Sample records for upstream start codons

  1. Two alternative ways of start site selection in human norovirus reinitiation of translation.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2014-04-25

    The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

  2. New Universal Rules of Eukaryotic Translation Initiation Fidelity

    PubMed Central

    Zur, Hadas; Tuller, Tamir

    2013-01-01

    The accepted model of eukaryotic translation initiation begins with the scanning of the transcript by the pre-initiation complex from the 5′end until an ATG codon with a specific nucleotide (nt) context surrounding it is recognized (Kozak rule). According to this model, ATG codons upstream to the beginning of the ORF should affect translation. We perform for the first time, a genome-wide statistical analysis, uncovering a new, more comprehensive and quantitative, set of initiation rules for improving the cost of translation and its efficiency. Analyzing dozens of eukaryotic genomes, we find that in all frames there is a universal trend of selection for low numbers of ATG codons; specifically, 16–27 codons upstream, but also 5–11 codons downstream of the START ATG, include less ATG codons than expected. We further suggest that there is selection for anti optimal ATG contexts in the vicinity of the START ATG. Thus, the efficiency and fidelity of translation initiation is encoded in the 5′UTR as required by the scanning model, but also at the beginning of the ORF. The observed nt patterns suggest that in all the analyzed organisms the pre-initiation complex often misses the START ATG of the ORF, and may start translation from an alternative initiation start-site. Thus, to prevent the translation of undesired proteins, there is selection for nucleotide sequences with low affinity to the pre-initiation complex near the beginning of the ORF. With the new suggested rules we were able to obtain a twice higher correlation with ribosomal density and protein levels in comparison to the Kozak rule alone (e.g. for protein levels r = 0.7 vs. r = 0.31; p<10−12). PMID:23874179

  3. High-level tetracycline resistance mediated by efflux pumps Tet(A) and Tet(A)-1 with two start codons.

    PubMed

    Wang, Weixia; Guo, Qinglan; Xu, Xiaogang; Sheng, Zi-ke; Ye, Xinyu; Wang, Minggui

    2014-11-01

    Efflux is the most common mechanism of tetracycline resistance. Class A tetracycline efflux pumps, which often have high prevalence in Enterobacteriaceae, are encoded by tet(A) and tet(A)-1 genes. These genes have two potential start codons, GTG and ATG, located upstream of the genes. The purpose of this study was to determine the start codon(s) of the class A tetracycline resistance (tet) determinants tet(A) and tet(A)-1, and the tetracycline resistance level they mediated. Conjugation, transformation and cloning experiments were performed and the genetic environment of tet(A)-1 was analysed. The start codons in class A tet determinants were investigated by site-directed mutagenesis of ATG and GTG, the putative translation initiation codons. High-level tetracycline resistance was transferred from the clinical strain of Klebsiella pneumoniae 10-148 containing tet(A)-1 plasmid pHS27 to Escherichia coli J53 by conjugation. The transformants harbouring recombinant plasmids that carried tet(A) or tet(A)-1 exhibited tetracycline MICs of 256-512 µg ml(-1), with or without tetR(A). Once the ATG was mutated to a non-start codon, the tetracycline MICs were not changed, while the tetracycline MICs decreased from 512 to 64 µg ml(-1) following GTG mutation, and to ≤4 µg ml(-1) following mutation of both GTG and ATG. It was presumed that class A tet determinants had two start codons, which are the primary start codon GTG and secondary start codon ATG. Accordingly, two putative promoters were predicted. In conclusion, class A tet determinants can confer high-level tetracycline resistance and have two start codons. © 2014 The Authors.

  4. uORFs with unusual translational start codons autoregulate expression of eukaryotic ornithine decarboxylase homologs

    PubMed Central

    Ivanov, Ivaylo P.; Loughran, Gary; Atkins, John F.

    2008-01-01

    In a minority of eukaryotic mRNAs, a small functional upstream ORF (uORF), often performing a regulatory role, precedes the translation start site for the main product(s). Here, conserved uORFs in numerous ornithine decarboxylase homologs are identified from yeast to mammals. Most have noncanonical evolutionarily conserved start codons, the main one being AUU, which has not been known as an initiator for eukaryotic chromosomal genes. The AUG-less uORF present in mouse antizyme inhibitor, one of the ornithine decarboxylase homologs in mammals, mediates polyamine-induced repression of the downstream main ORF. This repression is part of an autoregulatory circuit, and one of its sensors is the AUU codon, which suggests that translation initiation codon identity is likely used for regulation in eukaryotes. PMID:18626014

  5. Co-expression of the Thermotoga neapolitana aglB gene with an upstream 3'-coding fragment of the malG gene improves enzymatic characteristics of recombinant AglB cyclomaltodextrinase.

    PubMed

    Lunina, Natalia A; Agafonova, Elena V; Chekanovskaya, Lyudmila A; Dvortsov, Igor A; Berezina, Oksana V; Shedova, Ekaterina N; Kostrov, Sergey V; Velikodvorskaya, Galina A

    2007-07-01

    A cluster of Thermotoga neapolitana genes participating in starch degradation includes the malG gene of sugar transport protein and the aglB gene of cyclomaltodextrinase. The start and stop codons of these genes share a common overlapping sequence, aTGAtg. Here, we compared properties of expression products of three different constructs with aglB from T. neapolitana. The first expression vector contained the aglB gene linked to an upstream 90-bp 3'-terminal region of the malG gene with the stop codon overlapping with the start codon of aglB. The second construct included the isolated coding sequence of aglB with two tandem potential start codons. The expression product of this construct in Escherichia coli had two tandem Met residues at its N terminus and was characterized by low thermostability and high tendency to aggregate. In contrast, co-expression of aglB and the 3'-terminal region of malG (the first construct) resulted in AglB with only one N-terminal Met residue and a much higher specific activity of cyclomaltodextrinase. Moreover, the enzyme expressed by such a construct was more thermostable and less prone to aggregation. The third construct was the same as the second one except that it contained only one ATG start codon. The product of its expression had kinetic and other properties similar to those of the enzyme with only one N-terminal Met residue.

  6. Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

    PubMed

    Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

    2018-04-01

    In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Translation of the first upstream ORF in the hepatitis B virus pregenomic RNA modulates translation at the core and polymerase initiation codons

    PubMed Central

    Chen, Augustine; Kao, Y. F.; Brown, Chris M.

    2005-01-01

    The human hepatitis B virus (HBV) has a compact genome encoding four major overlapping coding regions: the core, polymerase, surface and X. The polymerase initiation codon is preceded by the partially overlapping core and four or more upstream initiation codons. There is evidence that several mechanisms are used to enable the synthesis of the polymerase protein, including leaky scanning and ribosome reinitiation. We have examined the first AUG in the pregenomic RNA, it precedes that of the core. It initiates an uncharacterized short upstream open reading frame (uORF), highly conserved in all HBV subtypes, we designated the C0 ORF. This arrangement suggested that expression of the core and polymerase may be affected by this uORF. Initiation at the C0 ORF was confirmed in reporter constructs in transfected cells. The C0 ORF had an inhibitory role in downstream expression from the core initiation site in HepG2 cells and in vitro, but also stimulated reinitiation at the polymerase start when in an optimal context. Our results indicate that the C0 ORF is a determinant in balancing the synthesis of the core and polymerase proteins. PMID:15731337

  8. Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

    PubMed

    Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

    2008-06-01

    The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

  9. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  10. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

    PubMed Central

    Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

    1982-01-01

    The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

  11. Negative and Translation Termination-Dependent Positive Control of FLI-1 Protein Synthesis by Conserved Overlapping 5′ Upstream Open Reading Frames in Fli-1 mRNA

    PubMed Central

    Sarrazin, Sandrine; Starck, Joëlle; Gonnet, Colette; Doubeikovski, Alexandre; Melet, Fabrice; Morle, François

