Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

PubMed

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

PubMed Central

Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

2014-01-01

The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

NASA Astrophysics Data System (ADS)

Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

1994-07-01

We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Analysis of C. elegans VIG-1 expression.

PubMed

Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

2008-12-31

Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

Cloning and Characterization of 5′ Flanking Regulatory Sequences of AhLEC1B Gene from Arachis Hypogaea L.

PubMed Central

Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei

2015-01-01

LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444

The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsugu, H.; Horowitz, R.; Gibson, N.

1994-12-01

Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

PubMed Central

Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

1994-01-01

Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

PubMed

Sakumi, K; Sekiguchi, M

1989-01-20

The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Abundance and functional diversity of riboswitches in microbial communities

PubMed Central

Kazanov, Marat D; Vitreschak, Alexey G; Gelfand, Mikhail S

2007-01-01

Background Several recently completed large-scale enviromental sequencing projects produced a large amount of genetic information about microbial communities ('metagenomes') which is not biased towards cultured organisms. It is a good source for estimation of the abundance of genes and regulatory structures in both known and unknown members of microbial communities. In this study we consider the distribution of RNA regulatory structures, riboswitches, in the Sargasso Sea, Minnesota Soil and Whale Falls metagenomes. Results Over three hundred riboswitches were found in about 2 Gbp metagenome DNA sequences. The abundabce of riboswitches in metagenomes was highest for the TPP, B12 and GCVT riboswitches; the S-box, RFN, YKKC/YXKD, YYBP/YKOY regulatory elements showed lower but significant abundance, while the LYS, G-box, GLMS and YKOK riboswitches were rare. Regions downstream of identified riboswitches were scanned for open reading frames. Comparative analysis of identified ORFs revealed new riboswitch-regulated functions for several classes of riboswitches. In particular, we have observed phosphoserine aminotransferase serC (COG1932) and malate synthase glcB (COG2225) to be regulated by the glycine (GCVT) riboswitch; fatty acid desaturase ole1 (COG1398), by the cobalamin (B12) riboswitch; 5-methylthioribose-1-phosphate isomerase ykrS (COG0182), by the SAM-riboswitch. We also identified conserved riboswitches upstream of genes of unknown function: thiamine (TPP), cobalamine (B12), and glycine (GCVT, upstream of genes from COG4198). Conclusion This study demonstrates applicability of bioinformatics to the analysis of RNA regulatory structures in metagenomes. PMID:17908319

Computational methods in sequence and structure prediction

NASA Astrophysics Data System (ADS)

Lang, Caiyi

This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed a software package which is capable of designing novel protein structures at the atomic resolution. This software package allows us to perform protein structure design with a flexible backbone. The backbone flexibility includes loop region relaxation as well as a secondary structure collective mode relaxation scheme. (Abstract shortened by UMI.)

VIZARD: analysis of Affymetrix Arabidopsis GeneChip data

NASA Technical Reports Server (NTRS)

Moseyko, Nick; Feldman, Lewis J.

2002-01-01

SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at http://www.anm.f2s.com/research/vizard/ CONTACT: moseyko@uclink4.berkeley.edu.

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

PubMed Central

Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

1993-01-01

Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

DOE PAGES

Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina; ...

2015-11-10

Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina

Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

Modulation of tissue repair by regeneration enhancer elements.

PubMed

Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

2016-04-14

How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

PubMed

Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

2000-08-01

We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

PubMed Central

Zheng, Zhaoqing; Keifer, Joyce

2014-01-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

PubMed

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

PubMed Central

Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

2001-01-01

The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

Influence of gene dosage and autoregulation of the regulatory genes INO2 and INO4 on inositol/choline-repressible gene transcription in the yeast Saccharomyces cerevisiae.

PubMed

Schwank, S; Hoffmann, B; Sch-uller, H J

1997-06-01

Expression of structural genes of phospholipid biosynthesis in yeast is mediated by the inositol/choline-responsive element (ICRE). ICRE-dependent gene activation, requiring the regulatory genes INO2 and INO4, is repressed in the presence of the phospholipid precursors inositol and choline. INO2 and, to a less extent, INO4 are positively autoregulated by functional ICRE sequences in the respective upstream regions. However, an INO2 allele devoid of its ICRE functionally complemented an ino2 mutation and completely restored inositol/choline regulation of Ino2p-dependent reporter genes. Low-level expression of INO2 and INO4 genes, each under control of the heterologous MET25 promoter, did not alter the regulatory pattern of target genes. Thus, upstream regions of INO2 and INO4 are not crucial for transcriptional control of ICRE-dependent genes by inositol and choline. Interestingly, over-expression of INO2, but not of INO4, counteracted repression by phospholipid precursors. Possibly, a functional antagonism between INO2 and a negative regulator is the key event responsible for repression or de-repression.

Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

1999-11-19

As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

PubMed Central

Selinger, David A.; Chandler, Vicki L.

2001-01-01

The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sternberg, E.A.; Spizz, G.; Perry, W.M.

1988-07-01

Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Transcriptional Regulation in Saccharomyces cerevisiae: Transcription Factor Regulation and Function, Mechanisms of Initiation, and Roles of Activators and Coactivators

PubMed Central

Hahn, Steven; Young, Elton T.

2011-01-01

Here we review recent advances in understanding the regulation of mRNA synthesis in Saccharomyces cerevisiae. Many fundamental gene regulatory mechanisms have been conserved in all eukaryotes, and budding yeast has been at the forefront in the discovery and dissection of these conserved mechanisms. Topics covered include upstream activation sequence and promoter structure, transcription factor classification, and examples of regulated transcription factor activity. We also examine advances in understanding the RNA polymerase II transcription machinery, conserved coactivator complexes, transcription activation domains, and the cooperation of these factors in gene regulatory mechanisms. PMID:22084422

Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

PubMed

Lin, Min; Dan, Hanhong; Li, Yijing

2004-02-01

Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica.

PubMed

Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M

2015-12-01

Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

Deep learning of the regulatory grammar of yeast 5′ untranslated regions from 500,000 random sequences

PubMed Central

Groves, Benjamin; Kuchina, Anna; Rosenberg, Alexander B.; Jojic, Nebojsa; Fields, Stanley; Seelig, Georg

2017-01-01

Our ability to predict protein expression from DNA sequence alone remains poor, reflecting our limited understanding of cis-regulatory grammar and hampering the design of engineered genes for synthetic biology applications. Here, we generate a model that predicts the protein expression of the 5′ untranslated region (UTR) of mRNAs in the yeast Saccharomyces cerevisiae. We constructed a library of half a million 50-nucleotide-long random 5′ UTRs and assayed their activity in a massively parallel growth selection experiment. The resulting data allow us to quantify the impact on protein expression of Kozak sequence composition, upstream open reading frames (uORFs), and secondary structure. We trained a convolutional neural network (CNN) on the random library and showed that it performs well at predicting the protein expression of both a held-out set of the random 5′ UTRs as well as native S. cerevisiae 5′ UTRs. The model additionally was used to computationally evolve highly active 5′ UTRs. We confirmed experimentally that the great majority of the evolved sequences led to higher protein expression rates than the starting sequences, demonstrating the predictive power of this model. PMID:29097404

The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

1988-01-01

Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

An ant colony optimization based algorithm for identifying gene regulatory elements.

PubMed

Liu, Wei; Chen, Hanwu; Chen, Ling

2013-08-01

It is one of the most important tasks in bioinformatics to identify the regulatory elements in gene sequences. Most of the existing algorithms for identifying regulatory elements are inclined to converge into a local optimum, and have high time complexity. Ant Colony Optimization (ACO) is a meta-heuristic method based on swarm intelligence and is derived from a model inspired by the collective foraging behavior of real ants. Taking advantage of the ACO in traits such as self-organization and robustness, this paper designs and implements an ACO based algorithm named ACRI (ant-colony-regulatory-identification) for identifying all possible binding sites of transcription factor from the upstream of co-expressed genes. To accelerate the ants' searching process, a strategy of local optimization is presented to adjust the ants' start positions on the searched sequences. By exploiting the powerful optimization ability of ACO, the algorithm ACRI can not only improve precision of the results, but also achieve a very high speed. Experimental results on real world datasets show that ACRI can outperform other traditional algorithms in the respects of speed and quality of solutions. Copyright © 2013 Elsevier Ltd. All rights reserved.

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

Disease-Causing 7.4 kb Cis-Regulatory Deletion Disrupting Conserved Non-Coding Sequences and Their Interaction with the FOXL2 Promotor: Implications for Mutation Screening

PubMed Central

Dostie, Josée; Lemire, Edmond; Bouchard, Philippe; Field, Michael; Jones, Kristie; Lorenz, Birgit; Menten, Björn; Buysse, Karen; Pattyn, Filip; Friedli, Marc; Ucla, Catherine; Rossier, Colette; Wyss, Carine; Speleman, Frank; De Paepe, Anne; Dekker, Job; Antonarakis, Stylianos E.; De Baere, Elfride

2009-01-01

To date, the contribution of disrupted potentially cis-regulatory conserved non-coding sequences (CNCs) to human disease is most likely underestimated, as no systematic screens for putative deleterious variations in CNCs have been conducted. As a model for monogenic disease we studied the involvement of genetic changes of CNCs in the cis-regulatory domain of FOXL2 in blepharophimosis syndrome (BPES). Fifty-seven molecularly unsolved BPES patients underwent high-resolution copy number screening and targeted sequencing of CNCs. Apart from three larger distant deletions, a de novo deletion as small as 7.4 kb was found at 283 kb 5′ to FOXL2. The deletion appeared to be triggered by an H-DNA-induced double-stranded break (DSB). In addition, it disrupts a novel long non-coding RNA (ncRNA) PISRT1 and 8 CNCs. The regulatory potential of the deleted CNCs was substantiated by in vitro luciferase assays. Interestingly, Chromosome Conformation Capture (3C) of a 625 kb region surrounding FOXL2 in expressing cellular systems revealed physical interactions of three upstream fragments and the FOXL2 core promoter. Importantly, one of these contains the 7.4 kb deleted fragment. Overall, this study revealed the smallest distant deletion causing monogenic disease and impacts upon the concept of mutation screening in human disease and developmental disorders in particular. PMID:19543368

A genome-wide SNP scan accelerates trait-regulatory genomic loci identification in chickpea

PubMed Central

Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C.L.L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

We identified 44844 high-quality SNPs by sequencing 92 diverse chickpea accessions belonging to a seed and pod trait-specific association panel using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays. A GWAS (genome-wide association study) in an association panel of 211, including the 92 sequenced accessions, identified 22 major genomic loci showing significant association (explaining 23–47% phenotypic variation) with pod and seed number/plant and 100-seed weight. Eighteen trait-regulatory major genomic loci underlying 13 robust QTLs were validated and mapped on an intra-specific genetic linkage map by QTL mapping. A combinatorial approach of GWAS, QTL mapping and gene haplotype-specific LD mapping and transcript profiling uncovered one superior haplotype and favourable natural allelic variants in the upstream regulatory region of a CesA-type cellulose synthase (Ca_Kabuli_CesA3) gene regulating high pod and seed number/plant (explaining 47% phenotypic variation) in chickpea. The up-regulation of this superior gene haplotype correlated with increased transcript expression of Ca_Kabuli_CesA3 gene in the pollen and pod of high pod/seed number accession, resulting in higher cellulose accumulation for normal pollen and pollen tube growth. A rapid combinatorial genome-wide SNP genotyping-based approach has potential to dissect complex quantitative agronomic traits and delineate trait-regulatory genomic loci (candidate genes) for genetic enhancement in crop plants, including chickpea. PMID:26058368

Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

PubMed

Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

1994-05-01

Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

PubMed

Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

1995-01-01

Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells

PubMed Central

Camp, J. Gray; Weiser, Matthew; Cocchiaro, Jordan L.; Kingsley, David M.; Furey, Terrence S.; Sheikh, Shehzad Z.; Rawls, John F.

2017-01-01

The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs) in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS) found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development and physiology. PMID:28850571

Constraints on the evolution of a doublesex target gene arising from doublesex’s pleiotropic deployment

PubMed Central

Luo, Shengzhan D.; Baker, Bruce S.

2015-01-01

“Regulatory evolution,” that is, changes in a gene’s expression pattern through changes at its regulatory sequence, rather than changes at the coding sequence of the gene or changes of the upstream transcription factors, has been increasingly recognized as a pervasive evolution mechanism. Many somatic sexually dimorphic features of Drosophila melanogaster are the results of gene expression regulated by the doublesex (dsx) gene, which encodes sex-specific transcription factors (DSXF in females and DSXM in males). Rapid changes in such sexually dimorphic features are likely a result of changes at the regulatory sequence of the target genes. We focused on the Flavin-containing monooxygenase-2 (Fmo-2) gene, a likely direct dsx target, to elucidate how sexually dimorphic expression and its evolution are brought about. We found that dsx is deployed to regulate the Fmo-2 transcription both in the midgut and in fat body cells of the spermatheca (a female-specific tissue), through a canonical DSX-binding site in the Fmo-2 regulatory sequence. In the melanogaster group, Fmo-2 transcription in the midgut has evolved rapidly, in contrast to the conserved spermathecal transcription. We identified two cis-regulatory modules (CRM-p and CRM-d) that direct sexually monomorphic or dimorphic Fmo-2 transcription, respectively, in the midguts of these species. Changes of Fmo-2 transcription in the midgut from sexually dimorphic to sexually monomorphic in some species are caused by the loss of CRM-d function, but not the loss of the canonical DSX-binding site. Thus, conferring transcriptional regulation on a CRM level allows the regulation to evolve rapidly in one tissue while evading evolutionary constraints posed by other tissues. PMID:25675536

A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.

PubMed

Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J

2012-09-01

Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification of a cis-Regulatory Element Involved in Phytochrome Down-Regulated Expression of the Pea Small GTPase Gene pra21

PubMed Central

Inaba, Takehito; Nagano, Yukio; Sakakibara, Toshihiro; Sasaki, Yukiko

1999-01-01

The pra2 gene encodes a pea (Pisum sativum) small GTPase belonging to the YPT/rab family, and its expression is down-regulated by light, mediated by phytochrome. We have isolated and characterized a genomic clone of this gene and constructed a fusion DNA of its 5′-upstream region in front of the gene for firefly luciferase. Using this construct in a transient assay, we determined a pra2 cis-regulatory region sufficient to direct the light down-regulation of the luciferase reporter gene. Both 5′- and internal deletion analyses revealed that the 93-bp sequence between −734 and −642 from the transcriptional start site was important for phytochrome down-regulation. Gain-of-function analysis showed that this 93-bp region could confer light down-regulation when fused to the cauliflower mosaic virus 35S promoter. Furthermore, linker-scanning analysis showed that a 12-bp sequence within the 93-bp region mediated phytochrome down-regulation. Gel-retardation analysis showed the presence of a nuclear factor that was specifically bound to the 12-bp sequence in vitro. These results indicate that this element is a cis-regulatory element involved in phytochrome down-regulated expression. PMID:10364400

[Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

PubMed

Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

2013-10-01

Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.

PubMed

Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning

2016-08-01

miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.

Search for 5'-leader regulatory RNA structures based on gene annotation aided by the RiboGap database.

PubMed

Naghdi, Mohammad Reza; Smail, Katia; Wang, Joy X; Wade, Fallou; Breaker, Ronald R; Perreault, Jonathan

2017-03-15

The discovery of noncoding RNAs (ncRNAs) and their importance for gene regulation led us to develop bioinformatics tools to pursue the discovery of novel ncRNAs. Finding ncRNAs de novo is challenging, first due to the difficulty of retrieving large numbers of sequences for given gene activities, and second due to exponential demands on calculation needed for comparative genomics on a large scale. Recently, several tools for the prediction of conserved RNA secondary structure were developed, but many of them are not designed to uncover new ncRNAs, or are too slow for conducting analyses on a large scale. Here we present various approaches using the database RiboGap as a primary tool for finding known ncRNAs and for uncovering simple sequence motifs with regulatory roles. This database also can be used to easily extract intergenic sequences of eubacteria and archaea to find conserved RNA structures upstream of given genes. We also show how to extend analysis further to choose the best candidate ncRNAs for experimental validation. Copyright © 2017 Elsevier Inc. All rights reserved.

Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

PubMed Central

Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

2002-01-01

κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

Conserved noncoding sequences conserve biological networks and influence genome evolution.

PubMed

Xie, Jianbo; Qian, Kecheng; Si, Jingna; Xiao, Liang; Ci, Dong; Zhang, Deqiang

2018-05-01

Comparative genomics approaches have identified numerous conserved cis-regulatory sequences near genes in plant genomes. Despite the identification of these conserved noncoding sequences (CNSs), our knowledge of their functional importance and selection remains limited. Here, we used a combination of DNA methylome analysis, microarray expression analyses, and functional annotation to study these sequences in the model tree Populus trichocarpa. Methylation in CG contexts and non-CG contexts was lower in CNSs, particularly CNSs in the 5'-upstream regions of genes, compared with other sites in the genome. We observed that CNSs are enriched in genes with transcription and binding functions, and this also associated with syntenic genes and those from whole-genome duplications, suggesting that cis-regulatory sequences play a key role in genome evolution. We detected a significant positive correlation between CNS number and protein interactions, suggesting that CNSs may have roles in the evolution and maintenance of biological networks. The divergence of CNSs indicates that duplication-degeneration-complementation drives the subfunctionalization of a proportion of duplicated genes from whole-genome duplication. Furthermore, population genomics confirmed that most CNSs are under strong purifying selection and only a small subset of CNSs shows evidence of adaptive evolution. These findings provide a foundation for future studies exploring these key genomic features in the maintenance of biological networks, local adaptation, and transcription.

The role of heterologous chloroplast sequence elements in transgene integration and expression.

PubMed

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-04-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.

The Role of Heterologous Chloroplast Sequence Elements in Transgene Integration and Expression1[W][OA

PubMed Central

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-01-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101

Cooperative action of multiple cis-acting elements is required for N-myc expression in branchial arches: specific contribution of GATA3.

PubMed

Potvin, Eric; Beuret, Laurent; Cadrin-Girard, Jean-François; Carter, Marcelle; Roy, Sophie; Tremblay, Michel; Charron, Jean

2010-11-01

The precise expression of the N-myc proto-oncogene is essential for normal mammalian development, whereas altered N-myc gene regulation is known to be a determinant factor in tumor formation. Using transgenic mouse embryos, we show that N-myc sequences from kb -8.7 to kb +7.2 are sufficient to reproduce the N-myc embryonic expression profile in developing branchial arches and limb buds. These sequences encompass several regulatory elements dispersed throughout the N-myc locus, including an upstream limb bud enhancer, a downstream somite enhancer, a branchial arch enhancer in the second intron, and a negative regulatory element in the first intron. N-myc expression in the limb buds is under the dominant control of the limb bud enhancer. The expression in the branchial arches necessitates the interplay of three regulatory domains. The branchial arch enhancer cooperates with the somite enhancer region to prevent an inhibitory activity contained in the first intron. The characterization of the branchial arch enhancer has revealed a specific role of the transcription factor GATA3 in the regulation of N-myc expression. Together, these data demonstrate that correct N-myc developmental expression is achieved via cooperation of multiple positive and negative regulatory elements.

Scapula development is governed by genetic interactions of Pbx1 with its family members and with Emx2 via their cooperative control of Alx1

PubMed Central

Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo

2010-01-01

The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

PubMed Central

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Convergent evolution and adaptation of Pseudomonas aeruginosa within patients with cystic fibrosis.

PubMed

Marvig, Rasmus Lykke; Sommer, Lea Mette; Molin, Søren; Johansen, Helle Krogh

2015-01-01

Little is known about how within-host evolution compares between genotypically different strains of the same pathogenic species. We sequenced the whole genomes of 474 longitudinally collected clinical isolates of Pseudomonas aeruginosa sampled from 34 children and young individuals with cystic fibrosis. Our analysis of 36 P. aeruginosa lineages identified convergent molecular evolution in 52 genes. This list of genes suggests a role in host adaptation for remodeling of regulatory networks and central metabolism, acquisition of antibiotic resistance and loss of extracellular virulence factors. Furthermore, we find an ordered succession of mutations in key regulatory networks. Accordingly, mutations in downstream transcriptional regulators were contingent upon mutations in upstream regulators, suggesting that remodeling of regulatory networks might be important in adaptation. The characterization of genes involved in host adaptation may help in predicting bacterial evolution in patients with cystic fibrosis and in the design of future intervention strategies.

Genome-wide network of regulatory genes for construction of a chordate embryo.

PubMed

Shoguchi, Eiichi; Hamaguchi, Makoto; Satoh, Nori

2008-04-15

Animal development is controlled by gene regulation networks that are composed of sequence-specific transcription factors (TF) and cell signaling molecules (ST). Although housekeeping genes have been reported to show clustering in the animal genomes, whether the genes comprising a given regulatory network are physically clustered on a chromosome is uncertain. We examined this question in the present study. Ascidians are the closest living relatives of vertebrates, and their tadpole-type larva represents the basic body plan of chordates. The Ciona intestinalis genome contains 390 core TF genes and 119 major ST genes. Previous gene disruption assays led to the formulation of a basic chordate embryonic blueprint, based on over 3000 genetic interactions among 79 zygotic regulatory genes. Here, we mapped the regulatory genes, including all 79 regulatory genes, on the 14 pairs of Ciona chromosomes by fluorescent in situ hybridization (FISH). Chromosomal localization of upstream and downstream regulatory genes demonstrates that the components of coherent developmental gene networks are evenly distributed over the 14 chromosomes. Thus, this study provides the first comprehensive evidence that the physical clustering of regulatory genes, or their target genes, is not relevant for the genome-wide control of gene expression during development.

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

PubMed

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

2014-06-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

PubMed

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

PubMed Central

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

PubMed

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

DNA sequence and characterization of GcvA, a LysR family regulatory protein for the Escherichia coli glycine cleavage enzyme system.

PubMed Central

Wilson, R L; Stauffer, G V

1994-01-01

The gene encoding GcvA, the trans-acting regulatory protein for the Escherichia coli glycine cleavage enzyme system, has been sequenced. The gcvA locus contains an open reading frame of 930 nucleotides that could encode a protein with a molecular mass of 34.4 kDa, consistent with the results of minicell analysis indicating that GcvA is a polypeptide of approximately 33 kDa. The deduced amino acid sequence of GcvA revealed that this protein shares similarity with the LysR family of activator proteins. The transcription start site was found to be 72 bp upstream of the presumed translation start site. A chromosomal deletion of gcvA resulted in the inability of cells to activate the expression of a gcvT-lacZ gene fusion when grown in the presence of glycine and an inability to repress gcvT-lacZ expression when grown in the presence of inosine. The regulation of gcvA was examined by constructing a gcvA-lacZ gene fusion in which beta-galactosidase synthesis is under the control of the gcvA regulatory region. Although gcvA expression appears to be autogenously regulated over a two- to threefold range, it is neither induced by glycine nor repressed by inosine. Images PMID:8188587

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

PubMed

Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

1987-01-01

The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

Genome-wide mapping of autonomous promoter activity in human cells

PubMed Central

van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas

2017-01-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146

Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

PubMed

Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

2015-05-30

Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

Isolation, characterization, and evaluation of three Citrus sinensis-derived constitutive gene promoters.

PubMed

Erpen, L; Tavano, E C R; Harakava, R; Dutt, M; Grosser, J W; Piedade, S M S; Mendes, B M J; Mourão Filho, F A A

2018-05-23

Regulatory sequences from the citrus constitutive genes cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1) were isolated, fused to the uidA gene, and qualitatively and quantitatively evaluated in transgenic sweet orange plants. The 5' upstream region of a gene (the promoter) is the most important component for the initiation and regulation of gene transcription of both native genes and transgenes in plants. The isolation and characterization of gene regulatory sequences are essential to the development of intragenic or cisgenic genetic manipulation strategies, which imply the use of genetic material from the same species or from closely related species. We describe herein the isolation and evaluation of the promoter sequence from three constitutively expressed citrus genes: cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1). The functionality of the promoters was confirmed by a histochemical GUS assay in leaves, stems, and roots of stably transformed citrus plants expressing the promoter-uidA construct. Lower uidA mRNA levels were detected when the transgene was under the control of citrus promoters as compared to the expression under the control of the CaMV35S promoter. The association of the uidA gene with the citrus-derived promoters resulted in mRNA levels of up to 60-41.8% of the value obtained with the construct containing CaMV35S driving the uidA gene. Moreover, a lower inter-individual variability in transgene expression was observed amongst the different transgenic lines, where gene constructs containing citrus-derived promoters were used. In silico analysis of the citrus-derived promoter sequences revealed that their activity may be controlled by several putative cis-regulatory elements. These citrus promoters will expand the availability of regulatory sequences for driving gene expression in citrus gene-modification programs.

Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

PubMed

Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

2010-02-01

GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

Deregulation of polycomb repressor complex 1 modifier AUTS2 in T-cell leukemia.

PubMed

Nagel, Stefan; Pommerenke, Claudia; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G; MacLeod, Roderick A F

2016-07-19

Recently, we identified deregulated expression of the B-cell specific transcription factor MEF2C in T-cell acute lymphoid leukemia (T-ALL). Here, we performed sequence analysis of a regulatory upstream section of MEF2C in T-ALL cell lines which, however, proved devoid of mutations. Unexpectedly, we found strong conservation between the regulatory upstream region of MEF2C (located at chromosomal band 5q14) and an intergenic stretch at 7q11 located between STAG3L4 and AUTS2, covering nearly 20 kb. While the non-coding gene STAG3L4 was inconspicuously expressed, AUTS2 was aberrantly upregulated in 6% of T-ALL patients (public dataset GSE42038) and in 3/24 T-ALL cell lines, two of which represented very immature differentiation stages. AUTS2 expression was higher in normal B-cells than in T-cells, indicating lineage-specific activity in lymphopoiesis. While excluding chromosomal aberrations, examinations of AUTS2 transcriptional regulation in T-ALL cells revealed activation by IL7-IL7R-STAT5-signalling and MEF2C. AUTS2 protein has been shown to interact with polycomb repressor complex 1 subtype 5 (PRC1.5), transforming this particular complex into an activator. Accordingly, expression profiling and functional analyses demonstrated that AUTS2 activated while PCGF5 repressed transcription of NKL homeobox gene MSX1 in T-ALL cells. Forced expression and pharmacological inhibition of EZH2 in addition to H3K27me3 analysis indicated that PRC2 repressed MSX1 as well. Taken together, we found that AUTS2 and MEF2C, despite lying on different chromosomes, share strikingly similar regulatory upstream regions and aberrant expression in T-ALL subsets. Our data implicate chromatin complexes PRC1/AUTS2 and PRC2 in a gene network in T-ALL regulating early lymphoid differentiation.

Eukaryotic initiation factor 3 (eIF3) and 5’ mRNA leader sequences as agents of translational regulation in Arabidopsis. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

von Arnim, Albrecht G.

2015-02-04

Protein synthesis, or translation, consumes a sizable fraction of the cell’s energy budget, estimated at 5% and up to 50% in differentiated and growing cells, respectively. Plants also invest significant energy and biomass to construct and maintain the translation apparatus. Translation is regulated by a variety of external stimuli. Compared to transcriptional control, attributes of translational control include reduced sensitivity to stochastic fluctuation, a finer gauge of control, and more rapid responsiveness to environmental stimuli. Yet, our murky understanding of translational control allows few generalizations. Consequently, translational regulation is underutilized in the context of transgene regulation, although synthetic biologists aremore » now beginning to appropriate RNA-level gene regulation into their regulatory circuits. We also know little about how translational control contributes to the diversity of plant form and function. This project explored how an emerging regulatory mRNA sequence element, upstream open reading frames (uORFs), is integrated with the general translation initiation machinery to permit translational regulation on specific mRNAs.« less

The disruption of a novel limb cis-regulatory element of SHH is associated with autosomal dominant preaxial polydactyly-hypertrichosis

PubMed Central

Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne

2016-01-01

The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype. PMID:25782671

Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

PubMed Central

O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

2014-01-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

Isolation, characterization, and structure analysis of a vacuolar processing enzyme gene (MhVPEγ) from Malus hupehensis (Pamp) Rehd.

PubMed

Ran, Kun; Yang, Hongqiang; Sun, Xiaoli; Li, Qiang; Jiang, Qianqian; Zhang, Weiwei; Shen, Wei

2014-05-01

Vacuolar processing enzymes (VPEs) have received considerable attention recently, as they exhibit caspase-1-like cleavage activity and regulate the process of PCD. However, knowledge about their detailed characteristics and structures is relatively limited. In this study, a gamma vacuolar processing enzyme gene, MhVPEγ, has been isolated from the leaves of Malus hupehensis (Ramp) Rehd. var pinyiensis Jiang. MhVPEγ coded-translated protein sequence comprised of 494 amino acids with a signal peptide and a transmembrane helix structure at N-terminal, peptidase_C13 domain, and vacuolar sorting signal at C-terminal. Consequently, genomic walking approach was performed for the isolation of its upstream sequence. Computational analysis demonstrated several motifs of the promoter exhibiting hypothetic MeJA, ABA, and light-induced characteristics, as well as some typical domains universally discovered in promoter, such as TATA-box and CAAT-box. MhVPEγ transcript level was enhanced during wounding treatment, and WUN-motif, as one of the cis-acting regulatory elements existing in the upstream sequence perhaps regulates its expression. In silico-constructed 3D models revealed that MhCPYL successively interacts with MhVPEγ like that of "Induced Fit-Lock and Key" model, providing molecular conformation evidence that CPY is a direct substrate of VPEγ. This study is the first stride to understand the molecular mechanism of VPEγ and CPYL interactions.

The Pochonia chlamydosporia serine protease gene vcp1 is subject to regulation by carbon, nitrogen and pH: implications for nematode biocontrol.

PubMed

Ward, Elaine; Kerry, Brian R; Manzanilla-López, Rosa H; Mutua, Gerald; Devonshire, Jean; Kimenju, John; Hirsch, Penny R

2012-01-01

The alkaline serine protease VCP1 of the fungus Pochonia chlamydosporia belongs to a family of subtilisin-like enzymes that are involved in infection of nematode and insect hosts. It is involved early in the infection process, removing the outer proteinaceous vitelline membrane of nematode eggs. Little is known about the regulation of this gene, even though an understanding of how nutrients and other factors affect its expression is critical for ensuring its efficacy as a biocontrol agent. This paper provides new information on the regulation of vcp1 expression. Sequence analysis of the upstream regulatory region of this gene in 30 isolates revealed that it was highly conserved and contained sequence motifs characteristic of genes that are subject to carbon, nitrogen and pH-regulation. Expression studies, monitoring enzyme activity and mRNA, confirmed that these factors affect VCP1 production. As expected, glucose reduced VCP1 expression and for a few hours so did ammonium chloride. Surprisingly, however, by 24 h VCP1 levels were increased in the presence of ammonium chloride for most isolates. Ambient pH also regulated VCP1 expression, with most isolates producing more VCP1 under alkaline conditions. There were some differences in the response of one isolate with a distinctive upstream sequence including a variant regulatory-motif profile. Cryo-scanning electron microscopy studies indicated that the presence of nematode eggs stimulates VCP1 production by P. chlamydosporia, but only where the two are in close contact. Overall, the results indicate that readily-metabolisable carbon sources and unfavourable pH in the rhizosphere/egg-mass environment may compromise nematode parasitism by P. chlamydosporia. However, contrary to previous indications using other nematophagous and entomopathogenic fungi, ammonium nitrate (e.g. from fertilizers) may enhance biocontrol potential in some circumstances.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Secondary structural entropy in RNA switch (Riboswitch) identification.

PubMed

Manzourolajdad, Amirhossein; Arnold, Jonathan

2015-04-28

RNA regulatory elements play a significant role in gene regulation. Riboswitches, a widespread group of regulatory RNAs, are vital components of many bacterial genomes. These regulatory elements generally function by forming a ligand-induced alternative fold that controls access to ribosome binding sites or other regulatory sites in RNA. Riboswitch-mediated mechanisms are ubiquitous across bacterial genomes. A typical class of riboswitch has its own unique structural and biological complexity, making de novo riboswitch identification a formidable task. Traditionally, riboswitches have been identified through comparative genomics based on sequence and structural homology. The limitations of structural-homology-based approaches, coupled with the assumption that there is a great diversity of undiscovered riboswitches, suggests the need for alternative methods for riboswitch identification, possibly based on features intrinsic to their structure. As of yet, no such reliable method has been proposed. We used structural entropy of riboswitch sequences as a measure of their secondary structural dynamics. Entropy values of a diverse set of riboswitches were compared to that of their mutants, their dinucleotide shuffles, and their reverse complement sequences under different stochastic context-free grammar folding models. Significance of our results was evaluated by comparison to other approaches, such as the base-pairing entropy and energy landscapes dynamics. Classifiers based on structural entropy optimized via sequence and structural features were devised as riboswitch identifiers and tested on Bacillus subtilis, Escherichia coli, and Synechococcus elongatus as an exploration of structural entropy based approaches. The unusually long untranslated region of the cotH in Bacillus subtilis, as well as upstream regions of certain genes, such as the sucC genes were associated with significant structural entropy values in genome-wide examinations. Various tests show that there is in fact a relationship between higher structural entropy and the potential for the RNA sequence to have alternative structures, within the limitations of our methodology. This relationship, though modest, is consistent across various tests. Understanding the behavior of structural entropy as a fairly new feature for RNA conformational dynamics, however, may require extensive exploratory investigation both across RNA sequences and folding models.

Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene

PubMed Central

Levy, Nitzan; Tatomer, Dierdre; Herber, Candice B.; Zhao, Xiaoyue; Tang, Hui; Sargeant, Toby; Ball, Lonnele J.; Summers, Jonathan; Speed, Terence P.; Leitman, Dale C.

2008-01-01

Estrogen receptors (ERs) regulate gene transcription by interacting with regulatory elements. Most information regarding how ER activates genes has come from studies using a small set of target genes or simple consensus sequences such as estrogen response element, activator protein 1, and Sp1 elements. However, these elements cannot explain the differences in gene regulation patterns and clinical effects observed with estradiol (E2) and selective estrogen receptor modulators. To obtain a greater understanding of how E2 and selective estrogen receptor modulators differentially regulate genes, it is necessary to investigate their action on a more comprehensive set of native regulatory elements derived from ER target genes. Here we used chromatin immunoprecipitation-cloning and sequencing to isolate 173 regulatory elements associated with ERα. Most elements were found in the introns (38%) and regions greater than 10 kb upstream of the transcription initiation site (38%); 24% of the elements were found in the proximal promoter region (<10 kb). Only 11% of the elements contained a classical estrogen response element; 23% of the elements did not have any known response elements, including one derived from the naked cuticle homolog gene, which was associated with the recruitment of p160 coactivators. Transfection studies found that 80% of the 173 elements were regulated by E2, raloxifene, or tamoxifen with ERα or ERβ. Tamoxifen was more effective than raloxifene at activating the elements with ERα, whereas raloxifene was superior with ERβ. Our findings demonstrate that E2, tamoxifen, and raloxifene differentially regulate native ER-regulatory elements isolated by chromatin immunoprecipitation with ERα and ERβ. PMID:17962382

Development of a genotype-by-sequencing immunogenetic assay as exemplified by screening for variation in red fox with and without endemic rabies exposure.

PubMed

Donaldson, Michael E; Rico, Yessica; Hueffer, Karsten; Rando, Halie M; Kukekova, Anna V; Kyle, Christopher J

2018-01-01

Pathogens are recognized as major drivers of local adaptation in wildlife systems. By determining which gene variants are favored in local interactions among populations with and without disease, spatially explicit adaptive responses to pathogens can be elucidated. Much of our current understanding of host responses to disease comes from a small number of genes associated with an immune response. High-throughput sequencing (HTS) technologies, such as genotype-by-sequencing (GBS), facilitate expanded explorations of genomic variation among populations. Hybridization-based GBS techniques can be leveraged in systems not well characterized for specific variants associated with disease outcome to "capture" specific genes and regulatory regions known to influence expression and disease outcome. We developed a multiplexed, sequence capture assay for red foxes to simultaneously assess ~300-kbp of genomic sequence from 116 adaptive, intrinsic, and innate immunity genes of predicted adaptive significance and their putative upstream regulatory regions along with 23 neutral microsatellite regions to control for demographic effects. The assay was applied to 45 fox DNA samples from Alaska, where three arctic rabies strains are geographically restricted and endemic to coastal tundra regions, yet absent from the boreal interior. The assay provided 61.5% on-target enrichment with relatively even sequence coverage across all targeted loci and samples (mean = 50×), which allowed us to elucidate genetic variation across introns, exons, and potential regulatory regions (4,819 SNPs). Challenges remained in accurately describing microsatellite variation using this technique; however, longer-read HTS technologies should overcome these issues. We used these data to conduct preliminary analyses and detected genetic structure in a subset of red fox immune-related genes between regions with and without endemic arctic rabies. This assay provides a template to assess immunogenetic variation in wildlife disease systems.

Nucleotide sequence analysis reveals linked N-acetyl hydrolase, thioesterase, transport, and regulatory genes encoded by the bialaphos biosynthetic gene cluster of Streptomyces hygroscopicus.

PubMed Central

Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J

1991-01-01

Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide identity, 31% amino acid identity), as well as to GrsT, a protein encoded by a gene located adjacent to gramicidin S synthetase in Bacillus brevis, and to vertebrate (mallard duck and rat) thioesterases. The amino acid sequence and hydrophobicity profile of ORF3 indicated that it was related to a family of membrane transport proteins. It was strikingly similar to the citrate uptake protein encoded by the transposon Tn3411. Images PMID:2066341

Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

1987-11-01

To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

PubMed

Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

2014-01-01

Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.

PubMed

Rodriguez, A M; Callahan, J E; Fawcett, P; Ge, X; Xu, P; Kitten, T

2011-04-01

Streptococcus sanguinis is a major component of the oral flora and an important cause of infective endocarditis. Although S. sanguinis is naturally competent, genome sequencing has suggested significant differences in the S. sanguinis competence system relative to those of other streptococci. An S. sanguinis mutant possessing an in-frame deletion in the comC gene, which encodes competence-stimulating peptide (CSP), was created. Addition of synthetic CSP induced competence in this strain. Gene expression in this strain was monitored by microarray analysis at multiple time-points from 2.5 to 30 min after CSP addition, and verified by quantitative reverse transcription-polymerase chain reaction. Over 200 genes were identified whose expression was altered at least two-fold in at least one time point, with the majority upregulated. The 'late' response was typical of that seen in previous studies. However, comparison of the 'early' response in S. sanguinis with that of other oral streptococci revealed unexpected differences with regard to the number of genes induced, the nature of those genes, and their putative upstream regulatory sequences. Streptococcus sanguinis possesses a comparatively limited early response, which may define a minimal streptococcal competence regulatory circuit. © 2011 John Wiley & Sons A/S.

