle and lower part of the catchment were major source in different size fractions, especially in silt (10-63 μm) samples. Gowrie Creek as covers southern-upstream part of the catchment was a major contributor at the outlet of the catchment in finest size fraction (<10 μm) Large differences between the contributions of suspended sediments from upper tributaries in different size fractions necessitate the selection of appropriate size fraction on sediment tracing in the catchment and also major effect of particle size on the movement and deposition of sediments.

Expression of eukaryotic polypeptides in chloroplasts

DOEpatents

Mayfield, Stephen P.

2013-06-04

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

The in vivo use of alternate 3'-splice sites in group I introns.

PubMed

Sellem, C H; Belcour, L

1994-04-11

Alternative splicing of group I introns has been postulated as a possible mechanism that would ensure the translation of proteins encoded into intronic open reading frames, discontinuous with the upstream exon and lacking an initiation signal. Alternate splice sites were previously depicted according to secondary structures of several group I introns. We present here strong evidence that, in the case of Podospora anserina nad 1-i4 and cox1-i7 mitochondrial introns, alternative splicing events do occur in vivo. Indeed, by PCR experiments we have detected molecules whose sequence is precisely that expected if the predicted alternate 3'-splice sites were used.

Risk assessment of great horned owls (Bubo virginianus) exposed to polychlorinated biphenyls and DDT along the Kalamazoo River, Michigan, USA.

PubMed

Strause, Karl D; Zwiernik, Matthew J; Im, Sook Hyeon; Bradley, Patrick W; Moseley, Pamela P; Kay, Denise P; Park, Cyrus S; Jones, Paul D; Blankenship, Alan L; Newsted, John L; Giesy, John P

2007-07-01

The great horned owl (GHO; Bubo virginianus) was used in a multiple lines of evidence study of polychlorinated biphenyls (PCBs) and p,p'-dichlorodiphenyltrichloroethane (DDT) exposures at the Kalamazoo River Superfund Site (KRSS), Kalamazoo, Michigan, USA. The study examined risks from total PCBs, including 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalents (TEQWorld Health Organization [WHO]-Avian Toxicity Equivalency Factor [TEF]), and total DDTs (sum of DDT, dichlorodiphenyldichloroethylene [DDE], and dichlorodiphenyldichloroethane [DDD]; sigmaDDT) by measuring concentrations in eggs and nestling blood plasma in two regions of the KRSS (upper, lower) and an upstream reference area (RA). An ecological risk assessment compared concentrations of the contaminants of concern (COCs) in eggs or plasma to toxicity reference values. Productivity and relative abundance measures for KRSS GHOs were compared with other GHO populations. Egg shell thickness was measured to assess effects of p,p'-DDE. The concentrations of PCBs in eggs were as great as 4.7 x 10(2) and 4.0 x 10(4) ng PCB/g, wet weight at the RA and combined KRSS sites, respectively. Egg TEQ(WHO-Avian) calculated from aryl hydrocarbon receptor-active PCB congeners and WHO TEFs ranged to 8.0 and 1.9 x 10(2) pg TEQ(WHO-Avian)/g, (wet wt) at the RA and combined KRSS, respectively. Egg sigmaDDT concentrations were as great as 4.2 x 10(2) and 5.0 x 10(3) ng sigmaDDT/g (wet wt) at the RA and combined KRSS, respectively. Hazard quotients (HQs) for the upper 95% confidence interval (UCI) (geometric mean) and least observable adverse effect concentration (LOAEC) for COCs in eggs were < or = 1.0 for all sites. Hazard quotient values based on the no observable adverse effect concentration (NOAEC) 95% UCI in eggs were < or = 1.0, except at the LKRSS (PCB HQ = 3.1; TEQ(WHO-Avian) HQ = 1.3). Productivity and relative abundance measures indicated no population level effects in the UKRSS.

The risk of overestimating the risk-metal leaching to groundwater near contaminated glass waste deposits and exposure via drinking water.

PubMed

Augustsson, A; Uddh Söderberg, T; Jarsjö, J; Åström, M; Olofsson, B; Balfors, B; Destouni, G

2016-10-01

This study investigates metal contamination patterns and exposure to Sb, As, Ba, Cd and Pb via intake of drinking water in a region in southeastern Sweden where the production of artistic glass has resulted in a large number of contaminated sites. Despite high total concentrations of metals in soil and groundwater at the glassworks sites properties, all drinking water samples from households with private wells, located at a 30-640m distance from a glassworks site, were below drinking water criteria from the WHO for Sb, As, Ba and Cd. A few drinking water samples showed concentrations of Pb above the WHO guideline, but As was the only element found in concentrations that could result in human exposure near toxicological reference values. An efficient retention of metals in the natural soil close to the source areas, which results in a moderate impact on local drinking water, is implied. Firstly, by the lack of significant difference in metal concentrations when comparing households located upstream and downstream of the main waste deposits, and secondly, by the lack of correlation between the metal concentration in drinking water and distance to the nearest glassworks site. However, elevated Pb and Cd concentrations in drinking water around glassworks sites when compared to regional groundwater indicate that diffuse contamination of the soils found outside the glassworks properties, and not only the glass waste landfills, may have a significant impact on groundwater quality. We further demonstrate that different mobilization patterns apply to different metals. Regarding the need to use reliable data to assess drinking water contamination and human exposure, we finally show that the conservative modelling approaches that are frequently used in routine risk assessments may result in exposure estimates many times higher than those based on measured concentrations in the drinking water that is actually being used for consumption. Copyright © 2016 Elsevier B.V. All rights reserved.

Walla Walla River Basin Fish Screen Evaluations, 2003: Nursery Bridge Fishway and Garden City-Lowden II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vucelick, Jessica A.; McMichael, Geoffrey A.

2003-11-01

The Pacific Northwest National Laboratory (PNNL) evaluated the fish screens at the Nursery Bridge Fishway and at the newly constructed Garden City-Lowden II site west of Walla Walla, Washington in the Walla Walla River Basin during the spring and summer of 2003. Both fish screen facilities were examined to determine if they were being effectively operated and maintained to provide for safe fish passage. At the Nursery Bridge Fishway, the screens were evaluated specifically to determine whether the louvers that aid in controlling water flow from behind the screens could be adjusted so that the screens would meet fish protectionmore » criteria. Data were collected to determine whether velocities in front of the screens and in the bypasses met current National Oceanic and Atmospheric Administration Fisheries ((NOAA Fisheries), formerly National Marine Fisheries Service (NMFS)) criteria to promote safe and timely fish passage before and after changing the louver settings. Rock weirs downstream of the dam were also evaluated to determine whether they might impede upstream migration of juvenile salmonids during low flow conditions. At the Garden City-Lowden II site, data were collected to establish a baseline for operating conditions and to determine whether any changes in the baffle settings were needed. Based on the results of our studies in 2003, we concluded: Nursery Bridge Site: (1) 68% of the initial velocity measurements on the west screen exceeded the NOAA Fisheries criteria of 0.4 ft/s for approach velocity; (2) A simple adjustment of the existing louvers was not sufficient to fix the problem; (3) The sediment and debris load in the river upstream of the screens exceeded the design criteria for the site, which had frequent breakdowns in the screen cleaning systems; and (4) The rock weirs downstream of the dam would not be expected to impede upstream movement of juvenile fish during low flow conditions. Garden City-Lowden II: (1) The flat inclined-plate screen design appeared to be efficiently protecting juvenile fish from entrainment, impingement and migration delay; (2) Approach velocities met the NMFS criteria of less than 0.4 ft/s in June, and no change in baffle settings was needed; (3) Sweep velocities were generally lower than approach velocities and did not increase toward the downstream end of the site; and (4) The automated cleaning system at the Garden City-Lowden II site works adequately when sediment loads are low, though its effectiveness at cleaning the screens decreases as sediment and debris loads and algal growth increase.« less

Occurrence of phosphorus, nitrate, and suspended solids in streams of the Cheney Reservoir Watershed, south-central Kansas, 1997-2000

USGS Publications Warehouse

Milligan, Chad R.; Pope, Larry M.

2001-01-01

Improving water quality of Cheney Reservoir in south-central Kansas is an important objective of State and local water managers. The reservoir serves as a water supply for about 350,00 people in the Wichita area and an important recreational resource for the area. In 1992, a task force was formed to study and prepare a plan to identify and mitigate potential sources of stream contamination in the Cheney Reservoir watershed. This task force was established to develop stream-water-quality goals to aid in the development and implementation of best-management practices in the watershed. In 1996, the U.S. Geological Survey entered into a cooperative study with the city of Wichita to assess the water quality in the Cheney Reservoir watershed. Water-quality constituents of particular concern in the Cheney Reservoir watershed are phosphorus, nitrate, and total suspended solids. Water-quality samples were collected at five streamflow-gaging sites upstream from the reservoir and at the outflow of the reservoir. The purpose of this report is to present the results of a 4-year (1997-2000) data-collection effort to quantify the occurrence of phosphorus, nitrate, and suspended solids during base-flow, runoff, and long-term streamflow conditions (all available data for 1997-2000) and to compare these results to stream-water-quality goals established by the Cheney Reservoir Task Force. Mean concentrations of each of the constituents examined during this study exceeded the Cheney Reservoir Task Force stream-water-quality goal for at least one of the streamflow conditions evaluated. Most notably, mean base-flow and mean long-term concentrations of total phosphorus and mean base-flow concentrations of dissolved nitrate exceeded the goals of 0.05, 0.10, and 0.25 milligram per liter, respectively, at all five sampling sites upstream from the reservoir. Additionally, the long-term stream-water-quality goal for dissolved nitrate was exceeded by the mean concentration at one upstream sampling site, and the base-flow total suspended solids goal (20 milligrams per liter) and long-term total suspended solids goal (100 milligrams per liter) were each exceeded by mean concentrations at three upstream sampling sites. Generally, it seems unlikely that water-quality goals for streams in the Cheney Reservoir watershed will be attainable for mean base-flow and mean long-term total phosphorus and total suspended solids concentrations and for mean base-flow dissolved nitrate concentrations as long as current (2001) watershed conditions and practices persist. However, future changes in these conditions and practices that mitigate the transport of these consitutents may modify this conclusion.

Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

DOE PAGES

Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina; ...

2015-11-10

Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina

Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

PubMed

Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

2011-03-01

Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

Upstream migration of Pacific lampreys in the John Day River, Oregon: Behavior, timing, and habitat use

USGS Publications Warehouse

Robinson, T. Craig; Bayer, J.M.

2005-01-01

Adult Pacific lamprey migration and habitat preferences for over-winter holding and spawning, and larval rearing in tributaries to the Columbia River are not well understood. The John Day River is one such tributary where larval and adult stages of this species have been documented, and its free-flowing character provided the opportunity to study migration of Pacific lampreys unimpeded by passage constraints. Forty-two adult Pacific lampreys were captured in the John Day River near its mouth during their upstream migration. Pacific lampreys were surgically implanted with radio transmitters and released onsite, and tracked by fixed-site, aerial, and terrestrial telemetry methods for nearly one year. Adults moved upstream exclusively at night, with a mean rate of 11.1 ?? 6.3 km/day. They halted upstream migration by September, and held a single position for approximately six months in the lateral margins of riffles and glides, using boulders for cover. More than half of Pacific lampreys resumed migration in March before ending movement in early May. Pacific lampreys that resumed migration in spring completed a median of 87% of their upstream migration before over-winter holding. Upon completing migration. Pacific lampreys briefly held position before beginning downstream movement at the end of May. Though not directly observed, halting migration and movement downstream were likely the result of spawning and death. Gains in adult Pacific lamprey passage through the Columbia River hydrosystem and tributaries may be made by improvements that would expedite migration during spring and summer and increase the quantity and variety of cover and refuge opportunities. ?? 2005 by the Northwest Scientific Association. All rights reserved.