    2000-01-01

    The proto-oncogene Fli-1 encodes a transcription factor of the ets family whose overexpression is associated with multiple virally induced leukemias in mouse, inhibits murine and avian erythroid cell differentiation, and induces drastic perturbations of early development in Xenopus. This study demonstrates the surprisingly sophisticated regulation of Fli-1 mRNA translation. We establish that two FLI-1 protein isoforms (of 51 and 48 kDa) detected by Western blotting in vivo are synthesized by alternative translation initiation through the use of two highly conserved in-frame initiation codons, AUG +1 and AUG +100. Furthermore, we show that the synthesis of these two FLI-1 isoforms is regulated by two short overlapping 5′ upstream open reading frames (uORF) beginning at two highly conserved upstream initiation codons, AUG −41 and GUG −37, and terminating at two highly conserved stop codons, UGA +35 and UAA +15. The mutational analysis of these two 5′ uORF revealed that each of them negatively regulates FLI-1 protein synthesis by precluding cap-dependent scanning to the 48- and 51-kDa AUG codons. Simultaneously, the translation termination of the two 5′ uORF appears to enhance 48-kDa protein synthesis, by allowing downstream reinitiation at the 48-kDa AUG codon, and 51-kDa protein synthesis, by allowing scanning ribosomes to pile up and consequently allowing upstream initiation at the 51-kDa AUG codon. To our knowledge, this is the first example of a cellular mRNA displaying overlapping 5′ uORF whose translation termination appears to be involved in the positive control of translation initiation at both downstream and upstream initiation codons. PMID:10757781

  12. A Non-Canonical Initiation Site Is Required for Efficient Translation of the Dendritically Localized Shank1 mRNA

    PubMed Central

    Studtmann, Katrin; Ölschläger-Schütt, Janin; Buck, Friedrich; Richter, Dietmar; Sala, Carlo; Bockmann, Jürgen; Kindler, Stefan; Kreienkamp, Hans-Jürgen

    2014-01-01

    Local protein synthesis in dendrites enables neurons to selectively change the protein complement of individual postsynaptic sites. Though it is generally assumed that this mechanism requires tight translational control of dendritically transported mRNAs, it is unclear how translation of dendritic mRNAs is regulated. We have analyzed here translational control elements of the dendritically localized mRNA coding for the postsynaptic scaffold protein Shank1. In its 5′ region, the human Shank1 mRNA exhibits two alternative translation initiation sites (AUG+1 and AUG+214), three canonical upstream open reading frames (uORFs1-3) and a high GC content. In reporter assays, fragments of the 5′UTR with high GC content inhibit translation, suggesting a contribution of secondary structures. uORF3 is most relevant to translation control as it overlaps with the first in frame start codon (AUG+1), directing translation initiation to the second in frame start codon (AUG+214). Surprisingly, our analysis points to an additional uORF initiated at a non-canonical ACG start codon. Mutation of this start site leads to an almost complete loss of translation initiation at AUG+1, demonstrating that this unconventional uORF is required for Shank1 synthesis. Our data identify a novel mechanism whereby initiation at a non-canonical site allows for translation of the main Shank1 ORF despite a highly structured 5′UTR. PMID:24533096

  13. A transducer for microbial sensory rhodopsin that adopts GTG as a start codon is identified in Haloarcula marismortui.

    PubMed

    Fu, Hsu-Yuan; Lu, Yen-Hsu; Yi, Hsiu-Ping; Yang, Chii-Shen

    2013-04-05

    Microbial sensory rhodopsins are known to mediate phototaxis, and all of the known sensory rhodopsins execute this function with a specific cognate transducer that has two-transmembrane (2-TM) regions. In the genome of Haloarcula marismortui, a total of six rhodopsin genes were annotated, and we previously showed three of them to be the ion type and suggested the other three as sensory type, even though the candidate transducer gene, htr, for HmSRI was missing the 2-TM region that is found in all of the other known transducers. Here we showed this htr gene featured a preceding 2-TM region when the alternative start codon GTG located 291 nucleotides upstream of the original annotated open reading frame (ORF) was introduced and it is named as htrI in this study. Overexpression of HmHtrI exhibited it existed as a membrane protein and several biophysical assays confirmed it functionally interacted with HmSRI. Together with our previous reverse-transcriptase-PCR results and phototaxis measurements, the new ORF of original predicted soluble htr gene product was a membrane protein with a 2-TM region, HmHtrI; and it serves as the cognate transducer for HmSRI. HmHtrI therefore is the first transducer for the sensory rhodopsin adopted start codon other than ATG. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

    PubMed

    Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

    2013-06-21

    Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

  15. Systematic screening for mutations in the human serotonin 1F receptor gene in patients with bipolar affective disorder and schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shimron-Abarbanell, D.; Harms, H.; Erdmann, J.

    1996-04-09

    Using single strand conformational analysis we screened the complete coding sequence of the serotonin 1F (5-HT{sub 1F}) receptor gene for the presence of DNA sequence variation in a sample of 137 unrelated individuals including 45 schizophrenic patients, 46 bipolar patients, as well as 46 healthy controls. We detected only three rare sequence variants which are characterized by single base pair substitutions, namely a silent T{r_arrow}A transversion in the third position of codon 261 (encoding isoleucine), a silent C{r_arrow}T transition in the third position of codon 176 (encoding histidine), and a C{r_arrow}T transition in position -78 upstream from the start codon.more » The lack of significant mutations in patients suffering from schizophrenia and bipolar affective disorder indicates that the 5-HT{sub 1F} receptor is not commonly involved in the etiology of these diseases. 12 refs., 1 fig., 2 tabs.« less

  16. The Effect of an Alternate Start Codon on Heterologous Expression of a PhoA Fusion Protein in Mycoplasma gallisepticum

    PubMed Central

    Panicker, Indu S.; Browning, Glenn F.; Markham, Philip F.

    2015-01-01

    While the genomes of many Mycoplasma species have been sequenced, there are no collated data on translational start codon usage, and the effects of alternate start codons on gene expression have not been studied. Analysis of the annotated genomes found that ATG was the most prevalent translational start codon among Mycoplasma spp. However in Mycoplasma gallisepticum a GTG start codon is commonly used in the vlhA multigene family, which encodes a highly abundant, phase variable lipoprotein adhesin. Therefore, the effect of this alternate start codon on expression of a reporter PhoA lipoprotein was examined in M. gallisepticum. Mutation of the start codon from ATG to GTG resulted in a 2.5 fold reduction in the level of transcription of the phoA reporter, but the level of PhoA activity in the transformants containing phoA with a GTG start codon was only 63% of that of the transformants with a phoA with an ATG start codon, suggesting that GTG was a more efficient translational initiation codon. The effect of swapping the translational start codon in phoA reporter gene expression was less in M. gallisepticum than has been seen previously in Escherichia coli or Bacillus subtilis, suggesting the process of translational initiation in mycoplasmas may have some significant differences from those used in other bacteria. This is the first study of translational start codon usage in mycoplasmas and the impact of the use of an alternate start codon on expression in these bacteria. PMID:26010086

  17. The helicase Ded1p controls use of near-cognate translation initiation codons in 5' UTRs.

    PubMed

    Guenther, Ulf-Peter; Weinberg, David E; Zubradt, Meghan M; Tedeschi, Frank A; Stawicki, Brittany N; Zagore, Leah L; Brar, Gloria A; Licatalosi, Donny D; Bartel, David P; Weissman, Jonathan S; Jankowsky, Eckhard

    2018-06-27

    The conserved and essential DEAD-box RNA helicase Ded1p from yeast and its mammalian orthologue DDX3 are critical for the initiation of translation 1 . Mutations in DDX3 are linked to tumorigenesis 2-4 and intellectual disability 5 , and the enzyme is targeted by a range of viruses 6 . How Ded1p and its orthologues engage RNAs during the initiation of translation is unknown. Here we show, by integrating transcriptome-wide analyses of translation, RNA structure and Ded1p-RNA binding, that the effects of Ded1p on the initiation of translation are connected to near-cognate initiation codons in 5' untranslated regions. Ded1p associates with the translation pre-initiation complex at the mRNA entry channel and repressing the activity of Ded1p leads to the accumulation of RNA structure in 5' untranslated regions, the initiation of translation from near-cognate start codons immediately upstream of these structures and decreased protein synthesis from the corresponding main open reading frames. The data reveal a program for the regulation of translation that links Ded1p, the activation of near-cognate start codons and mRNA structure. This program has a role in meiosis, in which a marked decrease in the levels of Ded1p is accompanied by the activation of the alternative translation initiation sites that are seen when the activity of Ded1p is repressed. Our observations indicate that Ded1p affects translation initiation by controlling the use of near-cognate initiation codons that are proximal to mRNA structure in 5' untranslated regions.