Physiological and molecular characterization of genetic competence in Streptococcus sanguinis

PubMed Central

Rodriguez, Alejandro Miguel; Callahan, Jill E.; Fawcett, Paul; Ge, Xiuchun; Xu, Ping; Kitten, Todd

2011-01-01

SUMMARY Streptococcus sanguinis is a major component of the oral flora and an important cause of infective endocarditis. Although S. sanguinis is naturally competent, genome sequencing has suggested significant differences in the S. sanguinis competence system relative to those of other streptococci. An S. sanguinis mutant possessing an in-frame deletion in the comC gene, which encodes competence-stimulating peptide (CSP), was created. Addition of synthetic CSP induced competence in this strain. Gene expression in this strain was monitored by microarray analysis at multiple time points from 2.5 to 30 min after CSP addition, and verified by quantitative RT-PCR. Over 200 genes were identified whose expression was altered at least two-fold in at least one time point, with the majority upregulated. The “late” response was typical of that seen in previous studies. However, comparison of the “early” response in S. sanguinis with that of other oral streptococci revealed unexpected differences with regard to the number of genes induced, the nature of these genes, and their putative upstream regulatory sequences. S. sanguinis possesses a comparatively limited early response, which may define a minimal streptococcal competence regulatory circuit. PMID:21375701

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

PubMed

Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

2003-01-01

The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

Tenebrio molitor antifreeze protein gene identification and regulation.

PubMed

Qin, Wensheng; Walker, Virginia K

2006-02-15

The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

Co-regulation of Iron Metabolism and Virulence Associated Functions by Iron and XibR, a Novel Iron Binding Transcription Factor, in the Plant Pathogen Xanthomonas

PubMed Central

Pandey, Sheo Shankar; Patnana, Pradeep Kumar; Lomada, Santosh Kumar; Tomar, Archana; Chatterjee, Subhadeep

2016-01-01

Abilities of bacterial pathogens to adapt to the iron limitation present in hosts is critical to their virulence. Bacterial pathogens have evolved diverse strategies to coordinately regulate iron metabolism and virulence associated functions to maintain iron homeostasis in response to changing iron availability in the environment. In many bacteria the ferric uptake regulator (Fur) functions as transcription factor that utilize ferrous form of iron as cofactor to regulate transcription of iron metabolism and many cellular functions. However, mechanisms of fine-tuning and coordinated regulation of virulence associated function beyond iron and Fur-Fe2+ remain undefined. In this study, we show that a novel transcriptional regulator XibR (named X anthomonas iron binding regulator) of the NtrC family, is required for fine-tuning and co-coordinately regulating the expression of several iron regulated genes and virulence associated functions in phytopathogen Xanthomonas campestris pv. campestris (Xcc). Genome wide expression analysis of iron-starvation stimulon and XibR regulon, GUS assays, genetic and functional studies of xibR mutant revealed that XibR positively regulates functions involved in iron storage and uptake, chemotaxis, motility and negatively regulates siderophore production, in response to iron. Furthermore, chromatin immunoprecipitation followed by quantitative real-time PCR indicated that iron promoted binding of the XibR to the upstream regulatory sequence of operon’s involved in chemotaxis and motility. Circular dichroism spectroscopy showed that purified XibR bound ferric form of iron. Electrophoretic mobility shift assay revealed that iron positively affected the binding of XibR to the upstream regulatory sequences of the target virulence genes, an effect that was reversed by ferric iron chelator deferoxamine. Taken together, these data revealed that how XibR coordinately regulates virulence associated and iron metabolism functions in Xanthomonads in response to iron availability. Our results provide insight of the complex regulatory mechanism of fine-tuning of virulence associated functions with iron availability in this important group of phytopathogen. PMID:27902780

Association of the 5′-upstream regulatory region of the α7 nicotinic acetylcholine receptor subunit gene (CHRNA7) with schizophrenia

PubMed Central

Stephens, Sarah H.; Logel, Judith; Barton, Amanda; Franks, Alexis; Schultz, Jessica; Short, Margaret; Dickenson, Jane; James, Benjamin; Fingerlin, Tasha E.; Wagner, Brandie; Hodgkinson, Colin; Graw, Sharon; Ross, Randal G.; Freedman, Robert; Leonard, Sherry

2009-01-01

Background The α7 neuronal nicotinic acetylcholine receptor subunit gene (CHRNA7) is localized in a chromosomal region (15q14) linked to schizophrenia in multiple independent studies. CHRNA7 was selected as the best candidate gene in the region for a well-documented endophenotype of schizophrenia, the P50 sensory processing deficit, by genetic linkage and biochemical studies. Methods Subjects included Caucasian-Non Hispanic and African-American case-control subjects collected in Denver, and schizophrenic subjects from families in the NIMH Genetics Initiative on Schizophrenia. Thirty-five single nucleotide polymorphisms (SNPs) in the 5′-upstream regulatory region of CHRNA7 were genotyped for association with schizophrenia, and for smoking in schizophrenia. Results The rs3087454 SNP, located at position −1831 bp in the upstream regulatory region of CHRNA7, was significantly associated with schizophrenia in the case-control samples after multiple-testing correction (P = 0.0009, African American; P = 0.013, Caucasian-Non Hispanic); the association was supported in family members. There was nominal association of this SNP with smoking in schizophrenia. Conclusions The data support association of regulatory region polymorphisms in the CHRNA7 gene with schizophrenia. PMID:19181484

Foxl2 function in ovarian development.

PubMed

Uhlenhaut, Nina Henriette; Treier, Mathias

2006-07-01

Foxl2 is a forkhead transcription factor essential for proper reproductive function in females. Human patients carrying mutations in the FOXL2 gene display blepharophimosis/ptosis/epicanthus inversus syndrome (BPES), an autosomal dominant disease associated with eyelid defects and premature ovarian failure in females. Recently, animal models for BPES have been developed that in combination with a catalogue of human FOXL2 mutations provide further insight into its molecular function. Mice homozygous mutant for Foxl2 display craniofacial malformations and female infertility. The analysis of the murine phenotype has revealed that Foxl2 is required for granulosa cell function. These ovarian somatic cells surround and nourish the oocyte and play an important role in follicle formation and activation. Mutations upstream of FOXL2 in humans, not affecting the coding sequence itself, have also been shown to cause BPES, which points to the existence of a distant regulatory element necessary for proper gene expression. The same regulatory sequences may be deleted in the goat polled intersex syndrome (PIS), in which FoxL2 expression is severely reduced. Sequence comparison of FoxL2 from several vertebrate species has shown that it is a highly conserved gene involved in ovary development. Thus, the detailed understanding of Foxl2 function and regulation and the identification of its transcriptional targets may open new avenues for the treatment of female infertility in the future.

Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

PubMed

Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

1998-05-01

Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

Nucleotide sequences and regulational analysis of genes involved in conversion of aniline to catechol in Pseudomonas putida UCC22(pTDN1).

PubMed Central

Fukumori, F; Saint, C P

1997-01-01

A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291

DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.

PubMed

Choudhary, M; Kaplan, S

2000-02-15

This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

Potential Direct Regulators of the Drosophila yellow Gene Identified by Yeast One-Hybrid and RNAi Screens

PubMed Central

Kalay, Gizem; Lusk, Richard; Dome, Mackenzie; Hens, Korneel; Deplancke, Bart; Wittkopp, Patricia J.

2016-01-01

The regulation of gene expression controls development, and changes in this regulation often contribute to phenotypic evolution. Drosophila pigmentation is a model system for studying evolutionary changes in gene regulation, with differences in expression of pigmentation genes such as yellow that correlate with divergent pigment patterns among species shown to be caused by changes in cis- and trans-regulation. Currently, much more is known about the cis-regulatory component of divergent yellow expression than the trans-regulatory component, in part because very few trans-acting regulators of yellow expression have been identified. This study aims to improve our understanding of the trans-acting control of yellow expression by combining yeast-one-hybrid and RNAi screens for transcription factors binding to yellow cis-regulatory sequences and affecting abdominal pigmentation in adults, respectively. Of the 670 transcription factors included in the yeast-one-hybrid screen, 45 showed evidence of binding to one or more sequence fragments tested from the 5′ intergenic and intronic yellow sequences from D. melanogaster, D. pseudoobscura, and D. willistoni, suggesting that they might be direct regulators of yellow expression. Of the 670 transcription factors included in the yeast-one-hybrid screen, plus another TF previously shown to be genetically upstream of yellow, 125 were also tested using RNAi, and 32 showed altered abdominal pigmentation. Nine transcription factors were identified in both screens, including four nuclear receptors related to ecdysone signaling (Hr78, Hr38, Hr46, and Eip78C). This finding suggests that yellow expression might be directly controlled by nuclear receptors influenced by ecdysone during early pupal development when adult pigmentation is forming. PMID:27527791

The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

PubMed

Fleckenstein, E C; Dirks, W G; Drexler, H G

2000-02-01

The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

PubMed

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

The REP2 Repeats of the Genome of Neisseria meningitidis Are Associated with Genes Coordinately Regulated during Bacterial Cell Interaction

PubMed Central

Morelle, Sandrine; Carbonnelle, Etienne; Nassif, Xavier

2003-01-01

Interaction with host cells is essential in meningococcal pathogenesis especially at the blood-brain barrier. This step is likely to involve a common regulatory pathway allowing coordinate regulation of genes necessary for the interaction with endothelial cells. The analysis of the genomic sequence of Neisseria meningitidis Z2491 revealed the presence of many repeats. One of these, designated REP2, contains a −24/−12 type promoter and a ribosome binding site 5 to 13 bp before an ATG. In addition most of these REP2 sequences are located immediately upstream of an ORF. Among these REP2-associated genes are pilC1 and crgA, described as being involved in steps essential for the interaction of N. meningitidis with host cells. Furthermore, the REP2 sequences located upstream of pilC1 and crgA correspond to the previously identified promoters known to be induced during the initial localized adhesion of N. meningitidis with human cells. This characteristic led us to hypothesize that at least some of the REP2-associated genes were upregulated under the same circumstances as pilC1 and crgA. Quantitative PCR in real time demonstrated that the expression of 14 out of 16 REP2-associated genes were upregulated during the initial localized adhesion of N. meningitidis. Taken together, these data suggest that these repeats control a set of genes necessary for the efficient interaction of this pathogen with host cells. Subsequent mutational analysis was performed to address the role of these genes during meningococcus-cell interaction. PMID:12670987

Enhancer elements upstream of the SHOX gene are active in the developing limb.

PubMed

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-05-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

Enhancer elements upstream of the SHOX gene are active in the developing limb

PubMed Central

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-01-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128

Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

PubMed

Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

2007-08-01

To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

Analysis of the putative regulatory region of the gastric inhibitory polypeptide receptor gene in food-dependent Cushing's syndrome.

PubMed

Antonini, S R; N'Diaye, N; Baldacchino, V; Hamet, P; Tremblay, J; Lacroix, A

2004-07-01

Gastric inhibitory polypeptide (GIP)-dependent Cushing's syndrome (CS) results from the ectopic expression of non-mutated GIP receptor (hGIPR) in the adrenal cortex. We evaluated whether mutations or polymorphisms in the regulatory region of the GIPR gene could lead to this aberrant expression. We studied 9.0kb upstream and 1.3kb downstream of the GIPR gene putative promoter (pProm) by sequencing leukocyte DNA from controls and from adrenal tissues of GIP- and non-GIP-dependent CS patients. The putative proximal promoter region (800 bp) and the first exon and intron of the hGIPR gene were sequenced on adrenal DNA from nine GIP-dependent CS, as well as on leukocyte DNA of nine normal controls. Three variations found in this region were found in all patients and controls; at position -4/-5, an insertion of a T was seen in four out of nine patients and in five out of nine controls. Transient transfection studies conducted in rat GC and mouse Y1 cells showed that the TT allele confers loss of 40% in the promoter activity. The analysis of the 8-kb distal pProm region revealed eight distal single nucleotide polymorphisms (SNPs) without probable association with the disease, since frequencies in patients and controls were very similar. In conclusion, mutations or SNPs in the regulatory region of the GIPR gene are unlikely to underlie GIP-dependent CS. Copyright 2004 Elsevier Ltd.

Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

PubMed Central

Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

2005-01-01

Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism

ERIC Educational Resources Information Center

Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong

2011-01-01

Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.

PubMed

Dale, Rodney M; Topczewski, Jacek

2011-09-15

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

PubMed Central

Dale, Rodney M.; Topczewski, Jacek

2011-01-01

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274

Molecular epidemiology of nga and NAD glycohydrolase/ADP-ribosyltransferase activity among Streptococcus pyogenes causing streptococcal toxic shock syndrome.

PubMed

Stevens, D L; Salmi, D B; McIndoo, E R; Bryant, A E

2000-10-01

Severe invasive group A streptococcal (GAS) infections emerged in the late 1980s, yet no single virulence factor has been common to all isolates from infected patients. A strong association was recently found between isolates of such cases (regardless of M type) and the production of NAD glycohydrolase (NADase). Of interest, all M-1 strains isolated after 1988 were positive for NADase, whereas virtually all M-1 GAS were previously negative for NADase. Genetic analysis demonstrated that GAS isolates were >96% identical in nga and >99% identical in their upstream regulatory sequences. Furthermore, because NADase-negative strains did not produce immunoreactive NADase, we concluded that additional regulatory element(s) control NADase production. NADase purified from GAS altered neutrophil-directed migration and chemiluminescence responses and had potent ADP-ribosyltransferase activity. In summary, the temporal relationship of NADase expression, alone or with other streptococcal virulence factors, may contribute to the pathogenesis of invasive GAS infections.

UV Radiation–Sensitive Norin 1 Rice Contains Defective Cyclobutane Pyrimidine Dimer Photolyase

PubMed Central

Hidema, Jun; Kumagai, Tadashi; Sutherland, Betsy M.

2000-01-01

Norin 1, a progenitor of many economically important Japanese rice strains, is highly sensitive to the damaging effects of UVB radiation (wavelengths 290 to 320 nm). Norin 1 seedlings are deficient in photorepair of cyclobutane pyrimidine dimers. However, the molecular origin of this deficiency was not known and, because rice photolyase genes have not been cloned and sequenced, could not be determined by examining photolyase structural genes or upstream regulatory elements for mutations. We therefore used a photoflash approach, which showed that the deficiency in photorepair in vivo resulted from a functionally altered photolyase. These results were confirmed by studies with extracts, which showed that the Norin 1 photolyase–dimer complex was highly thermolabile relative to the wild-type Sasanishiki photolyase. This deficiency results from a structure/function alteration of photolyase rather than of nonspecific repair, photolytic, or regulatory elements. Thus, the molecular origin of this plant DNA repair deficiency, resulting from a spontaneously occurring mutation to UV radiation sensitivity, is defective photolyase. PMID:11006332

Upstream mononucleotide A-repeats play a cis-regulatory role in mammals through the DICER1 and Ago proteins.

PubMed

Aporntewan, Chatchawit; Pin-on, Piyapat; Chaiyaratana, Nachol; Pongpanich, Monnat; Boonyaratanakornkit, Viroj; Mutirangura, Apiwat

2013-10-01

A-repeats are the simplest form of tandem repeats and are found ubiquitously throughout genomes. These mononucleotide repeats have been widely believed to be non-functional 'junk' DNA. However, studies in yeasts suggest that A-repeats play crucial biological functions, and their role in humans remains largely unknown. Here, we showed a non-random pattern of distribution of sense A- and T-repeats within 20 kb around transcription start sites (TSSs) in the human genome. Different distributions of these repeats are observed upstream and downstream of TSSs. Sense A-repeats are enriched upstream, whereas sense T-repeats are enriched downstream of TSSs. This enrichment directly correlates with repeat size. Genes with different functions contain different lengths of repeats. In humans, tissue-specific genes are enriched for short repeats of <10 bp, whereas housekeeping genes are enriched for long repeats of ≥10 bp. We demonstrated that DICER1 and Argonaute proteins are required for the cis-regulatory role of A-repeats. Moreover, in the presence of a synthetic polymer that mimics an A-repeat, protein binding to A-repeats was blocked, resulting in a dramatic change in the expression of genes containing upstream A-repeats. Our findings suggest a length-dependent cis-regulatory function of A-repeats and that Argonaute proteins serve as trans-acting factors, binding to A-repeats.

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

PubMed

Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

1998-07-01

Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence.

PubMed

Benko, Sabina; Fantes, Judy A; Amiel, Jeanne; Kleinjan, Dirk-Jan; Thomas, Sophie; Ramsay, Jacqueline; Jamshidi, Negar; Essafi, Abdelkader; Heaney, Simon; Gordon, Christopher T; McBride, David; Golzio, Christelle; Fisher, Malcolm; Perry, Paul; Abadie, Véronique; Ayuso, Carmen; Holder-Espinasse, Muriel; Kilpatrick, Nicky; Lees, Melissa M; Picard, Arnaud; Temple, I Karen; Thomas, Paul; Vazquez, Marie-Paule; Vekemans, Michel; Roest Crollius, Hugues; Hastie, Nicholas D; Munnich, Arnold; Etchevers, Heather C; Pelet, Anna; Farlie, Peter G; Fitzpatrick, David R; Lyonnet, Stanislas

2009-03-01

Pierre Robin sequence (PRS) is an important subgroup of cleft palate. We report several lines of evidence for the existence of a 17q24 locus underlying PRS, including linkage analysis results, a clustering of translocation breakpoints 1.06-1.23 Mb upstream of SOX9, and microdeletions both approximately 1.5 Mb centromeric and approximately 1.5 Mb telomeric of SOX9. We have also identified a heterozygous point mutation in an evolutionarily conserved region of DNA with in vitro and in vivo features of a developmental enhancer. This enhancer is centromeric to the breakpoint cluster and maps within one of the microdeletion regions. The mutation abrogates the in vitro enhancer function and alters binding of the transcription factor MSX1 as compared to the wild-type sequence. In the developing mouse mandible, the 3-Mb region bounded by the microdeletions shows a regionally specific chromatin decompaction in cells expressing Sox9. Some cases of PRS may thus result from developmental misexpression of SOX9 due to disruption of very-long-range cis-regulatory elements.

Integrated Module and Gene-Specific Regulatory Inference Implicates Upstream Signaling Networks

PubMed Central

Roy, Sushmita; Lagree, Stephen; Hou, Zhonggang; Thomson, James A.; Stewart, Ron; Gasch, Audrey P.

2013-01-01

Regulatory networks that control gene expression are important in diverse biological contexts including stress response and development. Each gene's regulatory program is determined by module-level regulation (e.g. co-regulation via the same signaling system), as well as gene-specific determinants that can fine-tune expression. We present a novel approach, Modular regulatory network learning with per gene information (MERLIN), that infers regulatory programs for individual genes while probabilistically constraining these programs to reveal module-level organization of regulatory networks. Using edge-, regulator- and module-based comparisons of simulated networks of known ground truth, we find MERLIN reconstructs regulatory programs of individual genes as well or better than existing approaches of network reconstruction, while additionally identifying modular organization of the regulatory networks. We use MERLIN to dissect global transcriptional behavior in two biological contexts: yeast stress response and human embryonic stem cell differentiation. Regulatory modules inferred by MERLIN capture co-regulatory relationships between signaling proteins and downstream transcription factors thereby revealing the upstream signaling systems controlling transcriptional responses. The inferred networks are enriched for regulators with genetic or physical interactions, supporting the inference, and identify modules of functionally related genes bound by the same transcriptional regulators. Our method combines the strengths of per-gene and per-module methods to reveal new insights into transcriptional regulation in stress and development. PMID:24146602

Genes encoding Xenopus laevis Ig L chains: Implications for the evolution of [kappa] and [lambda] chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zezza, D.J.; Stewart, S.E.; Steiner, L.A.

1992-12-15

Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less

An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

PubMed Central

Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

2018-01-01

Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gindhart, J.G. Jr.; Kaufman, T.C.

1995-02-01

The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products.more » When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerr, J.M.; Fisher, L.W.; Termine, J.D.

The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

PubMed Central

Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

2010-01-01

Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

PubMed

Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

2010-06-01

Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Yuxiang, E-mail: yuxiangqin@126.com; Tian, Yanchen; Han, Lu

Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusionmore » between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway.« less

Identification of a Novel Transcript and Regulatory Mechanism for Microsomal Triglyceride Transfer Protein

PubMed Central

Suzuki, Takashi; Brown, Judy J.; Swift, Larry L.

2016-01-01

Microsomal triglyceride transfer protein (MTP) is essential for the assembly of triglyceride-rich apolipoprotein B-containing lipoproteins. Previous studies in our laboratory identified a novel splice variant of MTP in mice that we named MTP-B. MTP-B has a unique first exon (1B) located 2.7 kB upstream of the first exon (1A) for canonical MTP (MTP-A). The two mature isoforms, though nearly identical in sequence and function, have different tissue expression patterns. In this study we report the identification of a second MTP splice variant (MTP-C), which contains both exons 1B and 1A. MTP-C is expressed in all the tissues we tested. In cells transfected with MTP-C, protein expression was less than 15% of that found when the cells were transfected with MTP-A or MTP-B. In silico analysis of the 5’-UTR of MTP-C revealed seven ATGs upstream of the start site for MTP-A, which is the only viable start site in frame with the main coding sequence. One of those ATGs was located in the 5’-UTR for MTP-A. We generated reporter constructs in which the 5’-UTRs of MTP-A or MTP-C were inserted between an SV40 promoter and the coding sequence of the luciferase gene and transfected these constructs into HEK 293 cells. Luciferase activity was significantly reduced by the MTP-C 5’-UTR, but not by the MTP-A 5’-UTR. We conclude that alternative splicing plays a key role in regulating MTP expression by introducing unique 5’-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP levels and activity. PMID:26771188

A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

PubMed

Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

2012-09-01

The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

Rhodobase, a meta-analytical tool for reconstructing gene regulatory networks in a model photosynthetic bacterium.

PubMed

Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark

2011-02-01

We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, J.; Liu, C.; Koopman, W.J.

Ligation of the Fas cell-surface molecule induces apoptosis. Defective Fas-mediated apoptosis has been associated with spontaneous autoimmunity in mice. Using human Fas/Apo-1 cDNA as a probe, the authors have molecularly cloned and characterized the human Fas chromosomal gene. The gene consists of nine exons and spans more than 26 kilobases of DNA. The lengths of introns vary from > 14 kilobases at the 5` end of the gene to 152 base pairs upstream of the exon encoding the transmembrane domain. The domain structure of the human Fas is encoded by an exon or a set of exons. Primer extension analysismore » revealed three major transcription initiation sites. The promoter region lacked canonical {open_quotes}TATA{close_quotes} and {open_quotes}CAAT{close_quotes} boxes but was a {open_quotes}GC-rich{close_quotes} sequence, and contained consensus sequences for AP-1, GF-1, NY-Y, CP-2, EBP20, and c-myb. These data provide the first characterization of the human Fas gene and insight into its regulatory region. 54 refs., 3 figs., 1 tab.« less

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

PubMed Central

Robson, Nicole D.; Telesnitsky, Alice

2000-01-01

Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, C.H.; Wei, Li-Na; Copeland, N.G.

We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation.

PubMed

Naville, Magali; Gautheret, Daniel

2010-01-01

Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.

A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

PubMed

Alten, Leonie; Schuster-Gossler, Karin; Eichenlaub, Michael P; Wittbrodt, Beate; Wittbrodt, Joachim; Gossler, Achim

2012-01-01

The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs) whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC) expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE) upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

Identification and subcellular localization of porcine deltacoronavirus accessory protein NS6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Puxian; Fang, Liurong; Liu, Xiaorong

Porcine deltacoronavirus (PDCoV) is an emerging swine enteric coronavirus. Accessory proteins are genus-specific for coronavirus, and two putative accessory proteins, NS6 and NS7, are predicted to be encoded by PDCoV; however, this remains to be confirmed experimentally. Here, we identified the leader-body junction sites of NS6 subgenomic RNA (sgRNA) and found that the actual transcription regulatory sequence (TRS) utilized by NS6 is non-canonical and is located upstream of the predicted TRS. Using the purified NS6 from an Escherichia coli expression system, we obtained two anti-NS6 monoclonal antibodies that could detect the predicted NS6 in cells infected with PDCoV or transfectedmore » with NS6-expressing plasmids. Further studies revealed that NS6 is always localized in the cytoplasm of PDCoV-infected cells, mainly co-localizing with the endoplasmic reticulum (ER) and ER-Golgi intermediate compartments, as well as partially with the Golgi apparatus. Together, our results identify the NS6 sgRNA and demonstrate its expression in PDCoV-infected cells. -- Highlights: •The leader-body fusion site of NS6 sgRNA is identified. •NS6 sgRNA uses a non-canonical transcription regulatory sequence (TRS). •NS6 can be expressed in PDCoV-infected cell. •NS6 predominantly localize to the ER complex and ER-Golgi intermediate compartment.« less

Two novel genes, fanA and fanB, involved in the biogenesis of K99 fimbriae.

PubMed

Roosendaal, E; Boots, M; de Graaf, F K

1987-08-11

The nucleotide sequence of the region located transcriptionally upstream of the K99 fimbrial subunit gene (fanC) was determined. Several putative transcription signals and two open reading frames, designated fanA and fanB, became apparent. Frameshift mutations in fanA and fanB reduced K99 fimbriae expression 8-fold and 16-fold, respectively. Complementation of the mutants in trans restored the K99 expression to about 75% of the wild type level, indicating that fanA and fanB code for transacting polypeptides involved in the biogenesis of K99 fimbriae. The fanA and fanB gene products FanA and FanB were not detectable in minicell preparations, indicating that both polypeptides are synthesized in very small amounts. However, in an in vitro DNA directed translation system FanA and FanB could be identified. The deduced amino acid sequences of FanA and FanB showed that both polypeptides contain no signal peptides, indicating a cytoplasmic location. Furthermore, the polypeptides are very hydrophilic, mainly basic, and exhibit remarkable homology to each other and to a regulatory protein (papB) encoded by the pap-operon (1). Some of these features are characteristics of nucleic acid binding proteins, which suggests that FanA and FanB have a regulatory function in the synthesis of FanC and the auxiliary polypeptides FanD-H.

Cloning of Beauveria bassiana chitinase gene Bbchit1 and its application to improve fungal strain virulence.

PubMed

Fang, Weiguo; Leng, Bo; Xiao, Yuehua; Jin, Kai; Ma, Jincheng; Fan, Yanhua; Feng, Jing; Yang, Xingyong; Zhang, Yongjun; Pei, Yan

2005-01-01

Entomopathogenic fungi can produce a series of chitinases, some of which act synergistically with proteases to degrade insect cuticle. However, chitinase involvement in insect fungus pathogenesis has not been fully characterized. In this paper, an endochitinase, Bbchit1, was purified to homogeneity from liquid cultures of Beauveria bassiana grown in a medium containing colloidal chitin. Bbchit1 had a molecular mass of about 33 kDa and pI of 5.4. Based on the N-terminal amino acid sequence, the chitinase gene, Bbchit1, and its upstream regulatory sequence were cloned. Bbchit1 was intronless, and there was a single copy in B. bassiana. Its regulatory sequence contained putative CreA/Crel carbon catabolic repressor binding domains, which was consistent with glucose suppression of Bbchit1. At the amino acid level, Bbchit1 showed significant similarity to a Streptomyces avermitilis putative endochitinase, a Streptomyces coelicolor putative chitinase, and Trichoderma harzianum endochitinase Chit36Y. However, Bbchit1 had very low levels of identity to other chitinase genes previously isolated from entomopathogenic fungi, indicating that Bbchit1 was a novel chitinase gene from an insect-pathogenic fungus. A gpd-Bbchit1 construct, in which Bbchit1 was driven by the Aspergiullus nidulans constitutive promoter, was transformed into the genome of B. bassiana, and three transformants that overproduced Bbchit1 were obtained. Insect bioassays revealed that overproduction of Bbchit1 enhanced the virulence of B. bassiana for aphids, as indicated by significantly lower 50% lethal concentrations and 50% lethal times of the transformants compared to the values for the wild-type strain.

Cloning of Beauveria bassiana Chitinase Gene Bbchit1 and Its Application To Improve Fungal Strain Virulence

PubMed Central

Fang, Weiguo; Leng, Bo; Xiao, Yuehua; Jin, Kai; Ma, Jincheng; Fan, Yanhua; Feng, Jing; Yang, Xingyong; Zhang, Yongjun; Pei, Yan

2005-01-01

Entomopathogenic fungi can produce a series of chitinases, some of which act synergistically with proteases to degrade insect cuticle. However, chitinase involvement in insect fungus pathogenesis has not been fully characterized. In this paper, an endochitinase, Bbchit1, was purified to homogeneity from liquid cultures of Beauveria bassiana grown in a medium containing colloidal chitin. Bbchit1 had a molecular mass of about 33 kDa and pI of 5.4. Based on the N-terminal amino acid sequence, the chitinase gene, Bbchit1, and its upstream regulatory sequence were cloned. Bbchit1 was intronless, and there was a single copy in B. bassiana. Its regulatory sequence contained putative CreA/Crel carbon catabolic repressor binding domains, which was consistent with glucose suppression of Bbchit1. At the amino acid level, Bbchit1 showed significant similarity to a Streptomyces avermitilis putative endochitinase, a Streptomyces coelicolor putative chitinase, and Trichoderma harzianum endochitinase Chit36Y. However, Bbchit1 had very low levels of identity to other chitinase genes previously isolated from entomopathogenic fungi, indicating that Bbchit1 was a novel chitinase gene from an insect-pathogenic fungus. A gpd-Bbchit1 construct, in which Bbchit1 was driven by the Aspergiullus nidulans constitutive promoter, was transformed into the genome of B. bassiana, and three transformants that overproduced Bbchit1 were obtained. Insect bioassays revealed that overproduction of Bbchit1 enhanced the virulence of B. bassiana for aphids, as indicated by significantly lower 50% lethal concentrations and 50% lethal times of the transformants compared to the values for the wild-type strain. PMID:15640210

Tissue expression analysis, cloning and characterization of the 5'-regulatory region of the bovine FABP3 gene.

PubMed

Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen

2016-09-01

Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.

The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

PubMed Central

Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

1986-01-01

The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

Regulatory network rewiring for secondary metabolism in Arabidopsis thaliana under various conditions

PubMed Central

2014-01-01

Background Plant secondary metabolites are critical to various biological processes. However, the regulations of these metabolites are complex because of regulatory rewiring or crosstalk. To unveil how regulatory behaviors on secondary metabolism reshape biological processes, we constructed and analyzed a dynamic regulatory network of secondary metabolic pathways in Arabidopsis. Results The dynamic regulatory network was constructed through integrating co-expressed gene pairs and regulatory interactions. Regulatory interactions were either predicted by conserved transcription factor binding sites (TFBSs) or proved by experiments. We found that integrating two data (co-expression and predicted regulatory interactions) enhanced the number of highly confident regulatory interactions by over 10% compared with using single data. The dynamic changes of regulatory network systematically manifested regulatory rewiring to explain the mechanism of regulation, such as in terpenoids metabolism, the regulatory crosstalk of RAV1 (AT1G13260) and ATHB1 (AT3G01470) on HMG1 (hydroxymethylglutaryl-CoA reductase, AT1G76490); and regulation of RAV1 on epoxysqualene biosynthesis and sterol biosynthesis. Besides, we investigated regulatory rewiring with expression, network topology and upstream signaling pathways. Regulatory rewiring was revealed by the variability of genes’ expression: pathway genes and transcription factors (TFs) were significantly differentially expressed under different conditions (such as terpenoids biosynthetic genes in tissue experiments and E2F/DP family members in genotype experiments). Both network topology and signaling pathways supported regulatory rewiring. For example, we discovered correlation among the numbers of pathway genes, TFs and network topology: one-gene pathways (such as δ-carotene biosynthesis) were regulated by a fewer TFs, and were not critical to metabolic network because of their low degrees in topology. Upstream signaling pathways of 50 TFs were identified to comprehend the underlying mechanism of TFs’ regulatory rewiring. Conclusion Overall, this dynamic regulatory network largely improves the understanding of perplexed regulatory rewiring in secondary metabolism in Arabidopsis. PMID:24993737

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells

PubMed Central

Leddin, Mathias; Perrod, Chiara; Hoogenkamp, Maarten; Ghani, Saeed; Assi, Salam; Heinz, Sven; Wilson, Nicola K.; Follows, George; Schönheit, Jörg; Vockentanz, Lena; Mosammam, Ali M.; Chen, Wei; Tenen, Daniel G.; Westhead, David R.; Göttgens, Berthold

2011-01-01

The transcription factor PU.1 occupies a central role in controlling myeloid and early B-cell development, and its correct lineage-specific expression is critical for the differentiation choice of hematopoietic progenitors. However, little is known of how this tissue-specific pattern is established. We previously identified an upstream regulatory cis element whose targeted deletion in mice decreases PU.1 expression and causes leukemia. We show here that the upstream regulatory cis element alone is insufficient to confer physiologic PU.1 expression in mice but requires the cooperation with other, previously unidentified elements. Using a combination of transgenic studies, global chromatin assays, and detailed molecular analyses we present evidence that PU.1 is regulated by a novel mechanism involving cross talk between different cis elements together with lineage-restricted autoregulation. In this model, PU.1 regulates its expression in B cells and macrophages by differentially associating with cell type–specific transcription factors at one of its cis-regulatory elements to establish differential activity patterns at other elements. PMID:21239694

Identification of new TSGA10 transcript variants in human testis with conserved regulatory RNA elements in 5'untranslated region and distinct expression in breast cancer.

PubMed

Salehipour, Pouya; Nematzadeh, Mahsa; Mobasheri, Maryam Beigom; Afsharpad, Mandana; Mansouri, Kamran; Modarressi, Mohammad Hossein

2017-09-01

Testis specific gene antigen 10 (TSGA10) is a cancer testis antigen involved in the process of spermatogenesis. TSGA10 could also play an important role in the inhibition of angiogenesis by preventing nuclear localization of HIF-1α. Although it has been shown that TSGA10 messenger RNA (mRNA) is mainly expressed in testis and some tumors, the transcription pattern and regulatory mechanisms of this gene remain largely unknown. Here, we report that human TSGA10 comprises at least 22 exons and generates four different transcript variants. It was identified that using two distinct promoters and splicing of exons 4 and 7 produced these transcript variants, which have the same coding sequence, but the sequence of 5'untanslated region (5'UTR) is different between them. This is significant because conserved regulatory RNA elements like upstream open reading frame (uORF) and putative internal ribosome entry site (IRES) were found in this region which have different combinations in each transcript variant and it may influence translational efficiency of them in normal or unusual environmental conditions like hypoxia. To indicate the transcription pattern of TSGA10 in breast cancer, expression of identified transcript variants was analyzed in 62 breast cancer samples. We found that TSGA10 tends to express variants with shorter 5'UTR and fewer uORF elements in breast cancer tissues. Our study demonstrates for the first time the expression of different TSGA10 transcript variants in testis and breast cancer tissues and provides a first clue to a role of TSGA10 5'UTR in regulation of translation in unusual environmental conditions like hypoxia. Copyright © 2017. Published by Elsevier B.V.

Revealing cell cycle control by combining model-based detection of periodic expression with novel cis-regulatory descriptors

PubMed Central

Andersson, Claes R; Hvidsten, Torgeir R; Isaksson, Anders; Gustafsson, Mats G; Komorowski, Jan

2007-01-01

Background We address the issue of explaining the presence or absence of phase-specific transcription in budding yeast cultures under different conditions. To this end we use a model-based detector of gene expression periodicity to divide genes into classes depending on their behavior in experiments using different synchronization methods. While computational inference of gene regulatory circuits typically relies on expression similarity (clustering) in order to find classes of potentially co-regulated genes, this method instead takes advantage of known time profile signatures related to the studied process. Results We explain the regulatory mechanisms of the inferred periodic classes with cis-regulatory descriptors that combine upstream sequence motifs with experimentally determined binding of transcription factors. By systematic statistical analysis we show that periodic classes are best explained by combinations of descriptors rather than single descriptors, and that different combinations correspond to periodic expression in different classes. We also find evidence for additive regulation in that the combinations of cis-regulatory descriptors associated with genes periodically expressed in fewer conditions are frequently subsets of combinations associated with genes periodically expression in more conditions. Finally, we demonstrate that our approach retrieves combinations that are more specific towards known cell-cycle related regulators than the frequently used clustering approach. Conclusion The results illustrate how a model-based approach to expression analysis may be particularly well suited to detect biologically relevant mechanisms. Our new approach makes it possible to provide more refined hypotheses about regulatory mechanisms of the cell cycle and it can easily be adjusted to reveal regulation of other, non-periodic, cellular processes. PMID:17939860

Transcriptional regulation by retinoic acid of interleukin-2 alpha receptors in human B cells.

PubMed Central

Bhatti, L; Sidell, N

1994-01-01

In this study, we demonstrated that retinoic acid (RA) up-regulated interleukin-2 receptor-alpha (IL-2R alpha) expression on two human B-cell lines, IE8.6 and SKW6.4. Deleted forms of the human IL-2R alpha promoter linked to the bacterial chloramphenicol acetyltransferase reporter gene were transfected into IE8.6 cells in order to define RA-responsive regulatory domains. Experiments using the -1.6 kb construct, which contains all known regulatory regions in the IL-2R alpha promoter, indicated that RA could induce IL-2R alpha promoter activity. The basal activity of the -471 construct was initially low, but was markedly enhanced by the addition of RA. Deletion of promoter sequences between -471 and -317 resulted in a significant augmentation of basal promoter activity and abolished promoter induction by RA. This finding revealed a requirement for sequences 5' of base -317 for RA-induced promoter activation, raising the possibility of the presence of both a RA response element and a negative regulatory element (NRE) upstream of base -317. Transfection studies with internal deletion mutants with the putative NRE removed resulted in increases in basal promoter activity and unresponsiveness to RA similar to the -317 construct. In contrast, an internal deletion mutant with the NRE intact had low basal activity and was inducible by RA similar to the -471 construct. Taken together, our results suggested that RA-induced activation of the IL-2R alpha promoter was through changes in the function of a NRE present between bases -400 and -368. This 31-base pair element may interact with an adjacent RA-responsive regulatory site as well as being responsible for down-regulation of basal IL-2R alpha expression under certain conditions. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8157276

Regulation of zebrafish CYP3A65 transcription by AHR2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting

2013-07-15

CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenicmore » lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in mammalian CYP3 genes.« less

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

HSI2/VAL1 Silences AGL15 to Regulate the Developmental Transition from Seed Maturation to Vegetative Growth in Arabidopsis[OPEN

PubMed Central

Abdelmageed, Haggag; Kang, Miyoung

2018-01-01

Gene expression during seed development in Arabidopsis thaliana is controlled by transcription factors including LEAFY COTYLEDON1 (LEC1) and LEC2, ABA INSENSITIVE3 (ABI3), FUSCA3 (FUS3), known as LAFL proteins, and AGAMOUS-LIKE15 (AGL15). The transition from seed maturation to germination and seedling growth requires the transcriptional silencing of these seed maturation-specific factors leading to downregulation of structural genes including those that encode seed storage proteins, oleosins, and dehydrins. During seed germination and vegetative growth, B3-domain protein HSI2/VAL1 is required for the transcriptional silencing of LAFL genes. Here, we report chromatin immunoprecipitation analysis indicating that HSI2/VAL1 binds to the upstream sequences of the AGL15 gene but not at LEC1, ABI3, FUS3, or LEC2 loci. Functional analysis indicates that the HSI2/VAL1 B3 domain interacts with two RY elements upstream of the AGL15 coding region and at least one of them is required for HSI2/VAL1-dependent AGL15 repression. Expression analysis of the major seed maturation regulatory genes LEC1, ABI3, FUS3, and LEC2 in different genetic backgrounds demonstrates that HSI2/VAL1 is epistatic to AGL15 and represses the seed maturation regulatory program through downregulation of AGL15 by deposition of H3K27me3 at this locus. This hypothesis is further supported by results that show that HSI2/VAL1 physically interacts with the Polycomb Repressive Complex 2 component protein MSI1, which is also enriched at the AGL15 locus. PMID:29475938

Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

PubMed

Wang, Cheng; Yu, Jie; Kallen, Caleb B

2008-01-01

The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

PubMed Central

Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

2007-01-01

Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be needed to test whether the observed differences are extrapolatable to monocots and dicots in general, and to understand how they contribute to the fine-tuning of the hormonal response. The outcome of our investigation can now be used to direct future experimentation designed to further dissect the ABA-dependent regulatory networks. PMID:17672917

Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

PubMed

Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

2007-08-01

In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be needed to test whether the observed differences are extrapolatable to monocots and dicots in general, and to understand how they contribute to the fine-tuning of the hormonal response. The outcome of our investigation can now be used to direct future experimentation designed to further dissect the ABA-dependent regulatory networks.

Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

PubMed Central

Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

1997-01-01

GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

Mycobacterium tuberculosis Exploits a Molecular Off Switch of the Immune System for Intracellular Survival.

PubMed

von Both, Ulrich; Berk, Maurice; Agapow, Paul-Michael; Wright, Joseph D; Git, Anna; Hamilton, Melissa Shea; Goldgof, Greg; Siddiqui, Nazneen; Bellos, Evangelos; Wright, Victoria J; Coin, Lachlan J; Newton, Sandra M; Levin, Michael

2018-01-12

Mycobacterium tuberculosis (M. tuberculosis) survives and multiplies inside human macrophages by subversion of immune mechanisms. Although these immune evasion strategies are well characterised functionally, the underlying molecular mechanisms are poorly understood. Here we show that during infection of human whole blood with M. tuberculosis, host gene transcriptional suppression, rather than activation, is the predominant response. Spatial, temporal and functional characterisation of repressed genes revealed their involvement in pathogen sensing and phagocytosis, degradation within the phagolysosome and antigen processing and presentation. To identify mechanisms underlying suppression of multiple immune genes we undertook epigenetic analyses. We identified significantly differentially expressed microRNAs with known targets in suppressed genes. In addition, after searching regions upstream of the start of transcription of suppressed genes for common sequence motifs, we discovered novel enriched composite sequence patterns, which corresponded to Alu repeat elements, transposable elements known to have wide ranging influences on gene expression. Our findings suggest that to survive within infected cells, mycobacteria exploit a complex immune "molecular off switch" controlled by both microRNAs and Alu regulatory elements.

Unexpected sequences and structures of mtDNA required for efficient transcription from the first heavy-strand promoter

PubMed Central

Uchida, Akira; Murugesapillai, Divakaran; Kastner, Markus; Wang, Yao; Lodeiro, Maria F; Prabhakar, Shaan; Oliver, Guinevere V; Arnold, Jamie J; Maher, L James; Williams, Mark C; Cameron, Craig E

2017-01-01

Human mtDNA contains three promoters, suggesting a need for differential expression of the mitochondrial genome. Studies of mitochondrial transcription have used a reductionist approach, perhaps masking differential regulation. Here we evaluate transcription from light-strand (LSP) and heavy-strand (HSP1) promoters using templates that mimic their natural context. These studies reveal sequences upstream, hypervariable in the human population (HVR3), and downstream of the HSP1 transcription start site required for maximal yield. The carboxy-terminal tail of TFAM is essential for activation of HSP1 but not LSP. Images of the template obtained by atomic force microscopy show that TFAM creates loops in a discrete region, the formation of which correlates with activation of HSP1; looping is lost in tail-deleted TFAM. Identification of HVR3 as a transcriptional regulatory element may contribute to between-individual variability in mitochondrial gene expression. The unique requirement of HSP1 for the TFAM tail may enable its regulation by post-translational modifications. DOI: http://dx.doi.org/10.7554/eLife.27283.001 PMID:28745586

Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

PubMed

Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

2001-06-01

Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

Genetics of bacteria that oxidize one-carbon compounds. Progress report, March 1, 1991--June 30, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanson, R.S.

In the past several years researchers have identified at least 20 genes whose products were required for the oxidation of methanol to formaldehyde in three different facultative methylotrophic bacteria. These genes include structural genes for a cytochrome c{sub L} (mox G) and is a specific electron acceptor for methanol dehydrogenase (MDH), and the two structural genes that encode the large subunit (mox F) and smaller subunit (mox I) of MDH. Other genes are required for the synthesis of the prosthetic group of MDH, Pyrroloquinoline quinone (PQQ), and proteins required for assembly of the active MDH in the periplasm. Three genesmore » are believed to be required for incorporation of calcium into the MDH tetramer. The principal investigator`s group has studied the regulation of methanol oxidation in the pink-pigmented-facultative methylotroph Methylobacterium organophilum XX. The authors have mapped several genes and have sequenced the mox F gene and sequences upstream of mox F. The authors had tentatively identified several genes required for the transcription of the MDH structural genes in three methylotrophs. In the previous proposal, the P.I. proposed to establish an in-vitro transcription/translation system to study the function of the regulatory gene products. Further studies demonstrated that the regulation of transcription of these genes was far more complex than imagined at that time and the research plan was modified to determine the number and function of the regulatory genes using genetic approaches.« less

Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

PubMed

Vieille-Grosjean, I; Huber, P

1995-03-03

The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

A predictive biophysical model of translational coupling to coordinate and control protein expression in bacterial operons

PubMed Central

Tian, Tian; Salis, Howard M.

2015-01-01

Natural and engineered genetic systems require the coordinated expression of proteins. In bacteria, translational coupling provides a genetically encoded mechanism to control expression level ratios within multi-cistronic operons. We have developed a sequence-to-function biophysical model of translational coupling to predict expression level ratios in natural operons and to design synthetic operons with desired expression level ratios. To quantitatively measure ribosome re-initiation rates, we designed and characterized 22 bi-cistronic operon variants with systematically modified intergenic distances and upstream translation rates. We then derived a thermodynamic free energy model to calculate de novo initiation rates as a result of ribosome-assisted unfolding of intergenic RNA structures. The complete biophysical model has only five free parameters, but was able to accurately predict downstream translation rates for 120 synthetic bi-cistronic and tri-cistronic operons with rationally designed intergenic regions and systematically increased upstream translation rates. The biophysical model also accurately predicted the translation rates of the nine protein atp operon, compared to ribosome profiling measurements. Altogether, the biophysical model quantitatively predicts how translational coupling controls protein expression levels in synthetic and natural bacterial operons, providing a deeper understanding of an important post-transcriptional regulatory mechanism and offering the ability to rationally engineer operons with desired behaviors. PMID:26117546

Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the -111 kb-Myf5 enhancer.

PubMed

Daubas, Philippe; Buckingham, Margaret E

2013-04-15

The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.

[Bacteriophage λ: electrostatic properties of the genome and its elements].

PubMed

Krutinina, G G; Krutinin, E A; Kamzolova, S G; Osypov, A A

2015-01-01

Bacteriophage λ is a classical model object in molecular biology, but little is still known on the physical properties of its DNA and regulatory elements. A study was made of the electrostatic properties of phage λ DNA and regulatory elements. A global electrostatic potential distribution along the phage genome was found to be nonuniform with main regulatory elements being located in a limited region with a high potential. The RNA polymerase binding frequency on the linearized phage chromosome directly correlates with its local potential. Strong promoters of the phage and its host Escherichia coli have distinct electrostatic upstream elements, which differ in nucleotide sequence. Attachment and recombination sites of phage λ and its host have a higher potential, which possibly facilitates their recognition by integrase. Phage λ and host Rho-independent terminators have a symmetrical M-shaped potential profile, which only slightly depends on the annotated terminator palindrome length, and occur in a region with a substantially higher potential, which may cause polymerase retention, facilitating the formation of a terminator hairpin in RNA. It was concluded that virtually all elements of phage λ genome have potential distribution specifics, which are related to their structural properties and may play a role in their biological function. The global potential distribution along the phage genome reflects the architecture of the regulation of its transcription and integration in the host genome.

Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

PubMed

Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

2016-12-01

In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

Arabidopsis intragenomic conserved noncoding sequence

PubMed Central

Thomas, Brian C.; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Freeling, Michael

2007-01-01

After the most recent tetraploidy in the Arabidopsis lineage, most gene pairs lost one, but not both, of their duplicates. We manually inspected the 3,179 retained gene pairs and their surrounding gene space still present in the genome using a custom-made viewer application. The display of these pairs allowed us to define intragenic conserved noncoding sequences (CNSs), identify exon annotation errors, and discover potentially new genes. Using a strict algorithm to sort high-scoring pair sequences from the bl2seq data, we created a database of 14,944 intragenomic Arabidopsis CNSs. The mean CNS length is 31 bp, ranging from 15 to 285 bp. There are ≈1.7 CNSs associated with a typical gene, and Arabidopsis CNSs are found in all areas around exons, most frequently in the 5′ upstream region. Gene ontology classifications related to transcription, regulation, or “response to …” external or endogenous stimuli, especially hormones, tend to be significantly overrepresented among genes containing a large number of CNSs, whereas protein localization, transport, and metabolism are common among genes with no CNSs. There is a 1.5% overlap between these CNSs and the 218,982 putative RNAs in the Arabidopsis Small RNA Project database, allowing for two mismatches. These CNSs provide a unique set of noncoding sequences enriched for function. CNS function is implied by evolutionary conservation and independently supported because CNS-richness predicts regulatory gene ontology categories. PMID:17301222

Sequence and Genetic Characterization of etrA, an fnr Analog that Regulates Anaerobic Respiration in Shewanella putrefaciens MR-1

NASA Technical Reports Server (NTRS)

Saffarini, Daad A.; Nelson, Kenneth H.

1993-01-01

An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

Signaling coupled epigenomic regulation of gene expression.

PubMed

Kumar, R; Deivendran, S; Santhoshkumar, T R; Pillai, M R

2017-10-26

Inheritance of genomic information independent of the DNA sequence, the epigenetics, as well as gene transcription are profoundly shaped by serine/threonine and tyrosine signaling kinases and components of the chromatin remodeling complexes. To precisely respond to a changing external milieu, human cells efficiently translate upstream signals into post-translational modifications (PTMs) on histones and coregulators such as corepressors, coactivators, DNA-binding factors and PTM modifying enzymes. Because a protein with multiple residues for putative PTMs is expected to undergo more than one PTM in cells stimulated with growth factors, the outcome of combinational PTM codes on histones and coregulators is profoundly shaped by regulatory interplays between PTMs. The genomic functions of signaling kinases in cancer cells are manifested by the downstream effectors of cytoplasmic signaling cascades as well as translocation of the cytoplasmic signaling kinases to the nucleus. Signaling-mediated phosphorylation of histones serves as a regulatory switch for other PTMs, and connects chromatin remodeling complexes into gene transcription and gene activity. Here, we will discuss the recent advances in signaling-dependent epigenomic regulation of gene transcription using a few representative cancer-relevant serine/threonine and tyrosine kinases and their interplay with chromatin remodeling factors in cancer cells.

Construction and Quantitative Validation of Chicken CXCR4 Expression Reporter.

PubMed

Es-Haghi, Masoumeh; Bassami, Mohammadreza; Dehghani, Hesam

2016-03-01

Site directional migration is an important biological event and an essential behavior for latent migratory cells. A migratory cell maintains its motility, survival, and proliferation abilities by a network of signaling pathways where CXCR4/SDF signaling route plays crucial role for directed homing of a polarized cell. The chicken embryo due to its specific vasculature modality has been used as a valuable model for organogenesis, migration, cancer, and metastasis. In this research, the regulatory regions of chicken CXCR4 gene have been characterized in a chicken hematopoietic lymphoblast cell line (MSB1). A region extending from -2000 bp upstream of CXCR4 gene to +68 after its transcriptional start site, in addition to two other mutant fragments were constructed and cloned in a promoter-less reporter vector. Promoter activity was analyzed by quantitative real-time RT-PCR and flow cytometry techniques. Our findings show that the full sequence from -2000 to +68 bp of CXCR4 regulatory region is required for maximum promoter functionality, while the mutant CXCR4 promoter fragments show a partial promoter activity. The chicken CXCR4 promoter validated in this study could be used for characterization of directed migratory cells in chicken development and disease models.

Regulation of the scp Genes in the Cyanobacterium Synechocystis sp. PCC 6803--What is New?

PubMed

Cheregi, Otilia; Funk, Christiane

2015-08-12

In the cyanobacterium Synechocystis sp. PCC 6803 there are five genes encoding small CAB-like (SCP) proteins, which have been shown to be up-regulated under stress. Analyses of the promoter sequences of the scp genes revealed the existence of an NtcA binding motif in two scp genes, scpB and scpE. Binding of NtcA, the key transcriptional regulator during nitrogen stress, to the promoter regions was shown by electrophoretic mobility shift assay. The metabolite 2-oxoglutarate did not increase the affinity of NtcA for binding to the promoters of scpB and scpE. A second motif, the HIP1 palindrome 5' GGCGATCGCC 3', was detected in the upstream regions of scpB and scpC. The transcription factor encoded by sll1130 has been suggested to recognize this motif to regulate heat-responsive genes. Our data suggest that HIP1 is not a regulatory element within the scp genes. Further, the presence of the high light regulatory (HLR1) motif was confirmed in scpB-E, in accordance to their induced transcriptions in cells exposed to high light. The HLR1 motif was newly discovered in eight additional genes.

Sequence-based model of gap gene regulatory network.

PubMed

Kozlov, Konstantin; Gursky, Vitaly; Kulakovskiy, Ivan; Samsonova, Maria

2014-01-01

The detailed analysis of transcriptional regulation is crucially important for understanding biological processes. The gap gene network in Drosophila attracts large interest among researches studying mechanisms of transcriptional regulation. It implements the most upstream regulatory layer of the segmentation gene network. The knowledge of molecular mechanisms involved in gap gene regulation is far less complete than that of genetics of the system. Mathematical modeling goes beyond insights gained by genetics and molecular approaches. It allows us to reconstruct wild-type gene expression patterns in silico, infer underlying regulatory mechanism and prove its sufficiency. We developed a new model that provides a dynamical description of gap gene regulatory systems, using detailed DNA-based information, as well as spatial transcription factor concentration data at varying time points. We showed that this model correctly reproduces gap gene expression patterns in wild type embryos and is able to predict gap expression patterns in Kr mutants and four reporter constructs. We used four-fold cross validation test and fitting to random dataset to validate the model and proof its sufficiency in data description. The identifiability analysis showed that most model parameters are well identifiable. We reconstructed the gap gene network topology and studied the impact of individual transcription factor binding sites on the model output. We measured this impact by calculating the site regulatory weight as a normalized difference between the residual sum of squares error for the set of all annotated sites and for the set with the site of interest excluded. The reconstructed topology of the gap gene network is in agreement with previous modeling results and data from literature. We showed that 1) the regulatory weights of transcription factor binding sites show very weak correlation with their PWM score; 2) sites with low regulatory weight are important for the model output; 3) functional important sites are not exclusively located in cis-regulatory elements, but are rather dispersed through regulatory region. It is of importance that some of the sites with high functional impact in hb, Kr and kni regulatory regions coincide with strong sites annotated and verified in Dnase I footprint assays.

Cyclic nucleotide-gated ion channel gene family in rice, identification, characterization and experimental analysis of expression response to plant hormones, biotic and abiotic stresses.

PubMed

Nawaz, Zarqa; Kakar, Kaleem Ullah; Saand, Mumtaz A; Shu, Qing-Yao

2014-10-04

Cyclic nucleotide-gated channels (CNGCs) are Ca2+-permeable cation transport channels, which are present in both animal and plant systems. They have been implicated in the uptake of both essential and toxic cations, Ca2+ signaling, pathogen defense, and thermotolerance in plants. To date there has not been a genome-wide overview of the CNGC gene family in any economically important crop, including rice (Oryza sativa L.). There is an urgent need for a thorough genome-wide analysis and experimental verification of this gene family in rice. In this study, a total of 16 full length rice CNGC genes distributed on chromosomes 1-6, 9 and 12, were identified by employing comprehensive bioinformatics analyses. Based on phylogeny, the family of OsCNGCs was classified into four major groups (I-IV) and two sub-groups (IV-A and IV- B). Likewise, the CNGCs from all plant lineages clustered into four groups (I-IV), where group II was conserved in all land plants. Gene duplication analysis revealed that both chromosomal segmentation (OsCNGC1 and 2, 10 and 11, 15 and 16) and tandem duplications (OsCNGC1 and 2) significantly contributed to the expansion of this gene family. Motif composition and protein sequence analysis revealed that the CNGC specific domain "cyclic nucleotide-binding domain (CNBD)" comprises a "phosphate binding cassette" (PBC) and a "hinge" region that is highly conserved among the OsCNGCs. In addition, OsCNGC proteins also contain various other functional motifs and post-translational modification sites. We successively built a stringent motif: (LI-X(2)-[GS]-X-[FV]-X-G-[1]-ELL-X-W-X(12,22)-SA-X(2)-T-X(7)-[EQ]-AF-X-L) that recognizes the rice CNGCs specifically. Prediction of cis-acting regulatory elements in 5' upstream sequences and expression analyses through quantitative qPCR demonstrated that OsCNGC genes were highly responsive to multiple stimuli including hormonal (abscisic acid, indoleacetic acid, kinetin and ethylene), biotic (Pseudomonas fuscovaginae and Xanthomonas oryzae pv. oryzae) and abiotic (cold) stress. There are 16 CNGC genes in rice, which were probably expanded through chromosomal segmentation and tandem duplications and comprise a PBC and a "hinge" region in the CNBD domain, featured by a stringent motif. The various cis-acting regulatory elements in the upstream sequences may be responsible for responding to multiple stimuli, including hormonal, biotic and abiotic stresses.

Genome Analysis Reveals Interplay between 5′UTR Introns and Nuclear mRNA Export for Secretory and Mitochondrial Genes

PubMed Central

Cenik, Can; Chua, Hon Nian; Zhang, Hui; Tarnawsky, Stefan P.; Akef, Abdalla; Derti, Adnan; Tasan, Murat; Moore, Melissa J.; Palazzo, Alexander F.; Roth, Frederick P.

2011-01-01

In higher eukaryotes, messenger RNAs (mRNAs) are exported from the nucleus to the cytoplasm via factors deposited near the 5′ end of the transcript during splicing. The signal sequence coding region (SSCR) can support an alternative mRNA export (ALREX) pathway that does not require splicing. However, most SSCR–containing genes also have introns, so the interplay between these export mechanisms remains unclear. Here we support a model in which the furthest upstream element in a given transcript, be it an intron or an ALREX–promoting SSCR, dictates the mRNA export pathway used. We also experimentally demonstrate that nuclear-encoded mitochondrial genes can use the ALREX pathway. Thus, ALREX can also be supported by nucleotide signals within mitochondrial-targeting sequence coding regions (MSCRs). Finally, we identified and experimentally verified novel motifs associated with the ALREX pathway that are shared by both SSCRs and MSCRs. Our results show strong correlation between 5′ untranslated region (5′UTR) intron presence/absence and sequence features at the beginning of the coding region. They also suggest that genes encoding secretory and mitochondrial proteins share a common regulatory mechanism at the level of mRNA export. PMID:21533221

Three enhancer regions regulate gbx2 gene expression in the isthmic region during zebrafish development.

PubMed

Islam, Md Ekramul; Kikuta, Hiroshi; Inoue, Fumitaka; Kanai, Maiko; Kawakami, Atsushi; Parvin, Mst Shahnaj; Takeda, Hiroyuki; Yamasu, Kyo

2006-12-01

In vertebrate embryos, positioning of the boundary between the midbrain and hindbrain (MHB) and subsequent isthmus formation are dependent upon the interaction between the Otx2 and Gbx genes. In zebrafish, sequential expression of gbx1 and gbx2 in the anterior hindbrain contributes to this process, whereas in mouse embryos, a single Gbx gene (Gbx2) is responsible for MHB development. In the present study, to investigate the regulatory mechanism of gbx2 in the MHB/isthmic region of zebrafish embryos, we cloned the gene and showed that its organization is conserved among different vertebrates. Promoter analyses revealed three enhancers that direct reporter gene expression after the end of epiboly in the anterior-most hindbrain, which is a feature of the zebrafish gbx2 gene. One of the enhancers is located upstream of gbx2 (AMH1), while the other two enhancers are located downstream of gbx2 (AMH2 and AMH3). Detailed analysis of the AMH1 enhancer showed that it directs expression in the rhombomere 1 (r1) region and the dorsal thalamus, as has been shown for gbx2, whereas no expression was induced by the AMH1 enhancer in other embryonic regions in which gbx2 is expressed. The AMH1 enhancer is composed of multiple regulatory subregions that share the same spatial specificity. The most active of the regulatory subregions is a 291-bp region that contains at least two Pax2-binding sites, both of which are necessary for the function of the main component (PB1-A region) of the AMH1 enhancer. In accordance with these results, enhancer activity in the PB1-A region, as well as gbx2 expression in r1, was missing in no isthmus mutant embryos that lacked functional pax2a. In addition, we identified an upstream conserved sequence of 227bp that suppresses the enhancer activity of AMH1. Taken together, these findings suggest that gbx2 expression during the somitogenesis stage in zebrafish is regulated by a complex mechanism involving Pax2 as well as activators and suppressors in the regions flanking the gene.

Tissue specific expression of the retinoic acid receptor-beta 2: regulation by short open reading frames in the 5'-noncoding region

PubMed Central

1994-01-01

The 40-S subunit of eukaryotic ribosomes binds to the capped 5'-end of mRNA and scans for the first AUG in a favorable sequence context to initiate translation. Most eukaryotic mRNAs therefore have a short 5'- untranslated region (5'-UTR) and no AUGs upstream of the translational start site; features that seem to assure efficient translation. However, approximately 5-10% of all eukaryotic mRNAs, particularly those encoding for regulatory proteins, have complex leader sequences that seem to compromise translational initiation. The retinoic-acid- receptor-beta 2 (RAR beta 2) mRNA is such a transcript with a long (461 nucleotides) 5'-UTR that contains five, partially overlapping, upstream open reading frames (uORFs) that precede the major ORF. We have begun to investigate the function of this complex 5'-UTR in transgenic mice, by introducing mutations in the start/stop codons of the uORFs in RAR beta 2-lacZ reporter constructs. When we compared the expression patterns of mutant and wild-type constructs we found that these mutations affected expression of the downstream RAR beta 2-ORF, resulting in an altered regulation of RAR beta 2-lacZ expression in heart and brain. Other tissues were unaffected. RNA analysis of adult tissues demonstrated that the uORFs act at the level of translation; adult brains and hearts of transgenic mice carrying a construct with either the wild-type or a mutant UTR, had the same levels of mRNA, but only the mutant produced protein. Our study outlines an unexpected role for uORFs: control of tissue-specific and developmentally regulated gene expression. PMID:7962071

A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

PubMed Central

2014-01-01

Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

Regulatory sequence analysis tools.

PubMed

van Helden, Jacques

2003-07-01

The web resource Regulatory Sequence Analysis Tools (RSAT) (http://rsat.ulb.ac.be/rsat) offers a collection of software tools dedicated to the prediction of regulatory sites in non-coding DNA sequences. These tools include sequence retrieval, pattern discovery, pattern matching, genome-scale pattern matching, feature-map drawing, random sequence generation and other utilities. Alternative formats are supported for the representation of regulatory motifs (strings or position-specific scoring matrices) and several algorithms are proposed for pattern discovery. RSAT currently holds >100 fully sequenced genomes and these data are regularly updated from GenBank.

Genome sequencing and comparative genomics of honey bee microsporidia, Nosema apis reveal novel insights into host-parasite interactions.

PubMed

Chen, Yan ping; Pettis, Jeffery S; Zhao, Yan; Liu, Xinyue; Tallon, Luke J; Sadzewicz, Lisa D; Li, Renhua; Zheng, Huoqing; Huang, Shaokang; Zhang, Xuan; Hamilton, Michele C; Pernal, Stephen F; Melathopoulos, Andony P; Yan, Xianghe; Evans, Jay D

2013-07-05

The microsporidia parasite Nosema contributes to the steep global decline of honey bees that are critical pollinators of food crops. There are two species of Nosema that have been found to infect honey bees, Nosema apis and N. ceranae. Genome sequencing of N. apis and comparative genome analysis with N. ceranae, a fully sequenced microsporidia species, reveal novel insights into host-parasite interactions underlying the parasite infections. We applied the whole-genome shotgun sequencing approach to sequence and assemble the genome of N. apis which has an estimated size of 8.5 Mbp. We predicted 2,771 protein- coding genes and predicted the function of each putative protein using the Gene Ontology. The comparative genomic analysis led to identification of 1,356 orthologs that are conserved between the two Nosema species and genes that are unique characteristics of the individual species, thereby providing a list of virulence factors and new genetic tools for studying host-parasite interactions. We also identified a highly abundant motif in the upstream promoter regions of N. apis genes. This motif is also conserved in N. ceranae and other microsporidia species and likely plays a role in gene regulation across the microsporidia. The availability of the N. apis genome sequence is a significant addition to the rapidly expanding body of microsprodian genomic data which has been improving our understanding of eukaryotic genome diversity and evolution in a broad sense. The predicted virulent genes and transcriptional regulatory elements are potential targets for innovative therapeutics to break down the life cycle of the parasite.

Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

PubMed Central

Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

1993-01-01

The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Molecular Regulatory Pathways Link Sepsis With Metabolic Syndrome: Non-coding RNA Elements Underlying the Sepsis/Metabolic Cross-Talk.

PubMed

Meydan, Chanan; Bekenstein, Uriya; Soreq, Hermona

2018-01-01

Sepsis and metabolic syndrome (MetS) are both inflammation-related entities with high impact for human health and the consequences of concussions. Both represent imbalanced parasympathetic/cholinergic response to insulting triggers and variably uncontrolled inflammation that indicates shared upstream regulators, including short microRNAs (miRs) and long non-coding RNAs (lncRNAs). These may cross talk across multiple systems, leading to complex molecular and clinical outcomes. Notably, biomedical and RNA-sequencing based analyses both highlight new links between the acquired and inherited pathogenic, cardiac and inflammatory traits of sepsis/MetS. Those include the HOTAIR and MIAT lncRNAs and their targets, such as miR-122, -150, -155, -182, -197, -375, -608 and HLA-DRA. Implicating non-coding RNA regulators in sepsis and MetS may delineate novel high-value biomarkers and targets for intervention.

Production of human monoclonal antibody in eggs of chimeric chickens.

PubMed

Zhu, Lei; van de Lavoir, Marie-Cecile; Albanese, Jenny; Beenhouwer, David O; Cardarelli, Pina M; Cuison, Severino; Deng, David F; Deshpande, Shrikant; Diamond, Jennifer H; Green, Lynae; Halk, Edward L; Heyer, Babette S; Kay, Robert M; Kerchner, Allyn; Leighton, Philip A; Mather, Christine M; Morrison, Sherie L; Nikolov, Zivko L; Passmore, David B; Pradas-Monne, Alicia; Preston, Benjamin T; Rangan, Vangipuram S; Shi, Mingxia; Srinivasan, Mohan; White, Steven G; Winters-Digiacinto, Peggy; Wong, Susan; Zhou, Wen; Etches, Robert J

2005-09-01

The tubular gland of the chicken oviduct is an attractive system for protein expression as large quantities of proteins are deposited in the egg, the production of eggs is easily scalable and good manufacturing practices for therapeutics from eggs have been established. Here we examined the ability of upstream and downstream DNA sequences of ovalbumin, a protein produced exclusively in very high quantities in chicken egg white, to drive tissue-specific expression of human mAb in chicken eggs. To accommodate these large regulatory regions, we established and transfected lines of chicken embryonic stem (cES) cells and formed chimeras that express mAb from cES cell-derived tubular gland cells. Eggs from high-grade chimeras contained up to 3 mg of mAb that possesses enhanced antibody-dependent cellular cytotoxicity (ADCC), nonantigenic glycosylation, acceptable half-life, excellent antigen recognition and good rates of internalization.

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

Caste development and reproduction: a genome-wide analysis of hallmarks of insect eusociality

PubMed Central

Cristino, A S; Nunes, F M F; Lobo, C H; Bitondi, M M G; Simões, Z L P; Da Fontoura Costa, L; Lattorff, H M G; Moritz, R F A; Evans, J D; Hartfelder, K

2006-01-01

The honey bee queen and worker castes are a model system for developmental plasticity. We used established expressed sequence tag information for a Gene Ontology based annotation of genes that are differentially expressed during caste development. Metabolic regulation emerged as a major theme, with a caste-specific difference in the expression of oxidoreductases vs. hydrolases. Motif searches in upstream regions revealed group-specific motifs, providing an entry point to cis-regulatory network studies on caste genes. For genes putatively involved in reproduction, meiosis-associated factors came out as highly conserved, whereas some determinants of embryonic axes either do not have clear orthologs (bag of marbles, gurken, torso), or appear to be lacking (trunk) in the bee genome. Our results are the outcome of a first genome-based initiative to provide an annotated framework for trends in gene regulation during female caste differentiation (representing developmental plasticity) and reproduction. PMID:17069641

Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans

PubMed Central

Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W.; Grubert, Fabian; Candille, Sophie I.; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L.; Tang, Hua; Ricci, Emiliano; Snyder, Michael P.

2015-01-01

Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy—many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. PMID:26297486

The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

PubMed Central

Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

2008-01-01

Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

Copy number variation of two separate regulatory regions upstream of SOX9 causes isolated 46,XY or 46,XX disorder of sex development.

PubMed

Kim, Gwang-Jin; Sock, Elisabeth; Buchberger, Astrid; Just, Walter; Denzer, Friederike; Hoepffner, Wolfgang; German, James; Cole, Trevor; Mann, Jillian; Seguin, John H; Zipf, William; Costigan, Colm; Schmiady, Hardi; Rostásy, Moritz; Kramer, Mildred; Kaltenbach, Simon; Rösler, Bernd; Georg, Ina; Troppmann, Elke; Teichmann, Anne-Christin; Salfelder, Anika; Widholz, Sebastian A; Wieacker, Peter; Hiort, Olaf; Camerino, Giovanna; Radi, Orietta; Wegner, Michael; Arnold, Hans-Henning; Scherer, Gerd

2015-04-01

SOX9 mutations cause the skeletal malformation syndrome campomelic dysplasia in combination with XY sex reversal. Studies in mice indicate that SOX9 acts as a testis-inducing transcription factor downstream of SRY, triggering Sertoli cell and testis differentiation. An SRY-dependent testis-specific enhancer for Sox9 has been identified only in mice. A previous study has implicated copy number variations (CNVs) of a 78 kb region 517-595 kb upstream of SOX9 in the aetiology of both 46,XY and 46,XX disorders of sex development (DSD). We wanted to better define this region for both disorders. By CNV analysis, we identified SOX9 upstream duplications in three cases of SRY-negative 46,XX DSD, which together with previously reported duplications define a 68 kb region, 516-584 kb upstream of SOX9, designated XXSR (XX sex reversal region). More importantly, we identified heterozygous deletions in four families with SRY-positive 46,XY DSD without skeletal phenotype, which define a 32.5 kb interval 607.1-639.6 kb upstream of SOX9, designated XY sex reversal region (XYSR). To localise the suspected testis-specific enhancer, XYSR subfragments were tested in cell transfection and transgenic experiments. While transgenic experiments remained inconclusive, a 1.9 kb SRY-responsive subfragment drove expression specifically in Sertoli-like cells. Our results indicate that isolated 46,XY and 46,XX DSD can be assigned to two separate regulatory regions, XYSR and XXSR, far upstream of SOX9. The 1.9 kb SRY-responsive subfragment from the XYSR might constitute the core of the Sertoli-cell enhancer of human SOX9, representing the so far missing link in the genetic cascade of male sex determination. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

Characterization of regulatory elements within the coat protein (CP) coding region of Tobacco mosaic virus affecting subgenomic transcription and green fluorescent protein expression from the CP subgenomic RNA promoter.

PubMed

Man, Michal; Epel, Bernard L

2004-06-01

A replicon based on Tobacco mosaic virus that was engineered to express the open reading frame (ORF) of the green fluorescent protein (GFP) gene in place of the native coat protein (CP) gene from a minimal CP subgenomic (sg) RNA promoter was found to accumulate very low levels of GFP. Regulatory regions within the CP ORF were identified that, when presented as untranslated regions flanking the GFP ORF, enhanced or inhibited sg transcription and GFP expression. Full GFP expression from the CP sgRNA promoter required more than the first 20 nt of the CP ORF but not beyond the first 56 nt. Further analysis indicated the presence of an enhancer element between nt +25 and +55 with respect to the CP translation start site. The inclusion of this enhancer sequence upstream of the GFP ORF led to elevated sg transcription and to a 50-fold increase in GFP accumulation in comparison with a minimal CP promoter in which the entire CP ORF was displaced by the GFP ORF. Inclusion of the 3'-terminal 22 nt had a minor positive effect on GFP accumulation, but the addition of extended untranslated sequences from the 3' terminus of the CP ORF downstream of the GFP ORF was basically found to inhibit sg transcription. Secondary structure analysis programs predicted the CP sgRNA promoter to reside within two stable stem-loop structures, which are followed by an enhancer region.

In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

PubMed

Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

2017-02-07

Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

Loss of imprinting at the Dlk1-Gtl2 locus caused by insertional mutagenesis in the Gtl2 5' region

PubMed Central

Steshina, Ekaterina Y; Carr, Michael S; Glick, Elena A; Yevtodiyenko, Aleksey; Appelbe, Oliver K; Schmidt, Jennifer V

2006-01-01

Background The Dlk1 and Gtl2 genes define a region of mouse chromosome 12 that is subject to genomic imprinting, the parental allele-specific expression of a gene. Although imprinted genes play important roles in growth and development, the mechanisms by which imprinting is established and maintained are poorly understood. Differentially methylated regions (DMRs), which carry methylation on only one parental allele, are involved in imprinting control at many loci. The Dlk1-Gtl2 region contains three known DMRs, the Dlk1 DMR in the 3' region of Dlk1, the intergenic DMR 15 kb upstream of Gtl2, and the Gtl2 DMR at the Gtl2 promoter. Three mouse models are analyzed here that provide new information about the regulation of Dlk1-Gtl2 imprinting. Results A previously existing insertional mutation (Gtl2lacZ), and a targeted deletion in which the Gtl2 upstream region was replaced by a Neo cassette (Gtl2Δ5'Neo), display partial lethality and dwarfism upon paternal inheritance. Molecular characterization shows that both mutations cause loss of imprinting and changes in expression of the Dlk1, Gtl2 and Meg8/Rian genes. Dlk1 levels are decreased upon paternal inheritance of either mutation, suggesting Dlk1 may be causative for the lethality and dwarfism. Loss of imprinting on the paternal chromosome in both Gtl2lacZ and Gtl2Δ5'Neo mice is accompanied by the loss of paternal-specific Gtl2 DMR methylation, while maternal loss of imprinting suggests a previously unknown regulatory role for the maternal Gtl2 DMR. Unexpectedly, when the Neo gene is excised, Gtl2Δ5' animals are of normal size, imprinting is unchanged and the Gtl2 DMR is properly methylated. The exogenous DNA sequences integrated upstream of Gtl2 are therefore responsible for the growth and imprinting effects. Conclusion These data provide further evidence for the coregulation of the imprinted Dlk1 and Gtl2 genes, and support a role for Dlk1 as an important neonatal growth factor. The ability of the Gtl2lacZ and Gtl2Δ5'Neo mutations to cause long-range changes in imprinting and gene expression suggest that regional imprinting regulatory elements may lie in proximity to the integration site. PMID:17014736

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

PubMed Central

Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

1990-01-01

We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

Application of a framework for extrapolating chemical effects ...

EPA Pesticide Factsheets

Cross-species extrapolation of toxicity data from limited surrogate test organisms to all wildlife with potential of chemical exposure remains a key challenge in ecological risk assessment. A number of factors affect extrapolation, including the chemical exposure, pharmacokinetics, life-stage, and pathway similarities/differences. Here we propose a framework using a tiered approach for species extrapolation that enables a transparent weight-of-evidence driven evaluation of pathway conservation (or lack thereof) in the context of adverse outcome pathways. Adverse outcome pathways describe the linkages from a molecular initiating event, defined as the chemical-biomolecule interaction, through subsequent key events leading to an adverse outcome of regulatory concern (e.g., mortality, reproductive dysfunction). Tier 1 of the extrapolation framework employs in silico evaluations of sequence and structural conservation of molecules (e.g., receptors, enzymes) associated with molecular initiating events or upstream key events. Such evaluations make use of available empirical and sequence data to assess taxonomic relevance. Tier 2 uses in vitro bioassays, such as enzyme inhibition/activation, competitive receptor binding, and transcriptional activation assays to explore functional conservation of pathways across taxa. Finally, Tier 3 provides a comparative analysis of in vivo responses between species utilizing well-established model organisms to assess departure from

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

Widespread promoter-mediated coordination of transcription and mRNA degradation

PubMed Central

2012-01-01

Background Previous work showed that mRNA degradation is coordinated with transcription in yeast, and in several genes the control of mRNA degradation was linked to promoter elements through two different mechanisms. Here we show at the genomic scale that the coordination of transcription and mRNA degradation is promoter-dependent in yeast and is also observed in humans. Results We first demonstrate that swapping upstream cis-regulatory sequences between two yeast species affects both transcription and mRNA degradation and suggest that while some cis-regulatory elements control either transcription or degradation, multiple other elements enhance both processes. Second, we show that adjacent yeast genes that share a promoter (through divergent orientation) have increased similarity in their patterns of mRNA degradation, providing independent evidence for the promoter-mediated coupling of transcription to mRNA degradation. Finally, analysis of the differences in mRNA degradation rates between mammalian cell types or mammalian species suggests a similar coordination between transcription and mRNA degradation in humans. Conclusions Our results extend previous studies and suggest a pervasive promoter-mediated coordination between transcription and mRNA degradation in yeast. The diverse genes and regulatory elements associated with this coordination suggest that it is generated by a global mechanism of gene regulation and modulated by gene-specific mechanisms. The observation of a similar coupling in mammals raises the possibility that coupling of transcription and mRNA degradation may reflect an evolutionarily conserved phenomenon in gene regulation. PMID:23237624

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

PubMed

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

The noncoding human genome and the future of personalised medicine.