Big Spring spinedace and associated fish populations and habitat conditions in Condor Canyon, Meadow Valley Wash, Nevada

USGS Publications Warehouse

Jezorek, Ian G.; Connolly, Patrick J.; Munz, Carrie S.; Dixon, Chris

2011-01-01

Executive Summary: This project was designed to document habitat conditions and populations of native and non-native fish within the 8-kilometer Condor Canyon section of Meadow Valley Wash, Nevada, with an emphasis on Big Spring spinedace (Lepidomeda mollispinis pratensis). Other native fish present were speckled dace (Rhinichthys osculus) and desert sucker (Catostomus clarki). Big Spring spinedace were known to exist only within this drainage and were known to have been extirpated from a portion of their former habitat located downstream of Condor Canyon. Because of this extirpation and the limited distribution of Big Spring spinedace, the U.S. Fish and Wildlife Service listed this species as threatened under the Endangered Species Act in 1985. Prior to our effort, little was known about Big Spring spinedace populations or life histories and habitat associations. In 2008, personnel from the U.S. Geological Survey's Columbia River Research Laboratory began surveys of Meadow Valley Wash in Condor Canyon. Habitat surveys characterized numerous variables within 13 reaches, thermologgers were deployed at 9 locations to record water temperatures, and fish populations were surveyed at 22 individual sites. Additionally, fish were tagged with Passive Integrated Transponder (PIT) tags, which allowed movement and growth information to be collected on individual fish. The movements of tagged fish were monitored with a combination of recapture events and stationary in-stream antennas, which detected tagged fish. Meadow Valley Wash within Condor Canyon was divided by a 12-meter (m) waterfall known as Delmue Falls. About 6,100 m of stream were surveyed downstream of the falls and about 2,200 m of stream were surveyed upstream of the falls. Although about three-quarters of the surveyed stream length was downstream of Delmue Falls, the highest densities and abundance of native fish were upstream of the falls. Big Spring spinedace and desert sucker populations were highest near the upper end of Condor Canyon, where a tributary known as Kill Wash, and several springs, contribute flow and moderate high and low water temperature. Kill Wash and the area around its confluence with Meadow Valley Wash appeared important for spawning of all three native species. Detections of PIT-tagged fish indicated that there were substantial movements to this area during the spring. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. A population of non-native rainbow trout (Oncorhynchus mykiss) was found within the 2,000 m of stream immediately downstream of Delmue Falls. Non-native crayfish were very common both upstream and downstream of Delmue Falls. We were not able to quantify crayfish populations, but they compose a significant portion of the biomass of aquatic species in Condor Canyon. There were some distinctive habitat features that may have favored native fish upstream of Delmue Falls. Upstream of the falls, water temperatures were moderated by inputs from springs, turbidity was lower, pool habitat was more prevalent, substrate heterogeneity was higher, and there was less fine sediment than

Water-quality conditions near the confluence of the Snake and Boise Rivers, Canyon County, Idaho

USGS Publications Warehouse

Wood, Molly S.; Etheridge, Alexandra

2011-01-01

Total Maximum Daily Loads (TMDLs) have been established under authority of the Federal Clean Water Act for the Snake River-Hells Canyon reach, on the border of Idaho and Oregon, to improve water quality and preserve beneficial uses such as public consumption, recreation, and aquatic habitat. The TMDL sets targets for seasonal average and annual maximum concentrations of chlorophyll-a at 14 and 30 micrograms per liter, respectively. To attain these conditions, the maximum total phosphorus concentration at the mouth of the Boise River in Idaho, a tributary to the Snake River, has been set at 0.07 milligrams per liter. However, interactions among chlorophyll-a, nutrients, and other key water-quality parameters that may affect beneficial uses in the Snake and Boise Rivers are unknown. In addition, contributions of nutrients and chlorophyll-a loads from the Boise River to the Snake River have not been fully characterized. To evaluate seasonal trends and relations among nutrients and other water-quality parameters in the Boise and Snake Rivers, a comprehensive monitoring program was conducted near their confluence in water years (WY) 2009 and 2010. The study also provided information on the relative contribution of nutrient and sediment loads from the Boise River to the Snake River, which has an effect on water-quality conditions in downstream reservoirs. State and site-specific water-quality standards, in addition to those that relate to the Snake River-Hells Canyon TMDL, have been established to protect beneficial uses in both rivers. Measured water-quality conditions in WY2009 and WY2010 exceeded these targets at one or more sites for the following constituents: water temperature, total phosphorus concentrations, total phosphorus loads, dissolved oxygen concentration, pH, and chlorophyll-a concentrations (WY2009 only). All measured total phosphorus concentrations in the Boise River near Parma exceeded the seasonal target of 0.07 milligram per liter. Data collected during the study show seasonal differences in all measured parameters. In particular, surprisingly high concentrations of chlorophyll-a were measured at all three main study sites in winter and early spring, likely due to changes in algal populations. Discharge conditions and dissolved orthophosphorus concentrations are key drivers for chlorophyll-a on a seasonal and annual basis on the Snake River. Discharge conditions and upstream periphyton growth are most likely the key drivers for chlorophyll-a in the Boise River. Phytoplankton growth is not limited or driven by nutrient availability in the Boise River. Lower discharges and minimal substrate disturbance in WY2010 in comparison with WY2009 may have caused prolonged and increased periphyton and macrophyte growth and a reduced amount of sloughed algae in suspension in the summer of WY2010. Chlorophyll-a measured in samples commonly is used as an indicator of sestonic algae biomass, but chlorophyll-a concentrations and fluorescence may not be the most appropriate surrogates for algae growth, eutrophication, and associated effects on beneficial uses. Assessment of the effects of algae growth on beneficial uses should evaluate not only sestonic algae, but also benthic algae and macrophytes. Alternatively, continuous monitoring of dissolved oxygen detects the influence of aquatic plant respiration for all types of algae and macrophytes and is likely a more direct measure of effects on beneficial uses such as aquatic habitat. Most measured water-quality parameters in the Snake River were statistically different upstream and downstream of the confluence with the Boise River. Higher concentrations and loads were measured at the downstream site (Snake River at Nyssa) than the upstream site (Snake River near Adrian) for total phosphorus, dissolved orthophosphorus, total nitrogen, dissolved nitrite and nitrate, suspended sediment, and turbidity. Higher dissolved oxygen concentrations and pH were measured at the upstream site (Snake River near Adrian) than the downstream site (Snake River at Nyssa). Contributions from the Boise River measured at Parma do not constitute all of the increase in nutrient and sediment loads in the Snake River between the upstream and downstream sites. Surrogate models were developed using a combination of continuously monitored variables to estimate concentrations of nutrients and suspended sediment when samples were not possible. The surrogate models explained from 66 to 95 percent of the variability in nutrient and suspended sediment concentrations, depending on the site and model. Although the surrogate models could not always represent event-based changes in modeled parameters, they generally were successful in representing seasonal and annual patterns. Over a longer period, the surrogate models could be a useful tool for measuring compliance with state and site-specific water-quality standards and TMDL targets, for representing daily and seasonal variability in constituents, and for assessing effects of phosphorus reduction measures within the watershed.

Water quality monitoring of an international wetland at Harike, Punjab and its impact on biological systems

NASA Astrophysics Data System (ADS)

Kaur, Jasmit; Walia, Harpreet; Mabwoga, Samson Okongo; Arora, Saroj

2017-06-01

The present study entails the investigation of mutagenic and genotoxic effect of surface water samples collected from 13 different sites of the Harike wetland using the histidine reversion point mutation assay in Salmonella typhimurium (TA98) strain and plasmid nicking assay using pBR322, respectively. The physicochemical characterization of water samples using different parameters was conducted for water quality monitoring. Heavy metal analysis was performed to quantify the toxic components present in water samples. It was observed that although the water samples of all the sites demonstrated mutagenic as well as genotoxic activity, the effect was quite significant with the water samples from sites containing water from river Satluj, i.e., site 1 (upstream Satluj river), site 2 (Satluj river) and site 3 (reservoir Satluj). The high level of pollution due to industrial effluents and agricultural run-off at these sites may engender the genotoxicity and mutagenicity of water samples.

Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.

PubMed

Behrens, R; Hayles, J; Nurse, P

2000-12-01

Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.

Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames

PubMed Central

Behrens, Ralf; Hayles, Jacky; Nurse, Paul

2000-01-01

Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681

Linking water quality guidelines to the natural characteristics of catchments in order to support distinct aquatic ecosystems: Water quality guidelines for suspended particulate matter

NASA Astrophysics Data System (ADS)

Bilotta, G. S.; Grove, M. K.; Harrison, C.; Joyce, C. B.; Peacock, C.

2012-12-01

The natural characteristics of a catchment provide a template that controls the background rates of geomorphological processes operating within that catchment, which in-turn determines the background physico-chemical and hydro-morphological characteristics of the catchment's surface waters. Large differences in the natural characteristics of catchments (e.g. geology, topography, climate), lead to unique physico-chemical and hydro-morphological conditions that support unique freshwater communities. However, this uniqueness is not always recognised in international water quality guidelines, which often attempt to apply blanket water-quality guidelines to 'protect' a wide range of ecosystems. In this paper we investigate the natural characteristics that control background concentrations of suspended particulate matter (SPM - including nano-scale particles to sand-sized sediments), which is a well-known cause of ecological degradation. At present, the management of SPM is hampered by a lack of understanding of the SPM conditions that water quality managers should aim to achieve in contrasting environments in order to support good ecological status. To address this, in this paper we examine the SPM preferences of contrasting biological communities that are in reference condition (minimal anthropogenic disturbance and high ecological status). We analyse historical SPM data collected on a monthly basis from a wide range of reference-condition temperate environments (638 stream/river sites comprising 42 different biological community-types). This analysis reveals that there are statistically significant differences (One-way ANOVA p < 0.001) between the background SPM concentrations observed in contrasting communities that are in reference condition. Mean background SPM concentrations for contrasting communities ranged from 1.7 to 26.2 mg L-1 (i.e. more than a 15-fold difference). We propose a model for predicting environment-specific water quality guidelines for SPM. In order to develop this model, the 638 reference-condition sites were first classified into one of five mean background SPM ranges (0.00-5.99, 6.00-11.99, 12.00-17.99, 18.00-23.99 and >24.00 mg L-1). Stepwise Multiple Discriminant Analysis (MDA) of these ranges showed that a site's SPM range can be predicted as a function of: mean annual air temperature, mean annual precipitation, mean altitude of upstream catchment, distance from source, slope to source, channel width and depth, the percentage of catchment area comprised of clay, chalk, and hard rock solid geology, and the percentage of the catchment area comprised of blown sand/landslide material as the surface (drift) material. Although the model is still being improved and developed, this research highlights the need to link water quality guidelines to the natural characteristics of catchments and the physico-chemical preferences of the biological communities that would naturally inhabit them.