  18. Leaderless mRNAs are circularized in Chlamydomonas reinhardtii mitochondria.

    PubMed

    Cahoon, A Bruce; Qureshi, Ali A

    2018-06-01

    The mitochondrial genome of Chlamydomonas reinhardtii encodes eight protein coding genes transcribed on two polycistronic primary transcripts. The mRNAs are endonucleolytically cleaved from these transcripts directly upstream of their AUG start codons, creating leaderless mRNAs with 3' untranslated regions (UTR) comprised of most or all of their downstream intergenic regions. In this report, we provide evidence that these processed linear mRNAs are circularized, which places the 3' UTR upstream of the 5' start codon, creating a leader sequence ex post facto. The circular mRNAs were found to be ribosome associate by polysome profiling experiments suggesting they are translated. Sequencing of the 3'-5' junctions of the circularized mRNAs found the intra-molecular ligations occurred between fully processed 5' ends (the start AUG) and a variable 3' terminus. For five genes (cob, cox, nd2, nd4, and nd6), some of the 3' ends maintained an oligonucleotide addition during ligation, and for two of them, cob and nd6, these 3' termini were the most commonly recovered sequence. Previous reports have shown that after cleavage, three untemplated oligonucleotide additions may occur on the 3' termini of these mRNAs-adenylation, uridylylation, or cytidylation. These results suggest oligo(U) and oligo(C) additions may be part of the maturation process since they are maintained in the circular mRNAs. Circular RNAs occur in organisms across the biological spectrum, but their purpose in some systems, such as organelles (mitochondria and chloroplasts) is unclear. We hypothesize, that in C. reinhardtii mitochondria it may create a leader sequence to facilitate translation initiation, which may negate the need for an alternative translation initiation mechanism in this system, as previously speculated. In addition, circularization may play a protective role against exonucleases, and/or increase translational productivity.

  19. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  20. Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

    PubMed

    Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

    2012-07-01

    The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

    PubMed

    Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

    2013-10-01

    Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

  2. Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

    PubMed Central

    Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

    1994-01-01

    Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

  3. Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Machlin, S.M.; Hanson, R.S.

    The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

  4. The complete mitogenome sequence of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae).

    PubMed

    Kim, Seong Ryeol; Kim, Man Il; Hong, Mee Yeon; Kim, Kee Young; Kang, Pil Don; Hwang, Jae Sam; Han, Yeon Soo; Jin, Byung Rae; Kim, Iksoo

    2009-09-01

    The 15,338-bp long complete mitochondrial genome (mitogenome) of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae) was determined. This genome has a gene arrangement identical to those of all other sequenced lepidopteran insects, but differs from the most common type, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA(Ile). No typical start codon of the A. yamamai COI gene is available. Instead, a tetranucleotide, TTAG, which is found at the beginning context of all sequenced lepidopteran insects was tentatively designated as the start codon for A. yamamai COI gene. Three of the 13 protein-coding genes (PCGs) harbor the incomplete termination codon, T or TA. All tRNAs formed stable stem-and-loop structures, with the exception of tRNA(Ser)(AGN), the DHU arm of which formed a simple loop as has been observed in many other metazoan mt tRNA(Ser)(AGN). The 334-bp long A + T-rich region is noteworthy in that it harbors tRNA-like structures, as has also been seen in the A + T-rich regions of other insect mitogenomes. Phylogenetic analyses of the available species of Bombycoidea, Pyraloidea, and Tortricidea bolstered the current morphology-based hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As has been previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (A. yamamai and Caligula boisduvalii) formed a reciprocal monophyletic group.

  5. An MSC2 Promoter-lacZ Fusion Gene Reveals Zinc-Responsive Changes in Sites of Transcription Initiation That Occur across the Yeast Genome

    PubMed Central

    Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.

    2016-01-01

    The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924

  6. Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

    PubMed

    Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

    1999-10-28

    We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.

  7. The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

    PubMed Central

    Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

    2014-01-01

    The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

  8. The Enterococcus faecalis EbpA Pilus Protein: Attenuation of Expression, Biofilm Formation, and Adherence to Fibrinogen Start with the Rare Initiation Codon ATT

    PubMed Central

    Montealegre, Maria Camila; La Rosa, Sabina Leanti; Roh, Jung Hyeob; Harvey, Barrett R.

    2015-01-01

    ABSTRACT The endocarditis and biofilm-associated pili (Ebp) are important in Enterococcus faecalis pathogenesis, and the pilus tip, EbpA, has been shown to play a major role in pilus biogenesis, biofilm formation, and experimental infections. Based on in silico analyses, we previously predicted that ATT is the EbpA translational start codon, not the ATG codon, 120 bp downstream of ATT, which is annotated as the translational start. ATT is rarely used to initiate protein synthesis, leading to our hypothesis that this codon participates in translational regulation of Ebp production. To investigate this possibility, site-directed mutagenesis was used to introduce consecutive stop codons in place of two lysines at positions 5 and 6 from the ATT, to replace the ATT codon in situ with ATG, and then to revert this ATG to ATT; translational fusions of ebpA to lacZ were also constructed to investigate the effect of these start codons on translation. Our results showed that the annotated ATG does not start translation of EbpA, implicating ATT as the start codon; moreover, the presence of ATT, compared to the engineered ATG, resulted in significantly decreased EbpA surface display, attenuated biofilm, and reduced adherence to fibrinogen. Corroborating these findings, the translational fusion with the native ATT as the initiation codon showed significantly decreased expression of β-galactosidase compared to the construct with ATG in place of ATT. Thus, these results demonstrate that the rare initiation codon of EbpA negatively regulates EbpA surface display and negatively affects Ebp-associated functions, including biofilm and adherence to fibrinogen. PMID:26015496

  9. Efficient initiation of mammalian mRNA translation at a CUG codon.

    PubMed Central

    Dasso, M C; Jackson, R J

    1989-01-01

    Nucleotide substitutions were made at the initiation codon of an influenza virus NS cDNA clone in a vector carrying the bacteriophage T7 promoter. When capped mRNA transcripts of these constructs were translated in the rabbit reticulocyte lysate, a change in the initiation codon from...AUAAUGG...to...AUACUGG...reduced the in vitro translational efficiency by only 50-60%, and resulted in only a small increase in the yield of short products presumed to be initiated at downstream sites. Synthesis of the full-length product was initiated exclusively at the mutated codon, with negligible use either of in-frame upstream CUG or GUG codons, or of an in-frame downstream GUG codon. We conclude that CUG has the potential to function as an efficient initiation codon in mammalian systems, at least in certain contexts. Images PMID:2780285

  10. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

    PubMed

    Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

    1991-09-15

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

  11. Conserved small mRNA with an unique, extended Shine-Dalgarno sequence

    PubMed Central

    Hahn, Julia; Migur, Anzhela; von Boeselager, Raphael Freiherr; Kubatova, Nina; Kubareva, Elena; Schwalbe, Harald

    2017-01-01

    ABSTRACT Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3′-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of α-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level. PMID:27834614

  12. Regulation of translation by upstream translation initiation codons of surfactant protein A1 splice variants

    PubMed Central

    Tsotakos, Nikolaos; Silveyra, Patricia; Lin, Zhenwu; Thomas, Neal; Vaid, Mudit

    2014-01-01

    Surfactant protein A (SP-A), a molecule with roles in lung innate immunity and surfactant-related functions, is encoded by two genes in humans: SFTPA1 (SP-A1) and SFTPA2 (SP-A2). The mRNAs from these genes differ in their 5′-untranslated regions (5′-UTR) due to differential splicing. The 5′-UTR variant ACD′ is exclusively found in transcripts of SP-A1, but not in those of SP-A2. Its unique exon C contains two upstream AUG codons (uAUGs) that may affect SP-A1 translation efficiency. The first uAUG (u1) is in frame with the primary start codon (p), but the second one (u2) is not. The purpose of this study was to assess the impact of uAUGs on SP-A1 expression. We employed RT-qPCR to determine the presence of exon C-containing SP-A1 transcripts in human RNA samples. We also used in vitro techniques including mutagenesis, reporter assays, and toeprinting analysis, as well as in silico analyses to determine the role of uAUGs. Exon C-containing mRNA is present in most human lung tissue samples and its expression can, under certain conditions, be regulated by factors such as dexamethasone or endotoxin. Mutating uAUGs resulted in increased luciferase activity. The mature protein size was not affected by the uAUGs, as shown by a combination of toeprint and in silico analysis for Kozak sequence, secondary structure, and signal peptide and in vitro translation in the presence of microsomes. In conclusion, alternative splicing may introduce uAUGs in SP-A1 transcripts, which in turn negatively affect SP-A1 translation, possibly affecting SP-A1/SP-A2 ratio, with potential for clinical implication. PMID:25326576

  13. Positive and negative feedback regulatory loops of thiol-oxidative stress response mediated by an unstable isoform of sigmaR in actinomycetes.