PubMed

Cowie, Philip; Hay, Elizabeth A; MacKenzie, Alasdair

2015-01-30

Non-coding cis-regulatory sequences act as the 'eyes' of the genome and their role is to perceive, organise and relay cellular communication information to RNA polymerase II at gene promoters. The evolution of these sequences, that include enhancers, silencers, insulators and promoters, has progressed in multicellular organisms to the extent that cis-regulatory sequences make up as much as 10% of the human genome. Parallel evidence suggests that 75% of polymorphisms associated with heritable disease occur within predicted cis-regulatory sequences that effectively alter the 'perception' of cis-regulatory sequences or render them blind to cell communication cues. Cis-regulatory sequences also act as major functional targets of epigenetic modification thus representing an important conduit through which changes in DNA-methylation affects disease susceptibility. The objectives of the current review are (1) to describe what has been learned about identifying and characterising cis-regulatory sequences since the sequencing of the human genome; (2) to discuss their role in interpreting cell signalling pathways pathways; and (3) outline how this role may be altered by polymorphisms and epigenetic changes. We argue that the importance of the cis-regulatory genome for the interpretation of cellular communication pathways cannot be overstated and understanding its role in health and disease will be critical for the future development of personalised medicine.

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

NASA Astrophysics Data System (ADS)

Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

2005-09-01

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Mutant swarms of a totivirus-like entities are present in the red macroalga Chondrus crispus and have been partially transferred to the nuclear genome.

PubMed

Rousvoal, Sylvie; Bouyer, Betty; López-Cristoffanini, Camilo; Boyen, Catherine; Collén, Jonas

2016-08-01

Chondrus crispus Stackhouse (Gigartinales) is a red seaweed found on North Atlantic rocky shores. Electrophoresis of RNA extracts showed a prominent band with a size of around 6,000 bp. Sequencing of the band revealed several sequences with similarity to totiviruses, double-stranded RNA viruses that normally infect fungi. This virus-like entity was named C. crispus virus (CcV). It should probably be regarded as an extreme viral quasispecies or a mutant swarm since low identity (<65%) was found between sequences. Totiviruses typically code for two genes: one capsid gene (gag) and one RNA-dependent RNA polymerase gene (pol) with a pseudoknot structure between the genes. Both the genes and the intergenic structures were found in the CcV sequences. A nonidentical gag gene was also found in the nuclear genome of C. crispus, with associated expressed sequence tags (EST) and upstream regulatory features. The gene was presumably horizontally transferred from the virus to the alga. Similar dsRNA bands were seen in extracts from different life cycle stages of C. crispus and from all geographic locations tested. In addition, similar bands were also observed in RNA extractions from other red algae; however, the significance of this apparently widespread phenomenon is unknown. Neither phenotype caused by the infection nor any virus particles or capsid proteins were identified; thus, the presence of viral particles has not been validated. These findings increase the known host range of totiviruses to include marine red algae. © 2016 Phycological Society of America.

Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

NASA Technical Reports Server (NTRS)

Romano, Laura A.; Wray, Gregory A.

2003-01-01

Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

PubMed

Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

2005-09-22

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Molecular characterization of the Serratia marcescens OmpF porin, and analysis of S. marcescens OmpF and OmpC osmoregulation.

PubMed

Hutsul, J A; Worobec, E

1997-08-01

Serratia marcescens is a nosocomial pathogen with a high incidence of beta-lactam resistance. Reduced amounts of outer-membrane porins have been correlated with increased resistance to beta-lactams but only one porin, OmpC, has been characterized at the molecular level. In this study we present the molecular characterization of a second porin, OmpF, and an analysis of the expression of S. marcescens porins in response to various environmental changes. Two porins were isolated from the outer membrane using urea-SDS-PAGE and the relative amounts were shown to be influenced by the osmolarity of the medium and the presence of salicylate. From a S. marcescens genomic DNA library an 8 kb EcoRI fragment was isolated that hybridized with an oligonucleotide encoding the published N-terminal amino acid sequence of the S. marcescens 41 kDa porin. A 41 kDa protein was detected in the outer membrane of Escherichia coli NM522 carrying the cloned S. marcescens DNA. The cloned gene was sequenced and shown to code for a protein that shared 60-70% identity with other known OmpF and OmpC sequences. The upstream DNA sequence of the S. marcescens gene was similar to the corresponding E. coli ompF sequence; however, a regulatory element important in repression of E. coli ompF at high osmolarity was absent. The cloned S. marcescens OmpF in E. coli increased in expression in conditions of high osmolarity. The potential involvement of micF in the observed osmoregulation of S. marcescens porins is discussed.

Mutations in the newly identified RAX regulatory sequence are not a frequent cause of micro/anophthalmia.

PubMed

Chassaing, Nicolas; Vigouroux, Adeline; Calvas, Patrick

2009-06-01

Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (SOX2, OTX2, RAX, and CHX10) have been implicated in isolated micro/anophthalmia, but causative mutations of these genes explain less than a quarter of these developmental defects. A specifically conserved SOX2/OTX2-mediated RAX expression regulatory sequence has recently been identified. We postulated that mutations in this sequence could lead to micro/anophthalmia, and thus we performed molecular screening of this regulatory element in patients suffering from micro/anophthalmia. Fifty-one patients suffering from nonsyndromic microphthalmia (n = 40) or anophthalmia (n = 11) were included in this study after negative molecular screening for SOX2, OTX2, RAX, and CHX10 mutations. Mutation screening of the RAX regulatory sequence was performed by direct sequencing for these patients. No mutations were identified in the highly conserved RAX regulatory sequence in any of the 51 patients. Mutations in the newly identified RAX regulatory sequence do not represent a frequent cause of nonsyndromic micro/anophthalmia.

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

PubMed

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.

Comparative Analysis of V-Akt Murine Thymoma Viral Oncogene Homolog 3 (AKT3) Gene between Cow and Buffalo Reveals Substantial Differences for Mastitis.

PubMed

Ullah, Farman; Bhattarai, Dinesh; Cheng, Zhangrui; Liang, Xianwei; Deng, Tingxian; Rehman, Zia Ur; Talpur, Hira Sajjad; Worku, Tesfaye; Brohi, Rahim Dad; Safdar, Muhammad; Ahmad, Muhammad Jamil; Salim, Mohammad; Khan, Momen; Ahmad, Hafiz Ishfaq; Zhang, Shujun

2018-01-01

AKT3 gene is a constituent of the serine/threonine protein kinase family and plays a crucial role in synthesis of milk fats and cholesterol by regulating activity of the sterol regulatory element binding protein (SREBP). AKT3 is highly conserved in mammals and its expression levels during the lactation periods of cattle are markedly increased. AKT3 is highly expressed in the intestine followed by mammary gland and it is also expressed in immune cells. It is involved in the TLR pathways as effectively as proinflammatory cytokines. The aims of this study were to investigate the sequences differences between buffalo and cow. Our results showed that there were substantial differences between buffalo and cow in some exons and noteworthy differences of the gene size in different regions. We also identified the important consensus sequence motifs, variation in 2000 upstream of ATG, substantial difference in the "3'UTR" region, and miRNA association in the buffalo sequences compared with the cow. In addition, genetic analyses, such as gene structure, phylogenetic tree, position of different motifs, and functional domains, were performed to establish their correlation with other species. This may indicate that a buffalo breed has potential resistance to disease, environment changes, and airborne microorganisms and some good production and reproductive traits.

Myotonin protein-kinase [AGC]n trinucleotide repeat in seven nonhuman primates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Novelli, G.; Sineo, L.; Pontieri, E.

Myotonic dystrophy (DM) is due to a genomic instability of a trinucleotide [AGC]n motif, located at the 3{prime} UTR region of a protein-kinase gene (myotonin protein kinase, MT-PK). The [AGC] repeat is meiotically and mitotically unstable, and it is directly related to the manifestations of the disorder. Although a gene dosage effect of the MT-PK has been demonstrated n DM muscle, the mechanism(s) by which the intragenic repeat expansion leads to disease is largely unknown. This non-standard mutational event could reflect an evolutionary mechanism widespread among animal genomes. We have isolated and sequenced the complete 3{prime}UTR region of the MT-PKmore » gene in seven primates (macaque, orangutan, gorilla, chimpanzee, gibbon, owl monkey, saimiri), and examined by comparative sequence nucleotide analysis the [AGC]n intragenic repeat and the surrounding nucleotides. The genomic organization, including the [AGC]n repeat structure, was conserved in all examined species, excluding the gibbon (Hylobates agilis), in which the [AGC]n upstream sequence (GGAA) is replaced by a GA dinucleotide. The number of [AGC]n in the examined species ranged between 7 (gorilla) and 13 repeats (owl monkeys), with a polymorphism informative content (PIC) similar to that observed in humans. These results indicate that the 3{prime}UTR [AGC] repeat within the MT-PK gene is evolutionarily conserved, supporting that this region has important regulatory functions.« less

Exploration of G-quadruplex function in c-Myb gene and its transcriptional regulation by topotecan.

PubMed

Li, Fangyuan; Zhou, Jiang; Xu, Ming; Yuan, Gu

2018-02-01

Our bioinformatics research shows that there are four G-rich sequences (S1-S4) in the upstream region of the transcription start site of c-Myb gene, and we have proved that these sequences have the ability to form G-quadruplex structures. This work mainly focuses on G-quadruplex function, recognition and transcription regulation in c-Myb gene, revealing a novel regulatory element in c-Myb proximal promoter region, and its transcription regulation by G-quadruplex binder. The research has identified that the enhancer effect in c-Myb transcription was primarily affected by the G-quadruplex formed by S1 sequence, and the up-regulation effect may due to the removal of repressive progress of MZF-1 by stabilizing G-quadruplex. Attentions were being paid to the development of G-quadruplex binders for selective recognition, and topotecan was found to have high binding affinity in vitro and could effectively affect the c-Myb transcription activities in cells. The regulation of G-quadruplex with binders in transcriptional, translational levels by Q-RT-PCR and western blot was in expectation of providing a strategy for gene expression modulation. In conclusion, our study revealed a G-quadruplex structure in c-Myb proximal promoter region, which was of great importance in the regulation of c-Myb function. Copyright © 2017 Elsevier B.V. All rights reserved.

A variable DNA recognition site organization establishes the LiaR-mediated cell envelope stress response of enterococci to daptomycin

DOE PAGES

Davlieva, Milya; Shi, Yiwen; Leonard, Paul G.; ...

2015-04-19

LiaR is a ‘master regulator’ of the cell envelope stress response in enterococci and many other Gram-positive organisms. Mutations to liaR can lead to antibiotic resistance to a variety of antibiotics including the cyclic lipopeptide daptomycin. LiaR is phosphorylated in response to membrane stress to regulate downstream target operons. Using DNA footprinting of the regions upstream of the liaXYZ and liaFSR operons we show that LiaR binds an extended stretch of DNA that extends beyond the proposed canonical consensus sequence suggesting a more complex level of regulatory control of target operons. We go on to determine the biochemical and structuralmore » basis for increased resistance to daptomycin by the adaptive mutation to LiaR (D191N) first identified from the pathogen Enterococcus faecalis S613. LiaR D191N increases oligomerization of LiaR to form a constitutively activated tetramer that has high affinity for DNA even in the absence of phosphorylation leading to increased resistance. The crystal structures of the LiaR DNA binding domain complexed to the putative consensus sequence as well as an adjoining secondary sequence show that upon binding, LiaR induces DNA bending that is consistent with increased recruitment of RNA polymerase to the transcription start site and upregulation of target operons.« less

Comparative Analysis of V-Akt Murine Thymoma Viral Oncogene Homolog 3 (AKT3) Gene between Cow and Buffalo Reveals Substantial Differences for Mastitis

PubMed Central

Bhattarai, Dinesh; Cheng, Zhangrui; Liang, Xianwei; Deng, Tingxian; Rehman, Zia Ur; Talpur, Hira Sajjad; Worku, Tesfaye; Brohi, Rahim Dad; Safdar, Muhammad; Ahmad, Muhammad Jamil; Salim, Mohammad; Khan, Momen; Ahmad, Hafiz Ishfaq

2018-01-01

AKT3 gene is a constituent of the serine/threonine protein kinase family and plays a crucial role in synthesis of milk fats and cholesterol by regulating activity of the sterol regulatory element binding protein (SREBP). AKT3 is highly conserved in mammals and its expression levels during the lactation periods of cattle are markedly increased. AKT3 is highly expressed in the intestine followed by mammary gland and it is also expressed in immune cells. It is involved in the TLR pathways as effectively as proinflammatory cytokines. The aims of this study were to investigate the sequences differences between buffalo and cow. Our results showed that there were substantial differences between buffalo and cow in some exons and noteworthy differences of the gene size in different regions. We also identified the important consensus sequence motifs, variation in 2000 upstream of ATG, substantial difference in the “3′UTR” region, and miRNA association in the buffalo sequences compared with the cow. In addition, genetic analyses, such as gene structure, phylogenetic tree, position of different motifs, and functional domains, were performed to establish their correlation with other species. This may indicate that a buffalo breed has potential resistance to disease, environment changes, and airborne microorganisms and some good production and reproductive traits. PMID:29862252

Effect of food-related stress conditions and loss of agr and sigB on seb promoter activity in S. aureus.

PubMed

Sihto, Henna-Maria; Stephan, Roger; Engl, Christoph; Chen, John; Johler, Sophia

2017-08-01

Staphylococcal enterotoxin B (SEB) causes staphylococcal food poisoning and is produced in up to ten times higher quantities than other major enterotoxins. While Staphylococcus aureus growth is often repressed by competing flora, the organism exhibits a decisive growth advantage under some stress conditions. So far, data on the influence of food-related stressors and regulatory mutations on seb expression is limited and largely based on laboratory strains, which were later reported to harbor mutations. Therefore, the aim of this study was to investigate the influence of stress and regulatory mutations on seb promoter activity. To this end, transcriptional fusions were created in two strains, USA300 and HG003, carrying different seb upstream sequences fused to a blaZ reporter. NaCl, nitrite, and glucose stress led to significantly decreased seb promoter activity, while lactic acid stress resulted in significantly increased seb promoter activity. Loss of agr decreased seb promoter activity and loss of sigB increased promoter activity, with the magnitude of change depending on the strain. These results demonstrate that mild stress conditions encountered during food production and preservation can induce significant changes in seb promoter activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Purification and characterization of human mitochondrial transcription factor 1.

PubMed Central

Fisher, R P; Clayton, D A

1988-01-01

We purified to near homogeneity a transcription factor from human KB cell mitochondria. This factor, designated mitochondrial transcription factor 1 (mtTF1), is required for the in vitro recognition of both major promoters of human mitochondrial DNA by the homologous mitochondrial RNA polymerase. Furthermore, it has been shown to bind upstream regulatory elements of the two major promoters. After separation from RNA polymerase by phosphocellulose chromatography, mtTF1 was chromatographed on a MonoQ anion-exchange fast-performance liquid chromatography column. Analysis of mtTF1-containing fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single major polypeptide with an Mr of approximately 25,000. Centrifugation in analytical glycerol gradients indicated a sedimentation coefficient of approximately 2.5 S, consistent with a monomeric 25-kilodalton protein. Finally, when the 25-kilodalton polypeptide was excised from a stained sodium dodecyl sulfate-polyacrylamide gel and allowed to renature, it regained DNA-binding and transcriptional stimulatory activities at both promoters. Although mtTF1 is the only mitochondrial DNA-binding transcription factor to be purified and characterized, its properties, such as a high affinity for random DNA and a weak specificity for one of its target sequences, may typify this class of regulatory proteins. Images PMID:3211148

Ancestral multipartite units in light-responsive plant promoters have structural features correlating with specific phototransduction pathways.

PubMed Central

Argüello-Astorga, G R; Herrera-Estrella, L R

1996-01-01

Regulation of plant gene transcription by light is mediated by multipartite cis-regulatory units. Previous attempts to identify structural features that are common to all light-responsive elements (LREs) have been unsuccessful. To address the question of what is needed to confer photoresponsiveness to a promoter, the upstream sequences from more than 110 light-regulated plant genes were analyzed by a new, phylogenetic-structural method. As a result, 30 distinct conserved DNA module arrays (CMAs) associated with light-responsive promoter regions were identified. Several of these CMAs have remained invariant throughout the evolutionary radiation of angiosperms and are conserved between homologous genes as well as between members of different gene families. The identified CMAs share a gene superfamily-specific core that correlates with the particular phytochrome-dependent transduction pathway that controls their expression, i.e. ACCTA(A/C)C(A/C) for the cGMP-dependent phenylpropanoid metabolism-associated genes, and GATA(A/T)GR for the Ca2+/calmodulin-dependent photosynthesis-associated nuclear genes. In addition to suggesting a general model for the functional and structural organization of LREs, the data obtained in this study indicate that angiosperm LREs probably evolved from complex cis-acting elements involved in regulatory processes other than photoregulation in gymnosperms. PMID:8938415

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Oral streptococci with genetic determinants similar to the glucosyltransferase regulatory gene, rgg.

PubMed Central

Vickerman, M M; Sulavik, M C; Clewell, D B

1995-01-01

The Streptococcus gordonii Challis glucosyltransferase structural gene, gtfG, is positively regulated by the upstream gene, rgg, the only described gtf regulatory determinant in oral streptococci. Southern hybridization analyses indicated that rgg-like and gtfG-like determinants were present on the same HindIII fragment in strains of S. gordonii, Streptococcus sanguis, and Streptococcus oralis, whereas no rgg-like determinants were detected in mutans streptococci, Streptococcus mitis, and Streptococcus salivarius. PMID:7591096

Growth and stress response mechanisms underlying post-feeding regenerative organ growth in the Burmese python.

PubMed

Andrew, Audra L; Perry, Blair W; Card, Daren C; Schield, Drew R; Ruggiero, Robert P; McGaugh, Suzanne E; Choudhary, Amit; Secor, Stephen M; Castoe, Todd A

2017-05-02

Previous studies examining post-feeding organ regeneration in the Burmese python (Python molurus bivittatus) have identified thousands of genes that are significantly differentially regulated during this process. However, substantial gaps remain in our understanding of coherent mechanisms and specific growth pathways that underlie these rapid and extensive shifts in organ form and function. Here we addressed these gaps by comparing gene expression in the Burmese python heart, liver, kidney, and small intestine across pre- and post-feeding time points (fasted, one day post-feeding, and four days post-feeding), and by conducting detailed analyses of molecular pathways and predictions of upstream regulatory molecules across these organ systems. Identified enriched canonical pathways and upstream regulators indicate that while downstream transcriptional responses are fairly tissue specific, a suite of core pathways and upstream regulator molecules are shared among responsive tissues. Pathways such as mTOR signaling, PPAR/LXR/RXR signaling, and NRF2-mediated oxidative stress response are significantly differentially regulated in multiple tissues, indicative of cell growth and proliferation along with coordinated cell-protective stress responses. Upstream regulatory molecule analyses identify multiple growth factors, kinase receptors, and transmembrane receptors, both within individual organs and across separate tissues. Downstream transcription factors MYC and SREBF are induced in all tissues. These results suggest that largely divergent patterns of post-feeding gene regulation across tissues are mediated by a core set of higher-level signaling molecules. Consistent enrichment of the NRF2-mediated oxidative stress response indicates this pathway may be particularly important in mediating cellular stress during such extreme regenerative growth.

The phn Genes of Burkholderia sp. Strain RP007 Constitute a Divergent Gene Cluster for Polycyclic Aromatic Hydrocarbon Catabolism

PubMed Central

Laurie, Andrew D.; Lloyd-Jones, Gareth

1999-01-01

Cloning and molecular ecological studies have underestimated the diversity of polycyclic aromatic hydrocarbon (PAH) catabolic genes by emphasizing classical nah-like (nah, ndo, pah, and dox) sequences. Here we report the description of a divergent set of PAH catabolic genes, the phn genes, which although isofunctional to the classical nah-like genes, show very low homology. This phn locus, which contains nine open reading frames (ORFs), was isolated on an 11.5-kb HindIII fragment from phenanthrene-degrading Burkholderia sp. strain RP007. The phn genes are significantly different in sequence and gene order from previously characterized genes for PAH degradation. They are transcribed by RP007 when grown at the expense of either naphthalene or phenanthrene, while in Escherichia coli the recombinant phn enzymes have been shown to be capable of oxidizing both naphthalene and phenanthrene to predicted metabolites. The locus encodes iron sulfur protein α and β subunits of a PAH initial dioxygenase but lacks the ferredoxin and reductase components. The dihydrodiol dehydrogenase of the RP007 pathway, PhnB, shows greater similarity to analogous dehydrogenases from described biphenyl pathways than to those characterized from naphthalene/phenanthrene pathways. An unusual extradiol dioxygenase, PhnC, shows no similarity to other extradiol dioxygenases for naphthalene or biphenyl oxidation but is the first member of the recently proposed class III extradiol dioxygenases that is specific for polycyclic arene diols. Upstream of the phn catabolic genes are two putative regulatory genes, phnR and phnS. Sequence homology suggests that phnS is a LysR-type transcriptional activator and that phnR, which is divergently transcribed with respect to phnSFECDAcAdB, is a member of the ς54-dependent family of positive transcriptional regulators. Reverse transcriptase PCR experiments suggest that this gene cluster is coordinately expressed and is under regulatory control which may involve PhnR and PhnS. PMID:9882667

Exon 2-mediated c-myc mRNA decay in vivo is independent of its translation.

PubMed Central

Pistoi, S; Roland, J; Babinet, C; Morello, D

1996-01-01

We have previously shown that the steady-state level of c-myc mRNA in vivo is primarily controlled by posttranscriptional regulatory mechanisms. To identify the sequences involved in this process, we constructed a series of H-2/myc transgenic lines in which various regions of the human c-MYC gene were placed under the control of the quasi-ubiquitous H-2K class I regulatory sequences. We demonstrated that the presence of one of the two coding exons, exon 2 or exon 3, is sufficient to confer a level of expression of transgene mRNA similar to that of endogenous c-myc in various adult tissues as well as after partial hepatectomy or after protein synthesis inhibition. We now focus on the molecular mechanisms involved in modulation of expression of mRNAs containing c-myc exon 2 sequences, with special emphasis on the coupling between translation and c-myc mRNA turnover. We have undertaken an analysis of expression, both at the mRNA level and at the protein level, of new transgenic constructs in which the translation is impaired either by disruption of the initiation codon or by addition of stop codons upstream of exon 2. Our results show that the translation of c-myc exon 2 is not required for regulated expression of the transgene in the different situations analyzed, and therefore they indicate that the mRNA destabilizing function of exon 2 is independent of translation by ribosomes. Our investigations also reveal that, in the thymus, some H-2/myc transgenes express high levels of mRNA but low levels of protein. Besides the fact that these results suggest the existence of tissue-specific mechanisms that control c-myc translatability in vivo, they also bring another indication of the uncoupling of c-myc mRNA translation and degradation. PMID:8756668

Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

PubMed

Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

2015-03-20

Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

Cis-regulatory signatures of orthologous stress-associated bZIP transcription factors from rice, sorghum and Arabidopsis based on phylogenetic footprints

PubMed Central

2012-01-01

Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa) formed ten clusters of orthologous groups (COG) with genes from the monocot sorghum (Sorghum bicolor) and dicot Arabidopsis (Arabidopsis thaliana). The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS) classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic) or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in conjunction with lineage-specific or species-specific regulatory fine-tuners. This synergy may be critical for finer-scale spatio-temporal regulation, hence unique expression profiles of homologous transcription factors from different species with distinct zones of ecological adaptation such as rice, sorghum and Arabidopsis. The patterns revealed from these comparisons set the stage for further empirical validation by functional genomics. PMID:22992304

76 FR 73534 - Proposed Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-29

...-2011-0002; Internal Agency Docket No. FEMA-B-1230] Proposed Flood Elevation Determinations AGENCY... proposed Base (1% annual-chance) Flood Elevations (BFEs) and proposed BFE modifications for the communities... regarding the proposed regulatory flood elevations for the reach described by the downstream and upstream...

76 FR 1121 - Proposed Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-07

... approximately 410 feet of Lewis County. upstream of U.S. Route 61 Business. * National Geodetic Vertical Datum... intersection of Impact Drive and FM Road 2404. * National Geodetic Vertical Datum. + North American Vertical..., Environmental Consideration. An environmental impact assessment has not been prepared. Regulatory Flexibility...

Characterization of ROP18 alleles in human toxoplasmosis.

PubMed

Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

2014-04-01

The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

Functional Organization of hsp70 Cluster in Camel (Camelus dromedarius) and Other Mammals

PubMed Central

Garbuz, David G.; Astakhova, Lubov N.; Zatsepina, Olga G.; Arkhipova, Irina R.; Nudler, Eugene; Evgen'ev, Michael B.

2011-01-01

Heat shock protein 70 (Hsp70) is a molecular chaperone providing tolerance to heat and other challenges at the cellular and organismal levels. We sequenced a genomic cluster containing three hsp70 family genes linked with major histocompatibility complex (MHC) class III region from an extremely heat tolerant animal, camel (Camelus dromedarius). Two hsp70 family genes comprising the cluster contain heat shock elements (HSEs), while the third gene lacks HSEs and should not be induced by heat shock. Comparison of the camel hsp70 cluster with the corresponding regions from several mammalian species revealed similar organization of genes forming the cluster. Specifically, the two heat inducible hsp70 genes are arranged in tandem, while the third constitutively expressed hsp70 family member is present in inverted orientation. Comparison of regulatory regions of hsp70 genes from camel and other mammals demonstrates that transcription factor matches with highest significance are located in the highly conserved 250-bp upstream region and correspond to HSEs followed by NF-Y and Sp1 binding sites. The high degree of sequence conservation leaves little room for putative camel-specific regulatory elements. Surprisingly, RT-PCR and 5′/3′-RACE analysis demonstrated that all three hsp70 genes are expressed in camel's muscle and blood cells not only after heat shock, but under normal physiological conditions as well, and may account for tolerance of camel cells to extreme environmental conditions. A high degree of evolutionary conservation observed for the hsp70 cluster always linked with MHC locus in mammals suggests an important role of such organization for coordinated functioning of these vital genes. PMID:22096537

The human phospholamban gene: structure and expression.

PubMed

McTiernan, C F; Frye, C S; Lemster, B H; Kinder, E A; Ogletree-Hughes, M L; Moravec, C S; Feldman, A M

1999-03-01

Phospholamban, through modulation of sarcoplasmic reticulum calcium-ATPase activity, is a key regulator of cardiac diastolic function. Alterations in phospholamban expression may define parameters of muscle relaxation. In experimental animals, phospholamban is differentially expressed in various striated and smooth muscles, and within the four chambers of the heart. Decreased phospholamban expression within the heart during heart failure has also been observed. Furthermore, regulatory elements of mammalian phospholamban genes remain poorly defined. To extend these studies to humans, we (1) characterized phospholamban expression in various human organs, (2) isolated genomic clones encoding the human phospholamban gene, and (3) prepared human phospholamban promoter/luciferase reporter constructs and performed transient transfection assays to begin identification of regulatory elements. We observed that human ventricle and quadriceps displayed high levels of phospholamban transcripts and proteins, with markedly lower expression observed in smooth muscles, while the right atria also expressed low levels of phospholamban. The human phospholamban gene structure closely resembles that reported for chicken, rabbit, rat, and mouse. Comparison of the human to other mammalian phospholamban genes indicates a marked conservation of sequence for at least 217 bp upstream of the transcription start site, which contains conserved motifs for GATA, CP1/NFY, M-CAT-like, and E-box elements. Transient transfection assays with a series of plasmids containing deleted 5' flanking regions (between -2530 and -66 through +85) showed that sequences between -169 and the CP1-box at -93 were required for maximal promoter activity in neonatal rat cardiomyocytes. Activity of these reporters in HeLa cells was markedly lower than that observed in rat cardiomyocytes, suggesting at least a partial tissue selectivity of these reporter constructs.

RSAT 2015: Regulatory Sequence Analysis Tools

PubMed Central

Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A.; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M.; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

2015-01-01

RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/. PMID:25904632

Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

USDA-ARS?s Scientific Manuscript database

Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

76 FR 36044 - Proposed Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-21

..., Environmental Consideration. An environmental impact assessment has not been prepared. Regulatory Flexibility... Communities affected in meters (MSL) Effective Modified Kane County, Illinois, and Incorporated Areas Big Rock... Jericho Road (at the of Big Rock. Kendall County boundary). Approximately 1.0 mile None +689 upstream of...

Origins of extrinsic variability in eukaryotic gene expression

NASA Astrophysics Data System (ADS)

Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff

2006-02-01

Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes simultaneously, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modelling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous lower limit for expression variability. A second source, which is modelled as originating from a common upstream transcription factor, exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.

Origins of extrinsic variability in eukaryotic gene expression

NASA Astrophysics Data System (ADS)

Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff

2006-03-01

Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes in concert, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modeling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous noise floor in expression variability. A second source which is modeled as originating from a common upstream transcription factor exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.

Genome-Wide Identification of Regulatory Sequences Undergoing Accelerated Evolution in the Human Genome

PubMed Central

Dong, Xinran; Wang, Xiao; Zhang, Feng; Tian, Weidong

2016-01-01

Accelerated evolution of regulatory sequence can alter the expression pattern of target genes, and cause phenotypic changes. In this study, we used DNase I hypersensitive sites (DHSs) to annotate putative regulatory sequences in the human genome, and conducted a genome-wide analysis of the effects of accelerated evolution on regulatory sequences. Working under the assumption that local ancient repeat elements of DHSs are under neutral evolution, we discovered that ∼0.44% of DHSs are under accelerated evolution (ace-DHSs). We found that ace-DHSs tend to be more active than background DHSs, and are strongly associated with epigenetic marks of active transcription. The target genes of ace-DHSs are significantly enriched in neuron-related functions, and their expression levels are positively selected in the human brain. Thus, these lines of evidences strongly suggest that accelerated evolution on regulatory sequences plays important role in the evolution of human-specific phenotypes. PMID:27401230

Population Genomics of Paramecium Species.

PubMed

Johri, Parul; Krenek, Sascha; Marinov, Georgi K; Doak, Thomas G; Berendonk, Thomas U; Lynch, Michael

2017-05-01

Population-genomic analyses are essential to understanding factors shaping genomic variation and lineage-specific sequence constraints. The dearth of such analyses for unicellular eukaryotes prompted us to assess genomic variation in Paramecium, one of the most well-studied ciliate genera. The Paramecium aurelia complex consists of ∼15 morphologically indistinguishable species that diverged subsequent to two rounds of whole-genome duplications (WGDs, as long as 320 MYA) and possess extremely streamlined genomes. We examine patterns of both nuclear and mitochondrial polymorphism, by sequencing whole genomes of 10-13 worldwide isolates of each of three species belonging to the P. aurelia complex: P. tetraurelia, P. biaurelia, P. sexaurelia, as well as two outgroup species that do not share the WGDs: P. caudatum and P. multimicronucleatum. An apparent absence of global geographic population structure suggests continuous or recent dispersal of Paramecium over long distances. Intergenic regions are highly constrained relative to coding sequences, especially in P. caudatum and P. multimicronucleatum that have shorter intergenic distances. Sequence diversity and divergence are reduced up to ∼100-150 bp both upstream and downstream of genes, suggesting strong constraints imposed by the presence of densely packed regulatory modules. In addition, comparison of sequence variation at non-synonymous and synonymous sites suggests similar recent selective pressures on paralogs within and orthologs across the deeply diverging species. This study presents the first genome-wide population-genomic analysis in ciliates and provides a valuable resource for future studies in evolutionary and functional genetics in Paramecium. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

NASA Technical Reports Server (NTRS)

Frudakis, T. N.; Wilt, F.

1995-01-01

The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

Two alternative ways of start site selection in human norovirus reinitiation of translation.

PubMed

Luttermann, Christine; Meyers, Gregor

2014-04-25

The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans.

PubMed

Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W; Grubert, Fabian; Candille, Sophie I; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L; Tang, Hua; Ricci, Emiliano; Snyder, Michael P

2015-11-01

Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy--many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. © 2015 Cenik et al.; Published by Cold Spring Harbor Laboratory Press.

Positive Feedback Keeps Duration of Mitosis Temporally Insulated from Upstream Cell-Cycle Events.

PubMed

Araujo, Ana Rita; Gelens, Lendert; Sheriff, Rahuman S M; Santos, Silvia D M

2016-10-20

Cell division is characterized by a sequence of events by which a cell gives rise to two daughter cells. Quantitative measurements of cell-cycle dynamics in single cells showed that despite variability in G1-, S-, and G2 phases, duration of mitosis is short and remarkably constant. Surprisingly, there is no correlation between cell-cycle length and mitotic duration, suggesting that mitosis is temporally insulated from variability in earlier cell-cycle phases. By combining live cell imaging and computational modeling, we showed that positive feedback is the molecular mechanism underlying the temporal insulation of mitosis. Perturbing positive feedback gave rise to a sluggish, variable entry and progression through mitosis and uncoupled duration of mitosis from variability in cell cycle length. We show that positive feedback is important to keep mitosis short, constant, and temporally insulated and anticipate it might be a commonly used regulatory strategy to create modularity in other biological systems. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

PubMed

Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

1999-10-28

We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.

The Histone Acetyltransferase MOF is a Key Regulator of the Embryonic Stem Cell Core Transcriptional Network

PubMed Central

Li, Xiangzhi; Li, Li; Pandey, Ruchi; Byun, Jung S.; Gardner, Kevin; Qin, Zhaohui; Dou, Yali

2012-01-01

SUMMARY Pluripotent embryonic stem cells (ESCs) maintain self-renewal and the potential for rapid response to differentiation cues. Both ESC features are subject to epigenetic regulation. Here we show that histone acetyltransferase Mof plays an essential role in the maintenance of ESC self-renewal and pluripotency. ESCs with Mof deletion lose characteristic morphology, alkaline phosphatase (AP) staining and differentiation potential. They also have aberrant expression of core transcription factors Nanog, Oct4 and Sox2. Importantly, the phenotypes of Mof null ESCs can be partially suppressed by Nanog overexpression, supporting that Mof functions as an upstream regulator of Nanog in ESCs. Genome-wide ChIP sequencing and transcriptome analyses further demonstrate that Mof is an integral component of ESC core transcription network and Mof primes genes for diverse developmental programs. Mof is also required for Wdr5 recruitment and H3 K4 methylation at key regulatory loci, highlighting complexity and interconnectivity of various chromatin regulators in ESCs. PMID:22862943

Generation of a transgenic ORFeome library in Drosophila

PubMed Central

Bischof, Johannes; Sheils, Emma M.; Björklund, Mikael; Basler, Konrad

2014-01-01

Overexpression screens can be used to explore gene function in Drosophila melanogaster, but to demonstrate their full potential comprehensive and systematic collections of fly strains are required. Here we provide a protocol for high-throughput cloning of Drosophila open reading frames (ORFs) regulated by Upstream Activation Sequences (UAS sites); the resulting Gal4-inducible UAS-ORF plasmid library is then used to generate Drosophila strains by ΦC31 integrase-mediated site-specific integration. We also provide details for FLP/FRT-mediated in vivo exchange of epitope tags (or regulatory regions) in the ORF library strains, which further extends their potential applications. These transgenic UAS-ORF strains are a useful resource to complement and validate genetic experiments performed with loss-of-function mutants and RNAi lines. The duration of the complete protocol strongly depends on the number of ORFs required, but the procedure of injection and establishing balanced fly stocks can be completed within approx. 6-7 weeks for a few genes. PMID:24922270

Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

DOE PAGES

Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...

2016-03-26

Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

Genetic analysis of the dsz promoter and associated regulatory regions of Rhodococcus erythropolis IGTS8.

PubMed Central

Li, M Z; Squires, C H; Monticello, D J; Childs, J D

1996-01-01

The dsz gene cluster of Rhodococcus erythropolis IGTS8 comprises three genes, dszA, dszB, and dszC, whose products are involved in the conversion of dibenzothiophene (DBT) to 2-hydroxybiphenyl and sulfite. This organism can use DBT as the sole sulfur source but not as a carbon source. Dsz activity is repressed by methionine, cysteine, Casamino Acids, and sulfate but not by DBT or dimethyl sulfoxide. We cloned 385 bp of the DNA immediately 5' to dszA in front of the reporter gene lacZ of Escherichia coli. We showed that this region contains a Rhodococcus promoter and at least three dsz regulatory regions. After hydrazine mutagenesis of this DNA, colonies that were able to express beta-galactosidase in the presence of Casamino Acids were isolated. Sequencing of these mutants revealed two possible regulatory regions. One is at -263 to -244, and the other is at -93 to -38, where -1 is the base preceding the A of the initiation codon ATG of dszA. An S1 nuclease protection assay showed that the start of the dsz promoter is the G at -46 and that transcription is repressed by sulfate and cysteine but not by dimethyl sulfoxide. The promoter encompasses a region of potential diad symmetry that may contain an operator. Immediately upstream of the promoter is a protein-binding domain between -146 and -121. Deletion of this region did not affect repression, but promoter activity appeared to be reduced by threefold. Thus, it could be an activator binding site or an enhancer region. PMID:8932295

AtmiRNET: a web-based resource for reconstructing regulatory networks of Arabidopsis microRNAs.

PubMed

Chien, Chia-Hung; Chiang-Hsieh, Yi-Fan; Chen, Yi-An; Chow, Chi-Nga; Wu, Nai-Yun; Hou, Ping-Fu; Chang, Wen-Chi

2015-01-01

Compared with animal microRNAs (miRNAs), our limited knowledge of how miRNAs involve in significant biological processes in plants is still unclear. AtmiRNET is a novel resource geared toward plant scientists for reconstructing regulatory networks of Arabidopsis miRNAs. By means of highlighted miRNA studies in target recognition, functional enrichment of target genes, promoter identification and detection of cis- and trans-elements, AtmiRNET allows users to explore mechanisms of transcriptional regulation and miRNA functions in Arabidopsis thaliana, which are rarely investigated so far. High-throughput next-generation sequencing datasets from transcriptional start sites (TSSs)-relevant experiments as well as five core promoter elements were collected to establish the support vector machine-based prediction model for Arabidopsis miRNA TSSs. Then, high-confidence transcription factors participate in transcriptional regulation of Arabidopsis miRNAs are provided based on statistical approach. Furthermore, both experimentally verified and putative miRNA-target interactions, whose validity was supported by the correlations between the expression levels of miRNAs and their targets, are elucidated for functional enrichment analysis. The inferred regulatory networks give users an intuitive insight into the pivotal roles of Arabidopsis miRNAs through the crosstalk between miRNA transcriptional regulation (upstream) and miRNA-mediate (downstream) gene circuits. The valuable information that is visually oriented in AtmiRNET recruits the scant understanding of plant miRNAs and will be useful (e.g. ABA-miR167c-auxin signaling pathway) for further research. Database URL: http://AtmiRNET.itps.ncku.edu.tw/ © The Author(s) 2015. Published by Oxford University Press.