What's Upstream? GIS's critical role in developing nutrient ...

EPA Pesticide Factsheets

Eutrophication due to excess levels of nitrogen and phosphorus can seriously impair ecological function in estuaries. Protective criteria for nutrients are difficult to establish because the source can vary spatially and seasonally, originate either from the watershed or the ocean, and be natural or anthropogenic. GIS tools and processes can help in developing nutrient criteria by establishing reference conditions representative of natural background nutrient levels. Along the Oregon Coast in the Pacific Northwest, the primary source of nutrients in the wet season (November-April) is generally riverine. We delineated and extracted explicit spatial data from watersheds upstream of riverine water quality monitoring stations for parametric comparison to recorded nutrient levels. The SPARROW model (Wise and Johnson, 2011) was used to estimate relative contributions of nutrient sources at each station. Both raster and vector spatial data were used and include land use / land cover, demography, geology, terrain, precipitation and forest type. The relationships of nutrients to spatial data were then explored as an approach to establishing the reference expectation. The abstract introduces Geographic Information Systems (GIS) tools and processes employed for research conducted under the Safe and Sustainable Water Resources (SSWR) Task 2.3A, entitled “Nutrient Management for Sustainability of Aquatic Ecosystems.” One of the goals of the EPA Office of Water is to

A Method for Evaluating Outcomes of Restoration When No Reference Sites Exist

Treesearch

J. Stephen Brewer; Timothy Menzel

2009-01-01

Ecological restoration typically seeks to shift species composition toward that of existing reference sites. Yet, comparing the assemblages in restored and reference habitats assumes that similarity to the reference habitat is the optimal outcome of restoration and does not provide a perspective on regionally rare off-site species. When no such reference assemblages of...

Pacific lamprey (Entosphenus tridentatus) ammocoetes exposed to contaminated Portland Harbor sediments: Method development and effects on survival, growth, and behavior

USGS Publications Warehouse

Unrein, Julia R.; Morris, Jeffrey M.; Chitwood, Rob S.; Lipton, Joshua; Peers, Jennifer; van de Wetering, Stan; Schreck, Carl B.

2016-01-01

Many anthropogenic disturbances have contributed to the decline of Pacific lampreys (Entosphenus tridentatus), but potential negative effects of contaminants on lampreys are unclear. Lamprey ammocoetes are the only detritivorous fish in the lower Willamette River, Oregon, USA, and have been observed in Portland Harbor sediments. Their long benthic larval stage places them at risk from the effects of contaminated sediment. The authors developed experimental methods to assess the effects of contaminated sediment on the growth and behavior of field-collected ammocoetes reared in a laboratory. Specifically, they developed methods to assess individual growth and burrowing behavior. Burrowing performance demonstrated high variability among contaminated sediments; however, ammocoetes presented with noncontaminated reference sediment initiated burrowing more rapidly and completed it faster. Ammocoete reemergence from contaminated sediments suggests avoidance of some chemical compounds. The authors conducted long-term exposure experiments on individually held ammocoetes using sediment collected from their native Siletz River, which included the following: contaminated sediments collected from 9 sites within Portland Harbor, 2 uncontaminated reference sediments collected upstream, 1 uncontaminated sediment with characteristics similar to Portland Harbor sediments, and clean sand. They determined that a 24-h depuration period was sufficient to evaluate weight changes and observed no mortality or growth effects in fish exposed to any of the contaminated sediments. However, the effect on burrowing behavior appeared to be a sensitive endpoint, with potentially significant implications for predator avoidance.

DEVELOPMENT OF INDICATORS OF EXPOSURE AND RESPONSE TO SEDIMENT AND HABITAT ALTERATION IN LAKE MICHIGAN COASTAL RIVERINE WETLANDS

EPA Science Inventory

Measures are being assessed to quantify the relationship of land-use in upstream watersheds to the habitat and biota in downstream coastal wetlands. Twenty-two sites were randomly drawn from a pool of 125 identified as riverine coastal wetlands along the shore of Lake Michigan. W...

Optogenetic Activation of Presynaptic Inputs in Lateral Amygdala Forms Associative Fear Memory

ERIC Educational Resources Information Center

Kwon, Jeong-Tae; Nakajima, Ryuichi; Hyung-Su, Kim; Jeong, Yire; Augustine, George J.; Han, Jin-Hee

2014-01-01

In Pavlovian fear conditioning, the lateral amygdala (LA) has been highlighted as a key brain site for association between sensory cues and aversive stimuli. However, learning-related changes are also found in upstream sensory regions such as thalamus and cortex. To isolate the essential neural circuit components for fear memory association, we…

Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

PubMed

Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

2001-06-01

Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

Passage survival of juvenile steelhead, coho salmon, and Chinook salmon in Lake Scanewa and at Cowlitz Falls Dam, Cowlitz River, Washington, 2010–16

USGS Publications Warehouse

Liedtke, Theresa L.; Kock, Tobias J.; Hurst, William

2018-04-03

A multi-year evaluation was conducted during 2010–16 to evaluate passage survival of juvenile steelhead (Oncorhynchus mykiss), Chinook salmon (O. tshawytscha), and coho salmon (O. kisutch) in Lake Scanewa, and at Cowlitz Falls Dam in the upper Cowlitz River Basin, Washington. Reservoir passage survival was evaluated in 2010, 2011, and 2016, and included the tagging and release of 1,127 juvenile salmonids. Tagged fish were released directly into the Cowlitz and Cispus Rivers, 22.3 and 8.9 km, respectively, upstream of the reservoir, and were monitored as they moved downstream into, and through the reservoir. A single release-recapture survival model was used to analyze detection records and estimate reservoir passage survival, which was defined as successful passage from reservoir entry to arrival at Cowlitz Falls Dam. Tagged fish generally moved quickly downstream of the release sites and, on average, arrived in the dam forebay within 2 d of release. Median travel time from release to first detection at the dam ranged from 0.23 to 0.96 d for juvenile steelhead, from 0.15 to 1.11 d for juvenile coho salmon, and from 0.18 to 1.89 d for juvenile Chinook salmon. Minimum reservoir passage survival probabilities were 0.960 for steelhead, 0.855 for coho salmon and 0.900 for Chinook salmon.Dam passage survival was evaluated at the pilot-study level during 2013–16 and included the tagging and release of 2,512 juvenile salmonids. Juvenile Chinook salmon were evaluated during 2013–14, and juvenile steelhead and coho salmon were evaluated during 2015–16. A paired-release study design was used that included release sites located upstream and downstream of Cowlitz Falls Dam. The downstream release site was positioned at the downstream margin of the dam’s tailrace, which allowed dam passage survival to be measured in a manner that included mortality that occurred in the passage route and in the dam tailrace. More than one-half of the tagged Chinook salmon (52 percent) released upstream of Cowlitz Falls Dam moved downstream and passed the project; the remaining fish either remained upstream of the dam (37 percent) or were collected (11 percent). In 2015 and 2016, collection efficiencies at Cowlitz Falls Dam were abnormally high for juvenile steelhead and coho salmon, which resulted in few fish passing the dam. Seven percent of the tagged steelhead (40 fish) and 4 percent of the tagged coho salmon (18 fish) released upstream of the dam eventually passed the project, but these low numbers of fish precluded the estimation of meaningful survival estimates. Dam passage survival probability estimates for juvenile Chinook salmon were 0.828 in 2013 and 0.861 in 2014, lower than previously reported for turbine-specific passage Cowlitz Falls Dam.

The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

1994-12-31

Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

Dynamics of mangrove-marsh ecotones in subtropical coastal wetlands: fire, sea-level rise, and water levels

USGS Publications Warehouse

Smith, Thomas J.; Foster, Ann M.; Tiling-Range, Ginger; Jones, John W.

2013-01-01

Ecotones are areas of sharp environmental gradients between two or more homogeneous vegetation types. They are a dynamic aspect of all landscapes and are also responsive to climate change. Shifts in the position of an ecotone across a landscape can be an indication of a changing environment. In the coastal Everglades of Florida, USA, a dominant ecotone type is that of mangrove forest and marsh. However, there is a variety of plants that can form the marsh component, including sawgrass (Cladium mariscus [L.] Pohl), needlegrass rush (Juncus roemerianus Scheele), and spikerush (Eleocharis spp.). Environmental factors including water depth, soil type, and occurrence of fires vary across these ecotones, influencing their dynamics. Altered freshwater inflows from upstream and increasing sea level over the past 100 years may have also had an impact. We analyzed a time series of historical aerial photographs for a number of sites in the coastal Everglades and measured change in position of mangrove–marsh ecotones. For three sites, detailed maps were produced and the area of marsh, mangrove, and other habitats was determined for five periods spanning the years 1928 to 2004. Contrary to our initial hypothesis on fire, we found that fire did not prevent mangrove expansion into marsh areas but may in fact assist mangroves to invade some marsh habitats, especially sawgrass. Disparate patterns in mangrove–marsh change were measured at two downstream sites, both of which had multiple fires over from 1948 to 2004. No change in mangrove or marsh area was measured at one site. Mangrove area increased and marsh area decreased at the second of these fire-impacted sites. We measured a significant increase in mangrove area and a decline in marsh area at an upstream site that had little occurrence of fire. At this site, water levels have increased significantly as sea level has risen, and this has probably been a factor in the mangrove expansion.

Effects of Streambank Fencing of Near-Stream Pasture Land on a Small Watershed in Lancaster County, Pennsylvania

USGS Publications Warehouse

Galeone, Daniel G.; Low, Dennis J.; Brightbill, Robin A.

2006-01-01

This study indicated that a small buffer width along a stream in pasture land can have a positive influence on surface-water quality, benthic macroinvertebrates, and near-stream shallow ground-water quality. Overland runoff processes that move suspended sediment to the stream were controlled (or reduced) to some extent by the vegetative buffer established. Results indicated streambank fencing resulted in decreases in N-species, total-P, and suspended-sediment concentrations and yields at the outlet of the treatment basin relative to untreated sites; however, dissolved-P concentrations and yields increased. These results indicate that nutrient management, in conjunction with streambank fencing, is important in helping to control nutrient loadings to streams in this agricultural setting. An upstream site (T-2) in the treatment basin showed post-treatment reductions in suspended-sediment yields and increases in N and P yields. The different results for these treated sites indicates the effects of streambank fencing should be studied at as large a scale as possible because field-scale influences on water quality as drainage area decreases can mute the effects of fencing. Benthic-macroinvertebrate data indicated streambank fencing had a positive influence on benthic macroinvertebrates and their habitat. More improvement was detected at the outlet of the treatment basin than the upstream sites. Probably the most important biological metric, taxa richness, indicated a greater number of benthic-macroinvertebrate taxa at treated relative to control sites after fencing. Results indicated fencing improved shallow ground-water quality (for the well nest in a stream-gaining area), as noted by decreased concentrations of N species and fecal-streptococcus counts. This improvement only occurred at the well nest where the stream was gaining water from the shallow ground-water system.

Biological assessment and streambed-sediment chemistry of streams in the Indianapolis metropolitan area, Indiana, 2003–2008

USGS Publications Warehouse

Voelker, David C.