    PubMed

    Kim, Min-Sik; Hahn, Mi-Young; Cho, Yoobok; Cho, Sang-Nae; Roe, Jung-Hye

    2009-09-01

    Alternate sigma factors provide an effective way of diversifying bacterial gene expression in response to environmental changes. In Streptomyces coelicolor where more than 65 sigma factors are predicted, sigma(R) is the major regulator for response to thiol-oxidative stresses. sigma(R) becomes available when its bound anti-sigma factor RsrA is oxidized at sensitive cysteine thiols to form disulphide bonds. sigma(R) regulon includes genes for itself and multiple thiol-reducing systems, which constitute positive and negative feedback loops respectively. We found that the positive amplification loop involves an isoform of sigma(R) (sigma(R')) with an N-terminal extension of 55 amino acids, produced from an upstream start codon. A major difference between constitutive sigma(R) and inducible sigma(R') is that the latter is markedly unstable (t(1/2) approximately 10 min) compared with the former (> 70 min). The rapid turnover of sigma(R') is partly due to induced ClpP1/P2 proteases from the sigma(R) regulon. This represents a novel way of elaborating positive and negative feedback loops in a control circuit. Similar phenomenon may occur in other actinomycetes that harbour multiple start codons in the sigR homologous gene. We observed that sigH gene, the sigR orthologue in Mycobacterium smegmatis, produces an unstable larger isoform of sigma(H) upon induction by thiol-oxidative stress.

  14. 5’-Terminal AUGs in Escherichia coli mRNAs with Shine-Dalgarno Sequences: Identification and Analysis of Their Roles in Non-Canonical Translation Initiation

    PubMed Central

    Beck, Heather J.; Fleming, Ian M. C.

    2016-01-01

    Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758

  15. Compound heterozygous deletions in pseudoautosomal region 1 in an infant with mild manifestations of langer mesomelic dysplasia.

    PubMed

    Tsuchiya, Takayoshi; Shibata, Minoru; Numabe, Hironao; Jinno, Tomoko; Nakabayashi, Kazuhiko; Nishimura, Gen; Nagai, Toshiro; Ogata, Tsutomu; Fukami, Maki

    2014-02-01

    Haploinsufficiency of SHOX on the short arm pseudoautosomal region (PAR1) leads to Leri-Weill dyschondrosteosis (LWD), and nullizygosity of SHOX results in Langer mesomelic dysplasia (LMD). Molecular defects of LWD/LMD include various microdeletions in PAR1 that involve exons and/or the putative upstream or downstream enhancer regions of SHOX, as well as several intragenic mutations. Here, we report on a Japanese male infant with mild manifestations of LMD and hitherto unreported microdeletions in PAR1. Clinical analysis revealed mesomelic short stature with various radiological findings indicative of LMD. Molecular analyses identified compound heterozygous deletions, that is, a maternally inherited ∼46 kb deletion involving the upstream region and exons 1-5 of SHOX, and a paternally inherited ∼500 kb deletion started from a position ∼300 kb downstream from SHOX. In silico analysis revealed that the downstream deletion did not affect the known putative enhancer regions of SHOX, although it encompassed several non-coding elements which were well conserved among various species with SHOX orthologs. These results provide the possibility of the presence of a novel enhancer for SHOX in the genomic region ∼300 to ∼800 kb downstream of the start codon. © 2013 Wiley Periodicals, Inc.

  16. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  17. Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

    PubMed

    Lin, Min; Dan, Hanhong; Li, Yijing

    2004-02-01

    Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

  18. Complete mitochondrial genome of Palawan peacock-pheasant Polyplectron napoleonis (Galliformes, Phasianidae).

    PubMed

    Quach, Tommy; Brooks, Daniel M; Miranda, Hector C

    2016-01-01

    The complete mitochondrial genome of the Palawan peacock-pheasant Polyplectron napoleonis is 16,710 bp and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a control-region. All protein-coding genes use the standard ATG start codon, except for cox1 which has GTG start codon. Seven out of 13 PCGs have TAA stop codons, two have AGG (cox1 and nd6), and three PCGs (nd2, cox2 and nd4) have incomplete stop codon of just T- - nucleotide.

  19. Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

    PubMed

    DeVry, C G; Tsai, W; Clarke, S

    1996-11-15

    The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

  20. Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

    PubMed Central

    Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

    2012-01-01

    NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

  1. Problem-Solving Test: The Effect of Synonymous Codons on Gene Expression

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: the genetic code, codon, degenerate codons, protein synthesis, aminoacyl-tRNA, anticodon, antiparallel orientation, wobble, unambiguous codons, ribosomes, initiation, elongation and termination of translation, peptidyl transferase, translocation, degenerate oligonucleotides, green…

  2. Reduce Manual Curation by Combining Gene Predictions from Multiple Annotation Engines, a Case Study of Start Codon Prediction

    PubMed Central

    Ederveen, Thomas H. A.; Overmars, Lex; van Hijum, Sacha A. F. T.

    2013-01-01

    Nowadays, prokaryotic genomes are sequenced faster than the capacity to manually curate gene annotations. Automated genome annotation engines provide users a straight-forward and complete solution for predicting ORF coordinates and function. For many labs, the use of AGEs is therefore essential to decrease the time necessary for annotating a given prokaryotic genome. However, it is not uncommon for AGEs to provide different and sometimes conflicting predictions. Combining multiple AGEs might allow for more accurate predictions. Here we analyzed the ab initio open reading frame (ORF) calling performance of different AGEs based on curated genome annotations of eight strains from different bacterial species with GC% ranging from 35–52%. We present a case study which demonstrates a novel way of comparative genome annotation, using combinations of AGEs in a pre-defined order (or path) to predict ORF start codons. The order of AGE combinations is from high to low specificity, where the specificity is based on the eight genome annotations. For each AGE combination we are able to derive a so-called projected confidence value, which is the average specificity of ORF start codon prediction based on the eight genomes. The projected confidence enables estimating likeliness of a correct prediction for a particular ORF start codon by a particular AGE combination, pinpointing ORFs notoriously difficult to predict start codons. We correctly predict start codons for 90.5±4.8% of the genes in a genome (based on the eight genomes) with an accuracy of 81.1±7.6%. Our consensus-path methodology allows a marked improvement over majority voting (9.7±4.4%) and with an optimal path ORF start prediction sensitivity is gained while maintaining a high specificity. PMID:23675487

  3. Broad genomic and transcriptional analysis reveals a highly derived genome in dinoflagellate mitochondria

    PubMed Central

    Jackson, Christopher J; Norman, John E; Schnare, Murray N; Gray, Michael W; Keeling, Patrick J; Waller, Ross F

    2007-01-01

    Background Dinoflagellates comprise an ecologically significant and diverse eukaryotic phylum that is sister to the phylum containing apicomplexan endoparasites. The mitochondrial genome of apicomplexans is uniquely reduced in gene content and size, encoding only three proteins and two ribosomal RNAs (rRNAs) within a highly compacted 6 kb DNA. Dinoflagellate mitochondrial genomes have been comparatively poorly studied: limited available data suggest some similarities with apicomplexan mitochondrial genomes but an even more radical type of genomic organization. Here, we investigate structure, content and expression of dinoflagellate mitochondrial genomes. Results From two dinoflagellates, Crypthecodinium cohnii and Karlodinium micrum, we generated over 42 kb of mitochondrial genomic data that indicate a reduced gene content paralleling that of mitochondrial genomes in apicomplexans, i.e., only three protein-encoding genes and at least eight conserved components of the highly fragmented large and small subunit rRNAs. Unlike in apicomplexans, dinoflagellate mitochondrial genes occur in multiple copies, often as gene fragments, and in numerous genomic contexts. Analysis of cDNAs suggests several novel aspects of dinoflagellate mitochondrial gene expression. Polycistronic transcripts were found, standard start codons are absent, and oligoadenylation occurs upstream of stop codons, resulting in the absence of termination codons. Transcripts of at least one gene, cox3, are apparently trans-spliced to generate full-length mRNAs. RNA substitutional editing, a process previously identified for mRNAs in dinoflagellate mitochondria, is also implicated in rRNA expression. Conclusion The dinoflagellate mitochondrial genome shares the same gene complement and fragmentation of rRNA genes with its apicomplexan counterpart. However, it also exhibits several unique characteristics. Most notable are the expansion of gene copy numbers and their arrangements within the genome, RNA editing, loss of stop codons, and use of trans-splicing. PMID:17897476

  4. Cation-induced transcriptional regulation of the dlt operon of Staphylococcus aureus.

    PubMed

    Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P

    2006-05-01

    Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with D-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. D-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating D-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na(+) and moderate concentrations of Mg(2+) and Ca(2+) but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg(2+)-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg(2+)-induced repression of the dlt operon in S. aureus.