Cis-regulation of the amphioxus engrailed gene: insights into evolution of a muscle-specific enhancer.

PubMed

Beaster-Jones, Laura; Schubert, Michael; Holland, Linda Z

2007-08-01

To gain insights into the relation between evolution of cis-regulatory DNA and evolution of gene function, we identified tissue-specific enhancers of the engrailed gene of the basal chordate amphioxus (Branchiostoma floridae) and compared their ability to direct expression in both amphioxus and its nearest chordate relative, the tunicate Ciona intestinalis. In amphioxus embryos, the native engrailed gene is expressed in three domains - the eight most anterior somites, a few cells in the central nervous system (CNS) and a few ectodermal cells. In contrast, in C. intestinalis, in which muscle development is highly divergent, engrailed expression is limited to the CNS. To characterize the tissue-specific enhancers of amphioxus engrailed, we first showed that 7.8kb of upstream DNA of amphioxus engrailed directs expression to all three domains in amphioxus that express the native gene. We then identified the amphioxus engrailed muscle-specific enhancer as the 1.2kb region of upstream DNA with the highest sequence identity to the mouse en-2 jaw muscle enhancer. This amphioxus enhancer directed expression to both the somites in amphioxus and to the larval muscles in C. intestinalis. These results show that even though expression of the native engrailed has apparently been lost in developing C. intestinalis muscles, they express the transcription factors necessary to activate transcription from the amphioxus engrailed enhancer, suggesting that gene networks may not be completely disrupted if an individual component is lost.

LhnR and upstream operon LhnABC in Agrobacterium vitis regulate the induction of tobacco hypersensitive responses, grape necrosis and swarming motility.

PubMed

Zheng, Desen; Hao, Guixia; Cursino, Luciana; Zhang, Hongsheng; Burr, Thomas J

2012-09-01

The characterization of Tn5 transposon insertional mutants of Agrobacterium vitis strain F2/5 revealed a gene encoding a predicted LysR-type transcriptional regulator, lhnR (for 'LysR-type regulator associated with HR and necrosis'), and an immediate upstream operon consisting of three open reading frames (lhnABC) required for swarming motility, surfactant production and the induction of a hypersensitive response (HR) on tobacco and necrosis on grape. The operon lhnABC is unique to A. vitis among the sequenced members in Rhizobiaceae. Mutagenesis of lhnR and lhnABC by gene disruption and complementation of ΔlhnR and ΔlhnABC confirmed their roles in the expression of these phenotypes. Mutation of lhnR resulted in complete loss of HR, swarming motility, surfactant production and reduced necrosis, whereas mutation of lhnABC resulted in loss of swarming motility, delayed and reduced HR development and reduced surfactant production and necrosis. The data from promoter-green fluorescent protein (gfp) fusions showed that lhnR suppresses the expression of lhnABC and negatively autoregulates its own expression. It was also shown that lhnABC negatively affects its own expression and positively affects the transcription of lhnR. lhnR and lhnABC constitute a regulatory circuit that coordinates the transcription level of lhnR, resulting in the expression of swarming, surfactant, HR and necrosis phenotypes. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

PubMed

Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

1999-01-01

In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

Potential Upstream Strategies for the Mitigation of Pharmaceuticals in the Aquatic Environment: a Brief Review.

PubMed

Blair, Benjamin D

2016-06-01

Active pharmaceutical ingredients represent a class of pollutants of emerging concern, and there is growing evidence that these pollutants can cause damage to the aquatic environment. As regulations to address these concerns are expected in developed nations, decision-makers are looking to the scientific community for potential solutions. To inform these regulatory efforts, further information on the potential strategies to reduce the levels of pharmaceuticals entering the aquatic environment is needed. End-of-pipe (i.e., wastewater treatment) technologies that can remove pharmaceuticals exist; however, they are costly to install and operate. Thus, the goal of this brief review is to look beyond end-of-pipe solutions and present various upstream mitigation strategies discussed within the scientific literature. Programs such as pharmaceutical take-back programs currently exist to attempt to reduce pharmaceutical concentrations in the environment, although access and coverage are often limited for many programs. Other potential strategies include redesigning pharmaceuticals to minimize aquatic toxicity, increasing the percent of the pharmaceuticals metabolized in the body, selecting less harmful pharmaceuticals for use, starting new prescriptions at lower dosages, selecting pharmaceuticals with lower excretion rates, and implementing source treatment such as urine separating toilets. Overall, this brief review presents a summary of the upstream preventative recommendations to mitigate pharmaceuticals from entering the aquatic environment with an emphasis on regulatory efforts in the USA and concludes with priorities for further research.

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

PubMed Central

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense.

PubMed

Wirthmueller, Lennart; Zhang, Yan; Jones, Jonathan D G; Parker, Jane E

2007-12-04

Recognition of specific pathogen molecules inside the cell by nucleotide-binding domain and leucine-rich repeat (NB-LRR) receptors constitutes an important layer of innate immunity in plants. Receptor activation triggers host cellular reprogramming involving transcriptional potentiation of basal defenses and localized programmed cell death. The sites and modes of action of NB-LRR receptors are, however, poorly understood. Arabidopsis Toll/Interleukin-1 (TIR) type NB-LRR receptor RPS4 recognizes the bacterial type III effector AvrRps4. We show that epitope-tagged RPS4 expressed under its native regulatory sequences distributes between endomembranes and nuclei in healthy and AvrRps4-triggered tissues. RPS4 accumulation in the nucleus, mediated by a bipartite nuclear localization sequence (NLS) at its C terminus, is necessary for triggering immunity through authentic activation by AvrRps4 in Arabidopsis or as an effector-independent "deregulated" receptor in tobacco. A strikingly conserved feature of TIR-NB-LRR receptors is their recruitment of the nucleocytoplasmic basal-defense regulator EDS1 in resistance to diverse pathogens. We find that EDS1 is an indispensable component of RPS4 signaling and that it functions downstream of RPS4 activation but upstream of RPS4-mediated transcriptional reprogramming in the nucleus.

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites.

PubMed

Irizarry, Kristopher J L; Bryden, Randall L

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus . Our results provide insight into pigment phenotypes in pythons.

Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

NASA Technical Reports Server (NTRS)

Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

1999-01-01

Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

GPS-PAIL: prediction of lysine acetyltransferase-specific modification sites from protein sequences.

PubMed

Deng, Wankun; Wang, Chenwei; Zhang, Ying; Xu, Yang; Zhang, Shuang; Liu, Zexian; Xue, Yu

2016-12-22

Protein acetylation catalyzed by specific histone acetyltransferases (HATs) is an essential post-translational modification (PTM) and involved in the regulation a broad spectrum of biological processes in eukaryotes. Although several ten thousands of acetylation sites have been experimentally identified, the upstream HATs for most of the sites are unclear. Thus, the identification of HAT-specific acetylation sites is fundamental for understanding the regulatory mechanisms of protein acetylation. In this work, we first collected 702 known HAT-specific acetylation sites of 205 proteins from the literature and public data resources, and a motif-based analysis demonstrated that different types of HATs exhibit similar but considerably distinct sequence preferences for substrate recognition. Using 544 human HAT-specific sites for training, we constructed a highly useful tool of GPS-PAIL for the prediction of HAT-specific sites for up to seven HATs, including CREBBP, EP300, HAT1, KAT2A, KAT2B, KAT5 and KAT8. The prediction accuracy of GPS-PAIL was critically evaluated, with a satisfying performance. Using GPS-PAIL, we also performed a large-scale prediction of potential HATs for known acetylation sites identified from high-throughput experiments in nine eukaryotes. Both online service and local packages were implemented, and GPS-PAIL is freely available at: http://pail.biocuckoo.org.

GPS-PAIL: prediction of lysine acetyltransferase-specific modification sites from protein sequences

PubMed Central

Deng, Wankun; Wang, Chenwei; Zhang, Ying; Xu, Yang; Zhang, Shuang; Liu, Zexian; Xue, Yu

2016-01-01

Protein acetylation catalyzed by specific histone acetyltransferases (HATs) is an essential post-translational modification (PTM) and involved in the regulation a broad spectrum of biological processes in eukaryotes. Although several ten thousands of acetylation sites have been experimentally identified, the upstream HATs for most of the sites are unclear. Thus, the identification of HAT-specific acetylation sites is fundamental for understanding the regulatory mechanisms of protein acetylation. In this work, we first collected 702 known HAT-specific acetylation sites of 205 proteins from the literature and public data resources, and a motif-based analysis demonstrated that different types of HATs exhibit similar but considerably distinct sequence preferences for substrate recognition. Using 544 human HAT-specific sites for training, we constructed a highly useful tool of GPS-PAIL for the prediction of HAT-specific sites for up to seven HATs, including CREBBP, EP300, HAT1, KAT2A, KAT2B, KAT5 and KAT8. The prediction accuracy of GPS-PAIL was critically evaluated, with a satisfying performance. Using GPS-PAIL, we also performed a large-scale prediction of potential HATs for known acetylation sites identified from high-throughput experiments in nine eukaryotes. Both online service and local packages were implemented, and GPS-PAIL is freely available at: http://pail.biocuckoo.org. PMID:28004786

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

RSAT 2015: Regulatory Sequence Analysis Tools.

PubMed

Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

2015-07-01

RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

PubMed

René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

2000-01-04

In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

The Gene Regulatory Network of Lens Induction Is Wired through Meis-Dependent Shadow Enhancers of Pax6

PubMed Central

Antosova, Barbora; Smolikova, Jana; Klimova, Lucie; Lachova, Jitka; Bendova, Michaela; Kozmikova, Iryna; Machon, Ondrej; Kozmik, Zbynek

2016-01-01

Lens induction is a classical developmental model allowing investigation of cell specification, spatiotemporal control of gene expression, as well as how transcription factors are integrated into highly complex gene regulatory networks (GRNs). Pax6 represents a key node in the gene regulatory network governing mammalian lens induction. Meis1 and Meis2 homeoproteins are considered as essential upstream regulators of Pax6 during lens morphogenesis based on their interaction with the ectoderm enhancer (EE) located upstream of Pax6 transcription start site. Despite this generally accepted regulatory pathway, Meis1-, Meis2- and EE-deficient mice have surprisingly mild eye phenotypes at placodal stage of lens development. Here, we show that simultaneous deletion of Meis1 and Meis2 in presumptive lens ectoderm results in arrested lens development in the pre-placodal stage, and neither lens placode nor lens is formed. We found that in the presumptive lens ectoderm of Meis1/Meis2 deficient embryos Pax6 expression is absent. We demonstrate using chromatin immunoprecipitation (ChIP) that in addition to EE, Meis homeoproteins bind to a remote, ultraconserved SIMO enhancer of Pax6. We further show, using in vivo gene reporter analyses, that the lens-specific activity of SIMO enhancer is dependent on the presence of three Meis binding sites, phylogenetically conserved from man to zebrafish. Genetic ablation of EE and SIMO enhancers demostrates their requirement for lens induction and uncovers an apparent redundancy at early stages of lens development. These findings identify a genetic requirement for Meis1 and Meis2 during the early steps of mammalian eye development. Moreover, they reveal an apparent robustness in the gene regulatory mechanism whereby two independent "shadow enhancers" maintain critical levels of a dosage-sensitive gene, Pax6, during lens induction. PMID:27918583

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2010 CFR

2010-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2012 CFR

2012-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2011 CFR

2011-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2014 CFR

2014-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

18 CFR 12.24 - Review and updating of plans.

Code of Federal Regulations, 2013 CFR

2013-04-01

... light of any significant changes in upstream or downstream circumstances which might affect water flows... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Review and updating of plans. 12.24 Section 12.24 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

PubMed

Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

2004-07-01

The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

Genome-Wide Identification of Regulatory Sequences Undergoing Accelerated Evolution in the Human Genome.

PubMed

Dong, Xinran; Wang, Xiao; Zhang, Feng; Tian, Weidong

2016-10-01

Accelerated evolution of regulatory sequence can alter the expression pattern of target genes, and cause phenotypic changes. In this study, we used DNase I hypersensitive sites (DHSs) to annotate putative regulatory sequences in the human genome, and conducted a genome-wide analysis of the effects of accelerated evolution on regulatory sequences. Working under the assumption that local ancient repeat elements of DHSs are under neutral evolution, we discovered that ∼0.44% of DHSs are under accelerated evolution (ace-DHSs). We found that ace-DHSs tend to be more active than background DHSs, and are strongly associated with epigenetic marks of active transcription. The target genes of ace-DHSs are significantly enriched in neuron-related functions, and their expression levels are positively selected in the human brain. Thus, these lines of evidences strongly suggest that accelerated evolution on regulatory sequences plays important role in the evolution of human-specific phenotypes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

The Hippo pathway: regulators and regulations

PubMed Central

Yu, Fa-Xing; Guan, Kun-Liang

2013-01-01

Control of cell number is crucial in animal development and tissue homeostasis, and its dysregulation may result in tumor formation or organ degeneration. The Hippo pathway in both Drosophila and mammals regulates cell number by modulating cell proliferation, cell death, and cell differentiation. Recently, numerous upstream components involved in the Hippo pathway have been identified, such as cell polarity, mechanotransduction, and G-protein-coupled receptor (GPCR) signaling. Actin cytoskeleton or cellular tension appears to be the master mediator that integrates and transmits upstream signals to the core Hippo signaling cascade. Here, we review regulatory mechanisms of the Hippo pathway and discuss potential implications involved in different physiological and pathological conditions. PMID:23431053

Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence

PubMed Central

Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya

2015-01-01

Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930

Analysis of the QTL for sleep homeostasis in mice: Homer1a is a likely candidate.

PubMed

Mackiewicz, M; Paigen, B; Naidoo, N; Pack, A I

2008-03-14

Electroencephalographic oscillations in the frequency range of 0.5-4 Hz, characteristic of slow-wave sleep (SWS), are often referred to as the delta oscillation or delta power. Delta power reflects sleep intensity and correlates with the homeostatic response to sleep loss. A published survey of inbred strains of mice demonstrated that the time course of accumulation of delta power varied among inbred strains, and the segregation of the rebound of delta power in BxD recombinant inbred strains identified a genomic region on chromosome 13 referred to as the delta power in SWS (or Dps1). The quantitative trait locus (QTL) contains genes that modify the accumulation of delta power after sleep deprivation. Here, we narrow the QTL using interval-specific haplotype analysis and present a comprehensive annotation of the remaining genes in the Dps1 region with sequence comparisons to identify polymorphisms within the coding and regulatory regions. We established the expression pattern of selected genes located in the Dps1 interval in sleep and wakefulness in B6 and D2 parental strains. Taken together, these steps reduced the number of potential candidate genes that may underlie the accumulation of delta power after sleep deprivation and explain the Dps1 QTL. The strongest candidate gene is Homer1a, which is supported by expression differences between sleep and wakefulness and the SNP polymorphism in the upstream regulatory regions.

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE PAGES

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.; ...

2015-04-08

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Mammalian genomic regulatory regions predicted by utilizing human genomics, transcriptomics, and epigenetics data

PubMed Central

Nguyen, Quan H; Tellam, Ross L; Naval-Sanchez, Marina; Porto-Neto, Laercio R; Barendse, William; Reverter, Antonio; Hayes, Benjamin; Kijas, James; Dalrymple, Brian P

2018-01-01

Abstract Genome sequences for hundreds of mammalian species are available, but an understanding of their genomic regulatory regions, which control gene expression, is only beginning. A comprehensive prediction of potential active regulatory regions is necessary to functionally study the roles of the majority of genomic variants in evolution, domestication, and animal production. We developed a computational method to predict regulatory DNA sequences (promoters, enhancers, and transcription factor binding sites) in production animals (cows and pigs) and extended its broad applicability to other mammals. The method utilizes human regulatory features identified from thousands of tissues, cell lines, and experimental assays to find homologous regions that are conserved in sequences and genome organization and are enriched for regulatory elements in the genome sequences of other mammalian species. Importantly, we developed a filtering strategy, including a machine learning classification method, to utilize a very small number of species-specific experimental datasets available to select for the likely active regulatory regions. The method finds the optimal combination of sensitivity and accuracy to unbiasedly predict regulatory regions in mammalian species. Furthermore, we demonstrated the utility of the predicted regulatory datasets in cattle for prioritizing variants associated with multiple production and climate change adaptation traits and identifying potential genome editing targets. PMID:29618048

Mammalian genomic regulatory regions predicted by utilizing human genomics, transcriptomics, and epigenetics data.

PubMed

Nguyen, Quan H; Tellam, Ross L; Naval-Sanchez, Marina; Porto-Neto, Laercio R; Barendse, William; Reverter, Antonio; Hayes, Benjamin; Kijas, James; Dalrymple, Brian P

2018-03-01

Genome sequences for hundreds of mammalian species are available, but an understanding of their genomic regulatory regions, which control gene expression, is only beginning. A comprehensive prediction of potential active regulatory regions is necessary to functionally study the roles of the majority of genomic variants in evolution, domestication, and animal production. We developed a computational method to predict regulatory DNA sequences (promoters, enhancers, and transcription factor binding sites) in production animals (cows and pigs) and extended its broad applicability to other mammals. The method utilizes human regulatory features identified from thousands of tissues, cell lines, and experimental assays to find homologous regions that are conserved in sequences and genome organization and are enriched for regulatory elements in the genome sequences of other mammalian species. Importantly, we developed a filtering strategy, including a machine learning classification method, to utilize a very small number of species-specific experimental datasets available to select for the likely active regulatory regions. The method finds the optimal combination of sensitivity and accuracy to unbiasedly predict regulatory regions in mammalian species. Furthermore, we demonstrated the utility of the predicted regulatory datasets in cattle for prioritizing variants associated with multiple production and climate change adaptation traits and identifying potential genome editing targets.

The unique genomic landscape surrounding the EPSPS gene in glyphosate resistant Amaranthus palmeri: a repetitive path to resistance.

PubMed

Molin, William T; Wright, Alice A; Lawton-Rauh, Amy; Saski, Christopher A

2017-01-17

The expanding number and global distributions of herbicide resistant weedy species threaten food, fuel, fiber and bioproduct sustainability and agroecosystem longevity. Amongst the most competitive weeds, Amaranthus palmeri S. Wats has rapidly evolved resistance to glyphosate primarily through massive amplification and insertion of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene across the genome. Increased EPSPS gene copy numbers results in higher titers of the EPSPS enzyme, the target of glyphosate, and confers resistance to glyphosate treatment. To understand the genomic unit and mechanism of EPSPS gene copy number proliferation, we developed and used a bacterial artificial chromosome (BAC) library from a highly resistant biotype to sequence the local genomic landscape flanking the EPSPS gene. By sequencing overlapping BACs, a 297 kb sequence was generated, hereafter referred to as the "EPSPS cassette." This region included several putative genes, dense clusters of tandem and inverted repeats, putative helitron and autonomous replication sequences, and regulatory elements. Whole genome shotgun sequencing (WGS) of two biotypes exhibiting high and no resistance to glyphosate was performed to compare genomic representation across the EPSPS cassette. Mapping of sequences for both biotypes to the reference EPSPS cassette revealed significant differences in upstream and downstream sequences relative to EPSPS with regard to both repetitive units and coding content between these biotypes. The differences in sequence may have resulted from a compounded-building mechanism such as repetitive transpositional events. The association of putative helitron sequences with the cassette suggests a possible amplification and distribution mechanism. Flow cytometry revealed that the EPSPS cassette added measurable genomic content. The adoption of glyphosate resistant cropping systems in major crops such as corn, soybean, cotton and canola coupled with excessive use of glyphosate herbicide has led to evolved glyphosate resistance in several important weeds. In Amaranthus palmeri, the amplification of the EPSPS cassette, characterized by a complex array of repetitive elements and putative helitron sequences, suggests an adaptive structural genomic mechanism that drives amplification and distribution around the genome. The added genomic content not found in glyphosate sensitive plants may be driving evolution through genome expansion.

Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

PubMed

Ogino; Itakura; Kato; Aoki; Sato

1999-07-01

: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but also other regulatory elements, possibly ERE, play an important role in induced and constitutive expressions of the eel CYP1A1 gene.

The Rose (Rosa hybrida) NAC Transcription Factor 3 Gene, RhNAC3, Involved in ABA Signaling Pathway Both in Rose and Arabidopsis

PubMed Central

Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing

2014-01-01

Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein could mediate ABA signaling both in rose and in A. thaliana. PMID:25290154

The rose (Rosa hybrida) NAC transcription factor 3 gene, RhNAC3, involved in ABA signaling pathway both in rose and Arabidopsis.

PubMed

Jiang, Guimei; Jiang, Xinqiang; Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing

2014-01-01

Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein could mediate ABA signaling both in rose and in A. thaliana.

Redundant CArG Box Cis-motif Activity Mediates SHATTERPROOF2 Transcriptional Regulation during Arabidopsis thaliana Gynoecium Development

PubMed Central

Sehra, Bhupinder; Franks, Robert G.

2017-01-01

In the Arabidopsis thaliana seed pod, pod shatter and seed dispersal properties are in part determined by the development of a longitudinally orientated dehiscence zone (DZ) that derives from cells of the gynoecial valve margin (VM). Transcriptional regulation of the MADS protein encoding transcription factors genes SHATTERPROOF1 (SHP1) and SHATTERPROOF2 (SHP2) are critical for proper VM identity specification and later on for DZ development. Current models of SHP1 and SHP2 regulation indicate that the transcription factors FRUITFULL (FUL) and REPLUMLESS (RPL) repress these SHP genes in the developing valve and replum domains, respectively. Thus the expression of the SHP genes is restricted to the VM. FUL encodes a MADS-box containing transcription factor that is predicted to act through CArG-box containing cis-regulatory motifs. Here we delimit functional modules within the SHP2 cis-regulatory region and examine the functional importance of CArG box motifs within these regulatory regions. We have characterized a 2.2kb region upstream of the SHP2 translation start site that drives early and late medial domain expression in the gynoecium, as well as expression within the VM and DZ. We identified two separable, independent cis-regulatory modules, a 1kb promoter region and a 700bp enhancer region, that are capable of giving VM and DZ expression. Our results argue for multiple independent cis-regulatory modules that support SHP2 expression during VM development and may contribute to the robustness of SHP2 expression in this tissue. Additionally, three closely positioned CArG box motifs located in the SHP2 upstream regulatory region were mutated in the context of the 2.2kb reporter construct. Mutating simultaneously all three CArG boxes caused a moderate de-repression of the SHP2 reporter that was detected within the valve domain, suggesting that these CArG boxes are involved in SHP2 repression in the valve. PMID:29085379

Genome-wide comparative analysis reveals human-mouse regulatory landscape and evolution.

PubMed

Denas, Olgert; Sandstrom, Richard; Cheng, Yong; Beal, Kathryn; Herrero, Javier; Hardison, Ross C; Taylor, James

2015-02-14

Because species-specific gene expression is driven by species-specific regulation, understanding the relationship between sequence and function of the regulatory regions in different species will help elucidate how differences among species arise. Despite active experimental and computational research, relationships among sequence, conservation, and function are still poorly understood. We compared transcription factor occupied segments (TFos) for 116 human and 35 mouse TFs in 546 human and 125 mouse cell types and tissues from the Human and the Mouse ENCODE projects. We based the map between human and mouse TFos on a one-to-one nucleotide cross-species mapper, bnMapper, that utilizes whole genome alignments (WGA). Our analysis shows that TFos are under evolutionary constraint, but a substantial portion (25.1% of mouse and 25.85% of human on average) of the TFos does not have a homologous sequence on the other species; this portion varies among cell types and TFs. Furthermore, 47.67% and 57.01% of the homologous TFos sequence shows binding activity on the other species for human and mouse respectively. However, 79.87% and 69.22% is repurposed such that it binds the same TF in different cells or different TFs in the same cells. Remarkably, within the set of repurposed TFos, the corresponding genome regions in the other species are preferred locations of novel TFos. These events suggest exaptation of some functional regulatory sequences into new function. Despite TFos repurposing, we did not find substantial changes in their predicted target genes, suggesting that CRMs buffer evolutionary events allowing little or no change in the TFos - target gene associations. Thus, the small portion of TFos with strictly conserved occupancy underestimates the degree of conservation of regulatory interactions. We mapped regulatory sequences from an extensive number of TFs and cell types between human and mouse using WGA. A comparative analysis of this correspondence unveiled the extent of the shared regulatory sequence across TFs and cell types under study. Importantly, a large part of the shared regulatory sequence is repurposed on the other species. This sequence, fueled by turnover events, provides a strong case for exaptation in regulatory elements.

Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

PubMed Central

Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

2015-01-01

Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

G-quadruplex prediction in E. coli genome reveals a conserved putative G-quadruplex-Hairpin-Duplex switch.

PubMed

Kaplan, Oktay I; Berber, Burak; Hekim, Nezih; Doluca, Osman

2016-11-02

Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Macrolide resistance in Legionella pneumophila: the role of LpeAB efflux pump.

PubMed

Massip, Clémence; Descours, Ghislaine; Ginevra, Christophe; Doublet, Patricia; Jarraud, Sophie; Gilbert, Christophe

2017-05-01

A previous study on 12 in vitro -selected azithromycin-resistant Legionella pneumophila lineages showed that ribosomal mutations were major macrolide resistance determinants. In addition to these mechanisms that have been well described in many species, mutations upstream of lpeAB operon, homologous to acrAB in Escherichia coli , were identified in two lineages. In this study, we investigated the role of LpeAB and of these mutations in macrolide resistance of L. pneumophila . The role of LpeAB was studied by testing the antibiotic susceptibility of WT, deleted and complemented L. pneumophila Paris strains. Translational fusion experiments using GFP as a reporter were conducted to investigate the consequences of the mutations observed in the upstream sequence of lpeAB operon. We demonstrated the involvement of LpeAB in an efflux pump responsible for a macrolide-specific reduced susceptibility of L. pneumophila Paris strain. Mutations in the upstream sequence of lpeAB operon were associated with an increased protein expression. Increased expression was also observed under sub-inhibitory macrolide concentrations in strains with both mutated and WT promoting regions. LpeAB are components of an efflux pump, which is a macrolide resistance determinant in L. pneumophila Paris strain. Mutations observed in the upstream sequence of lpeAB operon in resistant lineages led to an overexpression of this efflux pump. Sub-inhibitory concentrations of macrolides themselves participated in upregulating this efflux and could constitute a first step in the acquisition of a high macrolide resistance level. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

On the Concept of Cis-regulatory Information: From Sequence Motifs to Logic Functions

NASA Astrophysics Data System (ADS)

Tarpine, Ryan; Istrail, Sorin

The regulatory genome is about the “system level organization of the core genomic regulatory apparatus, and how this is the locus of causality underlying the twin phenomena of animal development and animal evolution” (E.H. Davidson. The Regulatory Genome: Gene Regulatory Networks in Development and Evolution, Academic Press, 2006). Information processing in the regulatory genome is done through regulatory states, defined as sets of transcription factors (sequence-specific DNA binding proteins which determine gene expression) that are expressed and active at the same time. The core information processing machinery consists of modular DNA sequence elements, called cis-modules, that interact with transcription factors. The cis-modules “read” the information contained in the regulatory state of the cell through transcription factor binding, “process” it, and directly or indirectly communicate with the basal transcription apparatus to determine gene expression. This endowment of each gene with the information-receiving capacity through their cis-regulatory modules is essential for the response to every possible regulatory state to which it might be exposed during all phases of the life cycle and in all cell types. We present here a set of challenges addressed by our CYRENE research project aimed at studying the cis-regulatory code of the regulatory genome. The CYRENE Project is devoted to (1) the construction of a database, the cis-Lexicon, containing comprehensive information across species about experimentally validated cis-regulatory modules; and (2) the software development of a next-generation genome browser, the cis-Browser, specialized for the regulatory genome. The presentation is anchored on three main computational challenges: the Gene Naming Problem, the Consensus Sequence Bottleneck Problem, and the Logic Function Inference Problem.

Two Distinct Mechanisms Govern RpoS-Mediated Repression of Tick-Phase Genes during Mammalian Host Adaptation by Borrelia burgdorferi, the Lyme Disease Spirochete.

PubMed

Grove, Arianna P; Liveris, Dionysios; Iyer, Radha; Petzke, Mary; Rudman, Joseph; Caimano, Melissa J; Radolf, Justin D; Schwartz, Ira

2017-08-22

The alternative sigma factor RpoS plays a key role modulating gene expression in Borrelia burgdorferi , the Lyme disease spirochete, by transcribing mammalian host-phase genes and repressing σ 70 -dependent genes required within the arthropod vector. To identify cis regulatory elements involved in RpoS-dependent repression, we analyzed green fluorescent protein (GFP) transcriptional reporters containing portions of the upstream regions of the prototypical tick-phase genes ospAB , the glp operon, and bba74 As RpoS-mediated repression occurs only following mammalian host adaptation, strains containing the reporters were grown in dialysis membrane chambers (DMCs) implanted into the peritoneal cavities of rats. Wild-type spirochetes harboring ospAB - and glp-gfp constructs containing only the minimal (-35/-10) σ 70 promoter elements had significantly lower expression in DMCs relative to growth in vitro at 37°C; no reduction in expression occurred in a DMC-cultivated RpoS mutant harboring these constructs. In contrast, RpoS-mediated repression of bba74 required a stretch of DNA located between -165 and -82 relative to its transcriptional start site. Electrophoretic mobility shift assays employing extracts of DMC-cultivated B. burgdorferi produced a gel shift, whereas extracts from RpoS mutant spirochetes did not. Collectively, these data demonstrate that RpoS-mediated repression of tick-phase borrelial genes occurs by at least two distinct mechanisms. One (e.g., ospAB and the glp operon) involves primarily sequence elements near the core promoter, while the other (e.g., bba74 ) involves an RpoS-induced transacting repressor. Our results provide a genetic framework for further dissection of the essential "gatekeeper" role of RpoS throughout the B. burgdorferi enzootic cycle. IMPORTANCE Borrelia burgdorferi , the Lyme disease spirochete, modulates gene expression to adapt to the distinctive environments of its mammalian host and arthropod vector during its enzootic cycle. The alternative sigma factor RpoS has been referred to as a "gatekeeper" due to its central role in regulating the reciprocal expression of mammalian host- and tick-phase genes. While RpoS-dependent transcription has been studied extensively, little is known regarding the mechanism(s) of RpoS-mediated repression. We employed a combination of green fluorescent protein transcriptional reporters along with an in vivo model to define cis regulatory sequences responsible for RpoS-mediated repression of prototypical tick-phase genes. Repression of ospAB and the glp operon requires only sequences near their core promoters, whereas modulation of bba74 expression involves a putative RpoS-dependent repressor that binds upstream of the core promoter. Thus, Lyme disease spirochetes employ at least two different RpoS-dependent mechanisms to repress tick-phase genes within the mammal. Copyright © 2017 Grove et al.

Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

PubMed

Nadjar-Boger, Elisabeth; Funkenstein, Bruria

2011-02-01

Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

PubMed

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-04-08

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

PubMed

Hobson, Neil; Deyholos, Michael K

2013-04-01

Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

Identification of regulatory targets for the bacterial Nus factor complex.

PubMed

Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

2017-12-11

Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma.

PubMed

Singh, Dinesh K; Kollipara, Rahul K; Vemireddy, Vamsidara; Yang, Xiao-Li; Sun, Yuxiao; Regmi, Nanda; Klingler, Stefan; Hatanpaa, Kimmo J; Raisanen, Jack; Cho, Steve K; Sirasanagandla, Shyam; Nannepaga, Suraj; Piccirillo, Sara; Mashimo, Tomoyuki; Wang, Shan; Humphries, Caroline G; Mickey, Bruce; Maher, Elizabeth A; Zheng, Hongwu; Kim, Ryung S; Kittler, Ralf; Bachoo, Robert M

2017-01-24

Efforts to identify and target glioblastoma (GBM) drivers have primarily focused on receptor tyrosine kinases (RTKs). Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2) transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc-finger E-box binding homeobox 1 (ZEB1), which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

A key role for foxQ2 in anterior head and central brain patterning in insects

PubMed Central

Kitzmann, Peter; Weißkopf, Matthias; Schacht, Magdalena Ines

2017-01-01

ABSTRACT Anterior patterning of animals is based on a set of highly conserved transcription factors but the interactions within the protostome anterior gene regulatory network (aGRN) remain enigmatic. Here, we identify the red flour beetle Tribolium castaneum ortholog of foxQ2 (Tc-foxQ2) as a novel upstream component of the aGRN. It is required for the development of the labrum and higher order brain structures, namely the central complex and the mushroom bodies. We reveal Tc-foxQ2 interactions by RNAi and heat shock-mediated misexpression. Surprisingly, Tc-foxQ2 and Tc-six3 mutually activate each other, forming a novel regulatory module at the top of the aGRN. Comparisons of our results with those of sea urchins and cnidarians suggest that foxQ2 has acquired more upstream functions in the aGRN during protostome evolution. Our findings expand the knowledge on foxQ2 gene function to include essential roles in epidermal development and central brain patterning. PMID:28811313

A sequence upstream of canonical PDZ-binding motif within CFTR COOH-terminus enhances NHERF1 interaction.

PubMed

Sharma, Neeraj; LaRusch, Jessica; Sosnay, Patrick R; Gottschalk, Laura B; Lopez, Andrea P; Pellicore, Matthew J; Evans, Taylor; Davis, Emily; Atalar, Melis; Na, Chan-Hyun; Rosson, Gedge D; Belchis, Deborah; Milewski, Michal; Pandey, Akhilesh; Cutting, Garry R

2016-12-01

The development of cystic fibrosis transmembrane conductance regulator (CFTR) targeted therapy for cystic fibrosis has generated interest in maximizing membrane residence of mutant forms of CFTR by manipulating interactions with scaffold proteins, such as sodium/hydrogen exchange regulatory factor-1 (NHERF1). In this study, we explored whether COOH-terminal sequences in CFTR beyond the PDZ-binding motif influence its interaction with NHERF1. NHERF1 displayed minimal self-association in blot overlays (NHERF1, K d = 1,382 ± 61.1 nM) at concentrations well above physiological levels, estimated at 240 nM from RNA-sequencing and 260 nM by liquid chromatography tandem mass spectrometry in sweat gland, a key site of CFTR function in vivo. However, NHERF1 oligomerized at considerably lower concentrations (10 nM) in the presence of the last 111 amino acids of CFTR (20 nM) in blot overlays and cross-linking assays and in coimmunoprecipitations using differently tagged versions of NHERF1. Deletion and alanine mutagenesis revealed that a six-amino acid sequence 1417 EENKVR 1422 and the terminal 1478 TRL 1480 (PDZ-binding motif) in the COOH-terminus were essential for the enhanced oligomerization of NHERF1. Full-length CFTR stably expressed in Madin-Darby canine kidney epithelial cells fostered NHERF1 oligomerization that was substantially reduced (∼5-fold) on alanine substitution of EEN, KVR, or EENKVR residues or deletion of the TRL motif. Confocal fluorescent microscopy revealed that the EENKVR and TRL sequences contribute to preferential localization of CFTR to the apical membrane. Together, these results indicate that COOH-terminal sequences mediate enhanced NHERF1 interaction and facilitate the localization of CFTR, a property that could be manipulated to stabilize mutant forms of CFTR at the apical surface to maximize the effect of CFTR-targeted therapeutics. Copyright © 2016 the American Physiological Society.

A sequence upstream of canonical PDZ-binding motif within CFTR COOH-terminus enhances NHERF1 interaction

PubMed Central

Sharma, Neeraj; LaRusch, Jessica; Sosnay, Patrick R.; Gottschalk, Laura B.; Lopez, Andrea P.; Pellicore, Matthew J.; Evans, Taylor; Davis, Emily; Atalar, Melis; Na, Chan-Hyun; Rosson, Gedge D.; Belchis, Deborah; Milewski, Michal; Pandey, Akhilesh

2016-01-01

The development of cystic fibrosis transmembrane conductance regulator (CFTR) targeted therapy for cystic fibrosis has generated interest in maximizing membrane residence of mutant forms of CFTR by manipulating interactions with scaffold proteins, such as sodium/hydrogen exchange regulatory factor-1 (NHERF1). In this study, we explored whether COOH-terminal sequences in CFTR beyond the PDZ-binding motif influence its interaction with NHERF1. NHERF1 displayed minimal self-association in blot overlays (NHERF1, Kd = 1,382 ± 61.1 nM) at concentrations well above physiological levels, estimated at 240 nM from RNA-sequencing and 260 nM by liquid chromatography tandem mass spectrometry in sweat gland, a key site of CFTR function in vivo. However, NHERF1 oligomerized at considerably lower concentrations (10 nM) in the presence of the last 111 amino acids of CFTR (20 nM) in blot overlays and cross-linking assays and in coimmunoprecipitations using differently tagged versions of NHERF1. Deletion and alanine mutagenesis revealed that a six-amino acid sequence 1417EENKVR1422 and the terminal 1478TRL1480 (PDZ-binding motif) in the COOH-terminus were essential for the enhanced oligomerization of NHERF1. Full-length CFTR stably expressed in Madin-Darby canine kidney epithelial cells fostered NHERF1 oligomerization that was substantially reduced (∼5-fold) on alanine substitution of EEN, KVR, or EENKVR residues or deletion of the TRL motif. Confocal fluorescent microscopy revealed that the EENKVR and TRL sequences contribute to preferential localization of CFTR to the apical membrane. Together, these results indicate that COOH-terminal sequences mediate enhanced NHERF1 interaction and facilitate the localization of CFTR, a property that could be manipulated to stabilize mutant forms of CFTR at the apical surface to maximize the effect of CFTR-targeted therapeutics. PMID:27793802

Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

PubMed Central

Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

2012-01-01

Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

PubMed

Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

2018-01-22

Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Chromosome-encoded narrow-spectrum Ambler class A beta-lactamase GIL-1 from Citrobacter gillenii.