2012-01-01

During 2003–2008, the U.S. Geological Survey sampled 13 sites in the Indianapolis metropolitan area in Indiana for benthic invertebrates, fish communities, and streambed-sediment chemistry. Data from seven White River sites and six tributary sites complement surface-water chemistry data collected by the Indianapolis Department of Public Works. The information is being used to assess changes in water quality in conjunction with the City's programs to reduce combined sewer overflows and other point and nonpoint sources of pollution in the Indianapolis area. During the study, 233 benthic-invertebrate taxa were identified from which the Ephemeroptera, Plecoptera, and Trichoptera (EPT) Index, the Hilsenhoff Biotic Index (HBI), and the Invertebrate Community Index (ICI) were calculated. EPT index scores ranged from 2 to 16 on the White River and from 2 to 17 on the tributaries. EPT index scores indicate that these pollution-intolerant taxa are more prevalent upstream from and away from the combined-sewer areas of Indianapolis. HBI scores from sites on the White River ranged from 4.67 (good) to 9.55 (very poor), whereas on the tributaries, scores ranged from 4.21 (very good) to 8.14 (poor). Lower HBI scores suggest that less organic pollution was present and, like the EPT scores, indicate better conditions where combined-sewer overflows (CSOs) are not present. Similarly, ICI scores indicated better conditions upstream from the CSO outfalls on the White River. White River scores ranged from 12 to 46, where higher ICI scores indicate better conditions in the benthic-invertebrate community. ICI scores at the tributary sites ranged from 12 to 52, with the highest scores on streams without CSOs.

Determination of heavy metal contents in water, sediments, and fish tissues of Shizothorax plagiostomus in river Panjkora at Lower Dir, Khyber Pakhtunkhwa, Pakistan.

PubMed

Ahmad, Kabir; Azizullah, Azizullah; Shama, Shama; Khattak, Muhammad Nasir Khan

2014-11-01

The present study was conducted to investigate the contamination of water, sediments, and fish tissues with heavy metals in river Panjkora at Lower Dir, Khyber Pakhtunkhwa, Pakistan. Water, sediments, and fish (Shizothorax plagiostomus) samples were collected from September 2012 to January 2013 at three different sites (upstream site at Sharigut, sewage site at Timergara, and downstream site at Sadoo) of river Panjkora. The concentrations of heavy metals in water were in the order Zn > Cu ≈ Pb > Ni ≈ Cd with mean values of 0.30, 0.01, 0.01, 0.0 and 0.0 mg/l, respectively, which were below the maximum permissible limits of WHO for drinking water. In sediments, heavy metals were found in the order Cu > Zn > Ni > Pb > Cd with mean concentrations of 50.6, 38.7, 9.3, 8, and 0.4 mg/kg, respectively. Ni and Cd were not found in any fish tissues, but Zn, Cu, and Pb were detected with the mean concentration ranges of 0.04-1.19, 0.03-0.12, and 0.01-0.09 μg/g, respectively. The present study demonstrates that disposal of waste effluents causes a slight increase in the concentration of heavy metals in river Panjkora as revealed by variation in metal concentrations from upstream to downstream site. Sewage disposal was also found to change physicochemical characteristics of Panjkora water. At present, water and fish of river Panjkora are safe for human consumption, but the continuous sewage disposal may create problems in the future.

Predicting Recreational Water Quality Using Turbidity in the Cuyahoga River, Cuyahoga Valley National Park, Ohio, 2004-7

USGS Publications Warehouse

Brady, Amie M.G.; Bushon, Rebecca N.; Plona, Meg B.

2009-01-01

The Cuyahoga River within Cuyahoga Valley National Park (CVNP) in Ohio is often impaired for recreational use because of elevated concentrations of bacteria, which are indicators of fecal contamination. During the recreational seasons (May through August) of 2004 through 2007, samples were collected at two river sites, one upstream of and one centrally-located within CVNP. Bacterial concentrations and turbidity were determined, and streamflow at time of sampling and rainfall amounts over the previous 24 hours prior to sampling were ascertained. Statistical models to predict Escherichia coli (E. coli) concentrations were developed for each site (with data from 2004 through 2006) and tested during an independent year (2007). At Jaite, a sampling site near the center of CVNP, the predictive model performed better than the traditional method of determining the current day's water quality using the previous day's E. coli concentration. During 2007, the Jaite model, based on turbidity, produced more correct responses (81 percent) and fewer false negatives (3.2 percent) than the traditional method (68 and 26 percent, respectively). At Old Portage, a sampling site just upstream from CVNP, a predictive model with turbidity and rainfall as explanatory variables did not perform as well as the traditional method. The Jaite model was used to estimate water quality at three other sites in the park; although it did not perform as well as the traditional method, it performed well - yielding between 68 and 91 percent correct responses. Further research would be necessary to determine whether using the Jaite model to predict recreational water quality elsewhere on the river would provide accurate results.

Investigation of hit-and-run crash occurrence and severity using real-time loop detector data and hierarchical Bayesian binary logit model with random effects.

PubMed

Xie, Meiquan; Cheng, Wen; Gill, Gurdiljot Singh; Zhou, Jiao; Jia, Xudong; Choi, Simon

2018-02-17

Most of the extensive research dedicated to identifying the influential factors of hit-and-run (HR) crashes has utilized typical maximum likelihood estimation binary logit models, and none have employed real-time traffic data. To fill this gap, this study focused on investigating factors contributing to HR crashes, as well as the severity levels of HR. This study analyzed 4-year crash and real-time loop detector data by employing hierarchical Bayesian models with random effects within a sequential logit structure. In addition to evaluation of the impact of random effects on model fitness and complexity, the prediction capability of the models was examined. Stepwise incremental sensitivity and specificity were calculated and receiver operating characteristic (ROC) curves were utilized to graphically illustrate the predictive performance of the model. Among the real-time flow variables, the average occupancy and speed from the upstream detector were observed to be positively correlated with HR crash possibility. The average upstream speed and speed difference between upstream and downstream speeds were correlated with the occurrence of severe HR crashes. In addition to real-time factors, other variables found influential for HR and severe HR crashes were length of segment, adverse weather conditions, dark lighting conditions with malfunctioning street lights, driving under the influence of alcohol, width of inner shoulder, and nighttime. This study suggests the potential traffic conditions of HR and severe HR occurrence, which refer to relatively congested upstream traffic conditions with high upstream speed and significant speed deviations on long segments. The above findings suggest that traffic enforcement should be directed toward mitigating risky driving under the aforementioned traffic conditions. Moreover, enforcement agencies may employ alcohol checkpoints to counter driving under the influence (DUI) at night. With regard to engineering improvements, wider inner shoulders may be constructed to potentially reduce HR cases and street lights should be installed and maintained in working condition to make roads less prone to such crashes.

Interaction of the Transcription Start Site Core Region and Transcription Factor YY1 Determine Ascorbate Transporter SVCT2 Exon 1a Promoter Activity

PubMed Central

Qiao, Huan; May, James M.

2012-01-01

Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872

COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

PubMed Central

Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

2002-01-01

Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

First steps in developing a multimetric macroinvertebrate index for the Ohio River

USGS Publications Warehouse

Applegate, J.M.; Baumann, P.C.; Emery, E.B.; Wooten, M.S.

2007-01-01

The causes of degradation of aquatic systems are often complex and stem from a variety of human influences. Comprehensive, multimetric biological indices have been developed to quantify this degradation and its effect on aquatic communities, and measure subsequent recovery from anthropogenic stressors. Traditionally, such indices have concentrated on small-to medium-sized streams. Recently, however, the Ohio River Fish Index (ORFIn) was created to assess biotic integrity in the Ohio River. The goal of the present project was to begin developing a companion Ohio River multimetric index using benthic macroinvertebrates. Hester-Dendy multiplate samplers were used to evaluate benthic macroinvertebrate assemblages in relation to a gradient of water quality disturbance, represented by varying distances downstream of industrial and municipal wastewater outfalls in the Ohio River. In August 1999 and 2000, samplers were set every 100 m downstream of outfalls (12 outfalls in 1999, 22 in 2000) for 300-1000 m, as well as at upstream reference sites. Candidate metrics (n = 55) were examined to determine which have potential to detect changes in water quality downstream of outfalls. These individual measures of community structure were plotted against distance downstream of each outfall to determine their response to water quality disturbance. Values at reference and outfall sites were also compared. Metrics that are ecologically relevant and showed a response to outfall disturbance were identified as potentially valuable in a multimetric index. Multiple box plots of index scores indicated greater response to outfall disturbance during periods of low-flow, and longitudinal river-wide trends. Evaluation of other types of anthropogenic disturbance, as well as continued analysis of the effects of chemical water quality on macroinvertebrate communities in future years will facilitate further development of a multimetric benthic macroinvertebrate index to evaluate biotic integrity in the Ohio River. Copyright ?? 2007 John Wiley & Sons, Ltd.

Final report (2002-2004): Benthic macroinvertebrate communities of reconstructed freshwater tidal wetlands in the Anacostia River, Washington, D.C

USGS Publications Warehouse

Brittingham, K.D.; Hammerschlag, R.S.

2006-01-01

Considerable work has been conducted on the benthic communities of inland aquatic systems, but there remains a paucity of effort on freshwater tidal wetlands. This study characterized the benthic macroinvertebrate communities of recently reconstructed urban freshwater tidal wetlands along the Anacostia River in Washington, D.C. The focus of the study was on the two main areas of Kingman Marsh, which were reconstructed by the U.S. Army Corps of Engineers in 2000 using Anacostia dredge material. Populations from this 'new' marsh were compared to those of similarly reconstructed Kenilworth Marsh (1993) just one half mile upstream, the relic reference Dueling Creek Marsh in the upper Anacostia estuary and the outside reference Patuxent freshwater tidal marsh in an adjacent watershed. Benthic macro invertebrate organisms were collected using selected techniques for evaluation including the Ekman bottom grab sampler, sediment corer, D-net and Hester-Dendy sampler. Samples were collected at least seasonally from tidal channels, tidal mudflats, three vegetation/sediment zones (low, middle and high marsh), and pools over a 3-year period (late 2001-2004). The macroinvertebrate communities present at the marsh sites proved to be good indicators of disturbance and stress (Kingman Marsh), pollution, urban vs. rural location (Kenilworth and Patuxent), and similarities between reconstructed and remnant wetlands (Kenilworth and Dueling Creek). Macroinvertebrate density was significantly greater at Kingman Marsh than Kenilworth Marsh due to more numerous chironomids and oligochaetes. This may reflect an increase in unvegetated sediments at Kingman (even at elevations above natural mudflat) due to grazing pressure from over-abundant resident Canada geese. Unvegetated sediments yielded greater macroinvertebrate abundance but lower richness than vegetated marsh sites. Data collected from this study provides information on the extent that benthic macroinvertebrate communities can serve as indicators of the relative success of freshwater tidal marsh reconstruction.

Defining the Reference Condition for Wadeable Streams in the Sand Hills Subdivision of the Southeastern Plains Ecoregion, USA

NASA Astrophysics Data System (ADS)

Kosnicki, Ely; Sefick, Stephen A.; Paller, Michael H.; Jarrell, Miller S.; Prusha, Blair A.; Sterrett, Sean C.; Tuberville, Tracey D.; Feminella, Jack W.