  5. Cation-Induced Transcriptional Regulation of the dlt Operon of Staphylococcus aureus

    PubMed Central

    Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P.

    2006-01-01

    Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with d-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. d-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating d-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na+ and moderate concentrations of Mg2+ and Ca2+ but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg2+-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg2+-induced repression of the dlt operon in S. aureus. PMID:16672616

  6. Complete mitochondrial genome of Chocolate Pansy, Junonia iphita (Lepidoptera: Nymphalidae: Nymphalinae).

    PubMed

    Vanlalruati, Catherine; Mandal, Surajit De; Gurusubramanian, Guruswami; Senthil Kumar, Nachimuthu

    2016-07-01

    The complete mitochondrial genome of Junonia iphita was determined to be 15,433 bp in length, including 37 typical mitochondrial genes and an AT-rich region. All the protein coding genes (PCGs) are initiated by typical ATN codons, except cox1 gene that is by CGA codon. Eight genes use complete termination codon (TAA), whereas the cox1, cox2 and nad5 genes end with single T; nad4 and nad1 ends with stop codon TA. All the tRNA show secondary cloverleaf structures except trnS1 (AGN). The A + T rich region is 546 bp in length containing ATAGA motif followed by a 18 bp poly-T stretch, two microsatellite-like (TA)9 elements and 8 bp poly-A stretch immediately upstream of trnM gene.

  7. Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

    PubMed Central

    Pi, J; Wookey, P J; Pittard, A J

    1991-01-01

    The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

  8. Bm65 is essential for the propagation of Bombyx mori nucleopolyhedrovirus.

    PubMed

    Tang, Qi; Li, Guohui; Yao, Qin; Chen, Liang; Feng, Fan; Yuan, Yi; Chen, Keping

    2013-01-01

    Orf65 (Bm65) of Bombyx mori nucleopolyhedrovirus (BmNPV) is a highly conserved gene that encodes an unknown 104-amino acid protein. In the present study, we have shown the role of Bm65 in the baculovirus life cycle. 5'-RACE analysis showed that the transcription start site of Bm65 was 14 nucleotides upstream of the start codon ATG. The transcription profile of Bm65 was detected from 6 to 72 h postinfection (p. i.) by RT-PCR. A Bm65-knockout bacmid was constructed by homologous recombination to characterize the role of Bm65 in viral life cycle. Fluorescence microscopy showed that Bm65-knockout virus was unable to generate infectious budded virus in BmN cells. Furthermore, quantitative real-time PCR analysis demonstrated that Bm65 deletion did not affect the viral DNA replication. To conclude, Bm65 is essential for the propagation of BmNPV, but is unnecessary for the replication of viral DNA.

  9. Translation initiation at an upstream CUG codon regulates the expression of Hibiscus chlorotic ringspot virus coat protein.

    PubMed

    Koh, Dora Chin-Yen; Wang, Xiaoxing; Wong, Sek-Man; Liu, D X

    2006-12-01

    Viruses depend heavily on host cells for replication and exploit the host translation machinery for its gene expression using various unorthodox translation mechanisms. According to the conventional scanning model, only the 5'-proximal gene in the viral RNA is accessible to the ribosomes whereas other genes are silent. In this study, we use a model plant RNA virus, Hibiscus chlorotic ringspot virus (HCRSV), to investigate various translation mechanisms involved in regulation of the expression of internal genes. The 3'-end 1.2kb region of HCRSV genomic and subgenomic RNAs were shown to encode four polypeptides of 38, 27, 25 and 22.5kDa. Mutagenesis studies revealed that a CUG codon ((2570)CUG) is the initiation codon for p27, the longest of the three co-C-terminal products (p27, p25 and p22.5), and translation of p25 and p22.5 was initiated at (2603)AUG and (2666)AUG, respectively. Translation initiation of the p27 expression at the (2570)CUG codon regulates the expression of p38, the viral coat protein through a leaky scanning mechanism and mutational analysis of an upstream open reading frame (ORF) demonstrated that initiation of the p27 expression at this CUG codon (instead of an AUG) may play a role in maintaining the ratio of p27 and p38. In addition, a previously identified internal ribosome entry site was shown to control the expression of p27 and p38 in the subgenomic RNA 2.

  10. Regulation of the sol Locus Genes for Butanol and Acetone Formation in Clostridium acetobutylicum ATCC 824 by a Putative Transcriptional Repressor

    PubMed Central

    Nair, Ramesh V.; Green, Edward M.; Watson, David E.; Bennett, George N.; Papoutsakis, Eleftherios T.

    1999-01-01

    A gene (orf1, now designated solR) previously identified upstream of the aldehyde/alcohol dehydrogenase gene aad (R. V. Nair, G. N. Bennett, and E. T. Papoutsakis, J. Bacteriol. 176:871–885, 1994) was found to encode a repressor of the sol locus (aad, ctfA, ctfB and adc) genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824. Primer extension analysis identified a transcriptional start site 35 bp upstream of the solR start codon. Amino acid comparisons of SolR identified a potential helix-turn-helix DNA-binding motif in the C-terminal half towards the center of the protein, suggesting a regulatory role. Overexpression of SolR in strain ATCC 824(pCO1) resulted in a solvent-negative phenotype owing to its deleterious effect on the transcription of the sol locus genes. Inactivation of solR in C. acetobutylicum via homologous recombination yielded mutants B and H (ATCC 824 solR::pO1X) which exhibited deregulated solvent production characterized by increased flux towards butanol and acetone formation, earlier induction of aad, lower overall acid production, markedly improved yields of solvents on glucose, a prolonged solvent production phase, and increased biomass accumulation compared to those of the wild-type strain. PMID:9864345

  11. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    PubMed

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  12. Upstream open reading frames regulate the expression of the nuclear Wnt13 isoforms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang Tao; Rector, Kyle; Barnett, Corey D.

    2008-02-22

    Wnt proteins control cell survival and cell fate during development. Although Wnt expression is tightly regulated in a spatio-temporal manner, the mechanisms involved both at the transcriptional and translational levels are poorly defined. We have identified a downstream translation initiation codon, AUG(+74), in Wnt13B and Wnt13C mRNAs responsible for the expression of Wnt13 nuclear forms. In this report, we demonstrate that the expression of the nuclear Wnt13C form is translationally regulated in response to stress and apoptosis. Though the 5'-leaders of both Wnt13C and Wnt13B mRNAs have an inhibitory effect on translation, they did not display an internal ribosome entrymore » site activity as demonstrated by dicistronic reporter assays. However, mutations or deletions of the upstream AUG(-99) and AUG(+1) initiation codons abrogate these translation inhibitory effects, demonstrating that Wnt13C expression is controlled by upstream open reading frames. Since long 5'-untranslated region with short upstream open reading frames characterize other Wnt transcripts, our present data on the translational control of Wnt13 expression open the way to further studies on the translation control of Wnt expression as a modulator of their subcellular localization and activity.« less

  13. Non-AUG translation: a new start for protein synthesis in eukaryotes

    PubMed Central

    Kearse, Michael G.; Wilusz, Jeremy E.

    2017-01-01

    Although it was long thought that eukaryotic translation almost always initiates at an AUG start codon, recent advancements in ribosome footprint mapping have revealed that non-AUG start codons are used at an astonishing frequency. These non-AUG initiation events are not simply errors but instead are used to generate or regulate proteins with key cellular functions; for example, during development or stress. Misregulation of non-AUG initiation events contributes to multiple human diseases, including cancer and neurodegeneration, and modulation of non-AUG usage may represent a novel therapeutic strategy. It is thus becoming increasingly clear that start codon selection is regulated by many trans-acting initiation factors as well as sequence/structural elements within messenger RNAs and that non-AUG translation has a profound impact on cellular states. PMID:28982758

  14. Translation of vph mRNA in Streptomyces lividans and Escherichia coli after removal of the 5' untranslated leader.

    PubMed

    Wu, C J; Janssen, G R

    1996-10-01

    The Streptomyces vinaceus viomycin phosphotransferase (vph) mRNA contains an untranslated leader with a conventional Shine-Dalgarno homology. The vph leader was removed by ligation of the vph coding sequence to the transcriptional start site of a Streptomyces or an Escherichia coli promoter, such that transcription would initiate at the first position of the vph start codon. Analysis of mRNA demonstrated that transcription initiated primarily at the A of the vph AUG translational start codon in both Streptomyces lividans and E. coli; cells expressing the unleadered vph mRNA were resistant to viomycin indicating that the Shine-Dalgarno sequence, or other features contained within the leader, was not necessary for vph translation. Addition of four nucleotides (5'-AUGC-3') onto the 5' end of the unleadered vph mRNA resulted in translation initiation from the vph start codon and the AUG triplet contained within the added sequence. Translational fusions of vph sequence to a Tn5 neo reporter gene indicated that the first 16 codons of vph coding sequence were sufficient to specify the translational start site and reading frame for expression of neomycin resistance in both E. coli and S. lividans.