PubMed

Naas, Thierry; Aubert, Daniel; Ozcan, Ayla; Nordmann, Patrice

2007-04-01

A novel beta-lactamase gene was cloned from the whole-cell DNA of an enterobacterial Citrobacter gillenii reference strain that displayed a weak narrow-spectrum beta-lactam-resistant phenotype and was expressed in Escherichia coli. It encoded a clavulanic acid-inhibited Ambler class A beta-lactamase, GIL-1, with a pI value of 7.5 and a molecular mass of ca. 29 kDa. GIL-1 had the highest percent amino acid sequence identity with TEM-1 and SHV-1, 77%, and 67%, respectively, and only 46%, 31%, and 32% amino acid sequence identity with CKO-1 (C. koseri), CdiA1 (C. diversus), and SED-1 (C. sedlaki), respectively. The substrate profile of the purified GIL-1 was similar to that of beta-lactamases TEM-1 and SHV-1. The blaGIL-1 gene was chromosomally located, as revealed by I-CeuI experiments, and was constitutively expressed at a low level in C. gillenii. No gene homologous to the regulatory ampR genes of chromosomal class C beta-lactamases was found upstream of the blaGIL-1 gene, which fits the noninducibility of beta-lactamase expression in C. gillenii. Rapid amplification of DNA 5' ends analysis of the promoter region revealed putative promoter sequences that diverge from what has been identified as the consensus sequence in E. coli. The blaGIL-1 gene was part of a 5.5-kb DNA fragment bracketed by a 9-bp duplication and inserted between the d-lactate dehydrogenase gene and the ydbH genes; this DNA fragment was absent in other Citrobacter species. This work further illustrates the heterogeneity of beta-lactamases in Citrobacter spp., which may indicate that the variability of Citrobacter species is greater than expected.

Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

PubMed

Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

2017-12-01

Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Regulation of Lactobacillus casei Sorbitol Utilization Genes Requires DNA-Binding Transcriptional Activator GutR and the Conserved Protein GutM▿

PubMed Central

Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.

2008-01-01

Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

GATA3 acts upstream of FOXA1 in mediating ESR1 binding by shaping enhancer accessibility.

PubMed

Theodorou, Vasiliki; Stark, Rory; Menon, Suraj; Carroll, Jason S

2013-01-01

Estrogen receptor (ESR1) drives growth in the majority of human breast cancers by binding to regulatory elements and inducing transcription events that promote tumor growth. Differences in enhancer occupancy by ESR1 contribute to the diverse expression profiles and clinical outcome observed in breast cancer patients. GATA3 is an ESR1-cooperating transcription factor mutated in breast tumors; however, its genomic properties are not fully defined. In order to investigate the composition of enhancers involved in estrogen-induced transcription and the potential role of GATA3, we performed extensive ChIP-sequencing in unstimulated breast cancer cells and following estrogen treatment. We find that GATA3 is pivotal in mediating enhancer accessibility at regulatory regions involved in ESR1-mediated transcription. GATA3 silencing resulted in a global redistribution of cofactors and active histone marks prior to estrogen stimulation. These global genomic changes altered the ESR1-binding profile that subsequently occurred following estrogen, with events exhibiting both loss and gain in binding affinity, implying a GATA3-mediated redistribution of ESR1 binding. The GATA3-mediated redistributed ESR1 profile correlated with changes in gene expression, suggestive of its functionality. Chromatin loops at the TFF locus involving ESR1-bound enhancers occurred independently of ESR1 when GATA3 was silenced, indicating that GATA3, when present on the chromatin, may serve as a licensing factor for estrogen-ESR1-mediated interactions between cis-regulatory elements. Together, these experiments suggest that GATA3 directly impacts ESR1 enhancer accessibility, and may potentially explain the contribution of mutant-GATA3 in the heterogeneity of ESR1+ breast cancer.

GATA3 acts upstream of FOXA1 in mediating ESR1 binding by shaping enhancer accessibility

PubMed Central

Theodorou, Vasiliki; Stark, Rory; Menon, Suraj; Carroll, Jason S.

2013-01-01

Estrogen receptor (ESR1) drives growth in the majority of human breast cancers by binding to regulatory elements and inducing transcription events that promote tumor growth. Differences in enhancer occupancy by ESR1 contribute to the diverse expression profiles and clinical outcome observed in breast cancer patients. GATA3 is an ESR1-cooperating transcription factor mutated in breast tumors; however, its genomic properties are not fully defined. In order to investigate the composition of enhancers involved in estrogen-induced transcription and the potential role of GATA3, we performed extensive ChIP-sequencing in unstimulated breast cancer cells and following estrogen treatment. We find that GATA3 is pivotal in mediating enhancer accessibility at regulatory regions involved in ESR1-mediated transcription. GATA3 silencing resulted in a global redistribution of cofactors and active histone marks prior to estrogen stimulation. These global genomic changes altered the ESR1-binding profile that subsequently occurred following estrogen, with events exhibiting both loss and gain in binding affinity, implying a GATA3-mediated redistribution of ESR1 binding. The GATA3-mediated redistributed ESR1 profile correlated with changes in gene expression, suggestive of its functionality. Chromatin loops at the TFF locus involving ESR1-bound enhancers occurred independently of ESR1 when GATA3 was silenced, indicating that GATA3, when present on the chromatin, may serve as a licensing factor for estrogen–ESR1-mediated interactions between cis-regulatory elements. Together, these experiments suggest that GATA3 directly impacts ESR1 enhancer accessibility, and may potentially explain the contribution of mutant-GATA3 in the heterogeneity of ESR1+ breast cancer. PMID:23172872

Discovery of functional non-coding conserved regions in the α-synuclein gene locus

PubMed Central

Sterling, Lori; Walter, Michael; Ting, Dennis; Schüle, Birgitt

2014-01-01

Several single nucleotide polymorphisms (SNPs) and the Rep-1 microsatellite marker of the α-synuclein ( SNCA) gene have consistently been shown to be associated with Parkinson’s disease, but the functional relevance is unclear. Based on these findings we hypothesized that conserved cis-regulatory elements in the SNCA genomic region regulate expression of SNCA, and that SNPs in these regions could be functionally modulating the expression of SNCA, thus contributing to neuronal demise and predisposing to Parkinson’s disease. In a pair-wise comparison of a 206kb genomic region encompassing the SNCA gene, we revealed 34 evolutionary conserved DNA sequences between human and mouse. All elements were cloned into reporter vectors and assessed for expression modulation in dual luciferase reporter assays.  We found that 12 out of 34 elements exhibited either an enhancement or reduction of the expression of the reporter gene. Three elements upstream of the SNCA gene displayed an approximately 1.5 fold (p<0.009) increase in expression. Of the intronic regions, three showed a 1.5 fold increase and two others indicated a 2 and 2.5 fold increase in expression (p<0.002). Three elements downstream of the SNCA gene showed 1.5 fold and 2.5 fold increase (p<0.0009). One element downstream of SNCA had a reduced expression of the reporter gene of 0.35 fold (p<0.0009) of normal activity. Our results demonstrate that the SNCA gene contains cis-regulatory regions that might regulate the transcription and expression of SNCA. Further studies in disease-relevant tissue types will be important to understand the functional impact of regulatory regions and specific Parkinson’s disease-associated SNPs and its function in the disease process. PMID:25566351

Hepatocyte Nuclear Factor 4α (HNF4α) Is a Transcription Factor of Vertebrate Fatty Acyl Desaturase Gene as Identified in Marine Teleost Siganus canaliculatus

PubMed Central

Dong, Yewei; Wang, Shuqi; Chen, Junliang; Zhang, Qinghao; Liu, Yang; You, Cuihong; Monroig, Óscar; Tocher, Douglas R.; Li, Yuanyou

2016-01-01

Rabbitfish Siganus canaliculatus was the first marine teleost demonstrated to have the capability of biosynthesizing long-chain polyunsaturated fatty acids (LC-PUFA) from C18 precursors, and to possess a Δ4 fatty acyl desaturase (Δ4 Fad) which was the first report in vertebrates, and is a good model for studying the regulatory mechanisms of LC-PUFA biosynthesis in teleosts. In order to understand regulatory mechanisms of transcription of Δ4 Fad, the gene promoter was cloned and characterized in the present study. An upstream sequence of 1859 bp from the initiation codon ATG was cloned as the promoter candidate. On the basis of bioinformatic analysis, several binding sites of transcription factors (TF) including GATA binding protein 2 (GATA-2), CCAAT enhancer binding protein (C/EBP), nuclear factor 1 (NF-1), nuclear factor Y (NF-Y), hepatocyte nuclear factor 4α (HNF4α) and sterol regulatory element (SRE), were identified in the promoter by site-directed mutation and functional assays. HNF4α and NF-1 were confirmed to interact with the core promoter of Δ4 Fad by gel shift assay and mass spectrometry. Moreover, over-expression of HNF4α increased promoter activity in HEK 293T cells and mRNA level of Δ4 Fad in rabbitfish primary hepatocytes, respectively. The results indicated that HNF4α is a TF of rabbitfish Δ4 Fad. To our knowledge, this is the first report on promoter structure of a Δ4 Fad, and also the first demonstration of HNF4α as a TF of vertebrate Fad gene involved in transcription regulation of LC-PUFA biosynthesis. PMID:27472219

Genome-wide identification of lncRNAs associated with chlorantraniliprole resistance in diamondback moth Plutella xylostella (L.).

PubMed

Zhu, Bin; Xu, Manyu; Shi, Haiyan; Gao, Xiwu; Liang, Pei

2017-05-15

Long noncoding RNAs (lncRNAs) are now considered important regulatory factors, with a variety of biological functions in many species including insects. Some lncRNAs have the ability to show rapid responses to diverse stimuli or stress factors and are involved in responses to insecticide. However, there are no reports to date on the characterization of lncRNAs associated with chlorantraniliprole resistance in Plutella xylostella. Nine RNA libraries constructed from one susceptible (CHS) and two chlorantraniliprole-resistant P. xylostella strains (CHR, ZZ) were sequenced, and 1309 lncRNAs were identified, including 877 intergenic lncRNAs, 190 intronic lncRNAs, 76 anti-sense lncRNAs and 166 sense-overlapping lncRNAs. Of the identified lncRNAs, 1059 were novel. Furthermore, we found that 64 lncRNAs were differentially expressed between CHR and CHS and 83 were differentially expressed between ZZ and CHS, of which 22 were differentially expressed in both CHR and ZZ. Most of the differentially expressed lncRNAs were hypothesized to be associated with chlorantraniliprole resistance in P. xylostella. The targets of lncRNAs via cis- (<10 kb upstream and downstream) or trans- (Pearson's correlation, r > 0.9 or < -0.9, P < 0.05) regulatory effects were also identified; many of the differently expressed lncRNAs were correlated with various important protein-coding genes involved in insecticide resistance, such as the ryanodine receptor, uridine diphosphate glucuronosyltransferase (UGTs), cytochrome P450, esterase and the ATP-binding cassette transporter. Our results represent the first global identification of lncRNAs associated with chlorantraniliprole resistance in P. xylostella. These results will facilitate future studies of the regulatory mechanisms of lncRNAs in chlorantraniliprole and other insecticide resistance and in other biological processes in P. xylostella.

Transcriptome Analysis of Polyhydroxybutyrate Cycle Mutants Reveals Discrete Loci Connecting Nitrogen Utilization and Carbon Storage in Sinorhizobium meliloti.

PubMed

D'Alessio, Maya; Nordeste, Ricardo; Doxey, Andrew C; Charles, Trevor C

2017-01-01

Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti , we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis ( phbA , phbB , phbAB , and phbC ), PHB degradation ( bdhA , phaZ , and acsA2 ), and glycogen synthesis ( glgA1 ). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to the cell. The impact of carbon storage on cellular metabolism would be reflected in global transcription patterns. By investigating the transcriptomic effects of genetically disrupting genes involved in the PHB carbon storage cycle, we revealed a relationship between intracellular carbon storage and nitrogen metabolism. This work demonstrates the utility of combining transcriptome sequencing with metabolic pathway mutations for identifying underlying gene regulatory mechanisms.

UMG Lenti: Novel Lentiviral Vectors for Efficient Transgene- and Reporter Gene Expression in Human Early Hematopoietic Progenitors

PubMed Central

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183

A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

PubMed

He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

2017-08-23

The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

2003-06-01

OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less

Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection

NASA Technical Reports Server (NTRS)

Harada, Kazuo; Orgel, Leslie E.

1993-01-01

We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.

A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

PubMed Central

Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

2000-01-01

Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

PubMed

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

Retroviruses Hijack Chromatin Loops to Drive Oncogene Expression and Highlight the Chromatin Architecture around Proto-Oncogenic Loci

PubMed Central

Pattison, Jillian M.; Wright, Jason B.; Cole, Michael D.

2015-01-01

The majority of the genome consists of intergenic and non-coding DNA sequences shown to play a major role in different gene regulatory networks. However, the specific potency of these distal elements as well as how these regions exert function across large genomic distances remains unclear. To address these unresolved issues, we closely examined the chromatin architecture around proto-oncogenic loci in the mouse and human genomes to demonstrate a functional role for chromatin looping in distal gene regulation. Using cell culture models, we show that tumorigenic retroviral integration sites within the mouse genome occur near existing large chromatin loops and that this chromatin architecture is maintained within the human genome as well. Significantly, as mutagenesis screens are not feasible in humans, we demonstrate a way to leverage existing screens in mice to identify disease relevant human enhancers and expose novel disease mechanisms. For instance, we characterize the epigenetic landscape upstream of the human Cyclin D1 locus to find multiple distal interactions that contribute to the complex cis-regulation of this cell cycle gene. Furthermore, we characterize a novel distal interaction upstream of the Cyclin D1 gene which provides mechanistic evidence for the abundant overexpression of Cyclin D1 occurring in multiple myeloma cells harboring a pathogenic translocation event. Through use of mapped retroviral integrations and translocation breakpoints, our studies highlight the importance of chromatin looping in oncogene expression, elucidate the epigenetic mechanisms crucial for distal cis-regulation, and in one particular instance, explain how a translocation event drives tumorigenesis through upregulation of a proto-oncogene. PMID:25799187

Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

PubMed Central

Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

2015-01-01

Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.

PubMed

Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C

2010-05-01

Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.

PAZAR: a framework for collection and dissemination of cis-regulatory sequence annotation

PubMed Central

Portales-Casamar, Elodie; Kirov, Stefan; Lim, Jonathan; Lithwick, Stuart; Swanson, Magdalena I; Ticoll, Amy; Snoddy, Jay; Wasserman, Wyeth W

2007-01-01

PAZAR is an open-access and open-source database of transcription factor and regulatory sequence annotation with associated web interface and programming tools for data submission and extraction. Curated boutique data collections can be maintained and disseminated through the unified schema of the mall-like PAZAR repository. The Pleiades Promoter Project collection of brain-linked regulatory sequences is introduced to demonstrate the depth of annotation possible within PAZAR. PAZAR, located at , is open for business. PMID:17916232

PAZAR: a framework for collection and dissemination of cis-regulatory sequence annotation.

PubMed

Portales-Casamar, Elodie; Kirov, Stefan; Lim, Jonathan; Lithwick, Stuart; Swanson, Magdalena I; Ticoll, Amy; Snoddy, Jay; Wasserman, Wyeth W

2007-01-01

PAZAR is an open-access and open-source database of transcription factor and regulatory sequence annotation with associated web interface and programming tools for data submission and extraction. Curated boutique data collections can be maintained and disseminated through the unified schema of the mall-like PAZAR repository. The Pleiades Promoter Project collection of brain-linked regulatory sequences is introduced to demonstrate the depth of annotation possible within PAZAR. PAZAR, located at http://www.pazar.info, is open for business.

Scanning sequences after Gibbs sampling to find multiple occurrences of functional elements

PubMed Central

Tharakaraman, Kannan; Mariño-Ramírez, Leonardo; Sheetlin, Sergey L; Landsman, David; Spouge, John L

2006-01-01

Background Many DNA regulatory elements occur as multiple instances within a target promoter. Gibbs sampling programs for finding DNA regulatory elements de novo can be prohibitively slow in locating all instances of such an element in a sequence set. Results We describe an improvement to the A-GLAM computer program, which predicts regulatory elements within DNA sequences with Gibbs sampling. The improvement adds an optional "scanning step" after Gibbs sampling. Gibbs sampling produces a position specific scoring matrix (PSSM). The new scanning step resembles an iterative PSI-BLAST search based on the PSSM. First, it assigns an "individual score" to each subsequence of appropriate length within the input sequences using the initial PSSM. Second, it computes an E-value from each individual score, to assess the agreement between the corresponding subsequence and the PSSM. Third, it permits subsequences with E-values falling below a threshold to contribute to the underlying PSSM, which is then updated using the Bayesian calculus. A-GLAM iterates its scanning step to convergence, at which point no new subsequences contribute to the PSSM. After convergence, A-GLAM reports predicted regulatory elements within each sequence in order of increasing E-values, so users have a statistical evaluation of the predicted elements in a convenient presentation. Thus, although the Gibbs sampling step in A-GLAM finds at most one regulatory element per input sequence, the scanning step can now rapidly locate further instances of the element in each sequence. Conclusion Datasets from experiments determining the binding sites of transcription factors were used to evaluate the improvement to A-GLAM. Typically, the datasets included several sequences containing multiple instances of a regulatory motif. The improvements to A-GLAM permitted it to predict the multiple instances. PMID:16961919

Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

2003-12-31

Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less

A compact, in vivo screen of all 6-mers reveals drivers of tissue-specific expression and guides synthetic regulatory element design.

PubMed

Smith, Robin P; Riesenfeld, Samantha J; Holloway, Alisha K; Li, Qiang; Murphy, Karl K; Feliciano, Natalie M; Orecchia, Lorenzo; Oksenberg, Nir; Pollard, Katherine S; Ahituv, Nadav

2013-07-18

Large-scale annotation efforts have improved our ability to coarsely predict regulatory elements throughout vertebrate genomes. However, it is unclear how complex spatiotemporal patterns of gene expression driven by these elements emerge from the activity of short, transcription factor binding sequences. We describe a comprehensive promoter extension assay in which the regulatory potential of all 6 base-pair (bp) sequences was tested in the context of a minimal promoter. To enable this large-scale screen, we developed algorithms that use a reverse-complement aware decomposition of the de Bruijn graph to design a library of DNA oligomers incorporating every 6-bp sequence exactly once. Our library multiplexes all 4,096 unique 6-mers into 184 double-stranded 15-bp oligomers, which is sufficiently compact for in vivo testing. We injected each multiplexed construct into zebrafish embryos and scored GFP expression in 15 tissues at two developmental time points. Twenty-seven constructs produced consistent expression patterns, with the majority doing so in only one tissue. Functional sequences are enriched near biologically relevant genes, match motifs for developmental transcription factors, and are required for enhancer activity. By concatenating tissue-specific functional sequences, we generated completely synthetic enhancers for the notochord, epidermis, spinal cord, forebrain and otic lateral line, and show that short regulatory sequences do not always function modularly. This work introduces a unique in vivo catalog of short, functional regulatory sequences and demonstrates several important principles of regulatory element organization. Furthermore, we provide resources for designing compact, reverse-complement aware k-mer libraries.

SNPs in putative regulatory regions identified by human mouse comparative sequencing and transcription factor binding site data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Poulabi; Bahlo, Melanie; Schwartz, Jody R.

2002-01-01

Genome wide disease association analysis using SNPs is being explored as a method for dissecting complex genetic traits and a vast number of SNPs have been generated for this purpose. As there are cost and throughput limitations of genotyping large numbers of SNPs and statistical issues regarding the large number of dependent tests on the same data set, to make association analysis practical it has been proposed that SNPs should be prioritized based on likely functional importance. The most easily identifiable functional SNPs are coding SNPs (cSNPs) and accordingly cSNPs have been screened in a number of studies. SNPs inmore » gene regulatory sequences embedded in noncoding DNA are another class of SNPs suggested for prioritization due to their predicted quantitative impact on gene expression. The main challenge in evaluating these SNPs, in contrast to cSNPs is a lack of robust algorithms and databases for recognizing regulatory sequences in noncoding DNA. Approaches that have been previously used to delineate noncoding sequences with gene regulatory activity include cross-species sequence comparisons and the search for sequences recognized by transcription factors. We combined these two methods to sift through mouse human genomic sequences to identify putative gene regulatory elements and subsequently localized SNPs within these sequences in a 1 Megabase (Mb) region of human chromosome 5q31, orthologous to mouse chromosome 11 containing the Interleukin cluster.« less

Non-random distribution and co-localization of purine/pyrimidine-encoded information and transcriptional regulatory domains.

PubMed

Povinelli, C M

1992-01-01

In order to detect sequence-based information predictive for the location of eukaryotic transcriptional regulatory domains, the frequencies and distributions of the 36 possible purine/pyrimidine reverse complement hexamer pairs was determined for test sets of real and random sequences. The distribution of one of the hexamer pairs (RRYYRR/YYRRYY, referred to as M1) was further examined in a larger set of sequences (> 32 genes, 230 kb). Predominant clusters of M1 and the locations of eukaryotic transcriptional regulatory domains were found to be associated and non-randomly distributed along the DNA consistent with a periodicity of approximately 1.2 kb. In the context of higher ordered chromatin this would align promoters, enhancers and the predominant clusters of M1 longitudinally along one face of a 30 nm fiber. Using only information about the distribution of the M1 motif, 50-70% of a sequence could be eliminated as being unlikely to contain transcriptional regulatory domains with an 87% recovery of the regulatory domains present.

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

Sense transcription through the S region is essential for immunoglobulin class switch recombination

PubMed Central

Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

2011-01-01

Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

PubMed

Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

1994-12-01

We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

Reducing DNA context dependence in bacterial promoters

PubMed Central

Carr, Swati B.; Densmore, Douglas M.

2017-01-01

Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

Mutation analysis of the human CYP3A4 gene 5' regulatory region: population screening using non-radioactive SSCP.

PubMed

Hamzeiy, Hossein; Vahdati-Mashhadian, Nasser; Edwards, Helen J; Goldfarb, Peter S

2002-03-20

Human CYP3A4 is the major cytochrome P450 isoenzyme in adult human liver and is known to metabolise many xenobiotic and endogenous compounds. There is substantial inter-individual variation in the hepatic levels of CYP3A4. Although, polymorphic mutations have been reported in the 5' regulatory region of the CYP3A4 gene, those that have been investigated so far do not appear to have any effect on gene expression. To determine whether other mutations exist in this region of the gene, we have performed a new population screen on a panel of 101 human DNA samples. A 1140 bp section of the 5' proximal regulatory region of the CYP3A4 gene, containing numerous regulatory motifs, was amplified from genomic DNA as three overlapping segments. The 300 bp distal enhancer region at -7.9kb containing additional regulatory motifs was also amplified. Mutation analysis of the resulting PCR products was carried out using non-radioactive single strand conformation polymorphism (SSCP) and confirmatory sequencing of both DNA strands in those samples showing extra SSCP bands. In addition to detection of the previously reported CYP3A4*1B allele in nine subjects, three novel alleles were found: CYP3A4*1E (having a T-->A transversion at -369 in one subject), CYP3A4*1F (having a C-->G tranversion at -747 in 17 subjects) and CYP3A4*15B containing a nine-nucleotide insertion between -845 and -844 linked to an A-->G transition at -392 and a G-->A transition in exon 6 (position 485 in the cDNA) in one subject. All the novel alleles were heterozygous. No mutations were found in the upstream distal enhancer region. Our results clearly indicate that this rapid and simple SSCP approach can reveal mutant alleles in drug metabolising enzyme genes. Detection and determination of the frequency of novel alleles in CYP3A4 will assist investigation of the relationship between genotype, xenobiotic metabolism and toxicity in the CYP3A family of isoenzymes.

Regulated expression of a repressor protein: FadR activates iclR.

PubMed Central

Gui, L; Sunnarborg, A; LaPorte, D C

1996-01-01

The control of the glyoxylate bypass operon (aceBAK) of Escherichia coli is mediated by two regulatory proteins, IclMR and FadR. IclMR is a repressor protein which has previously been shown to bind to a site which overlaps the aceBAK promoter. FAR is a repressor/activator protein which participates in control of the genes of fatty acid metabolism. A sequence just upstream of the iclR promoter bears a striking resemblance to FadR binding sites found in the fatty acid metabolic genes. The in vitro binding specificity of FadR, determined by oligonucleotide selection, was in good agreement with the sequences of these sites. The ability of FadR to bind to the site associated with iclR was demonstrated by gel shift and DNase I footprint analyses. Disruption of FadR or inactivation of the FadR binding site of iclR decreased the expression of an iclR::lacZ operon fusion, indicating that FadR activates the expression of iclR. It has been reported that disruption of fadR increases the expression of aceBAK. We observed a similar increase when we inactivated the FadR binding site of an iclR+ allele. This result suggests that FadR regulates aceBAK indirectly by altering the expression of IclR. PMID:8755903

The sRNAome mining revealed existence of unique signature small RNAs derived from 5.8SrRNA from Piper nigrum and other plant lineages.

PubMed

Asha, Srinivasan; Soniya, E V

2017-02-01

Small RNAs derived from ribosomal RNAs (srRNAs) are rarely explored in the high-throughput data of plant systems. Here, we analyzed srRNAs from the deep-sequenced small RNA libraries of Piper nigrum, a unique magnoliid plant. The 5' end of the putative long form of 5.8S rRNA (5.8S L rRNA) was identified as the site for biogenesis of highly abundant srRNAs that are unique among the Piperaceae family of plants. A subsequent comparative analysis of the ninety-seven sRNAomes of diverse plants successfully uncovered the abundant existence and precise cleavage of unique rRF signature small RNAs upstream of a novel 5' consensus sequence of the 5.8S rRNA. The major cleavage process mapped identically among the different tissues of the same plant. The differential expression and cleavage of 5'5.8S srRNAs in Phytophthora capsici infected P. nigrum tissues indicated the critical biological functions of these srRNAs during stress response. The non-canonical short hairpin precursor structure, the association with Argonaute proteins, and the potential targets of 5'5.8S srRNAs reinforced their regulatory role in the RNAi pathway in plants. In addition, this novel lineage specific small RNAs may have tremendous biological potential in the taxonomic profiling of plants.

The sRNAome mining revealed existence of unique signature small RNAs derived from 5.8SrRNA from Piper nigrum and other plant lineages

PubMed Central

Asha, Srinivasan; Soniya, E. V.

2017-01-01

Small RNAs derived from ribosomal RNAs (srRNAs) are rarely explored in the high-throughput data of plant systems. Here, we analyzed srRNAs from the deep-sequenced small RNA libraries of Piper nigrum, a unique magnoliid plant. The 5′ end of the putative long form of 5.8S rRNA (5.8SLrRNA) was identified as the site for biogenesis of highly abundant srRNAs that are unique among the Piperaceae family of plants. A subsequent comparative analysis of the ninety-seven sRNAomes of diverse plants successfully uncovered the abundant existence and precise cleavage of unique rRF signature small RNAs upstream of a novel 5′ consensus sequence of the 5.8S rRNA. The major cleavage process mapped identically among the different tissues of the same plant. The differential expression and cleavage of 5′5.8S srRNAs in Phytophthora capsici infected P. nigrum tissues indicated the critical biological functions of these srRNAs during stress response. The non-canonical short hairpin precursor structure, the association with Argonaute proteins, and the potential targets of 5′5.8S srRNAs reinforced their regulatory role in the RNAi pathway in plants. In addition, this novel lineage specific small RNAs may have tremendous biological potential in the taxonomic profiling of plants. PMID:28145468

The Near Naked Hairless (HrN) Mutation Disrupts Hair Formation but is not Due to a Mutation in the Hairless Coding Region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yutao; Das, Suchita; Olszewski, Robert Edward

Near naked hairless (HrN) is a semi-dominant mutation that arose spontaneously and was suggested by allelism testing to be an allele of mouse Hairless (Hr). HrN mice differ from other Hr mutants in that hair loss appears as the postnatal coat begins to emerge, as opposed to failure to initiate the first postnatal hair cycle, and that the mutation displays semi-dominant inheritance. We sequenced the Hr cDNA in HrN/HrN mice and characterized the pathological and molecular phenotypes to identify the basis for hair loss in this model. HrN/HrN mice exhibit dystrophic hairs that are unable to consistently emerge from themore » hair follicle, while HrN/+ mice display a sparse coat of hair and a milder degree of follicular dystrophy than their homozygous littermates. DNA microarray analysis of cutaneous gene expression demonstrates that numerous genes are downregulated in HrN/HrN mice, primarily genes important for hair structure. By contrast, Hr expression is significantly increased. Sequencing the Hr coding region, intron-exon boundaries, 5'- and 3'- UTR and immediate upstream region did not reveal the underlying mutation. Therefore HrN does not appear to be an allele of Hr but may result from a mutation in a closely linked gene or from a regulatory mutation in Hr.« less

Glycopeptide Resistance vanA Operons in Paenibacillus Strains Isolated from Soil

PubMed Central

Guardabassi, Luca; Perichon, Bruno; van Heijenoort, Jean; Blanot, Didier; Courvalin, Patrice

2005-01-01

The sequence and gene organization of the van operons in vancomycin (MIC of >256 μg/ml)- and teicoplanin (MIC of ≥32 μg/ml)-resistant Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B isolated from soil were determined. Both operons had regulatory (vanR and vanS), resistance (vanH, vanA, and vanX), and accessory (vanY, vanZ, and vanW) genes homologous to the corresponding genes in enterococcal vanA and vanB operons. The vanAPT operon in P. thiaminolyticus PT-2B1 had the same gene organization as that of vanA operons whereas vanAPA in P. apiarius PA-B2B resembled vanB operons due to the presence of vanW upstream from the vanHAX cluster but was closer to vanA operons in sequence. Reference P. apiarius strains NRRL B-4299 and NRRL B-4188 were found to harbor operons indistinguishable from vanAPA by PCR mapping, restriction fragment length polymorphism, and partial sequencing, suggesting that this operon was species specific. As in enterococci, resistance was inducible by glycopeptides and associated with the synthesis of pentadepsipeptide peptidoglycan precursors ending in d-Ala-d-Lac, as demonstrated by d,d-dipeptidase activities, high-pressure liquid chromatography, and mass spectrometry. The precursors differed from those in enterococci by the presence of diaminopimelic acid instead of lysine in the peptide chain. Altogether, the results are compatible with the notion that van operons in soil Paenibacillus strains and in enterococci have evolved from a common ancestor. PMID:16189102

Glycopeptide resistance vanA operons in Paenibacillus strains isolated from soil.

PubMed

Guardabassi, Luca; Perichon, Bruno; van Heijenoort, Jean; Blanot, Didier; Courvalin, Patrice

2005-10-01

The sequence and gene organization of the van operons in vancomycin (MIC of >256 microg/ml)- and teicoplanin (MIC of > or =32 microg/ml)-resistant Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B isolated from soil were determined. Both operons had regulatory (vanR and vanS), resistance (vanH, vanA, and vanX), and accessory (vanY, vanZ, and vanW) genes homologous to the corresponding genes in enterococcal vanA and vanB operons. The vanA(PT) operon in P. thiaminolyticus PT-2B1 had the same gene organization as that of vanA operons whereas vanA(PA) in P. apiarius PA-B2B resembled vanB operons due to the presence of vanW upstream from the vanHAX cluster but was closer to vanA operons in sequence. Reference P. apiarius strains NRRL B-4299 and NRRL B-4188 were found to harbor operons indistinguishable from vanA(PA) by PCR mapping, restriction fragment length polymorphism, and partial sequencing, suggesting that this operon was species specific. As in enterococci, resistance was inducible by glycopeptides and associated with the synthesis of pentadepsipeptide peptidoglycan precursors ending in D-Ala-D-Lac, as demonstrated by D,D-dipeptidase activities, high-pressure liquid chromatography, and mass spectrometry. The precursors differed from those in enterococci by the presence of diaminopimelic acid instead of lysine in the peptide chain. Altogether, the results are compatible with the notion that van operons in soil Paenibacillus strains and in enterococci have evolved from a common ancestor.

A genetic switch controls the production of flagella and toxins in Clostridium difficile.

PubMed

Anjuwon-Foster, Brandon R; Tamayo, Rita

2017-03-01

In the human intestinal pathogen Clostridium difficile, flagella promote adherence to intestinal epithelial cells. Flagellar gene expression also indirectly impacts production of the glucosylating toxins, which are essential to diarrheal disease development. Thus, factors that regulate the expression of the flgB operon will likely impact toxin production in addition to flagellar motility. Here, we report the identification a "flagellar switch" that controls the phase variable production of flagella and glucosylating toxins. The flagellar switch, located upstream of the flgB operon containing the early stage flagellar genes, is a 154 bp invertible sequence flanked by 21 bp inverted repeats. Bacteria with the sequence in one orientation expressed flagellum and toxin genes, produced flagella, and secreted the toxins ("flg phase ON"). Bacteria with the sequence in the inverse orientation were attenuated for flagellar and toxin gene expression, were aflagellate, and showed decreased toxin secretion ("flg phase OFF"). The orientation of the flagellar switch is reversible during growth in vitro. We provide evidence that gene regulation via the flagellar switch occurs post-transcription initiation and requires a C. difficile-specific regulatory factor to destabilize or degrade the early flagellar gene mRNA when the flagellar switch is in the OFF orientation. Lastly, through mutagenesis and characterization of flagellar phase locked isolates, we determined that the tyrosine recombinase RecV, which catalyzes inversion at the cwpV switch, is also responsible for inversion at the flagellar switch in both directions. Phase variable flagellar motility and toxin production suggests that these important virulence factors have both advantageous and detrimental effects during the course of infection.

HPV integration hijacks and multimerizes a cellular enhancer to generate a viral-cellular super-enhancer that drives high viral oncogene expression

PubMed Central

Redmond, Catherine J.; Dooley, Katharine E.; Fu, Haiqing; Gillison, Maura L.; Akagi, Keiko; Symer, David E.; Aladjem, Mirit I.

2018-01-01

Integration of human papillomavirus (HPV) genomes into cellular chromatin is common in HPV-associated cancers. Integration is random, and each site is unique depending on how and where the virus integrates. We recently showed that tandemly integrated HPV16 could result in the formation of a super-enhancer-like element that drives transcription of the viral oncogenes. Here, we characterize the chromatin landscape and genomic architecture of this integration locus to elucidate the mechanisms that promoted de novo super-enhancer formation. Using next-generation sequencing and molecular combing/fiber-FISH, we show that ~26 copies of HPV16 are integrated into an intergenic region of chromosome 2p23.2, interspersed with 25 kb of amplified, flanking cellular DNA. This interspersed, co-amplified viral-host pattern is frequent in HPV-associated cancers and here we designate it as Type III integration. An abundant viral-cellular fusion transcript encoding the viral E6/E7 oncogenes is expressed from the integration locus and the chromatin encompassing both the viral enhancer and a region in the adjacent amplified cellular sequences is strongly enriched in the super-enhancer markers H3K27ac and Brd4. Notably, the peak in the amplified cellular sequence corresponds to an epithelial-cell-type specific enhancer. Thus, HPV16 integration generated a super-enhancer-like element composed of tandem interspersed copies of the viral upstream regulatory region and a cellular enhancer, to drive high levels of oncogene expression. PMID:29364907

Conservation of Transcription Start Sites within Genes across a Bacterial Genus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.

Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less

Biophysically Inspired Rational Design of Structured Chimeric Substrates for DNAzyme Cascade Engineering

PubMed Central

Lakin, Matthew R.; Brown, Carl W.; Horwitz, Eli K.; Fanning, M. Leigh; West, Hannah E.; Stefanovic, Darko; Graves, Steven W.

2014-01-01

The development of large-scale molecular computational networks is a promising approach to implementing logical decision making at the nanoscale, analogous to cellular signaling and regulatory cascades. DNA strands with catalytic activity (DNAzymes) are one means of systematically constructing molecular computation networks with inherent signal amplification. Linking multiple DNAzymes into a computational circuit requires the design of substrate molecules that allow a signal to be passed from one DNAzyme to another through programmed biochemical interactions. In this paper, we chronicle an iterative design process guided by biophysical and kinetic constraints on the desired reaction pathways and use the resulting substrate design to implement heterogeneous DNAzyme signaling cascades. A key aspect of our design process is the use of secondary structure in the substrate molecule to sequester a downstream effector sequence prior to cleavage by an upstream DNAzyme. Our goal was to develop a concrete substrate molecule design to achieve efficient signal propagation with maximal activation and minimal leakage. We have previously employed the resulting design to develop high-performance DNAzyme-based signaling systems with applications in pathogen detection and autonomous theranostics. PMID:25347066

Deciphering the adaptation strategies of Desulfovibrio piezophilus to hydrostatic pressure through metabolic and transcriptional analyses.

PubMed

Amrani, Amira; van Helden, Jacques; Bergon, Aurélie; Aouane, Aicha; Ben Hania, Wajdi; Tamburini, Christian; Loriod, Béatrice; Imbert, Jean; Ollivier, Bernard; Pradel, Nathalie; Dolla, Alain

2016-08-01

Desulfovibrio piezophilus strain C1TLV30(T) is a mesophilic piezophilic sulfate-reducer isolated from Wood Falls at 1700 m depth in the Mediterranean Sea. In this study, we analysed the effect of the hydrostatic pressure on this deep-sea living bacterium at the physiologic and transcriptomic levels. Our results showed that lactate oxidation and energy metabolism were affected by the hydrostatic pressure. Especially, acetyl-CoA oxidation pathway and energy conservation through hydrogen and formate recycling would be more important when the hydrostatic pressure is above (26 MPa) than below (0.1 MPa) the optimal one (10 MPa). This work underlines also the role of the amino acid glutamate as a piezolyte for the Desulfovibrio genus. The transcriptomic analysis revealed 146 differentially expressed genes emphasizing energy production and conversion, amino acid transport and metabolism and cell motility and signal transduction mechanisms as hydrostatic pressure responding processes. This dataset allowed us to identify a sequence motif upstream of a subset of differentially expressed genes as putative pressure-dependent regulatory element. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

PubMed Central

Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

1993-01-01

Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

The function of the Mediator complex in plant immunity.

PubMed

An, Chuanfu; Mou, Zhonglin

2013-03-01

Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.

Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

PubMed

Schreiber, T; Tissier, A

2016-01-01

The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

Major recent and independent changes in levels and patterns of expression have occurred at the b gene, a regulatory locus in maize.

PubMed

Selinger, D A; Chandler, V L

1999-12-21

The b locus encodes a transcription factor that regulates the expression of genes that produce purple anthocyanin pigment. Different b alleles are expressed in distinct tissues, causing tissue-specific anthocyanin production. Understanding how phenotypic diversity is produced and maintained at the b locus should provide models for how other regulatory genes, including those that influence morphological traits and development, evolve. We have investigated how different levels and patterns of pigmentation have evolved by determining the phenotypic and evolutionary relationships between 18 alleles that represent the diversity of b alleles in Zea mays. Although most of these alleles have few phenotypic differences, five alleles have very distinct tissue-specific patterns of pigmentation. Superimposing the phenotypes on the molecular phylogeny reveals that the alleles with strong and distinctive patterns of expression are closely related to alleles with weak expression, implying that the distinctive patterns have arisen recently. We have identified apparent insertions in three of the five phenotypically distinct alleles, and the fourth has unique upstream restriction fragment length polymorphisms relative to closely related alleles. The insertion in B-Peru has been shown to be responsible for its unique expression and, in the other two alleles, the presence of the insertion correlates with the phenotype. These results suggest that major changes in gene expression are probably the result of large-scale changes in DNA sequence and/or structure most likely mediated by transposable elements.