2014-09-01

The Sand Hills subdivision of the Southeastern Plains ecoregion has been impacted by historical land uses over the past two centuries and, with the additive effects of contemporary land use, determining reference condition for streams in this region is a challenge. We identified reference condition based on the combined use of 3 independent selection methods. Method 1 involved use of a multivariate disturbance gradient derived from several stressors, method 2 was based on variation in channel morphology, and method 3 was based on passing 6 of 7 environmental criteria. Sites selected as reference from all 3 methods were considered primary reference, whereas those selected by 2 or 1 methods were considered secondary or tertiary reference, respectively. Sites not selected by any of the methods were considered non-reference. In addition, best professional judgment (BPJ) was used to exclude some sites from any reference class, and comparisons were made to examine the utility of BPJ. Non-metric multidimensional scaling indicated that use of BPJ may help designate non-reference sites when unidentified stressors are present. The macroinvertebrate community measures Ephemeroptera, Plecoptera, Trichoptera richness and North Carolina Biotic Index showed no differences between primary and secondary reference sites when BPJ was ignored. However, there was no significant difference among primary, secondary, and tertiary reference sites when BPJ was used. We underscore the importance of classifying reference conditions, especially in regions that have endured significant anthropogenic activity. We suggest that the use of secondary reference sites may enable construction of models that target a broader set of management interests.

Combining split-beam and dual-frequency identification sonars to estimate abundance of anadromous fishes in the Roanoke River, North Carolina

USGS Publications Warehouse

Hughes, Jacob B.; Hightower, Joseph E.

2015-01-01

Riverine hydroacoustic techniques are an effective method for evaluating abundance of upstream migrating anadromous fishes. To use these methods in the Roanoke River, North Carolina, at a wide site with uneven bottom topography, we used a combination of split-beam sonar and dual-frequency identification sonar (DIDSON) deployments. We aimed a split-beam sonar horizontally to monitor midchannel and near-bottom zones continuously over the 3-month spring monitoring periods in 2010 and 2011. The DIDSON was rotated between seven cross-channel locations (using a vertical aim) and nearshore regions (using horizontal aims). Vertical deployment addressed blind spots in split-beam coverage along the bottom and provided reliable information about the cross-channel and vertical distributions of upstream migrants. Using a Bayesian framework, we modeled sonar counts within four cross-channel strata and apportioned counts by species using species proportions from boat electrofishing and gill netting. Modeled estimates (95% credible intervals [CIs]) of total upstream migrants in 2010 and 2011 were 2.5 million (95% CI, 2.4–2.6 million) and 3.6 million (95% CI, 3.4–3.9 million), respectively. Results indicated that upstream migrants are extremely shore- and bottom-oriented, suggesting nearshore DIDSON monitoring improved the accuracy and precision of our estimates. This monitoring protocol and model may be widely applicable to river systems regardless of their cross-sectional width or profile.

Barrage fishponds: Reduction of pesticide concentration peaks and associated risk of adverse ecological effects in headwater streams.

PubMed

Gaillard, Juliette; Thomas, Marielle; Iuretig, Alain; Pallez, Christelle; Feidt, Cyril; Dauchy, Xavier; Banas, Damien

2016-03-15

Constructed wetlands have been suggested as pesticide risk mitigation measures. Yet, in many agricultural areas, ponds or shallow lakes are already present and may contribute to the control of non-point source contamination by pesticides. In order to test this hypothesis, we investigated the influence of extensively managed barrage fishponds (n = 3) on the dissolved concentrations of 100 pesticides in headwater streams over the course of a year. Among the 100 pesticides, 50 different substances were detected upstream and 48 downstream. Highest measured concentration upstream was 26.5 μg/L (2-methyl-4-chlorophenoxyacetic acid, MCPA) and 5.19 μg/L (isoproturon) downstream. Fishponds were found to reduce peak exposure levels as high pesticide concentrations (defined here as ≥ 1 μg/L) generally decreased by more than 90% between upstream and downstream sampling sites. The measured concentrations in the investigated streams were compared to laboratory toxicity data for standard test organisms (algae, invertebrates and fish) using the toxic unit approach. When considering the threshold levels set by the European Union within the first tier risk assessment procedure for pesticide registration (commission regulation (EU) N° 546/2011), regulatory threshold exceedances were observed for 22 pesticides upstream from fishponds and for 9 pesticides downstream. Therefore, the investigated barrage fishponds contributed to the reduction of pesticide peak concentrations and potential risk of adverse effects for downstream ecosystems. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Effects of Dams on Downstream Channel Characteristics in Pennsylvania and Maryland: Assessing the Potential Consequences of Dam Removal

NASA Astrophysics Data System (ADS)

Skalak, K. J.; Pizzuto, J. E.; Jenkins, P.

2003-12-01

The potential downstream effects of dam removal were assessed on fifteen sites of varying dam size and characteristics in Pennsylvania and Maryland. The dams ranged in size from a 30 cm high fish weir to a water supply dam 57 m high. Stream order ranged from 1 to 4. The dams are located in watersheds with varying degrees of human disturbance and urbanization. The dams are also operated differently, with significant consequences for hydraulic residence time and downstream flow variability. Most streams were alluvial, but 6 of the reaches were clearly bedrock channels. We hypothesize that the channel upstream, which is unaffected by the dam, will provide an accurate model for the channel downstream of the dam long after dam removal. Therefore, reaches upstream and downstream of the dam were compared to determine the effects of the dam as well as the condition of the stream that will ultimately develop decades after dam removal. Surprisingly, the dams had no consistent influence on channel morphology. However, the percentage of sand is significantly lower downstream than upstream: the mean % sand downstream is 11.47%, while the mean % sand upstream is 21.39%. The coarser fractions of the bed, as represented by the 84th percentile grain diameter, are unaffected by the presence of the dam. These results imply that decades after dam removal, the percentage of sand on the bed will increase, but the coarse fraction of the bed will remain relatively unchanged.

Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

PubMed

Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

2013-06-21

Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

A pause site for RNA polymerase II is associated with termination of transcription.

PubMed Central

Enriquez-Harris, P; Levitt, N; Briggs, D; Proudfoot, N J

1991-01-01

Termination of transcription by RNA polymerase II has been postulated to involve a pausing process. We have identified such a pause signal, 350 bp into the 3' flanking region of the human alpha 2 globin gene at a position where termination is thought to occur. We show that this pause signal enhances the utilization of an upstream poly(A) site which is otherwise out-competed by a stronger downstream poly(A) site. We also demonstrate that the pause site rescues a poly(A) site that is inactive due to its location within an intron. Using nuclear run-on analysis we show that elongating RNA polymerase II molecules accumulate over this pause signal. Furthermore we show that when the pause site is positioned immediately downstream of a strong poly(A) signal, significant levels of transcription termination take place. Images PMID:2050120

Phytoestrogens and mycotoxins in Iowa streams: An examination of underinvestigated compounds in agricultural basins

USGS Publications Warehouse

Kolpin, Dana W.; Hoerger, Corinne C.; Meyer, Michael T.; Wettstein, Felix E.; Hubbard, Laura E.; Bucheli, Thomas D.

2010-01-01

This study provides the first broad-scale investigation on the spatial and temporal occurrence of phytoestrogens and mycotoxins in streams in the United States. Fifteen stream sites across Iowa were sampled five times throughout the 2008 growing season to capture a range of climatic and crop-growth conditions. Basin size upstream from sampling sites ranged from 7 km2 to >836,000 km2 Atrazine (herbicide) also was measured in all samples as a frame-of-reference agriculturally derived contaminant. Target compounds were frequently detected in stream samples: atrazine (100%), formononetin (80%), equol (45%), deoxynivalenol (43%), daidzein (32%), biochanin A (23%), zearalenone (13%), and genistein (11%). The nearly ubiquitous detection of formononetin (isoflavone) suggests a widespread agricultural source, as one would expect with the intense row crop and livestock production present across Iowa. Conversely, the less spatially widespread detections of deoxynivalenol (mycotoxin) suggest a more variable source due to the required combination of proper host and proper temperature and moisture conditions necessary to promote Fusarium spp. infections. Although atrazine concentrations commonly exceeded 100 ng L-1 (42/75 measurements), only deoxynivalenol (6/56 measurements) had concentrations that occasionally exceeded this level. Temporal patterns in concentrations varied substantially between atrazine, formononetin, and deoxynivalenol, as one would expect for contaminants with different source inputs and processes of formation and degradation. The greatest phytoestrogen and mycotoxin concentrations were observed during spring snowmelt conditions. Phytoestrogens and mycotoxins were detected at all sampling sites regardless of basin size. The ecotoxicological effects from long-term, low-level exposures to phytoestrogens and mycotoxins or complex chemicals mixtures including these compounds that commonly take place in surface water are poorly understood and have yet to be systematically investigated in environmental studies.

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation

PubMed Central

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G.; Xie, Jiuyong

2012-01-01

The molecular basis of cell signal-regulated alternative splicing at the 3′ splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3′ splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3′ splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3′ splice site usage. PMID:22684629

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition

PubMed Central

Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.

2000-01-01

Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Effect of wastewater treatment facility closure on endocrine disrupting chemicals in a Coastal Plain stream

USGS Publications Warehouse

Bradley, Paul M.; Journey, Celeste A.; Clark, Jimmy M.

2016-01-01

Wastewater treatment facility (WWTF) closures are rare environmental remediation events; offering unique insight into contaminant persistence, long-term wastewater impacts, and ecosystem recovery processes. The U.S. Geological Survey assessed the fate of select endocrine disrupting chemicals (EDC) in surface water and streambed sediment one year before and one year after closure of a long-term WWTF located within the Spirit Creek watershed at Fort Gordon, Georgia. Sample sites included a WWTF-effluent control located upstream from the outfall, three downstream effluent-impacted sites located between the outfall and Spirit Lake, and one downstream from the lake's outfall. Prior to closure, the 2.2-km stream segment downstream from the WWTF outfall was characterized by EDC concentrations significantly higher (α = 0.05) than at the control site; indicating substantial downstream transport and limited in-stream attenuation of EDC, including pharmaceuticals, estrogens, alkylphenol ethoxylate (APE) metabolites, and organophosphate flame retardants (OPFR). Wastewater-derived pharmaceutical, APE metabolites, and OPFR compounds were also detected in the outflow of Spirit Lake, indicating the potential for EDC transport to aquatic ecosystems downstream of Fort Gordon under effluent discharge conditions. After the WWTF closure, no significant differences in concentrations or numbers of detected EDC compounds were observed between control and downstream locations. The results indicated EDC pseudo-persistence under preclosure, continuous supply conditions, with rapid attenuation following WWTF closure. Low concentrations of EDC at the control site throughout the study and comparable concentrations in downstream locations after WWTF closure indicated additional, continuing, upstream contaminant sources within the Spirit Creek watershed. 

Impacts of aircraft deicer and anti-icer runoff on receiving waters from Dallas/Fort Worth International Airport, Texas, U.S.A.