  15. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    PubMed

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  16. Mutagenesis of the three bases preceding the start codon of the beta-galactosidase mRNA and its effect on translation in Escherichia coli.

    PubMed Central

    Hui, A; Hayflick, J; Dinkelspiel, K; de Boer, H A

    1984-01-01

    The effect on the translation efficiency of various mutations in the three bases (the -1 triplet) that precede the AUG start codon of the beta-galactosidase mRNA in Escherichia coli was studied. Of the 39 mutants examined, the level of expression varies over a 20-fold range. The most favorable combinations of bases in the -1 triplet are UAU and CUU. The expression levels in the mutants with UUC, UCA or AGG as the -1 triplet are 20-fold lower than those with UAU or CUU. In general, a U residue immediately preceding the start codon is more favorable for expression than any other base; furthermore, an A residue at the -2 position enhances the translation efficiency in most instances. In both cases, however, the degree of enhancement depends on its context, i.e. the neighboring bases. Although the rules derived from this study are complex, the results show that mutations in any of the three bases preceding the start codon can strongly affect the translational efficiency of the beta-galactosidase mRNA. PMID:6425057

  17. Translation, modification and cellular distribution of two AC4 variants of African cassava mosaic virus in yeast and their pathogenic potential in plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hipp, Katharina, E-mail: katharina.hipp@bio.uni-st

    Plant infecting geminiviruses encode a small (A)C4 protein within the open reading frame of the replication-initiator protein. In African cassava mosaic virus, two in-frame start codons may be used for the translation of a longer and a shorter AC4 variant. Both were fused to green fluorescent protein or glutathione-S-transferase genes and expressed in fission yeast. The longer variant accumulated in discrete spots in the cytoplasm, whereas the shorter variant localized to the plasma membrane. A similar expression pattern was found in plants. A myristoylation motif may promote a targeting of the shorter variant to the plasma membrane. Mass spectrometry analysismore » of the yeast-expressed shorter variant detected the corresponding myristoylation. The biological relevance of the second start codon was confirmed using mutated infectious clones. Whereas mutating the first start codon had no effect on the infectivity in Nicotiana benthamiana plants, the second start codon proved to be essential. -- Highlights: •The ACMV AC4 may be translated from one or the other in-frame start codon. •Both AC4 variants are translated in fission yeast. •The long AC4 protein localizes to the cytoplasm, the short to the plasma membrane. •The short variant is myristoylated in yeast and may promote membrane localization. •Only the shorter AC4 variant has an impact on viral infections in plants.« less

  18. Molecular identification and transcriptional regulation of porcine IFIT2 gene.

    PubMed

    Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

    2018-04-06

    IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

  19. Isolation and characterization of a novel pollen-specific promoter in maize (Zea mays L.).

    PubMed

    Wang, He; Fan, Mingxia; Wang, Guohong; Zhang, Chunyu; Shi, Lei; Wei, Zhengyi; Ma, Wenjuan; Chang, Jing; Huang, Senxin; Lin, Feng

    2017-06-01

    ZmSTK2_USP, located on the long arm of chromosome 4, belongs to the serine/threonine kinase gene in maize. The sequence analysis of 2100 bp upstream from the start codon ATG has shown that it contains cis-element motifs and two types of anther/pollen-specific promoter elements (GTGA and AGAAA), suggesting that it is the pollen-specific promoter. To investigate the function of ZmSTK2_USP promoter, the GUS gene fusion system was employed. In proZmSTK2_USP-GUS genetically modified plants, GUS activity was detected in mature pollen grains and pollen tubes but not found in other floral and vegetative tissues. These results show that proZmSTK2_USP is the pollen-specific promoter and drives pollen-specific activity during the middle stage of pollen development until pollen maturation.

  20. Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

    PubMed Central

    Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

    2006-01-01

    The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

  1. Identification of Bombyx mori bidensovirus VD1-ORF4 reveals a novel protein associated with viral structural component.

    PubMed

    Li, Guohui; Hu, Zhaoyang; Guo, Xuli; Li, Guangtian; Tang, Qi; Wang, Peng; Chen, Keping; Yao, Qin

    2013-06-01

    Bombyx mori bidensovirus (BmBDV) VD1-ORF4 (open reading frame 4, ORF4) consists of 3,318 nucleotides, which codes for a predicted 1,105-amino acid protein containing a conserved DNA polymerase motif. However, its functions in viral propagation remain unknown. In the current study, the transcription of VD1-ORF4 was examined from 6 to 96 h postinfection (p.i.) by RT-PCR, 5'-RACE revealed the transcription initiation site of BmBDV ORF4 to be -16 nucleotides upstream from the start codon, and 3'-RACE revealed the transcription termination site of VD1-ORF4 to be +7 nucleotides downstream from termination codon. Three different proteins were examined in the extracts of BmBDV-infected silkworms midguts by Western blot using raised antibodies against VD1-ORF4 deduced amino acid, and a specific protein band about 53 kDa was further detected in purified virions using the same antibodies. Taken together, BmBDV VD1-ORF4 codes for three or more proteins during the viral life cycle, one of which is a 53 kDa protein and confirmed to be a component of BmBDV virion.

  2. Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

    PubMed Central

    KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

    2017-01-01

    Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

  3. The CUG-initiated larger form coat protein of Chinese wheat mosaic virus binds to the cysteine-rich RNA silencing suppressor.

    PubMed

    Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Ratti, Claudio; Chen, Jianping

    2013-10-01

    Some viruses use alternative translation initiation at non-AUG codons as a strategy to produce multiple proteins during gene expression. Here we show that, using this strategy, Chinese wheat mosaic virus (CWMV; Furovirus) expresses a larger form of coat protein (N-ext/CP) in infected plants. Site-directed mutagenesis and transient expression analysis confirmed that CWMV N-ext/CP is initiated at an upstream in-frame CUG codon at nucleotide position 207-209 of RNA 2, which adds a 39 amino acid (aa) N-terminal extension to the major CP. Interestingly, in planta and in vitro analyses indicated that CWMV N-ext/CP but not CP interacts with the CWMV cysteine-rich protein (CRP), an RNA silencing suppressor. We further determined that the N-terminal 39 aa extension, particularly the 10 aa region immediately upstream of the major CP coding region is responsible for the interaction of N-ext/CP with CRP. In an Agrobacterium co-infiltration assay, co-expression with N-ext/CP did not affect CRP silencing suppression activity. Thus the alternative translation initiation at a CUG codon provides the CWMV N-ext/CP with the ability to bind to the viral silencing suppressor. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. The effector gene xopAE of Xanthomonas euvesicatoria 85-10 is part of an operon and encodes an E3 ubiquitin ligase.

    PubMed

    Popov, Georgy; Majhi, Bharat Bhusan; Sessa, Guido

    2018-05-21

    The type III effector XopAE from the Xanthomonas euvesicatoria strain 85-10 ( Xe 85-10) was previously shown to inhibit plant immunity and enhance pathogen-induced disease symptoms. Evolutionary analysis of 60 xopAE alleles ( AEal ) revealed that the xopAE locus is conserved in multiple Xanthomonas species. The majority of xopAE alleles (55 out of 60) encodes a single ORF ( xopAE ), while in 5 alleles, including AEal 37 of the Xe 85-10 strain, a frame-shift splits the locus into two ORFs ( hpaF and a truncated xopAE ). To test whether the second ORF of AEal 37 ( xopAE 85-10 ) is translated, we examined expression of YFP fused downstream to truncated or mutant forms of the locus in Xanthomonas bacteria. YFP fluorescence was detected at maximal levels when the reporter was in proximity of an internal ribosome-binding site upstream to a rare ATT start codon in the xopAE 85-10 ORF, but severely reduced when these elements were abolished. In agreement with the notion that xopAE 85- 10 is a functional gene, its protein product was translocated into plant cells by the type III secretion system and translocation was dependent on its upstream ORF hpaF. Homology modeling predicted that XopAE 85-10 contains an E3 ligase XL-box domain at the C-terminus, and in vitro assays demonstrated that this domain displays mono-ubiquitination activity. Remarkably, the XL-box was essential for XopAE 85-10 to inhibit PAMP-induced gene expression in Arabidopsis protoplasts. Together, these results indicate that the xopAE 85-10 gene resides in a functional operon, which utilizes the alternative start codon ATT, and encodes a novel XL-box E3 ligase. Importance Xanthomonas bacteria utilize a type III secretion system to cause disease in many crops. This study provides insights into evolution, translocation and biochemical function of the XopAE type III secreted effector contributing to the understanding of Xanthomonas-host interactions. We establish XopAE as core effector of seven Xanthomonas species and elucidate evolution of the Xanthomonas euvesicatoria xopAE locus, which contains an operon encoding a truncated effector. Our findings indicate that this operon evolved from the split of a multi-domains gene into two ORFs that conserved the original domain function. Analysis of xopAE 85-10 translation provides the first evidence for translation initiation from an ATT codon in Xanthomonas Our data demonstrate that XopAE 85-10 is an XL-box E3 ubiquitin ligase and provide insights into structure and function of this effector family. Copyright © 2018 American Society for Microbiology.