Atypical Genetic Locus Associated with Constitutive Production of Enterocin B by Enterococcus faecium BFE 900

PubMed Central

Franz, Charles M. A. P.; Worobo, Randy W.; Quadri, Luis E. N.; Schillinger, Ulrich; Holzapfel, Wilhelm H.; Vederas, John C.; Stiles, Michael E.

1999-01-01

A purified bacteriocin produced by Enterococcus faecium BFE 900 isolated from black olives was shown by Edman degradation and mass spectrometric analyses to be identical to enterocin B produced by E. faecium T136 from meat (P. Casaus, T. Nilsen, L. M. Cintas, I. F. Nes, P. E. Hernández, and H. Holo, Microbiology 143:2287–2294, 1997). The structural gene was located on a 2.2-kb HindIII fragment and a 12.0-kb EcoRI chromosomal fragment. The genetic characteristics and production of EntB by E. faecium BFE 900 differed from that described so far by the presence of a conserved sequence like a regulatory box upstream of the EntB gene, and its production was constitutive and not regulated. The 2.2-kb chromosomal fragment contained the hitherto undetected immunity gene for EntB in an atypical orientation that is the reverse of that of the structural gene. Typical transport and other genes associated with bacteriocin production were not detected on the 12.0-kb chromosomal fragment containing the EntB structural gene. This makes the EntB genetic system different from most other bacteriocin systems, where transport and possible regulatory genes are clustered. EntB was subcloned and expressed by the dedicated secretion machinery of Carnobacterium piscicola LV17A. The structural gene was amplified by PCR, fused to the divergicin A signal peptide, and expressed by the general secretory pathway in Enterococcus faecalis ATCC 19433. PMID:10224016

Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

PubMed

Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

2018-04-21

Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

Disruption of the Abdominal-B Promoter Tethering Element Results in a Loss of Long-Range Enhancer-Directed Hox Gene Expression in Drosophila

PubMed Central

Ho, Margaret C. W.; Schiller, Benjamin J.; Akbari, Omar S.; Bae, Esther; Drewell, Robert A.

2011-01-01

There are many examples within gene complexes of transcriptional enhancers interacting with only a subset of target promoters. A number of molecular mechanisms including promoter competition, insulators and chromatin looping are thought to play a role in regulating these interactions. At the Drosophila bithorax complex (BX-C), the IAB5 enhancer specifically drives gene expression only from the Abdominal-B (Abd-B) promoter, even though the enhancer and promoter are 55 kb apart and are separated by at least three insulators. In previous studies, we discovered that a 255 bp cis-regulatory module, the promoter tethering element (PTE), located 5′ of the Abd-B transcriptional start site is able to tether IAB5 to the Abd-B promoter in transgenic embryo assays. In this study we examine the functional role of the PTE at the endogenous BX-C using transposon-mediated mutagenesis. Disruption of the PTE by P element insertion results in a loss of enhancer-directed Abd-B expression during embryonic development and a homeotic transformation of abdominal segments. A partial deletion of the PTE and neighboring upstream genomic sequences by imprecise excision of the P element also results in a similar loss of Abd-B expression in embryos. These results demonstrate that the PTE is an essential component of the regulatory network at the BX-C and is required in vivo to mediate specific long-range enhancer-promoter interactions. PMID:21283702

The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity

PubMed Central

Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H.; Allen, Andrew S.; Goldstein, David B.

2015-01-01

Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene’s proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene’s regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen’s Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, ncCADD and ncGWAVA, and find both scores are significantly predictive of human dosage sensitive genes and appear to carry information beyond conservation, as assessed by ncGERP. These results highlight that the intolerance of noncoding sequence stretches in the human genome can provide a critical complementary tool to other genome annotation approaches to help identify the parts of the human genome increasingly likely to harbor mutations that influence risk of disease. PMID:26332131

Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

PubMed

Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

2014-10-01

A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

Characterization and Use of Catabolite-Repressed Promoters from Gluconate Genes in Corynebacterium glutamicum†

PubMed Central

Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A.; Mateos, Luís M.

2006-01-01

The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP. PMID:16385030

Characterization and use of catabolite-repressed promoters from gluconate genes in Corynebacterium glutamicum.

PubMed

Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A; Mateos, Luís M

2006-01-01

The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression

PubMed Central

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-01-01

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

PubMed

Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

2017-11-01

We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

PubMed

Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

2013-06-21

Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

PubMed Central

Gilmartin, G M; Fleming, E S; Oetjen, J

1992-01-01

The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

PubMed

Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

2015-12-01

Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

PubMed Central

Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

2006-01-01

The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

Induction of surfactin production in Bacillus subtilis by gsp, a gene located upstream of the gramicidin S operon in Bacillus brevis.

PubMed Central

Borchert, S; Stachelhaus, T; Marahiel, M A

1994-01-01

The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553

Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

PubMed

Berends Sexton, T; Jones, J T; Mullet, J E

1990-05-01

A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

PubMed Central

Haut, Donald D.; Pintel, D. J.

1998-01-01

Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034

Genetic diversity among the Eurytemora affinis species complex in the Scheldt estuary and its tributaries using ISSR-PCR marker assay

NASA Astrophysics Data System (ADS)

Gasmi, S.; Ferval, M.; Pelissier, C.; D'Amico, F.; Maris, T.; Tackx, M.; Legal, L.

2014-05-01

As an estuary being restored, the Scheldt (Belgium/The Netherlands) offers an interesting setting to study the response of organisms and ecosystems to changing conditions. This study specifically deals with this with regard to the spatio-temporal distribution and possible genetic differentiation among the species complex Eurytemora affinis (copepoda, calanoida). Until the 1990s, E. affinis typically occurred downstream the Scheldt estuary (Belgium/The Netherlands). In parallel to water quality improvement, E.affinis has recently also occurred upstream the estuary and in some of the tributaries. This paper aims to assess the origin of the copepod sibling species complex E. affinis occurring upstream the Scheldt estuary through genetic characterization. Using the Inter Simple Sequence Repeat (ISSR) technique, we explored genetic pools of the E. affinis complex in three Scheldt localities (downstream, middle-estuary and upstream) and two of its tributaries. Four ISSR primers produced 75 polymorphic loci. Bayesian and hierarchical analysis revealed different but close genetic entities in both down and upstream localities. The middle-estuary individuals were genetically a composite mix of downstream and upstream populations (84% from downstream and 16% from upstream). A distinctive separation of the tributaries and the main Scheldt stream populations suggests that two fully independent genetic pools are present. It is of note that the tributaries showed a lack of genetic subdivision, that upstream and downstream E. affinis populations are closely related, and that the downstream population is most likely at the origin of the upstream one, which implies the necessity to guarantee sufficient oxygen concentration levels throughout the estuarine continuum to guarantee the presence of this species upstream. The results of the ISSR technique are discussed in comparison with genetic studies on E. affinis using COI barcoding.

ERK5 signaling gets XIAPed: a role for ubiquitin in the disassembly of a MAPK cascade

PubMed Central

Klein, Aileen M; Cobb, Melanie H

2014-01-01

Mitogen-activated protein kinase (MAPK) cascades are tightly controlled through a series of well-characterized phospho-regulatory events. In this issue, Takeda et al (2014) identify the inhibitor of apoptosis protein, XIAP, as a key regulator of ERK5 activation via uncoupling of upstream kinase activity by non-degradative ubiquitination. PMID:25012518

Detecting the Upstream Extent of Fish in the Redwood Region of Northern California

Treesearch

Aaron K. Bliesner; E. George Robison

2007-01-01

The point at which fish use ends represents a key ecological and regulatory demarcation on state and private forest land in the Redwood region. Currently, the end of fish use and other key demarcations with stream classification are measured or estimated based on judgments of Registered Professional Foresters and aquatic biologists with little guidance from empirical...

Upstream oversight assessment for agrifood nanotechnology: a case studies approach.

PubMed

Kuzma, Jennifer; Romanchek, James; Kokotovich, Adam

2008-08-01

Although nanotechnology is broadly receiving attention in public and academic circles, oversight issues associated with applications for agriculture and food remain largely unexplored. Agrifood nanotechnology is at a critical stage in which informed analysis can help shape funding priorities, risk assessment, and oversight activities. This analysis is designed to help society and policymakers anticipate and prepare for challenges posed by complicated, convergent applications of agrifood nanotechnology. The goal is to identify data, risk assessment, regulatory policy, and engagement needs for overseeing these products so they can be addressed prior to market entry. Our approach, termed upstream oversight assessment (UOA), has potential as a key element of anticipatory governance. It relies on distinct case studies of proposed applications of agrifood nanotechnology to highlight areas that need study and attention. As a tool for preparation, UOA anticipates the types and features of emerging applications; their endpoints of use in society; the extent to which users, workers, ecosystems, or consumers will be exposed; the nature of the material and its safety; whether and where the technologies might fit into current regulatory system(s); the strengths and weaknesses of the system(s) in light of these novel applications; and the possible social concerns related to oversight for them.

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

PubMed Central

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-01-01

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

The nT1 translocation separates vulval regulatory elements from the egl-18 and elt-6 GATA factor genes.

PubMed

Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V

2004-03-01

egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.

Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

PubMed Central

O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

1999-01-01

Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the control of a constitutive promoter resulted in heterologous enterocin A production in both E. faecalis and Lactococcus lactis. PMID:10103244

Validation of Skeletal Muscle cis-Regulatory Module Predictions Reveals Nucleotide Composition Bias in Functional Enhancers

PubMed Central

Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.

2011-01-01

We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875

Sexy splicing: regulatory interplays governing sex determination from Drosophila to mammals.

PubMed

Lalli, Enzo; Ohe, Kenji; Latorre, Elisa; Bianchi, Marco E; Sassone-Corsi, Paolo

2003-02-01

A remarkable array of strategies is used to produce sexual differentiation in different species. Complex gene hierarchies govern sex determination pathways, as exemplified by the classic D. melanogaster paradigm, where an interplay of transcriptional, splicing and translational mechanisms operate. Molecular studies support the hypothesis that genetic sex determination pathways evolved in reverse order, from downstream to upstream genes, in the cascade. The recent identification of a role for the key regulatory factors SRY and WT1(+KTS) in pre-mRNA splicing indicates that important steps in the mammalian sex determination process are likely to operate at the post-transcriptional level.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Primate-specific evolution of an LDLR enhancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Qian-Fei; Prabhakar, Shyam; Wang, Qianben

2005-12-01

Sequence changes in regulatory regions have often been invoked to explain phenotypic divergence among species, but molecular examples of this have been difficult to obtain. In this study we identified an anthropoid primate-specific sequence element that contributed to the regulatory evolution of the low-density lipoprotein receptor. Using a combination of close and distant species genomic sequence comparisons coupled with in vivo and in vitro studies, we found that a functional cholesterol-sensing sequence motif arose and was fixed within a pre-existing enhancer in the common ancestor of anthropoid primates. Our study demonstrates one molecular mechanism by which ancestral mammalian regulatory elementsmore » can evolve to perform new functions in the primate lineage leading to human.« less

Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

PubMed

Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

2015-08-01

Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

PubMed

Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

2015-08-06

Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

BayesPI-BAR: a new biophysical model for characterization of regulatory sequence variations

PubMed Central

Wang, Junbai; Batmanov, Kirill

2015-01-01

Sequence variations in regulatory DNA regions are known to cause functionally important consequences for gene expression. DNA sequence variations may have an essential role in determining phenotypes and may be linked to disease; however, their identification through analysis of massive genome-wide sequencing data is a great challenge. In this work, a new computational pipeline, a Bayesian method for protein–DNA interaction with binding affinity ranking (BayesPI-BAR), is proposed for quantifying the effect of sequence variations on protein binding. BayesPI-BAR uses biophysical modeling of protein–DNA interactions to predict single nucleotide polymorphisms (SNPs) that cause significant changes in the binding affinity of a regulatory region for transcription factors (TFs). The method includes two new parameters (TF chemical potentials or protein concentrations and direct TF binding targets) that are neglected by previous methods. The new method is verified on 67 known human regulatory SNPs, of which 47 (70%) have predicted true TFs ranked in the top 10. Importantly, the performance of BayesPI-BAR, which uses principal component analysis to integrate multiple predictions from various TF chemical potentials, is found to be better than that of existing programs, such as sTRAP and is-rSNP, when evaluated on the same SNPs. BayesPI-BAR is a publicly available tool and is able to carry out parallelized computation, which helps to investigate a large number of TFs or SNPs and to detect disease-associated regulatory sequence variations in the sea of genome-wide noncoding regions. PMID:26202972

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

PubMed

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Method to transform algae, materials therefor, and products produced thereby

DOEpatents

Dunahay, T.G.; Roessler, P.G.; Jarvis, E.E.

1997-08-26

Disclosed is a method to transform chlorophyll C-containing algae. The method includes introducing a recombinant molecule comprising a nucleic acid molecule encoding a dominant selectable marker operatively linked to an algal regulatory control sequence into a chlorophyll C-containing alga in such a manner that the marker is produced by the alga. In a preferred embodiment the algal regulatory control sequence is derived from a diatom and preferably Cyclotella cryptica. Also disclosed is a chimeric molecule having one or more regulatory control sequences derived from one or more chlorophyll C-containing algae operatively linked to a nucleic acid molecule encoding a selectable marker, an RNA molecule and/or a protein, wherein the nucleic acid molecule does not normally occur with one or more of the regulatory control sequences. Further, specifically disclosed are molecules pACCNPT10, pACCNPT4.8 and pACCNPT5.1. The methods and materials of the present invention provide the ability to accomplish stable genetic transformation of chlorophyll C-containing algae. 2 figs.

Method to transform algae, materials therefor, and products produced thereby

DOEpatents

Dunahay, Terri Goodman; Roessler, Paul G.; Jarvis, Eric E.

1997-01-01

Disclosed is a method to transform chlorophyll C-containing algae which includes introducing a recombinant molecule comprising a nucleic acid molecule encoding a dominant selectable marker operatively linked to an algal regulatory control sequence into a chlorophyll C-containing alga in such a manner that the marker is produced by the alga. In a preferred embodiment the algal regulatory control sequence is derived from a diatom and preferably Cyclotella cryptica. Also disclosed is a chimeric molecule having one or more regulatory control sequences derived from one or more chlorophyll C-containing algae operatively linked to a nucleic acid molecule encoding a selectable marker, an RNA molecule and/or a protein, wherein the nucleic acid molecule does not normally occur with one or more of the regulatory control sequences. Further specifically disclosed are molecules pACCNPT10, pACCNPT4.8 and pACCNPT5.1. The methods and materials of the present invention provide the ability to accomplish stable genetic transformation of chlorophyll C-containing algae.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Uniform, optimal signal processing of mapped deep-sequencing data.

PubMed

Kumar, Vibhor; Muratani, Masafumi; Rayan, Nirmala Arul; Kraus, Petra; Lufkin, Thomas; Ng, Huck Hui; Prabhakar, Shyam

2013-07-01

Despite their apparent diversity, many problems in the analysis of high-throughput sequencing data are merely special cases of two general problems, signal detection and signal estimation. Here we adapt formally optimal solutions from signal processing theory to analyze signals of DNA sequence reads mapped to a genome. We describe DFilter, a detection algorithm that identifies regulatory features in ChIP-seq, DNase-seq and FAIRE-seq data more accurately than assay-specific algorithms. We also describe EFilter, an estimation algorithm that accurately predicts mRNA levels from as few as 1-2 histone profiles (R ∼0.9). Notably, the presence of regulatory motifs in promoters correlates more with histone modifications than with mRNA levels, suggesting that histone profiles are more predictive of cis-regulatory mechanisms. We show by applying DFilter and EFilter to embryonic forebrain ChIP-seq data that regulatory protein identification and functional annotation are feasible despite tissue heterogeneity. The mathematical formalism underlying our tools facilitates integrative analysis of data from virtually any sequencing-based functional profile.

The 3’-Jα Region of the TCRα Locus Bears Gene Regulatory Activity in Thymic and Peripheral T Cells

PubMed Central

Kučerová-Levisohn, Martina; Knirr, Stefan; Mejia, Rosa I.; Ortiz, Benjamin D.

2015-01-01

Much progress has been made in understanding the important cis-mediated controls on mouse TCRα gene function, including identification of the Eα enhancer and TCRα locus control region (LCR). Nevertheless, previous data have suggested that other cis-regulatory elements may reside in the locus outside of the Eα/LCR. Based on prior findings, we hypothesized the existence of gene regulatory elements in a 3.9-kb region 5’ of the Cα exons. Using DNase hypersensitivity assays and TCRα BAC reporter transgenes in mice, we detected gene regulatory activity within this 3.9-kb region. This region is active in both thymic and peripheral T cells, and selectively affects upstream, but not downstream, gene expression. Together, these data indicate the existence of a novel cis-acting regulatory complex that contributes to TCRα transgene expression in vivo. The active chromatin sites we discovered within this region would remain in the locus after TCRα gene rearrangement, and thus may contribute to endogenous TCRα gene activity, particularly in peripheral T cells, where the Eα element has been found to be inactive. PMID:26177549

Genomic identification of regulatory elements by evolutionary sequence comparison and functional analysis.

PubMed

Loots, Gabriela G

2008-01-01

Despite remarkable recent advances in genomics that have enabled us to identify most of the genes in the human genome, comparable efforts to define transcriptional cis-regulatory elements that control gene expression are lagging behind. The difficulty of this task stems from two equally important problems: our knowledge of how regulatory elements are encoded in genomes remains elementary, and there is a vast genomic search space for regulatory elements, since most of mammalian genomes are noncoding. Comparative genomic approaches are having a remarkable impact on the study of transcriptional regulation in eukaryotes and currently represent the most efficient and reliable methods of predicting noncoding sequences likely to control the patterns of gene expression. By subjecting eukaryotic genomic sequences to computational comparisons and subsequent experimentation, we are inching our way toward a more comprehensive catalog of common regulatory motifs that lie behind fundamental biological processes. We are still far from comprehending how the transcriptional regulatory code is encrypted in the human genome and providing an initial global view of regulatory gene networks, but collectively, the continued development of comparative and experimental approaches will rapidly expand our knowledge of the transcriptional regulome.

Deciphering the transcriptional cis-regulatory code.

PubMed

Yáñez-Cuna, J Omar; Kvon, Evgeny Z; Stark, Alexander

2013-01-01

Information about developmental gene expression resides in defined regulatory elements, called enhancers, in the non-coding part of the genome. Although cells reliably utilize enhancers to orchestrate gene expression, a cis-regulatory code that would allow their interpretation has remained one of the greatest challenges of modern biology. In this review, we summarize studies from the past three decades that describe progress towards revealing the properties of enhancers and discuss how recent approaches are providing unprecedented insights into regulatory elements in animal genomes. Over the next years, we believe that the functional characterization of regulatory sequences in entire genomes, combined with recent computational methods, will provide a comprehensive view of genomic regulatory elements and their building blocks and will enable researchers to begin to understand the sequence basis of the cis-regulatory code. Copyright © 2012 Elsevier Ltd. All rights reserved.

Translation of the mRNA of the maize transcriptional activator Opaque-2 is inhibited by upstream open reading frames present in the leader sequence.

PubMed Central

Lohmer, S; Maddaloni, M; Motto, M; Salamini, F; Thompson, R D

1993-01-01

The protein encoded by the Opaque-2 (O2) gene is a transcription factor, translated from an mRNA that possesses an unusually long 5' leader sequence containing three upstream open reading frames (uORFs). The efficiency of translation of O2 mRNA has been tested in vivo by a transient assay in which the level of activation of the b32 promoter, a natural target of O2 protein, is measured. We show that uORF-less O2 alleles possess a higher transactivation value than the wild-type allele and that the reduction in transactivation due to the uORFs is a cis-dominant effect. The data presented indicate that both uORF1 and uORF2 are involved in the reducing effect and suggest that both are likely to be translated. PMID:8439744

Human Promoters Are Intrinsically Directional

PubMed Central

Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe

2015-01-01

Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469

RSAT 2018: regulatory sequence analysis tools 20th anniversary.

PubMed

Nguyen, Nga Thi Thuy; Contreras-Moreira, Bruno; Castro-Mondragon, Jaime A; Santana-Garcia, Walter; Ossio, Raul; Robles-Espinoza, Carla Daniela; Bahin, Mathieu; Collombet, Samuel; Vincens, Pierre; Thieffry, Denis; van Helden, Jacques; Medina-Rivera, Alejandra; Thomas-Chollier, Morgane

2018-05-02

RSAT (Regulatory Sequence Analysis Tools) is a suite of modular tools for the detection and the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, including from genome-wide datasets like ChIP-seq/ATAC-seq, (ii) motif scanning, (iii) motif analysis (quality assessment, comparisons and clustering), (iv) analysis of regulatory variations, (v) comparative genomics. Six public servers jointly support 10 000 genomes from all kingdoms. Six novel or refactored programs have been added since the 2015 NAR Web Software Issue, including updated programs to analyse regulatory variants (retrieve-variation-seq, variation-scan, convert-variations), along with tools to extract sequences from a list of coordinates (retrieve-seq-bed), to select motifs from motif collections (retrieve-matrix), and to extract orthologs based on Ensembl Compara (get-orthologs-compara). Three use cases illustrate the integration of new and refactored tools to the suite. This Anniversary update gives a 20-year perspective on the software suite. RSAT is well-documented and available through Web sites, SOAP/WSDL (Simple Object Access Protocol/Web Services Description Language) web services, virtual machines and stand-alone programs at http://www.rsat.eu/.

Identifying direct miRNA-mRNA causal regulatory relationships in heterogeneous data.

PubMed

Zhang, Junpeng; Le, Thuc Duy; Liu, Lin; Liu, Bing; He, Jianfeng; Goodall, Gregory J; Li, Jiuyong

2014-12-01

Discovering the regulatory relationships between microRNAs (miRNAs) and mRNAs is an important problem that interests many biologists and medical researchers. A number of computational methods have been proposed to infer miRNA-mRNA regulatory relationships, and are mostly based on the statistical associations between miRNAs and mRNAs discovered in observational data. The miRNA-mRNA regulatory relationships identified by these methods can be both direct and indirect regulations. However, differentiating direct regulatory relationships from indirect ones is important for biologists in experimental designs. In this paper, we present a causal discovery based framework (called DirectTarget) to infer direct miRNA-mRNA causal regulatory relationships in heterogeneous data, including expression profiles of miRNAs and mRNAs, and miRNA target information. DirectTarget is applied to the Epithelial to Mesenchymal Transition (EMT) datasets. The validation by experimentally confirmed target databases suggests that the proposed method can effectively identify direct miRNA-mRNA regulatory relationships. To explore the upstream regulators of miRNA regulation, we further identify the causal feedforward patterns (CFFPs) of TF-miRNA-mRNA to provide insights into the miRNA regulation in EMT. DirectTarget has the potential to be applied to other datasets to elucidate the direct miRNA-mRNA causal regulatory relationships and to explore the regulatory patterns. Copyright © 2014 Elsevier Inc. All rights reserved.

Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

PubMed

Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

2017-11-01

Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Functional Evolution of a cis-Regulatory Module

PubMed Central

Palsson, Arnar; Alekseeva, Elena; Bergman, Casey M; Nathan, Janaki; Kreitman, Martin

2005-01-01

Lack of knowledge about how regulatory regions evolve in relation to their structure–function may limit the utility of comparative sequence analysis in deciphering cis-regulatory sequences. To address this we applied reverse genetics to carry out a functional genetic complementation analysis of a eukaryotic cis-regulatory module—the even-skipped stripe 2 enhancer—from four Drosophila species. The evolution of this enhancer is non-clock-like, with important functional differences between closely related species and functional convergence between distantly related species. Functional divergence is attributable to differences in activation levels rather than spatiotemporal control of gene expression. Our findings have implications for understanding enhancer structure–function, mechanisms of speciation and computational identification of regulatory modules. PMID:15757364

Thermodynamics-based models of transcriptional regulation with gene sequence.

PubMed

Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

2015-12-01

Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

PubMed

Kang, J J; Yokoi, T J; Holland, M J

1995-12-01

The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

A genetic switch controls the production of flagella and toxins in Clostridium difficile

PubMed Central

2017-01-01

In the human intestinal pathogen Clostridium difficile, flagella promote adherence to intestinal epithelial cells. Flagellar gene expression also indirectly impacts production of the glucosylating toxins, which are essential to diarrheal disease development. Thus, factors that regulate the expression of the flgB operon will likely impact toxin production in addition to flagellar motility. Here, we report the identification a “flagellar switch” that controls the phase variable production of flagella and glucosylating toxins. The flagellar switch, located upstream of the flgB operon containing the early stage flagellar genes, is a 154 bp invertible sequence flanked by 21 bp inverted repeats. Bacteria with the sequence in one orientation expressed flagellum and toxin genes, produced flagella, and secreted the toxins (“flg phase ON”). Bacteria with the sequence in the inverse orientation were attenuated for flagellar and toxin gene expression, were aflagellate, and showed decreased toxin secretion (“flg phase OFF”). The orientation of the flagellar switch is reversible during growth in vitro. We provide evidence that gene regulation via the flagellar switch occurs post-transcription initiation and requires a C. difficile-specific regulatory factor to destabilize or degrade the early flagellar gene mRNA when the flagellar switch is in the OFF orientation. Lastly, through mutagenesis and characterization of flagellar phase locked isolates, we determined that the tyrosine recombinase RecV, which catalyzes inversion at the cwpV switch, is also responsible for inversion at the flagellar switch in both directions. Phase variable flagellar motility and toxin production suggests that these important virulence factors have both advantageous and detrimental effects during the course of infection. PMID:28346491

H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes

PubMed Central

Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

2016-01-01

Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches. PMID:26789284

Growth rate regulation of Escherichia coli acetyl coenzyme A carboxylase, which catalyzes the first committed step of lipid biosynthesis.

PubMed Central

Li, S J; Cronan, J E

1993-01-01

Acetyl coenzyme A (CoA) carboxylase catalyzes the synthesis of malonyl-CoA, the first intermediate of fatty acid synthesis. The Escherichia coli enzyme is encoded by four subunits located at three different positions on the E. coli chromosome. The accBC genes lie in a small operon at min 72, whereas accA and accD are located at min 4.3 and 50, respectively. We examined the expression of the genes that encode the E. coli acetyl-CoA carboxylase subunits (accA, accBC, and accD) under a variety of growth conditions by quantitative Northern (RNA) blot analysis. We found a direct correlation between the levels of transcription of the acc genes and the rate of cellular growth. Consistent results were also obtained upon nutritional upshift and downshift experiments and upon dilution of stationary-phase cultures into fresh media. We also determined the 5' end of the accA and accD mRNAs by primer extension and did transcriptional fusion analysis of the previously reported accBC promoter. Several interesting features were found in the promoter regions of these genes, including a bent DNA sequence and an open reading frame within the unusually long leader mRNA of the accBC operon, potential stem-loop structures in the accA and accD mRNA leader regions, and a stretch of GC-rich sequences followed by AT-rich sequences common to all three promoters. In addition, both accA and accD are located in complex gene clusters. For example, the accA promoter was localized within the upstream polC gene (which encodes the DNA polymerase III catalytic subunit), suggesting that additional regulatory mechanisms exist. Images PMID:7678242

Recruitment of the proneural gene scute to the Drosophila sex-determination pathway.

PubMed Central

Wrischnik, Lisa A; Timmer, John R; Megna, Lisa A; Cline, Thomas W

2003-01-01

In flies, scute (sc) works with its paralogs in the achaete-scute-complex (ASC) to direct neuronal development. However, in the family Drosophilidae, sc also acquired a role in the primary event of sex determination, X chromosome counting, by becoming an X chromosome signal element (XSE)-an evolutionary step shown here to have occurred after sc diverged from its closest paralog, achaete (ac). Two temperature-sensitive alleles, sc(sisB2) and sc(sisB3), which disrupt only sex determination, were recovered in a powerful F1 genetic selection and used to investigate how sc was recruited to the sex-determination pathway. sc(sisB2) revealed 3' nontranscribed regulatory sequences likely to be involved. The sc(sisB2) lesion abolished XSE activity when combined with mutations engineered in a sequence upstream of all XSEs. In contrast, changes in Sc protein sequence seem not to have been important for recruitment. The observation that the other new allele, sc(sisB3), eliminates the C-terminal half of Sc without affecting neurogenesis and that sc(sisB1), the most XSE-specific allele previously available, is a nonsense mutant, would seem to suggest the opposite, but we show that housefly Sc can substitute for fruit fly Sc in sex determination, despite lacking Drosophilidae-specific conserved residues in its C-terminal half. Lack of synergistic lethality among mutations in sc, twist, and dorsal argue against a proposed role for sc in mesoderm formation that had seemed potentially relevant to sex-pathway recruitment. The screen that yielded new sc alleles also generated autosomal duplications that argue against the textbook view that fruit fly sex signal evolution recruited a set of autosomal signal elements comparable to the XSEs. PMID:14704182

Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

PubMed

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-11-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

Systematic analysis and evolution of 5S ribosomal DNA in metazoans

PubMed Central

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-01-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690

H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes.

PubMed

Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

2016-01-01

Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches.

EMMPRIN, an upstream regulator of MMPs, in CNS biology.

PubMed

Kaushik, Deepak Kumar; Hahn, Jennifer Nancy; Yong, V Wee

2015-01-01

Matrix metalloproteinases (MMPs) are engaged in pathologies associated with infections, tumors, autoimmune disorders and neurological dysfunctions. With the identification of an upstream regulator of MMPs, EMMPRIN (Extracellular matrix metalloproteinase inducer, CD147), it is relevant to address if EMMPRIN plays a role in the pathology of central nervous system (CNS) diseases. This would enable the possibility of a more upstream and effective therapeutic target. Indeed, conditions including gliomas, Alzheimer's disease (AD), multiple sclerosis (MS), and other insults such as hypoxia/ischemia show elevated levels of EMMPRIN which correlate with MMP production. In contrast, given EMMPRIN's role in CNS homeostasis with respect to regulation of monocarboxylate transporters (MCTs) and interactions with adhesion molecules including integrins, we need to consider that EMMPRIN may also serve important regulatory or protective functions. This review summarizes the current understanding of EMMPRIN's involvement in CNS homeostasis, its possible roles in escalating or reducing neural injury, and the mechanisms of EMMPRIN including and apart from MMP induction. Copyright © 2015 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

Cis-regulatory landscapes of four cell types of the retina

PubMed Central

Hartl, Dominik; Jüttner, Josephine

2017-01-01

Abstract The retina is composed of ∼50 cell-types with specific functions for the process of vision. Identification of the cis-regulatory elements active in retinal cell-types is key to elucidate the networks controlling this diversity. Here, we combined transcriptome and epigenome profiling to map the regulatory landscape of four cell-types isolated from mouse retinas including rod and cone photoreceptors as well as rare inter-neuron populations such as horizontal and starburst amacrine cells. Integration of this information reveals sequence determinants and candidate transcription factors for controlling cellular specialization. Additionally, we refined parallel reporter assays to enable studying the transcriptional activity of large collection of sequences in individual cell-types isolated from a tissue. We provide proof of concept for this approach and its scalability by characterizing the transcriptional capacity of several hundred putative regulatory sequences within individual retinal cell-types. This generates a catalogue of cis-regulatory regions active in retinal cell types and we further demonstrate their utility as potential resource for cellular tagging and manipulation. PMID:29059322

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

The identification of cis-regulatory elements: A review from a machine learning perspective.

PubMed

Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

2015-12-01

The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field. Crown Copyright © 2015. Published by Elsevier Ireland Ltd. All rights reserved.

Strategies for Protein Overproduction in Escherichia coli.

ERIC Educational Resources Information Center

Mott, John E.

1984-01-01

Examines heterologous expression in Escherichia coli and the role of regulatory sequences which control gene expression at transcription resulting in abundant production of messenger RNA and regulatory sequences in mRNA which promote efficient translation. Also examines the role of E. coli cells in stabilizing mRNA and protein that is…

A subset of conserved mammalian long non-coding RNAs are fossils of ancestral protein-coding genes.

PubMed

Hezroni, Hadas; Ben-Tov Perry, Rotem; Meir, Zohar; Housman, Gali; Lubelsky, Yoav; Ulitsky, Igor

2017-08-30

Only a small portion of human long non-coding RNAs (lncRNAs) appear to be conserved outside of mammals, but the events underlying the birth of new lncRNAs in mammals remain largely unknown. One potential source is remnants of protein-coding genes that transitioned into lncRNAs. We systematically compare lncRNA and protein-coding loci across vertebrates, and estimate that up to 5% of conserved mammalian lncRNAs are derived from lost protein-coding genes. These lncRNAs have specific characteristics, such as broader expression domains, that set them apart from other lncRNAs. Fourteen lncRNAs have sequence similarity with the loci of the contemporary homologs of the lost protein-coding genes. We propose that selection acting on enhancer sequences is mostly responsible for retention of these regions. As an example of an RNA element from a protein-coding ancestor that was retained in the lncRNA, we describe in detail a short translated ORF in the JPX lncRNA that was derived from an upstream ORF in a protein-coding gene and retains some of its functionality. We estimate that ~ 55 annotated conserved human lncRNAs are derived from parts of ancestral protein-coding genes, and loss of coding potential is thus a non-negligible source of new lncRNAs. Some lncRNAs inherited regulatory elements influencing transcription and translation from their protein-coding ancestors and those elements can influence the expression breadth and functionality of these lncRNAs.

Development of a transgenic zebrafish model expressing GFP in the notochord, somite and liver directed by the hfe2 gene promoter.

PubMed

Bian, Yue-Hong; Xu, Cheng; Li, Junling; Xu, Jin; Zhang, Hongwei; Du, Shao Jun

2011-08-01

Hemojuvelin, also known as RGMc, is encoded by hfe2 gene that plays an important role in iron homeostasis. hfe2 is specifically expressed in the notochord, developing somite and skeletal muscles during development. The molecular regulation of hfe2 expression is, however, not clear. We reported here the characterization of hfe2 gene expression and the regulation of its tissue-specific expression in zebrafish embryos. We demonstrated that the 6 kb 5'-flanking sequence upstream of the ATG start codon in the zebrafish hfe2 gene could direct GFP specific expression in the notochord, somites, and skeletal muscle of zebrafish embryos, recapitulating the expression pattern of the endogenous gene. However, the Tg(hfe2:gfp) transgene is also expressed in the liver of fish embryos, which did not mimic the expression of the endogenous hfe2 at the early stage. Nevertheless, the Tg(hfe2:gfp) transgenic zebrafish provides a useful model to study liver development. Treating Tg(hfe2:gfp) transgenic zebrafish embryos with valproic acid, a liver development inhibitor, significantly inhibited GFP expression in zebrafish. Together, these data indicate that the tissue specific expression of hfe2 in the notochord, somites and muscles is regulated by regulatory elements within the 6 kb 5'-flanking sequence of the hfe2 gene. Moreover, the Tg(hfe2:gfp) transgenic zebrafish line provides a useful model system for analyzing liver development in zebrafish.

Genome improvement of the acarbose producer Actinoplanes sp. SE50/110 and annotation refinement based on RNA-seq analysis.

PubMed

Wolf, Timo; Schneiker-Bekel, Susanne; Neshat, Armin; Ortseifen, Vera; Wibberg, Daniel; Zemke, Till; Pühler, Alfred; Kalinowski, Jörn

2017-06-10

Actinoplanes sp. SE50/110 is the natural producer of acarbose, which is used in the treatment of diabetes mellitus type II. However, until now the transcriptional organization and regulation of the acarbose biosynthesis are only understood rudimentarily. The genome sequence of Actinoplanes sp. SE50/110 was known before, but was resequenced in this study to remove assembly artifacts and incorrect base callings. The annotation of the genome was refined in a multi-step approach, including modern bioinformatic pipelines, transcriptome and proteome data. A whole transcriptome RNA-seq library as well as an RNA-seq library enriched for primary 5'-ends were used for the detection of transcription start sites, to correct tRNA predictions, to identify novel transcripts like small RNAs and to improve the annotation through the correction of falsely annotated translation start sites. The transcriptome data sets were also applied to identify 31 cis-regulatory RNA structures, such as riboswitches or RNA thermometers as well as three leaderless transcribed short peptides found in putative attenuators upstream of genes for amino acid biosynthesis. The transcriptional organization of the acarbose biosynthetic gene cluster was elucidated in detail and fourteen novel biosynthetic gene clusters were suggested. The accurate genome sequence and precise annotation of the Actinoplanes sp. SE50/110 genome will be the foundation for future genetic engineering and systems biology studies. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular Cloning, Expression Analysis, and Functional Characterization of the H(+)-Pyrophosphatase from Jatropha curcas.

PubMed

Yang, Yumei; Luo, Zhu; Zhang, Mengru; Liu, Chang; Gong, Ming; Zou, Zhurong

2016-04-01

H(+)-pyrophosphatase (H(+)-PPase) is a primary pyrophosphate (PPi)-energized proton pump to generate electrochemical H(+) gradient for ATP production and substance translocations across membranes. It plays an important role in stress adaptation that was intensively substantiated by numerous transgenic plants overexpressing H(+)-PPases yet devoid of any correlated studies pointing to the elite energy plant, Jatropha curcas. Herein, we cloned the full length of J. curcas H(+)-PPase (JcVP1) complementary DNA (cDNA) by reverse transcription PCR, based on the assembled sequence of its ESTs highly matched to Hevea brasiliensis H(+)-PPase. This gene encodes a polypeptide of 765 amino acids that was predicted as a K(+)-dependent H(+)-PPase evolutionarily closest to those of other Euphorbiaceae plants. Many cis-regulatory elements relevant to environmental stresses, molecular signals, or tissue-specificity were identified by promoter prediction within the 1.5-kb region upstream of JcVP1 coding sequence. Meanwhile, the responses of JcVP1 expression to several common abiotic stresses (salt, drought, heat, cold) were characterized with a considerable accordance with the inherent stress tolerance of J. curcas. Moreover, we found that the heterologous expression of JcVP1 could significantly improve the salt tolerance in both recombinant Escherichia coli and Saccharomyces cerevisiae, and this effect could be further fortified in yeast by N-terminal addition of a vacuole-targeting signal peptide from the H(+)-PPase of Trypanosoma cruzi.

CzcR and CzcD, gene products affecting regulation of resistance to cobalt, zinc, and cadmium (czc system) in Alcaligenes eutrophus.

PubMed Central

Nies, D H

1992-01-01

The czcR gene, one of the two control genes responsible for induction of resistance to Co2+, Zn2+, and Cd2+ (czc system) in the Alcaligenes eutrophus plasmid pMOL30, was cloned and characterized. The 1,376-bp sequence upstream of the czcCBAD structural genes encodes a 41.4-kDa protein, the czcR gene product, transcribed in the opposite direction of that of the czcCBAD genes. The putative CzcR polypeptide (355 amino acid residues) contains 11 cysteine and 14 histidine residues which might form metal cation-binding sites. A czcC::lacZ reporter gene translational fusion was constructed, inserted into plasmid pMOL30 in A. eutrophus, and expressed under the control of CzcR. Zn2+, Co2+, and Cd2+, as well as Ni2+, Cu2+, Hg2+, and Mn2+ and even Al3+, served as inducers of beta-galactosidase activity. Besides the CzcR protein, the membrane-bound CzcD protein was essential for induction of czc. The CzcR and CzcD proteins display no sequence similarity to two-component regulatory systems of a sensor and a response activator type; however, CzcD has 34% identity with the ZRC-1 protein, which mediates zinc resistance in Saccharomyces cerevisiae (A. Kamizomo, M. Nishizawa, Y. Teranishi, K. Murata, and A. Kimura, Mol. Gen. Genet. 219:161-167, 1989). Images PMID:1459958

Dehydrins from wheat x Thinopyrum ponticum amphiploid increase salinity and drought tolerance under their own inducible promoters without growth retardation.