PubMed

Corsi, Steven R; Harwell, Glenn R; Geis, Steven W; Bergman, Daniel

2006-11-01

From October 2002 to April 2004, data were collected from Dallas/Fort Worth (DFW) International Airport (TX, U.S.A.) outfalls and receiving waters (Trigg Lake and Big Bear Creek) to document the magnitude and potential effects of aircraft deicer and anti-icer fluid (ADAF) runoff on water quality. Glycol concentrations at outfalls ranged from less than 18 to 23,800 mg/L, whereas concentrations in Big Bear Creek were less because of dilution, dispersion, and degradation, ranging from less than 18 to 230 mg/L. Annual loading results indicate that 10 and 35% of what was applied to aircraft was discharged to Big Bear Creek in 2003 and 2004, respectively. Glycol that entered Trigg Lake was diluted and degraded before reaching the lake outlet. Dissolved oxygen (DO) concentrations at airport outfalls sometimes were low (<2.0 mg/L) but typical of what was measured in an urban reference stream. In comparison, the DO concentration at Trigg Lake monitoring sites was consistently greater than 5.5 mg/L during the monitoring period, probably because of the installation of aerators in the lake by DFW personnel. The DO concentration in Big Bear Creek was very similar at sites upstream and downstream of airport influence (>5.0 mg/L). Results of toxicity tests indicate that effects on Ceriodaphnia dubia, Pimephales promelas, and Selanastrum capricornutum are influenced by type IV ADAF (anti-icer), not just type I ADAF (deicer) as is more commonly assumed.

Using spatial, seasonal, and diel drift patterns of larval Lost River suckers Deltistes luxatus (Cypriniformes: Catostomidae) and shortnose suckers Chasmistes brevirostris (Cypriniformes: Catostomidae) to help identify a site for a water withdrawal structure on the Williamson River, Oregon

USGS Publications Warehouse

Ellsworth, Craig M.; Tyler, Torrey J.; VanderKooi, Scott P.

2010-01-01

A small irrigation diversion dam near Chiloquin, Oregon, was removed and replaced with a pump station to improve fish passage for Lost River suckers (Deltistes luxatus) and shortnose suckers (Chasmistes brevirostris) entering the Sprague River on their spawning migrations. During the developmental phase of the pump station, a need was identified to better understand the larval drift characteristics of these endangered catostomids in order to reduce entrainment into the irrigation system. The spatial, seasonal, and diel distribution of drifting larvae was measured during the 2004 spawning season at two proposed sites on the Williamson River where the pump station could be located. Larval drift for both species coincided with the irrigation season making them subject to entrainment into the irrigation system. Drift occurred almost exclusively at night with larvae entering the drift at sunset and exiting the drift at sunrise. Nighttime larval densities were concentrated near the surface and at midchannel at both sites. Densities were generally greater on the side of mid-channel with greater flow. During early morning sampling we detected a general shift in larval drift from surface to subsurface drift. We also observed an increase in larval densities towards the shore opposite from the proposed pump station at the upper site whereas larval densities remained high at midchannel at the lower site. During daytime sampling, the few larvae that were collected were distributed throughout the water column at both pump sites. This study found that larvae drifting during all time periods were generally distributed further across the cross section, deeper in the water column, and closer to where the proposed water withdrawal structure would be built at the downstream site when compared to the upstream site. Recommendations were provided to locate the withdrawal facility at the upstream site and operate it in a manner such that larval entrainment would likely be minimized.

Stochastic empirical loading and dilution model (SELDM) version 1.0.0

USGS Publications Warehouse

Granato, Gregory E.

2013-01-01

The Stochastic Empirical Loading and Dilution Model (SELDM) is designed to transform complex scientific data into meaningful information about the risk of adverse effects of runoff on receiving waters, the potential need for mitigation measures, and the potential effectiveness of such management measures for reducing these risks. The U.S. Geological Survey developed SELDM in cooperation with the Federal Highway Administration to help develop planning-level estimates of event mean concentrations, flows, and loads in stormwater from a site of interest and from an upstream basin. Planning-level estimates are defined as the results of analyses used to evaluate alternative management measures; planning-level estimates are recognized to include substantial uncertainties (commonly orders of magnitude). SELDM uses information about a highway site, the associated receiving-water basin, precipitation events, stormflow, water quality, and the performance of mitigation measures to produce a stochastic population of runoff-quality variables. SELDM provides input statistics for precipitation, prestorm flow, runoff coefficients, and concentrations of selected water-quality constituents from National datasets. Input statistics may be selected on the basis of the latitude, longitude, and physical characteristics of the site of interest and the upstream basin. The user also may derive and input statistics for each variable that are specific to a given site of interest or a given area. SELDM is a stochastic model because it uses Monte Carlo methods to produce the random combinations of input variable values needed to generate the stochastic population of values for each component variable. SELDM calculates the dilution of runoff in the receiving waters and the resulting downstream event mean concentrations and annual average lake concentrations. Results are ranked, and plotting positions are calculated, to indicate the level of risk of adverse effects caused by runoff concentrations, flows, and loads on receiving waters by storm and by year. Unlike deterministic hydrologic models, SELDM is not calibrated by changing values of input variables to match a historical record of values. Instead, input values for SELDM are based on site characteristics and representative statistics for each hydrologic variable. Thus, SELDM is an empirical model based on data and statistics rather than theoretical physiochemical equations. SELDM is a lumped parameter model because the highway site, the upstream basin, and the lake basin each are represented as a single homogeneous unit. Each of these source areas is represented by average basin properties, and results from SELDM are calculated as point estimates for the site of interest. Use of the lumped parameter approach facilitates rapid specification of model parameters to develop planning-level estimates with available data. The approach allows for parsimony in the required inputs to and outputs from the model and flexibility in the use of the model. For example, SELDM can be used to model runoff from various land covers or land uses by using the highway-site definition as long as representative water quality and impervious-fraction data are available.

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

The concentration and chemical speciation of arsenic in the Nanpan River, the upstream of the Pearl River, China.

PubMed

Yang, Silin; Zhao, Ning; Zhou, Dequn; Wei, Rong; Yang, Bin; Pan, Bo

2016-04-01

The concentration and chemical speciation of arsenic (As) in different environmental matrixes (water, sediment, agricultural soils, and non-agricultural soils) were investigated in the Nanpan River area, the upstream of Pearl River, China. The results did not show any obvious transport of As along the flow direction of the river (from upstream to downstream). Total As concentrations in sediment were significantly different from those in agricultural soil. According to the comparison to quality standards, the As in sediments of the studied area have potential ecological risks and a minority of the sampling sites of agricultural soils in the studied area were polluted with As. As speciations were analyzed using sequential extraction and the percentage of non-residual fraction in sediment predominated over residual fraction. We thus believe that As in the studied area was with low mobility and bioavailability in sediment, agricultural soils, and non-agricultural soils. However, the bioavailability and mobility of As in sediment were higher than in both agricultural and non-agricultural soils, and thus, special attention should be paid for the risk assessment of As in the river in future studies.

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Translation of the first upstream ORF in the hepatitis B virus pregenomic RNA modulates translation at the core and polymerase initiation codons

PubMed Central

Chen, Augustine; Kao, Y. F.; Brown, Chris M.

2005-01-01

The human hepatitis B virus (HBV) has a compact genome encoding four major overlapping coding regions: the core, polymerase, surface and X. The polymerase initiation codon is preceded by the partially overlapping core and four or more upstream initiation codons. There is evidence that several mechanisms are used to enable the synthesis of the polymerase protein, including leaky scanning and ribosome reinitiation. We have examined the first AUG in the pregenomic RNA, it precedes that of the core. It initiates an uncharacterized short upstream open reading frame (uORF), highly conserved in all HBV subtypes, we designated the C0 ORF. This arrangement suggested that expression of the core and polymerase may be affected by this uORF. Initiation at the C0 ORF was confirmed in reporter constructs in transfected cells. The C0 ORF had an inhibitory role in downstream expression from the core initiation site in HepG2 cells and in vitro, but also stimulated reinitiation at the polymerase start when in an optimal context. Our results indicate that the C0 ORF is a determinant in balancing the synthesis of the core and polymerase proteins. PMID:15731337

Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

PubMed

Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

2018-04-06

The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

Decision support for the selection of reference sites using 137Cs as a soil erosion tracer

NASA Astrophysics Data System (ADS)

Arata, Laura; Meusburger, Katrin; Bürge, Alexandra; Zehringer, Markus; Ketterer, Michael E.; Mabit, Lionel; Alewell, Christine

2017-08-01

The classical approach of using 137Cs as a soil erosion tracer is based on the comparison between stable reference sites and sites affected by soil redistribution processes; it enables the derivation of soil erosion and deposition rates. The method is associated with potentially large sources of uncertainty with major parts of this uncertainty being associated with the selection of the reference sites. We propose a decision support tool to Check the Suitability of reference Sites (CheSS). Commonly, the variation among 137Cs inventories of spatial replicate reference samples is taken as the sole criterion to decide on the suitability of a reference inventory. Here we propose an extension of this procedure using a repeated sampling approach, in which the reference sites are resampled after a certain time period. Suitable reference sites are expected to present no significant temporal variation in their decay-corrected 137Cs depth profiles. Possible causes of variation are assessed by a decision tree. More specifically, the decision tree tests for (i) uncertainty connected to small-scale variability in 137Cs due to its heterogeneous initial fallout (such as in areas affected by the Chernobyl fallout), (ii) signs of erosion or deposition processes and (iii) artefacts due to the collection, preparation and measurement of the samples; (iv) finally, if none of the above can be assigned, this variation might be attributed to turbation processes (e.g. bioturbation, cryoturbation and mechanical turbation, such as avalanches or rockfalls). CheSS was exemplarily applied in one Swiss alpine valley where the apparent temporal variability called into question the suitability of the selected reference sites. In general we suggest the application of CheSS as a first step towards a comprehensible approach to test for the suitability of reference sites.

Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, C.H.; Wei, Li-Na; Copeland, N.G.

We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.

PubMed

Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng

2012-08-01

A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.