  5. eIF1 Loop 2 interactions with Met-tRNAi control the accuracy of start codon selection by the scanning preinitiation complex.

    PubMed

    Thakur, Anil; Hinnebusch, Alan G

    2018-05-01

    The eukaryotic 43S preinitiation complex (PIC), bearing initiator methionyl transfer RNA (Met-tRNA i ) in a ternary complex (TC) with eukaryotic initiation factor 2 (eIF2)-GTP, scans the mRNA leader for an AUG codon in favorable context. AUG recognition evokes rearrangement from an open PIC conformation with TC in a "P OUT " state to a closed conformation with TC more tightly bound in a "P IN " state. eIF1 binds to the 40S subunit and exerts a dual role of enhancing TC binding to the open PIC conformation while antagonizing the P IN state, necessitating eIF1 dissociation for start codon selection. Structures of reconstituted PICs reveal juxtaposition of eIF1 Loop 2 with the Met-tRNA i D loop in the P IN state and predict a distortion of Loop 2 from its conformation in the open complex to avoid a clash with Met-tRNA i We show that Ala substitutions in Loop 2 increase initiation at both near-cognate UUG codons and AUG codons in poor context. Consistently, the D71A-M74A double substitution stabilizes TC binding to 48S PICs reconstituted with mRNA harboring a UUG start codon, without affecting eIF1 affinity for 40S subunits. Relatively stronger effects were conferred by arginine substitutions; and no Loop 2 substitutions perturbed the rate of TC loading on scanning 40S subunits in vivo. Thus, Loop 2-D loop interactions specifically impede Met-tRNA i accommodation in the P IN state without influencing the P OUT mode of TC binding; and Arg substitutions convert the Loop 2-tRNA i clash to an electrostatic attraction that stabilizes P IN and enhances selection of poor start codons in vivo.

  6. Selective forces and mutational biases drive stop codon usage in the human genome: a comparison with sense codon usage.

    PubMed

    Trotta, Edoardo

    2016-05-17

    The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.

  7. Complete mitochondrial genome of the Yellownose skate: Zearaja chilensis (Rajiformes, Rajidae).

    PubMed

    Jeong, Dageum; Lee, Youn-Ho

    2016-01-01

    The complete sequence of mitochondrial DNA of a Yellownose skate, Zearaja chilensis was determined for the first time. It is 16,909 bp in length covering 2 rRNA, 22 tRNA and 13 protein coding genes with the identical gene order and structure as those of other Rajidae species. The nucleotide of L-strand is composed of low G (14.3%), and slightly high A + T (58.9%) nucleotides. The strong codon usage bias against the use of G (6.0%) is found at the third codon positions. Twelve of the 13 protein coding genes use ATG as the start codon while COX1 starts with GTG. As for the stop codon, only ND4 shows an incomplete stop codon TA. This is the first report of the mitogenome for a species in the genus Zearaja, providing a valuable source of genetic information on the evolution of the family Rajidae and the genus Zearaja as well as for establishment of a sustainble fishery management plan of the species.

  8. Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans

    PubMed Central

    Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W.; Grubert, Fabian; Candille, Sophie I.; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L.; Tang, Hua; Ricci, Emiliano; Snyder, Michael P.

    2015-01-01

    Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy—many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. PMID:26297486

  9. Engineering an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium/Rhodotorula species.

    PubMed

    Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui

    2015-10-26

    Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null mutant makes an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium and Rhodotorula genera. The system will be a valuable tool for metabolic engineering and enzyme expression in these yeast hosts.

  10. CCC CGA is a weak translational recoding site in Escherichia coli.

    PubMed

    Shu, Ping; Dai, Huacheng; Mandecki, Wlodek; Goldman, Emanuel

    2004-12-08

    Previously published experiments had indicated unexpected expression of a control vector in which a beta-galactosidase reporter was in the +1 reading frame relative to the translation start. This control vector contained the codon pair CCC CGA in the zero reading frame, raising the possibility that ribosomes rephased on this sequence, with peptidyl-tRNA(Pro) pairing with CCC in the +1 frame. This putative rephasing might also be exacerbated by the rare CGA Arg codon in the second position due to increased vacancy of the ribosomal A-site. To test this hypothesis, a series of site-directed mutants was constructed, including mutations in both the first and second codons of this codon pair. The results show that interrupting the continuous run of C residues with synonymous codon changes essentially abolishes the frameshift. Further, changing the rare Arg codon to a common Arg codon also reduces the frequency of the frameshift. These results provide strong support for the hypothesis that CCC CGA in the zero frame is indeed a weak translational frameshift site in Escherichia coli, with a 1-2% efficiency. Because the vector sequence also contains another CCC triplet in the +1 reading frame starting within the next codon after the CGA, our data also support possible contribution to expression of a +7 nucleotide ribosome hop into the same +1 reading frame. We also confirm here a previous report that CCC UGA is a translational frameshift site, in these experiments, with about 5% efficiency.

  11. Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

    PubMed Central

    Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

    2012-01-01

    Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

  12. The membrane-tethered transcription factor ANAC089 serves as redox-dependent suppressor of stromal ascorbate peroxidase gene expression

    PubMed Central

    Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef

    2012-01-01

    The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559

  13. Translational Control of the SigR-Directed Oxidative Stress Response in Streptomyces via IF3-Mediated Repression of a Noncanonical GTC Start Codon

    PubMed Central

    Feeney, Morgan A.; Chandra, Govind; Findlay, Kim C.; Paget, Mark S. B.

    2017-01-01

    ABSTRACT The major oxidative stress response in Streptomyces is controlled by the sigma factor SigR and its cognate antisigma factor RsrA, and SigR activity is tightly controlled through multiple mechanisms at both the transcriptional and posttranslational levels. Here we show that sigR has a highly unusual GTC start codon and that this leads to another level of SigR regulation, in which SigR translation is repressed by translation initiation factor 3 (IF3). Changing the GTC to a canonical start codon causes SigR to be overproduced relative to RsrA, resulting in unregulated and constitutive expression of the SigR regulon. Similarly, introducing IF3* mutations that impair its ability to repress SigR translation has the same effect. Thus, the noncanonical GTC sigR start codon and its repression by IF3 are critical for the correct and proper functioning of the oxidative stress regulatory system. sigR and rsrA are cotranscribed and translationally coupled, and it had therefore been assumed that SigR and RsrA are produced in stoichiometric amounts. Here we show that RsrA can be transcribed and translated independently of SigR, present evidence that RsrA is normally produced in excess of SigR, and describe the factors that determine SigR-RsrA stoichiometry. PMID:28611250

  14. The Andes hantavirus NSs protein is expressed from the viral small mRNA by a leaky scanning mechanism.

    PubMed

    Vera-Otarola, Jorge; Solis, Loretto; Soto-Rifo, Ricardo; Ricci, Emiliano P; Pino, Karla; Tischler, Nicole D; Ohlmann, Théophile; Darlix, Jean-Luc; López-Lastra, Marcelo

    2012-02-01

    The small mRNA (SmRNA) of all Bunyaviridae encodes the nucleocapsid (N) protein. In 4 out of 5 genera in the Bunyaviridae, the smRNA encodes an additional nonstructural protein denominated NSs. In this study, we show that Andes hantavirus (ANDV) SmRNA encodes an NSs protein. Data show that the NSs protein is expressed in the context of an ANDV infection. Additionally, our results suggest that translation initiation from the NSs initiation codon is mediated by ribosomal subunits that have bypassed the upstream N protein initiation codon through a leaky scanning mechanism.