PubMed

Qin, Yu-Xiang; Qin, Fangyuan

2016-02-01

Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Novel Allelic Variants in the Canine Cyclooxgenase-2 (Cox-2) Promoter Are Associated with Renal Dysplasia in Dogs

PubMed Central

Whiteley, Mary H.; Bell, Jerold S.; Rothman, Debby A.

2011-01-01

Renal dysplasia (RD) in dogs is a complex disease with a highly variable phenotype and mode of inheritance that does not follow a simple Mendelian pattern. Cox-2 (Cyclooxgenase-2) deficient mice have renal abnormalities and a pathology that has striking similarities to RD in dogs suggesting to us that mutations in the Cox-2 gene could be the cause of RD in dogs. Our data supports this hypothesis. Sequencing of the canine Cox-2 gene was done from clinically affected and normal dogs. Although no changes were detected in the Cox-2 coding region, small insertions and deletions of GC boxes just upstream of the ATG translation start site were found. These sequences are putative SP1 transcription factor binding sites that may represent important cis-acting DNA regulatory elements that govern the expression of Cox-2. A pedigree study of a family of Lhasa apsos revealed an important statistical correlation of these mutant alleles with the disease. We examined an additional 22 clinical cases from various breeds. Regardless of the breed or severity of disease, all of these had one or two copies of the Cox-2 allelic variants. We suggest that the unusual inheritance pattern of RD is due to these alleles, either by changing the pattern of expression of Cox-2 or making Cox-2 levels susceptible to influences of other genes or environmental factors that play an unknown but important role in the development of RD in dogs. PMID:21346820

Regulation of early gene expression from the bovine papillomavirus genome in transiently transfected C127 cells.

PubMed Central

Szymanski, P; Stenlund, A

1991-01-01

Expression of bovine papillomavirus (BPV) early gene products is required for viral DNA replication and establishment of the transformed phenotype. By the use of a highly efficient electroporation system, we have examined for the first time the transcriptional activity of BPV promoters in their natural genomic context in a replication-permissive cell line. We have determined that a qualitatively distinct stage of transcription is not detectable prior to DNA replication in transiently transfected cells. This suggests that the transcriptional activity of the BPV genome in stably transformed cells represents the early stage of BPV gene expression. Quantitative differences in promoter activity between transiently transfected and stably transformed cells suggest that subtle changes in gene expression may control progression of the viral life cycle. Deletion analysis demonstrated that the E2 transactivator protein stimulates all of the early promoters through sequences located in the upstream regulatory region. This E2-dependent enhancer was found to be highly redundant, and particular E2 binding sites did not display a preference for particular promoters. Despite this dependence on a common cis-acting sequence, the various promoters displayed different sensitivities to the E2 transactivator. The findings that E2 regulates all promoters and, with the exception of the E2 repressors, that no other known viral gene product appears to affect transcription indicate that the E2 system functions as the master regulator of BPV early gene expression. Images PMID:1656065

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Modulation of anaerobic energy metabolism of Bacillus subtilis by arfM (ywiD).

PubMed

Marino, M; Ramos, H C; Hoffmann, T; Glaser, P; Jahn, D

2001-12-01

Bacillus subtilis grows under anaerobic conditions utilizing nitrate ammonification and various fermentative processes. The two-component regulatory system ResDE and the redox regulator Fnr are the currently known parts of the regulatory system for anaerobic adaptation. Mutation of the open reading frame ywiD located upstream of the respiratory nitrate reductase operon narGHJI resulted in elimination of the contribution of nitrite dissimilation to anaerobic nitrate respiratory growth. Significantly reduced nitrite reductase (NasDE) activity was detected, while respiratory nitrate reductase activity was unchanged. Anaerobic induction of nasDE expression was found to be significantly dependent on intact ywiD, while anaerobic narGHJI expression was ywiD independent. Anaerobic transcription of hmp, encoding a flavohemoglobin-like protein, and of the fermentative operons lctEP and alsSD, responsible for lactate and acetoin formation, was partially dependent on ywiD. Expression of pta, encoding phosphotransacetylase involved in fermentative acetate formation, was not influenced by ywiD. Transcription of the ywiD gene was anaerobically induced by the redox regulator Fnr via the conserved Fnr-box (TGTGA-6N-TCACT) centered 40.5 bp upstream of the transcriptional start site. Anaerobic induction of ywiD by resDE was found to be indirect via resDE-dependent activation of fnr. The ywiD gene is subject to autorepression and nitrite repression. These results suggest a ResDE --> Fnr --> YwiD regulatory cascade for the modulation of genes involved in the anaerobic metabolism of B. subtilis. Therefore, ywiD was renamed arfM for anaerobic respiration and fermentation modulator.

Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.

PubMed

Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N

1999-01-01

The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.

Transcriptome Analysis of Polyhydroxybutyrate Cycle Mutants Reveals Discrete Loci Connecting Nitrogen Utilization and Carbon Storage in Sinorhizobium meliloti

PubMed Central

Nordeste, Ricardo

2017-01-01

ABSTRACT Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti, we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis (phbA, phbB, phbAB, and phbC), PHB degradation (bdhA, phaZ, and acsA2), and glycogen synthesis (glgA1). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to the cell. The impact of carbon storage on cellular metabolism would be reflected in global transcription patterns. By investigating the transcriptomic effects of genetically disrupting genes involved in the PHB carbon storage cycle, we revealed a relationship between intracellular carbon storage and nitrogen metabolism. This work demonstrates the utility of combining transcriptome sequencing with metabolic pathway mutations for identifying underlying gene regulatory mechanisms. Author Video: An author video summary of this article is available. PMID:28905000

Fine mapping and candidate gene analysis of the virescent gene v 1 in Upland cotton (Gossypium hirsutum).

PubMed

Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun

2018-02-01

The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the associations of CHLI protein function and the chlorophyll biosynthesis pathway but also has implications for cotton breeding.

Identification of Neurodegenerative Factors Using Translatome-Regulatory Network Analysis

PubMed Central

Brichta, Lars; Shin, William; Jackson-Lewis, Vernice; Blesa, Javier; Yap, Ee-Lynn; Walker, Zachary; Zhang, Jack; Roussarie, Jean-Pierre; Alvarez, Mariano J.; Califano, Andrea; Przedborski, Serge; Greengard, Paul

2016-01-01

For degenerative disorders of the central nervous system, the major obstacle to therapeutic advancement has been the challenge of identifying the key molecular mechanisms underlying neuronal loss. We developed a combinatorial approach including translational profiling and brain regulatory network analysis to search for key determinants of neuronal survival or death. Following the generation of transgenic mice for cell type-specific profiling of midbrain dopaminergic neurons, we established and compared translatome libraries reflecting the molecular signature of these cells at baseline or under degenerative stress. Analysis of these libraries by interrogating a context-specific brain regulatory network led to the identification of a repertoire of intrinsic upstream regulators that drive the dopaminergic stress response. The altered activity of these regulators was not associated with changes in their expression levels. This strategy can be generalized for the elucidation of novel molecular determinants involved in the degeneration of other classes of neurons. PMID:26214373

Spatiotemporal clustering of the epigenome reveals rules of dynamic gene regulation

PubMed Central

Yu, Pengfei; Xiao, Shu; Xin, Xiaoyun; Song, Chun-Xiao; Huang, Wei; McDee, Darina; Tanaka, Tetsuya; Wang, Ting; He, Chuan; Zhong, Sheng

2013-01-01

Spatial organization of different epigenomic marks was used to infer functions of the epigenome. It remains unclear what can be learned from the temporal changes of the epigenome. Here, we developed a probabilistic model to cluster genomic sequences based on the similarity of temporal changes of multiple epigenomic marks during a cellular differentiation process. We differentiated mouse embryonic stem (ES) cells into mesendoderm cells. At three time points during this differentiation process, we used high-throughput sequencing to measure seven histone modifications and variants—H3K4me1/2/3, H3K27ac, H3K27me3, H3K36me3, and H2A.Z; two DNA modifications—5-mC and 5-hmC; and transcribed mRNAs and noncoding RNAs (ncRNAs). Genomic sequences were clustered based on the spatiotemporal epigenomic information. These clusters not only clearly distinguished gene bodies, promoters, and enhancers, but also were predictive of bidirectional promoters, miRNA promoters, and piRNAs. This suggests specific epigenomic patterns exist on piRNA genes much earlier than germ cell development. Temporal changes of H3K4me2, unmethylated CpG, and H2A.Z were predictive of 5-hmC changes, suggesting unmethylated CpG and H3K4me2 as potential upstream signals guiding TETs to specific sequences. Several rules on combinatorial epigenomic changes and their effects on mRNA expression and ncRNA expression were derived, including a simple rule governing the relationship between 5-hmC and gene expression levels. A Sox17 enhancer containing a FOXA2 binding site and a Foxa2 enhancer containing a SOX17 binding site were identified, suggesting a positive feedback loop between the two mesendoderm transcription factors. These data illustrate the power of using epigenome dynamics to investigate regulatory functions. PMID:23033340

Metagenomic Analysis of Ammonia-Oxidizing Archaea Affiliated with the Soil Group

PubMed Central

Bartossek, Rita; Spang, Anja; Weidler, Gerhard; Lanzen, Anders; Schleper, Christa

2012-01-01

Ammonia-oxidizing archaea (AOA) have recently been recognized as a significant component of many microbial communities and represent one of the most abundant prokaryotic groups in the biosphere. However, only few AOA have been successfully cultivated so far and information on the physiology and genomic content remains scarce. We have performed a metagenomic analysis to extend the knowledge of the AOA affiliated with group I.1b that is widespread in terrestrial habitats and of which no genome sequences has been described yet. A fosmid library was generated from samples of a radioactive thermal cave (46°C) in the Austrian Central Alps in which AOA had been found as a major part of the microbial community. Out of 16 fosmids that possessed either an amoA or 16S rRNA gene affiliating with AOA, 5 were fully sequenced, 4 of which grouped with the soil/I.1b (Nitrososphaera-) lineage, and 1 with marine/I.1a (Nitrosopumilus-) lineage. Phylogenetic analyses of amoBC and an associated conserved gene were congruent with earlier analyses based on amoA and 16S rRNA genes and supported the separation of the soil and marine group. Several putative genes that did not have homologs in currently available marine Thaumarchaeota genomes indicated that AOA of the soil group contain specific genes that are distinct from their marine relatives. Potential cis-regulatory elements around conserved promoter motifs found upstream of the amo genes in sequenced (meta-) genomes differed in marine and soil group AOA. On one fosmid, a group of genes including amoA and amoB were flanked by identical transposable insertion sequences, indicating that amoAB could potentially be co-mobilized in the form of a composite transposon. This might be one of the mechanisms that caused the greater variation in gene order compared to genomes in the marine counterparts. Our findings highlight the genetic diversity within the two major and widespread lineages of Thaumarchaeota. PMID:22723795

Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto.

PubMed

Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

2017-01-01

Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.

Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto

PubMed Central

Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

2017-01-01

Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3’UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3’UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3’UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo. PMID:28253363

Co-regulation of the atrial natriuretic factor and cardiac myosin light chain-2 genes during alpha-adrenergic stimulation of neonatal rat ventricular cells. Identification of cis sequences within an embryonic and a constitutive contractile protein gene which mediate inducible expression.

PubMed

Knowlton, K U; Baracchini, E; Ross, R S; Harris, A N; Henderson, S A; Evans, S M; Glembotski, C C; Chien, K R

1991-04-25

To study the mechanisms which mediate the transcriptional activation of cardiac genes during alpha adrenergic stimulation, the present study examined the regulated expression of three cardiac genes, a ventricular embryonic gene (atrial natriuretic factor, ANF), a constitutively expressed contractile protein gene (cardiac MLC-2), and a cardiac sodium channel gene. alpha 1-Adrenergic stimulation activates the expression and release of ANF from neonatal ventricular cells. As assessed by RNase protection analyses, treatment with alpha-adrenergic agonists increases the steady-state levels of ANF mRNA by greater than 15-fold. However, a rat cardiac sodium channel gene mRNA is not induced, indicating that alpha-adrenergic stimulation does not lead to an increase in the expression of all cardiac genes. Studies employing a series of rat ANF luciferase and rat MLC-2 luciferase fusion genes identify 315- and 92-base pair cis regulatory sequences within an embryonic gene (ANF) and a constitutively expressed contractile protein gene (MLC-2), respectively, which mediate alpha-adrenergic-inducible gene expression. Transfection of various ANF luciferase reporters into neonatal rat ventricular cells demonstrated that upstream sequences which mediate tissue-specific expression (-3003 to -638) can be segregated from those responsible for inducibility. The lack of inducibility of a cardiac Na+ channel gene, and the segregation of ANF gene sequences which mediate cardiac specific from those which mediate inducible expression, provides further insight into the relationship between muscle-specific and inducible expression during cardiac myocyte hypertrophy. Based on these results, a testable model is proposed for the induction of embryonic cardiac genes and constitutively expressed contractile protein genes and the noninducibility of a subset of cardiac genes during alpha-adrenergic stimulation of neonatal rat ventricular cells.

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

PubMed

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

PubMed

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-07-27

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A Core Regulatory Pathway Controlling Rice Tiller Angle Mediated by the LAZY1-dependent Asymmetric Distribution of Auxin.

PubMed

Zhang, Ning; Yu, Hong; Yu, Hao; Cai, Yueyue; Huang, Linzhou; Xu, Cao; Xiong, Guosheng; Meng, Xiangbing; Wang, Jiyao; Chen, Haofeng; Liu, Guifu; Jing, Yanhui; Yuan, Yundong; Liang, Yan; Li, Shujia; Smith, Steven M; Li, Jiayang; Wang, Yonghong

2018-06-18

Tiller angle in cereals is a key shoot architecture trait that strongly influences grain yield. Studies in rice (Oryza sativa L.) have implicated shoot gravitropism in the regulation of tiller angle. However, the functional link between shoot gravitropism and tiller angle is unknown. Here, we conducted a large-scale transcriptome analysis of rice shoots in response to gravistimulation and identified two new nodes of a shoot gravitropism regulatory gene network that also controls rice tiller angle. We demonstrate that HEAT STRESS TRANSCRIPTION FACTOR 2D (HSFA2D) is an upstream positive regulator of the LAZY1-mediated asymmetric auxin distribution pathway. We also show that two functionally redundant transcription factor genes, WUSCHEL RELATED HOMEOBOX6 (WOX6) and WOX11, are expressed asymmetrically in response to auxin to connect gravitropism responses with the control of rice tiller angle. These findings define upstream and downstream genetic components that link shoot gravitropism, asymmetric auxin distribution, and rice tiller angle. The results highlight the power of the high-temporal-resolution RNA-seq dataset, and its use to explore further genetic components controlling tiller angle. Collectively these approaches will identify genes to improve grain yields by facilitating the optimization of plant architecture. © 2018 American Society of Plant Biologists. All rights reserved.

RNA-ID, a highly sensitive and robust method to identify cis-regulatory sequences using superfolder GFP and a fluorescence-based assay.

PubMed

Dean, Kimberly M; Grayhack, Elizabeth J

2012-12-01

We have developed a robust and sensitive method, called RNA-ID, to screen for cis-regulatory sequences in RNA using fluorescence-activated cell sorting (FACS) of yeast cells bearing a reporter in which expression of both superfolder green fluorescent protein (GFP) and yeast codon-optimized mCherry red fluorescent protein (RFP) is driven by the bidirectional GAL1,10 promoter. This method recapitulates previously reported progressive inhibition of translation mediated by increasing numbers of CGA codon pairs, and restoration of expression by introduction of a tRNA with an anticodon that base pairs exactly with the CGA codon. This method also reproduces effects of paromomycin and context on stop codon read-through. Five key features of this method contribute to its effectiveness as a selection for regulatory sequences: The system exhibits greater than a 250-fold dynamic range, a quantitative and dose-dependent response to known inhibitory sequences, exquisite resolution that allows nearly complete physical separation of distinct populations, and a reproducible signal between different cells transformed with the identical reporter, all of which are coupled with simple methods involving ligation-independent cloning, to create large libraries. Moreover, we provide evidence that there are sequences within a 9-nt library that cause reduced GFP fluorescence, suggesting that there are novel cis-regulatory sequences to be found even in this short sequence space. This method is widely applicable to the study of both RNA-mediated and codon-mediated effects on expression.

FimY Does Not Interfere with FimZ-FimW Interaction during Type 1 Fimbria Production by Salmonella enterica Serovar Typhimurium

PubMed Central

Zeiner, Sarah A.; Dwyer, Brett E.

2013-01-01

The production of type 1 fimbriae in Salmonella enterica serovar Typhimurium is controlled, in part, by three proteins, FimZ, FimY, and FimW. Amino acid sequence analysis indicates that FimZ belongs to the family of bacterial response regulators of two-component systems. In these studies, we have demonstrated that introducing a mutation mimicking phosphorylation of FimZ is necessary for activation of its target gene, fimA. In addition, the interaction of FimZ with FimW, a repressor of fimA expression, occurs only when FimZ is phosphorylated. Consequently, the negative regulatory effect of FimW is most likely due to downmodulation of the active FimZ protein. FimY does not appear to function as a response regulator, and its activity can be lost by mimicking the phosphorylation of FimY. Overproduction of FimY cannot alleviate the nonfimbriate phenotype in a FimZ mutant, whereas high levels of FimZ can overcome the nonfimbriate phenotype of a FimY mutant. It appears that FimY acts upstream of FimZ to activate fimA expression. PMID:24042120

hobo Induced rearrangements in the yellow locus influence the insulation effect of the gypsy su(Hw)-binding region in Drosophila melanogaster.

PubMed Central

Gause, M; Hovhannisyan, H; Kan, T; Kuhfittig, S; Mogila, V; Georgiev, P

1998-01-01

The su(Hw) protein is responsible for the insulation mediated by the su(Hw)-binding region present in the gypsy retrotransposon. In the y2 mutant, su(Hw) protein partially inhibits yellow transcription by repressing the function of transcriptional enhancers located distally from the yellow promoter with respect to gypsy. y2 mutation derivatives have been induced by the insertion of two hobo copies on the both sides of gypsy: into the yellow intron and into the 5' regulatory region upstream of the wing and body enhancers. The hobo elements have the same structure and orientation, opposite to the direction of yellow transcription. In the sequence context, where two copies of hobo are separated by the su(Hw)-binding region, hobo-dependent rearrangements are frequently associated with duplications of the region between the hobo elements. Duplication of the su(Hw)-binding region strongly inhibits the insulation of the yellow promoter separated from the body and wing enhancers by gypsy. These results provide a better insight into mechanisms by which the su(Hw)-binding region affects the enhancer function. PMID:9649529

De novo disruption of promoter and exon 1 of STAR gene reveals essential role for gonadal development.

PubMed

Piya, Anil; Kaur, Jasmeet; Rice, Alan M; Bose, Himangshu S

2017-01-01

Cholesterol transport into the mitochondria is required for synthesis of the first steroid, pregnenolone. Cholesterol is transported by the steroidogenic acute regulatory protein (STAR), which acts at the outer mitochondrial membrane prior to its import. Mutations in the STAR protein result in lipoid congenital adrenal hyperplasia (CAH). Although the STAR protein consists of seven exons, biochemical analysis in nonsteroidogenic COS-1 cells showed that the first two were not essential for pregnenolone synthesis. Here, we present a patient with ambiguous genitalia, salt-lossing crisis within two weeks after birth and low cortisol levels. Sequence analysis of the STAR , including the exon-intron boundaries, showed the complete deletion of exon 1 as well as more than 50 nucleotides upstream of STAR promoter. Mitochondrial protein import with the translated protein through synthesis cassette of the mutant STAR lacking exon 1 showed protein translation, but it is less likely to have synthesized without a promoter in our patient. Thus, a full-length STAR gene is necessary for physiological mitochondrial cholesterol transport in vivo . STAR exon 1 deletion caused lipoid CAH.Exon 1 substitution does not affect biochemical activity.StAR promoter is responsible for gonadal development.

Identification of Genes and Proteins Necessary for Catabolism of Acyclic Terpenes and Leucine/Isovalerate in Pseudomonas aeruginosa

PubMed Central

Förster-Fromme, Karin; Höschle, Birgit; Mack, Christina; Bott, Michael; Armbruster, Wolfgang; Jendrossek, Dieter

2006-01-01

Geranyl-coenzyme A (CoA)-carboxylase (GCase; AtuC/AtuF) and methylcrotonyl-CoA-carboxylase (MCase; LiuB/LiuD) are characteristic enzymes of the catabolic pathway of acyclic terpenes (citronellol and geraniol) and of saturated methyl-branched compounds, such as leucine or isovalerate, respectively. Proteins encoded by two gene clusters (atuABCDEFGH and liuRABCDE) of Pseudomonas aeruginosa PAO1 were essential for acyclic terpene utilization (Atu) and for leucine and isovalerate utilization (Liu), respectively, as revealed by phenotype analysis of 10 insertion mutants, two-dimensional gel electrophoresis, determination of GCase and MCase activities, and Western blot analysis of wild-type and mutant strains. Analysis of the genome sequences of other pseudomonads (P. putida KT2440 and P. fluorescens Pf-5) revealed candidate genes for Liu proteins for both species and candidate genes for Atu proteins in P. fluorescens. This result concurred with the finding that P. fluorescens, but not P. putida, could grow on acyclic terpenes (citronellol and citronellate), while both species were able to utilize leucine and isovalerate. A regulatory gene, atuR, was identified upstream of atuABCDEFGH and negatively regulated expression of the atu gene cluster. PMID:16820476

Regulating Toxin-Antitoxin Expression: Controlled Detonation of Intracellular Molecular Timebombs

PubMed Central

Hayes, Finbarr; Kędzierska, Barbara

2014-01-01

Genes for toxin-antitoxin (TA) complexes are widely disseminated in bacteria, including in pathogenic and antibiotic resistant species. The toxins are liberated from association with the cognate antitoxins by certain physiological triggers to impair vital cellular functions. TAs also are implicated in antibiotic persistence, biofilm formation, and bacteriophage resistance. Among the ever increasing number of TA modules that have been identified, the most numerous are complexes in which both toxin and antitoxin are proteins. Transcriptional autoregulation of the operons encoding these complexes is key to ensuring balanced TA production and to prevent inadvertent toxin release. Control typically is exerted by binding of the antitoxin to regulatory sequences upstream of the operons. The toxin protein commonly works as a transcriptional corepressor that remodels and stabilizes the antitoxin. However, there are notable exceptions to this paradigm. Moreover, it is becoming clear that TA complexes often form one strand in an interconnected web of stress responses suggesting that their transcriptional regulation may prove to be more intricate than currently understood. Furthermore, interference with TA gene transcriptional autoregulation holds considerable promise as a novel antibacterial strategy: artificial release of the toxin factor using designer drugs is a potential approach to induce bacterial suicide from within. PMID:24434949

Transcriptome analysis demonstrates that long noncoding RNA is involved in the hypoxic response in Larimichthys crocea.

PubMed

Liu, Wei; Liu, Xiaoxu; Wu, Changwen; Jiang, Lihua

2018-06-15

The large yellow croaker (Larimichthys crocea) has low hypoxia tolerance compared with other fish species, and the mRNA levels of hypoxia-inducible factor (HIF)-1α in its brain do not change markedly under hypoxic conditions. In this study, we investigated noncoding transcription in the hypoxic response mechanism of L. crocea. We generated a catalog of long noncoding RNAs (lncRNAs) from the brain of L. crocea individuals under hypoxic stress, investigated lncRNA expression patterns, and analyzed the HIF signaling pathway by RNA sequencing. Prolyl hydroxylase domain 2 (PHD2) expression significantly increased after 6 and 12 h of hypoxia, and a lncRNA (Linc_06633.1) was found in the upstream, antisense region of PHD2. Linc_06633.1 may be an important regulator that promotes PDH2 expression under hypoxia in L. crocea, and we constructed a regulatory profile of L. crocea under hypoxic conditions. To the best of our knowledge, it is the first study that has been conducted on hypoxia signaling pathway regulation by lncRNAs in L. crocea and elucidates the role played by lncRNAs in the regulation of the hypoxia stress response in teleost fish.

De novo disruption of promoter and exon 1 of STAR gene reveals essential role for gonadal development

PubMed Central

Piya, Anil; Kaur, Jasmeet; Rice, Alan M

2017-01-01

Summary Cholesterol transport into the mitochondria is required for synthesis of the first steroid, pregnenolone. Cholesterol is transported by the steroidogenic acute regulatory protein (STAR), which acts at the outer mitochondrial membrane prior to its import. Mutations in the STAR protein result in lipoid congenital adrenal hyperplasia (CAH). Although the STAR protein consists of seven exons, biochemical analysis in nonsteroidogenic COS-1 cells showed that the first two were not essential for pregnenolone synthesis. Here, we present a patient with ambiguous genitalia, salt-lossing crisis within two weeks after birth and low cortisol levels. Sequence analysis of the STAR, including the exon–intron boundaries, showed the complete deletion of exon 1 as well as more than 50 nucleotides upstream of STAR promoter. Mitochondrial protein import with the translated protein through synthesis cassette of the mutant STAR lacking exon 1 showed protein translation, but it is less likely to have synthesized without a promoter in our patient. Thus, a full-length STAR gene is necessary for physiological mitochondrial cholesterol transport in vivo. Learning points: STAR exon 1 deletion caused lipoid CAH. Exon 1 substitution does not affect biochemical activity. StAR promoter is responsible for gonadal development. PMID:28458886

[The ENCODE project and functional genomics studies].

PubMed

Ding, Nan; Qu, Hongzhu; Fang, Xiangdong

2014-03-01

Upon the completion of the Human Genome Project, scientists have been trying to interpret the underlying genomic code for human biology. Since 2003, National Human Genome Research Institute (NHGRI) has invested nearly $0.3 billion and gathered over 440 scientists from more than 32 institutions in the United States, China, United Kingdom, Japan, Spain and Singapore to initiate the Encyclopedia of DNA Elements (ENCODE) project, aiming to identify and analyze all regulatory elements in the human genome. Taking advantage of the development of next-generation sequencing technologies and continuous improvement of experimental methods, ENCODE had made remarkable achievements: identified methylation and histone modification of DNA sequences and their regulatory effects on gene expression through altering chromatin structures, categorized binding sites of various transcription factors and constructed their regulatory networks, further revised and updated database for pseudogenes and non-coding RNA, and identified SNPs in regulatory sequences associated with diseases. These findings help to comprehensively understand information embedded in gene and genome sequences, the function of regulatory elements as well as the molecular mechanism underlying the transcriptional regulation by noncoding regions, and provide extensive data resource for life sciences, particularly for translational medicine. We re-viewed the contributions of high-throughput sequencing platform development and bioinformatical technology improve-ment to the ENCODE project, the association between epigenetics studies and the ENCODE project, and the major achievement of the ENCODE project. We also provided our prospective on the role of the ENCODE project in promoting the development of basic and clinical medicine.

Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhattacharya, Monolekha; Das, Amit Kumar, E-mail: amitk@hijli.iitkgp.ernet.in

Highlights: Black-Right-Pointing-Pointer The regulatory sequences recognized by TcrX have been identified. Black-Right-Pointing-Pointer The regulatory region comprises of inverted repeats segregated by 30 bp region. Black-Right-Pointing-Pointer The mode of binding of TcrX with regulatory sequence is unique. Black-Right-Pointing-Pointer In silico TcrX-DNA docked model binds one of the inverted repeats. Black-Right-Pointing-Pointer Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has notmore » been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by {approx}30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.« less

Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

2010-10-15

Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

King, David A.

Oak Ridge Associated Universities (ORAU), under the Oak Ridge Institute for Science and Education (ORISE) contract, collected split surface water samples with Nuclear Fuel Services (NFS) representatives on August 21, 2013. Representatives from the U.S. Nuclear Regulatory Commission (NRC) and the Tennessee Department of Environment and Conservation were also in attendance. Samples were collected at four surface water stations, as required in the approved Request for Technical Assistance number 11-018. These stations included Nolichucky River upstream (NRU), Nolichucky River downstream (NRD), Martin Creek upstream (MCU), and Martin Creek downstream (MCD). Both ORAU and NFS performed gross alpha and gross betamore » analyses, and the comparison of results using the duplicate error ratio (DER), also known as the normalized absolute difference, are tabulated. All DER values were less than 3 and results are consistent with low (e.g., background) concentrations.« less

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

Parallel evolution of chordate cis-regulatory code for development.

PubMed

Doglio, Laura; Goode, Debbie K; Pelleri, Maria C; Pauls, Stefan; Frabetti, Flavia; Shimeld, Sebastian M; Vavouri, Tanya; Elgar, Greg

2013-11-01

Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs) are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

In Silico Detection of Sequence Variations Modifying Transcriptional Regulation

PubMed Central

Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob

2008-01-01

Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319

Dual Transcriptomic Profiling of Host and Microbiota during Health and Disease in Pediatric Asthma.

PubMed

Pérez-Losada, Marcos; Castro-Nallar, Eduardo; Bendall, Matthew L; Freishtat, Robert J; Crandall, Keith A

2015-01-01

High-throughput sequencing (HTS) analysis of microbial communities from the respiratory airways has heavily relied on the 16S rRNA gene. Given the intrinsic limitations of this approach, airway microbiome research has focused on assessing bacterial composition during health and disease, and its variation in relation to clinical and environmental factors, or other microbiomes. Consequently, very little effort has been dedicated to describing the functional characteristics of the airway microbiota and even less to explore the microbe-host interactions. Here we present a simultaneous assessment of microbiome and host functional diversity and host-microbe interactions from the same RNA-seq experiment, while accounting for variation in clinical metadata. Transcriptomic (host) and metatranscriptomic (microbiota) sequences from the nasal epithelium of 8 asthmatics and 6 healthy controls were separated in silico and mapped to available human and NCBI-NR protein reference databases. Human genes differentially expressed in asthmatics and controls were then used to infer upstream regulators involved in immune and inflammatory responses. Concomitantly, microbial genes were mapped to metabolic databases (COG, SEED, and KEGG) to infer microbial functions differentially expressed in asthmatics and controls. Finally, multivariate analysis was applied to find associations between microbiome characteristics and host upstream regulators while accounting for clinical variation. Our study showed significant differences in the metabolism of microbiomes from asthmatic and non-asthmatic children for up to 25% of the functional properties tested. Enrichment analysis of 499 differentially expressed host genes for inflammatory and immune responses revealed 43 upstream regulators differentially activated in asthma. Microbial adhesion (virulence) and Proteobacteria abundance were significantly associated with variation in the expression of the upstream regulator IL1A; suggesting that microbiome characteristics modulate host inflammatory and immune systems during asthma.

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

PubMed Central

KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

2017-01-01

Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames.

PubMed Central

Hall, R L; Moyer, R W

1991-01-01

Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

PubMed Central

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-01-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome. PMID:20392818

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

PubMed

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-08-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

Cis-regulatory landscapes of four cell types of the retina.

PubMed

Hartl, Dominik; Krebs, Arnaud R; Jüttner, Josephine; Roska, Botond; Schübeler, Dirk

2017-11-16

The retina is composed of ∼50 cell-types with specific functions for the process of vision. Identification of the cis-regulatory elements active in retinal cell-types is key to elucidate the networks controlling this diversity. Here, we combined transcriptome and epigenome profiling to map the regulatory landscape of four cell-types isolated from mouse retinas including rod and cone photoreceptors as well as rare inter-neuron populations such as horizontal and starburst amacrine cells. Integration of this information reveals sequence determinants and candidate transcription factors for controlling cellular specialization. Additionally, we refined parallel reporter assays to enable studying the transcriptional activity of large collection of sequences in individual cell-types isolated from a tissue. We provide proof of concept for this approach and its scalability by characterizing the transcriptional capacity of several hundred putative regulatory sequences within individual retinal cell-types. This generates a catalogue of cis-regulatory regions active in retinal cell types and we further demonstrate their utility as potential resource for cellular tagging and manipulation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Functional conservation of a forebrain enhancer from the elephant shark (Callorhinchus milii ) in zebrafish and mice.

PubMed

MacDonald, Ryan B; Debiais-Thibaud, Mélanie; Martin, Kyle; Poitras, Luc; Tay, Boon-Hui; Venkatesh, Byrappa; Ekker, Marc

2010-05-26

The phylogenetic position of the elephant shark (Callorhinchus milii ) is particularly relevant to study the evolution of genes and gene regulation in vertebrates. Here we examine the evolution of Dlx homeobox gene regulation during vertebrate embryonic development with a particular focus on the forebrain. We first identified the elephant shark sequence orthologous to the URE2 cis -regulatory element of the mouse Dlx1/Dlx2 locus (herein named CmURE2). We then conducted a comparative study of the sequence and enhancer activity of CmURE2 with that of orthologous regulatory sequences from zebrafish and mouse. The CmURE2 sequence shows a high percentage of identity with its mouse and zebrafish counterparts but is overall more similar to mouse URE2 (MmURE2) than to zebrafish URE2 (DrURE2). In transgenic zebrafish and mouse embryos, CmURE2 displayed enhancer activity in the forebrain that overlapped with that of DrURE2 and MmURE2. However, we detected notable differences in the activity of the three sequences in the diencephalon. Outside of the forebrain, CmURE2 shows enhancer activity in areas such as the pharyngeal arches and dorsal root ganglia where its' counterparts are also active. Our transgenic assays show that part of the URE2 enhancer activity is conserved throughout jawed vertebrates but also that new characteristics have evolved in the different groups. Our study demonstrates that the elephant shark is a useful outgroup to study the evolution of regulatory mechanisms in vertebrates and to address how changes in the sequence of cis -regulatory elements translate into changes in their regulatory activity.

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

PubMed Central

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-01-01

Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

PubMed

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-04-28

In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

Comparative analysis of gene regulatory networks: from network reconstruction to evolution.

PubMed

Thompson, Dawn; Regev, Aviv; Roy, Sushmita

2015-01-01

Regulation of gene expression is central to many biological processes. Although reconstruction of regulatory circuits from genomic data alone is therefore desirable, this remains a major computational challenge. Comparative approaches that examine the conservation and divergence of circuits and their components across strains and species can help reconstruct circuits as well as provide insights into the evolution of gene regulatory processes and their adaptive contribution. In recent years, advances in genomic and computational tools have led to a wealth of methods for such analysis at the sequence, expression, pathway, module, and entire network level. Here, we review computational methods developed to study transcriptional regulatory networks using comparative genomics, from sequence to functional data. We highlight how these methods use evolutionary conservation and divergence to reliably detect regulatory components as well as estimate the extent and rate of divergence. Finally, we discuss the promise and open challenges in linking regulatory divergence to phenotypic divergence and adaptation.

Chromatin Accessibility Mapping Identifies Mediators of Basal Transcription and Retinoid-Induced Repression of OTX2 in Medulloblastoma

PubMed Central

Zhang, Monica; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Furey, Terrence S.; Crawford, Gregory E.; Yan, Hai; He, Yiping

2014-01-01

Despite an emerging understanding of the genetic alterations giving rise to various tumors, the mechanisms whereby most oncogenes are overexpressed remain unclear. Here we have utilized an integrated approach of genomewide regulatory element mapping via DNase-seq followed by conventional reporter assays and transcription factor binding site discovery to characterize the transcriptional regulation of the medulloblastoma oncogene Orthodenticle Homeobox 2 (OTX2). Through these studies we have revealed that OTX2 is differentially regulated in medulloblastoma at the level of chromatin accessibility, which is in part mediated by DNA methylation. In cell lines exhibiting chromatin accessibility of OTX2 regulatory regions, we found that autoregulation maintains OTX2 expression. Comparison of medulloblastoma regulatory elements with those of the developing brain reveals that these tumors engage a developmental regulatory program to drive OTX2 transcription. Finally, we have identified a transcriptional regulatory element mediating retinoid-induced OTX2 repression in these tumors. This work characterizes for the first time the mechanisms of OTX2 overexpression in medulloblastoma. Furthermore, this study establishes proof of principle for applying ENCODE datasets towards the characterization of upstream trans-acting factors mediating expression of individual genes. PMID:25198066

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

PubMed Central

Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko

2015-01-01

Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

Expansin polynucleotides, related polypeptides and methods of use

DOEpatents

Cosgrove, Daniel J.; Wu, Yajun

2006-02-21

The present invention relates to beta expansin polypeptides, nucleotide sequences encoding the same and regulatory elements and their use in altering cell wall structure in plants. Nucleic acid constructs comprising a beta expansin sequence operably linked to a promoter, or other regulatory sequence are disclosed as well as vectors, plant cells, plants, and transformed seeds containing such constructs are provided. Methods for the use of such constructs in repressing or inducing expression of a beta expansin sequences in a plant are also provided as well as methods for harvesting transgenic expansin proteins. In addition, methods are provided for inhibiting or improving cell wall structure in plants by repression or induction of expansin sequences in plants.

In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

PubMed

Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

2018-01-01

DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

Evaluating brief motivational and self-regulatory hand hygiene interventions: a cross-over longitudinal design.

PubMed

Lhakhang, Pempa; Lippke, Sonia; Knoll, Nina; Schwarzer, Ralf

2015-02-04

Frequent handwashing can prevent infections, but non-compliance to hand hygiene is pervasive. Few theory- and evidence-based interventions to improve regular handwashing are available. Therefore, two intervention modules, a motivational and a self-regulatory one, were designed and evaluated. In a longitudinal study, 205 young adults, aged 18 to 26 years, were randomized into two intervention groups. The Mot-SelfR group received first a motivational intervention (Mot; risk perception and outcome expectancies) followed by a self-regulatory intervention (SelfR; perceived self-efficacy and planning) 17 days later. The SelfR-Mot group received the same two intervention modules in the opposite order. Follow-up data were assessed 17 and 34 days after the baseline. Both intervention sequences led to an increase in handwashing frequency, intention, self-efficacy, and planning. Also, overall gains were found for the self-regulatory module (increased planning and self-efficacy levels) and the motivational module (intention). Within groups, the self-regulatory module appeared to be more effective than the motivational module, independent of sequence. Self-regulatory interventions can help individuals to exhibit more handwashing. Sequencing may be important as a motivation module (Mot) first helps to set the goal and a self-regulatory module (SelfR) then helps to translate this goal into actual behavior, but further research is needed to evaluate mechanisms.