Nonlinearity Analysis for Efficient Modelling of Long-Term CO2 Storage

NASA Astrophysics Data System (ADS)

Li, Boxiao; Benson, Sally; Tchelepi, Hamdi

2014-05-01

Numerical simulation is widely used to predict the long-term fate of the injected CO2 in a storage formation. Performing large-scale simulations is often limited by the computational speed, where convergence failure of Newton iterations is one of the main bottlenecks. In order to design better numerical schemes and faster nonlinear solvers for modelling long-term CO2 storage, the nonlinearity in the simulations has to be analysed thoroughly, and the cause of convergence failures has to be identified clearly. We focus on the transport of CO2 and water in the presence of viscous, gravity, and heterogeneous capillary forces. We investigate the nonlinearity of the discrete transport equation obtained from finite-volume discretization with single-point phase-based upstream weighting, which is the industry standard. In particular, we study the discretized flux expressed as a function of saturations at the upstream and downstream (with respect to the total velocity) of each gridblock interface. We analyse the locations and complexity of the unit-flux, zero-flux, and inflection lines on the numerical flux. The unit- and zero-flux lines, referred to as kinks, correspond to a change of the flow direction, which often occurs when strong buoyancy and capillarity are present. We observe that these kinks and inflection lines are major sources of nonlinear convergence difficulties. We find that kinks create more challenges than inflection lines, especially when their locations depend on both the upstream and downstream saturations of the total velocity. When the flow is driven by viscous and gravity forces (e.g., during CO2 injection), one kink will occur in the numerical flux and its location depends only on the upstream saturation. However, when capillarity is dominant (e.g., during the post-injection period), two kinks will occur and both are functions of the upstream and downstream saturations, causing severe convergence difficulties particularly when heterogeneity is present. Our analysis of the numerical flux theoretically describes the cause of the convergence failures for simulating long-term CO2 storage. This understanding provides useful guidance in designing numerical schemes and nonlinear solvers that overcome the convergence bottlenecks. For example, to reduce the nonlinearity introduced by the two kinks in the presence of capillarity, we modify the method of Cances (2009) to discretize the capillary flux. Consequently, only one kink will occur even for coupled viscous, buoyancy, and heterogeneous capillary forces, and the kink depends only on the upstream saturation of the total velocity. An efficient nonlinear solver that is a significant refinement of the works of Jenny et al. (2009) and Wang and Tchelepi (2013) has also been proposed and demonstrated. References [1] C. Cances. Finite volume scheme for two-phase flows in heterogeneous porous media involving capillary pressure discontinuities. ESAIM:M2AN., 43, 973-1001, (2009). [2] P. Jenny, H.A. Tchelepi, and S.H. Lee. Unconditionally convergent nonlinear solver for hyperbolic conservation laws with S-shaped flux functions. J. Comput. Phys., 228, 7497-7512, (2009). [3] X. Wang and H.A. Tchelepi. Trust-region based solver for nonlinear transport in heterogeneous porous media. J. Comput. Phys., 253, 114-137, (2013).

Determining sources of dissolved organic carbon and disinfection byproduct precursors to the McKenzie River, Oregon

USGS Publications Warehouse

Kraus, Tamara E.C.; Anderson, Chauncey W.; Morgenstern, Karl; Downing, Bryan D.; Pellerin, Brian A.; Bergamaschi, Brian A.

2010-01-01

This study was conducted to determine the main sources of dissolved organic carbon (DOC) and disinfection byproduct (DBP) precursors to the McKenzie River, Oregon (USA). Water samples collected from the mainstem, tributaries, and reservoir outflows were analyzed for DOC concentration and DBP formation potentials (trihalomethanes [THMFPs] and haloacetic acids [HAAFPs]). In addition, optical properties (absorbance and fluorescence) of dissolved organic matter (DOM) were measured to provide insight into DOM composition and assess whether optical properties are useful proxies for DOC and DBP precursor concentrations. Optical properties indicative of composition suggest that DOM in the McKenzie River mainstem was primarily allochthonous - derived from soils and plant material in the upstream watershed. Downstream tributaries had higher DOC concentrations than mainstem sites (1.6 ?? 0.4 vs. 0.7 ?? 0.3 mg L-1) but comprised <5% of mainstem flows and had minimal effect on overall DBP precursor loads. Water exiting two large upstream reservoirs also had higher DOC concentrations than the mainstem site upstream of the reservoirs, but optical data did not support in situ algal production as a source of the added DOC during the study. Results suggest that the first major rain event in the fall contributes DOM with high DBP precursor content. Although there was interference in the absorbance spectra in downstream tributary samples, fluorescence data were strongly correlated to DOC concentration (R 2 = 0.98), THMFP (R2 = 0.98), and HAAFP (R2 = 0.96). These results highlight the value of using optical measurements for identifying the concentration and sources of DBP precursors in watersheds, which will help drinking water utilities improve source water monitoring and management programs. Copyright ?? 2010 by the American Society of Agronomy.

Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

PubMed Central

Datta, Kausiki; von Hippel, Peter H.

2008-01-01

Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

Effects of streambank fencing of pasture land on benthic macroinvertebrates and the quality of surface water and shallow ground water in the Big Spring Run basin of Mill Creek watershed, Lancaster County, Pennsylvania, 1993-2001

USGS Publications Warehouse

Galeone, Daniel G.; Brightbill, Robin A.; Low, Dennis J.; O'Brien, David L.

2006-01-01

Streambank fencing along stream channels in pastured areas and the exclusion of pasture animals from the channel are best-management practices designed to reduce nutrient and suspended-sediment yields from drainage basins. Establishment of vegetation in the fenced area helps to stabilize streambanks and provides better habitat for wildlife in and near the stream. This study documented the effectiveness of a 5- to 12-foot-wide buffer strip on the quality of surface water and near-stream ground water in a 1.42-mi2 treatment basin in Lancaster County, Pa. Two miles of stream were fenced in the basin in 1997 following a 3- to 4-year pre-treatment period of monitoring surface- and ground-water variables in the treatment and control basins. Changes in surface- and ground-water quality were monitored for about 4 years after fence installation. To alleviate problems in result interpretation associated with climatic and hydrologic variation over the study period, a nested experimental design including paired-basin and upstream/downstream components was used to study the effects of fencing on surface-water quality and benthic-macroinvertebrate communities. Five surface-water sites, one at the outlet of a 1.77-mi2 control basin (C-1), two sites in the treatment basin (T-3 and T-4) that were above any fence installation, and two sites (one at an upstream tributary site (T-2) and one at the outlet (T-1)) that were treated, were sampled intensively. Low-flow samples were collected at each site (approximately 25-30 per year at each site), and stormflow was sampled with automatic samplers at all sites except T-3. For each site where stormflow was sampled, from 35 to 60 percent of the storm events were sampled over the entire study period. Surface-water sites were sampled for analyses of nutrients, suspended sediment, and fecal streptococcus (only low-flow samples), with field parameters (only low-flow samples) measured during sample collection. Benthic-macroinvertebrate samples were collected in May and September of each year; samples were collected at the outlet of the control and treatment basins and at three upstream sites, two in the treatment basin and one in the control basin. For each benthic-macroinvertebrate sample: Stream riffles and pools were sampled using the kick-net method; habitat was characterized using Rapid Bioassessment Protocols (RBP); water-quality samples were collected for nutrients and suspended sediment; stream field parameters were measured; and multiple biological metrics were calculated. The experimental design to study the effects of fencing on the quality of near-stream shallow ground water involved a nested well approach. Two well nests were in the treatment basin, one each at surface-water sites T-1 and T-2. Within each well nest, the data from one deep well and three shallow wells (no greater than 12 ft deep) were used for regional characterization of ground-water quality. At each site, two of the shallow wells were inside the eventual fence (treated wells); the other shallow well was outside the eventual fence (control well). The wells were sampled monthly, primarily during periods with little to no recharge, for laboratory analysis of nutrients and fecal streptococcus; field parameters of water quality also were measured.

Assessing dissolved carbon transport and transformation along an estuarine river with stable isotope analyses

NASA Astrophysics Data System (ADS)

He, Songjie; Xu, Y. Jun

2017-10-01

Estuaries play an important role in the dynamics of dissolved carbon from rivers to coastal oceans. However, our knowledge of dissolved carbon transport and transformation in mixing zones of the world's coastal rivers is still limited. This study aims to determine how dissolved inorganic carbon (DIC) and dissolved organic carbon (DOC) concentrations and stable isotopes (δ13CDIC and δ13CDOC) change along an 88-km long estuarine river, the Calcasieu River in Louisiana, southern USA, with salinity ranging from 0.02 to 21.92. The study is expected to elucidate which processes most likely control carbon dynamics in a freshwater-saltwater mixing system, and to evaluate the net metabolism of this estuary. Between May 2015 and February 2016, water samples were collected and in-situ measurements on ambient water conditions were performed during five field trips at six sites from upstream to downstream of the Calcasieu River, which enters the Northern Gulf of Mexico (NGOM). The DIC concentration and δ13CDIC increased rapidly with increasing salinity in the mixing zone. The average DIC concentration and δ13CDIC at the site closest to the NGOM (site 6) were 1.31 mM and -6.34‰, respectively, much higher than those at the site furthest upstream (site 1, 0.42 mM and -20.83‰). The DIC concentrations appeared to be largely influenced by conservative mixing, while high water temperature may have played a role in deviating DIC concentration from the conservative line due likely to increased respiration and decomposition. The δ13CDIC values were close to those suggested by the conservative mixing model for May, June and November, but lower than those for July and February, suggesting that an estuarine river can fluctuate from a balanced to a heterotrophic system (i.e., production/respiration (P/R) < 1) seasonally. Unlike the DIC longitudinal trend, the DOC concentrations in the river estuary decreased from upstream to downstream, but to a much smaller degree. The DOC concentrations consistently showed a deviation from those suggested by the conservative mixing model, which may have been a consequence of in-stream photosynthesis. This river estuary consistently showed depleted δ13CDOC values (i.e., from -30.56‰ to -25.92‰), suggesting that the DOC source in the mixing zone was highly terrestrially derived. However, in this relatively small isotopic range, δ13CDOC alone has limitations in differentiating carbon produced by aquatic photosynthesis from carbon produced by terrestrial photosynthesis in a river-ocean continuum.

Occurrence and sources of Escherichia coli in metropolitan St. Louis streams, October 2004 through September 2007

USGS Publications Warehouse

Wilkison, Donald H.; Davis, Jerri V.

2010-01-01

The occurrence and sources of Escherichia coli (E. coli), one of several fecal indicator bacteria, in metropolitan St. Louis streams known to receive nonpoint source runoff, occasional discharges from combined and sanitary sewers, and treated wastewater effluent were investigated from October 2004 through September 2007. Three Missouri River sites, five Mississippi River sites, and six small basin tributary stream sites were sampled during base flow and storm events for the presence of E. coli and their sources. E. coli host-source determinations were conducted using local library based genotypic methods. Human fecal contamination in stream samples was additionally confirmed by the presence of Bacteroides thetaiotaomicron, an anaerobic, enteric bacterium with a high occurrence in, and specificity to, humans. Missouri River E. coli densities and loads during base flow were approximately 10 times greater than those in the Mississippi River above its confluence with the Missouri River. Although substantial amounts of E. coli originated from within the study area during base flow and storm events, considerable amounts of E. coli in the Missouri River, as well as in the middle Mississippi River sections downstream from its confluence with the Missouri River, originated in Missouri River reaches upstream from the study area. In lower Mississippi River reaches, bacteria contributions from the numerous combined and sanitary sewer overflows within the study area, as well as contributions from nonpoint source runoff, greatly increased instream E. coli densities. Although other urban factors cannot be discounted, average E. coli densities in streams were strongly correlated with the number of upstream combined and sanitary sewer overflow points, and the percentage of upstream impervious cover. Small basin sites with the greatest number of combined and sanitary sewer overflows (Maline Creek and the River des Peres) had larger E. coli densities, larger loads, and a greater percentage of E. coli attributable to humans than other small basin sites; however, even though small basin E. coli densities typically were much larger than in large river receiving streams, small basins contributed, on average, only a small part (a maximum of 16 percent) of the total E. coli load to larger rivers. On average, approximately one-third of E. coli in metropolitan St. Louis streams was identified as originating from humans. Another one-third of the E. coli was determined to have originated from unidentified sources; dogs and geese contributed lesser amounts, 10 and 20 percent, of the total instream bacteria. Sources of E. coli were largely independent of hydrologic conditions-an indication that sources remained relatively consistent with time.

StreamStats: A water resources web application

USGS Publications Warehouse

Ries, Kernell G.; Guthrie, John G.; Rea, Alan H.; Steeves, Peter A.; Stewart, David W.

2008-01-01

Streamflow statistics, such as the 1-percent flood, the mean flow, and the 7-day 10-year low flow, are used by engineers, land managers, biologists, and many others to help guide decisions in their everyday work. For example, estimates of the 1-percent flood (the flow that is exceeded, on average, once in 100 years and has a 1-percent chance of being exceeded in any year, sometimes referred to as the 100-year flood) are used to create flood-plain maps that form the basis for setting insurance rates and land-use zoning. This and other streamflow statistics also are used for dam, bridge, and culvert design; water-supply planning and management; water-use appropriations and permitting; wastewater and industrial discharge permitting; hydropower facility design and regulation; and the setting of minimum required streamflows to protect freshwater ecosystems. In addition, researchers, planners, regulators, and others often need to know the physical and climatic characteristics of the drainage basins (basin characteristics) and the influence of human activities, such as dams and water withdrawals, on streamflow upstream from locations of interest to understand the mechanisms that control water availability and quality at those locations. Knowledge of the streamflow network and downstream human activities also is necessary to adequately determine whether an upstream activity, such as a water withdrawal, can be allowed without adversely affecting downstream activities.Streamflow statistics could be needed at any location along a stream. Most often, streamflow statistics are needed at ungaged sites, where no streamflow data are available to compute the statistics. At U.S. Geological Survey (USGS) streamflow data-collection stations, which include streamgaging stations, partial-record stations, and miscellaneous-measurement stations, streamflow statistics can be computed from available data for the stations. Streamflow data are collected continuously at streamgaging stations. Streamflow measurements are collected systematically over a period of years at partial-record stations to estimate peak-flow or low-flow statistics. Streamflow measurements usually are collected at miscellaneous-measurement stations for specific hydrologic studies with various objectives.StreamStats is a Web-based Geographic Information System (GIS) application that was created by the USGS, in cooperation with Environmental Systems Research Institute, Inc. (ESRI)1, to provide users with access to an assortment of analytical tools that are useful for water-resources planning and management. StreamStats functionality is based on ESRI’s ArcHydro Data Model and Tools, described on the Web at http://resources.arcgis.com/en/communities/hydro/01vn0000000s000000.htm. StreamStats allows users to easily obtain streamflow statistics, basin characteristics, and descriptive information for USGS data-collection stations and user-selected ungaged sites. It also allows users to identify stream reaches that are upstream and downstream from user-selected sites, and to identify and obtain information for locations along the streams where activities that may affect streamflow conditions are occurring. This functionality can be accessed through a map-based user interface that appears in the user’s Web browser, or individual functions can be requested remotely as Web services by other Web or desktop computer applications. StreamStats can perform these analyses much faster than historically used manual techniques.StreamStats was designed so that each state would be implemented as a separate application, with a reliance on local partnerships to fund the individual applications, and a goal of eventual full national implementation. Idaho became the first state to implement StreamStats in 2003. By mid-2008, 14 states had applications available to the public, and 18 other states were in various stages of implementation.

Runoff and water-quality characteristics of three Discovery Farms in North Dakota, 2008–16

USGS Publications Warehouse

Galloway, Joel M.; Nustad, Rochelle A.

2017-12-21

Agricultural producers in North Dakota are aware of concerns about degrading water quality, and many of the producers are interested in implementing conservation practices to reduce the export of nutrients from their farms. Producers often implement conservation practices without knowledge of the water quality of the runoff from their farm or if conservation practices they may implement have any effect on water quality. In response to this lack of information, the U.S. Geological Survey, in cooperation with North Dakota State University Extension Service and in coordination with an advisory group consisting of State agencies, agricultural producers, and commodity groups, implemented a monitoring study as part of a Discovery Farms program in North Dakota in 2007. Three data-collection sites were established at each of three farms near Underwood, Embden, and Dazey, North Dakota. The purpose of this report is to describe runoff and water-quality characteristics using data collected at the three Discovery Farms during 2008–16. Runoff and water-quality data were used to help describe the implications of agricultural conservation practices on runoff and water-quality patterns.Runoff characteristics of monitoring sites at the three farms were determined by measuring flow volume and precipitation. Runoff at the Underwood farm monitoring sites generally was controlled by precipitation in the area, antecedent soil moisture conditions, and, after 2012, possibly by the diversion ditch constructed by the producer. Most of the annual runoff was in March and April each year during spring snowmelt. Runoff characteristics at the Embden farm are complex because of the mix of surface runoff and flow through two separate drainage tile systems. Annual flow volumes for the drainage tiles sites (sites E2 and E3) were several orders of magnitude greater than measured at the surface water site E1. Site E1 generally only had runoff briefly in March and April during spring snowmelt and during only a few large rain events throughout 2009–16. Flow was somewhat continuous at sites E2 and E3 throughout the year during years of increased precipitation, such as in 2010 and 2011. At Dazey farm, annual flow volumes at the most downstream site D3 for 2010–15 ranged from 88 acre-feet (2012) to 12,060 acre-feet (2010). The largest monthly runoff volumes at D1 (most upstream site; combination of data from site D1a [original site] and site D1b [relocated site]) and D3 were in March and April during spring snowmelt runoff and rain events.At Underwood farm, total ammonia and total phosphorus had the highest concentrations at the most upstream site (U1) and decreased sequentially at sites U2 and U3 downstream. Total ammonia and total phosphorus concentrations at the sites for Underwood farm also generally were higher than measured at sites for the Dazey and Embden farms. At Embden farm, nitrate plus nitrite concentrations were lowest at site E1 (surface-water site) and highest at sites E2 and E3 (drainage tile sites). Nitrate plus nitrite concentrations at sites E2 and E3 also were the highest among all the sites at all three farms. Median total nitrate plus nitrite concentrations for sites E1, E2, and E3 were 0.22, 13, and 10 milligrams per liter as nitrogen, respectively. Nutrient concentrations generally were greater at site D1 (most upstream site) compared to site D3 (most downstream site) at Dazey farm. Higher concentrations at site D1, which is farther upstream and closer to potential sources of nutrients, compared to lower concentrations at site D3, which is farther downstream and receives more runoff, indicates that dilution may be the reason concentrations decrease downstream.Annual loads for chloride at all three Underwood sites were the greatest in 2011 and the least in 2012, which coincided with years of the greatest and least annual flow volume, respectively. Total ammonia had a similar pattern at the three sites. Nitrate plus nitrite loads displayed a different pattern than chloride and total ammonia, indicating possible different sources. Chloride, total ammonia, total phosphorus, and suspended sediment were transported past site U1 mostly in March and the least from July through October. Monthly nitrate plus nitrite loads had a different pattern than the other constituents, indicating other possible sources such as fertilizer application in the surrounding cropland.Annual loads for Embden farm were considerably greater at sites E2 and E3 compared to site E1. Annual yields for all constituents also were substantially greater at sites E2 and E3 compared to site E1, mainly because of a combination of higher flow volumes and small contributing drainage areas at sites E2 and E3 compared to site E1.The greatest annual loads at Dazey farm site D3 for chloride, nitrate plus nitrite, and suspended sediment were in 2010 and 2011, and zero loads were estimated for 2012 because no flow was measured at the site. Mean monthly loads generally were greatest for most constituents in March and April at sites D1 and D3 except for suspended sediment that had the greatest monthly loads in May.To mitigate runoff and water-quality effects of their operations, the producers implemented various agricultural conservation practices before and during the Discovery Farms monitoring. Even though it was difficult to quantify the effects of the agricultural conservation practices implemented at the farms, the data collected from the Discovery Farms program provided a better understanding of some of the variables that affect runoff and water quality.

Dam Breach Release of Non-Cohesive Sediments: Channel Response and Recovery Rates

NASA Astrophysics Data System (ADS)

Collins, M. J.; Boardman, G.; Banks, W.; Andrews, M.; Conlon, M.; Dillow, J. J. A.; Gellis, A.; Lowe, S.; McClain, S.; Miller, A. J.; Snyder, N. P.; Wilcock, P. R.

2014-12-01

Dam removals featuring unchecked releases of non-cohesive sediments are excellent opportunities to learn more about stream channel response to abrupt increases in bed material supply that can occur deliberately or by natural processes like landslides and volcanic eruptions. Understanding channel response to sediment pulses, including response rates, is essential because human uses of river channels and floodplains are impacted by these events as are aquatic habitats. We had the opportunity to study a dam removal site at the Simkins Dam in Maryland, USA, that shares many important geophysical attributes of another well-studied dam removal in the humid northeast United States [Merrimack Village Dam, New Hampshire; Pearson et al., 2011]. The watershed sizes are the same order of magnitude (102 km2), and at both sites relatively low head dams were removed (~ 3-4 m) and ~60,000 m3 of dominantly sand-sized sediments discharged to low-gradient reaches immediately downstream. Analyzing four years of repeat morphometry and bed sediment grain size surveys at the Simkins site on the Patapsco River, as well as continuous discharge and suspended sediment gaging data, we clearly document a two-phase response in the upstream reach as described by Pearson et al. [2011] for their New Hampshire site and noted at other dam removals [e.g., Major et al., 2012]. In the early phase, approximately 50% of the impounded sediment mass was eroded rapidly over a period of about three months when flows were very modest (Figure 1). After incision to base level and channel widening in the former impoundment, a second phase began when further erosion depended on floods large enough to access impounded sediments more distant from the newly-formed channel. We also found important differences in the upstream responses at the Maryland and New Hampshire sites that appear to be related to valley type (non-glaciated versus glaciated, respectively). Response variances immediately downstream between the respective sites are potentially related to local gradient and hydraulics.

Didymosphenia geminata in the Upper Esopus Creek: current status, variability, and controlling factors

USGS Publications Warehouse

George, Scott D.; Baldigo, Barry P.

2015-01-01

In May of 2009, the bloom-forming diatom Didymosphenia geminata was first identified in the Upper Esopus Creek, a key tributary to the New York City water-supply and a popular recreational stream. The Upper Esopus receives supplemental flows from the Shandaken Portal, an underground aqueduct delivering waters from a nearby basin. The presence of D.geminata is a concern for the local economy, water supply, and aquatic ecosystem because nuisance blooms have been linked to degraded stream condition in other regions. Here we ascertain the extent and severity of the D. geminata invasion, determine the impact of supplemental flows from the Portal on D. geminata, and identify potential factors that may limitD. geminata in the watershed. Stream temperature, discharge, and water quality were characterized at select sites and periphyton samples were collected five times at 6 to 20 study sites between 2009 and 2010 to assess standing crop, diatom community structure, and density of D. geminata and all diatoms. Density of D. geminata ranged from 0–12 cells cm-2 at tributary sites, 0–781 cells cm-2 at sites upstream of the Portal, and 0–2,574 cells cm-2 at sites downstream of the Portal. Survey period and Portal (upstream or downstream) each significantly affected D. geminata cell density. In general, D. geminata was most abundant during the November 2009 and June 2010 surveys and at sites immediately downstream of the Portal. We found that D. geminata did not reach nuisance levels or strongly affect the periphyton community. Similarly, companion studies showed that local macroinvertebrate and fish communities were generally unaffected. A number of abiotic factors including variable flows and moderate levels of phosphorous and suspended sediment may limit blooms of D. geminatain this watershed.