  15. The Andes Hantavirus NSs Protein Is Expressed from the Viral Small mRNA by a Leaky Scanning Mechanism

    PubMed Central

    Vera-Otarola, Jorge; Solis, Loretto; Soto-Rifo, Ricardo; Ricci, Emiliano P.; Pino, Karla; Tischler, Nicole D.; Ohlmann, Théophile; Darlix, Jean-Luc

    2012-01-01

    The small mRNA (SmRNA) of all Bunyaviridae encodes the nucleocapsid (N) protein. In 4 out of 5 genera in the Bunyaviridae, the smRNA encodes an additional nonstructural protein denominated NSs. In this study, we show that Andes hantavirus (ANDV) SmRNA encodes an NSs protein. Data show that the NSs protein is expressed in the context of an ANDV infection. Additionally, our results suggest that translation initiation from the NSs initiation codon is mediated by ribosomal subunits that have bypassed the upstream N protein initiation codon through a leaky scanning mechanism. PMID:22156529

  16. Oligo kernels for datamining on biological sequences: a case study on prokaryotic translation initiation sites

    PubMed Central

    Meinicke, Peter; Tech, Maike; Morgenstern, Burkhard; Merkl, Rainer

    2004-01-01

    Background Kernel-based learning algorithms are among the most advanced machine learning methods and have been successfully applied to a variety of sequence classification tasks within the field of bioinformatics. Conventional kernels utilized so far do not provide an easy interpretation of the learnt representations in terms of positional and compositional variability of the underlying biological signals. Results We propose a kernel-based approach to datamining on biological sequences. With our method it is possible to model and analyze positional variability of oligomers of any length in a natural way. On one hand this is achieved by mapping the sequences to an intuitive but high-dimensional feature space, well-suited for interpretation of the learnt models. On the other hand, by means of the kernel trick we can provide a general learning algorithm for that high-dimensional representation because all required statistics can be computed without performing an explicit feature space mapping of the sequences. By introducing a kernel parameter that controls the degree of position-dependency, our feature space representation can be tailored to the characteristics of the biological problem at hand. A regularized learning scheme enables application even to biological problems for which only small sets of example sequences are available. Our approach includes a visualization method for transparent representation of characteristic sequence features. Thereby importance of features can be measured in terms of discriminative strength with respect to classification of the underlying sequences. To demonstrate and validate our concept on a biochemically well-defined case, we analyze E. coli translation initiation sites in order to show that we can find biologically relevant signals. For that case, our results clearly show that the Shine-Dalgarno sequence is the most important signal upstream a start codon. The variability in position and composition we found for that signal is in accordance with previous biological knowledge. We also find evidence for signals downstream of the start codon, previously introduced as transcriptional enhancers. These signals are mainly characterized by occurrences of adenine in a region of about 4 nucleotides next to the start codon. Conclusions We showed that the oligo kernel can provide a valuable tool for the analysis of relevant signals in biological sequences. In the case of translation initiation sites we could clearly deduce the most discriminative motifs and their positional variation from example sequences. Attractive features of our approach are its flexibility with respect to oligomer length and position conservation. By means of these two parameters oligo kernels can easily be adapted to different biological problems. PMID:15511290

  17. The control of lambda DNA terminase synthesis.

    PubMed Central

    Murialdo, H; Davidson, A; Chow, S; Gold, M

    1987-01-01

    Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

  18. The complete mitochondrial genome of the Longnose skate: Raja rhina (Rajiformes, Rajidae).

    PubMed

    Jeong, Dageum; Lee, Youn-Ho

    2015-02-01

    The complete sequence of mitochondrial DNA of a longnose skate, Raja rhina was determined for the first time. It is 16,910 bp in length containing 2 rRNA, 22 tRNA and 13 protein coding genes with the same gene order and structure as those of other Rajidae species. The nucleotide of L-strand is composed of 30.1% A, 27.2% C, 28.5% T and 14.2% G, showing a slight A + T bias. The G is the least used base and markedly lower at the third codon position (5.4%). Twelve of the 13 protein coding genes use ATG as their start codon while the COX1 starts with GTG. As for stop codon, only ND4 shows incomplete stop codon TA. This mitogenome is the first report for a species of the genus Raja, and providing a valuable resource of genetic information for understanding the phylogenetic relationship and the evolution of the genus Raja as well as the family, Rajidae.

  19. PreTIS: A Tool to Predict Non-canonical 5’ UTR Translational Initiation Sites in Human and Mouse

    PubMed Central

    Reuter, Kerstin; Helms, Volkhard

    2016-01-01

    Translation of mRNA sequences into proteins typically starts at an AUG triplet. In rare cases, translation may also start at alternative non–AUG codons located in the annotated 5’ UTR which leads to an increased regulatory complexity. Since ribosome profiling detects translational start sites at the nucleotide level, the properties of these start sites can then be used for the statistical evaluation of functional open reading frames. We developed a linear regression approach to predict in–frame and out–of–frame translational start sites within the 5’ UTR from mRNA sequence information together with their translation initiation confidence. Predicted start codons comprise AUG as well as near–cognate codons. The underlying datasets are based on published translational start sites for human HEK293 and mouse embryonic stem cells that were derived by the original authors from ribosome profiling data. The average prediction accuracy of true vs. false start sites for HEK293 cells was 80%. When applied to mouse mRNA sequences, the same model predicted translation initiation sites observed in mouse ES cells with an accuracy of 76%. Moreover, we illustrate the effect of in silico mutations in the flanking sequence context of a start site on the predicted initiation confidence. Our new webservice PreTIS visualizes alternative start sites and their respective ORFs and predicts their ability to initiate translation. Solely, the mRNA sequence is required as input. PreTIS is accessible at http://service.bioinformatik.uni-saarland.de/pretis. PMID:27768687

  20. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    PubMed Central

    Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

    2007-01-01

    Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

  1. The complete mitochondrial genome of the longhorn beetle Xylotrechus grayii (Coleoptera: Cerambycidae).

    PubMed

    Guo, Kun; Chen, Jun; Xu, Chang-Qing; Qiao, Hai-Li; Xu, Rong; Zhao, Xiang-Jian

    2016-05-01

    We sequenced the complete mitochondrial genome of the longhorn beetle, Xylotrechus grayii. The total length of the X. grayii mitogenome was 15,540 bp with an A + T content of 75.29%, consisting of 13 protein-coding genes (PCGs), 22 tRNA genes, 2 rRNA genes and an A + T-rich region. All the genes were arranged in the same order as that of the ancestral insect. All PCGs started with a typical ATN codon except for cox1 and nad1, which used TTG as start codon. Ten out of 13 PCGs terminated with incomplete codons (TA or T). The A + T-rich region was 893 bp in length with an A + T content of 85.89 %.

  2. Minigene-like inhibition of protein synthesis mediated by hungry codons near the start codon

    PubMed Central

    Jacinto-Loeza, Eva; Vivanco-Domínguez, Serafín; Guarneros, Gabriel; Hernández-Sánchez, Javier

    2008-01-01

    Rare AGA or AGG codons close to the initiation codon inhibit protein synthesis by a tRNA-sequestering mechanism as toxic minigenes do. To further understand this mechanism, a parallel analysis of protein synthesis and peptidyl-tRNA accumulation was performed using both a set of lacZ constructs where AGAAGA codons were moved codon by codon from +2, +3 up to +7, +8 positions and a series of 3–8 codon minigenes containing AGAAGA codons before the stop codon. β-Galactosidase synthesis from the AGAAGA lacZ constructs (in a Pth defective in vitro system without exogenous tRNA) diminished as the AGAAGA codons were closer to AUG codon. Likewise, β-galactosidase expression from the reporter +7 AGA lacZ gene (plus tRNA, 0.25 μg/μl) waned as the AGAAGAUAA minigene shortened. Pth counteracted both the length-dependent minigene effect on the expression of β-galactosidase from the +7 AGA lacZ reporter gene and the positional effect from the AGAAGA lacZ constructs. The +2, +3 AGAAGA lacZ construct and the shortest +2, +3 AGAAGAUAA minigene accumulated the highest percentage of peptidyl-tRNAArg4. These observations lead us to propose that hungry codons at early positions, albeit with less strength, inhibit protein synthesis by a minigene-like mechanism involving accumulation of peptidyl-tRNA. PMID:18583364

  3. Tissue specific expression of the retinoic acid receptor-beta 2: regulation by short open reading frames in the 5'-noncoding region

    PubMed Central

    1994-01-01

    The 40-S subunit of eukaryotic ribosomes binds to the capped 5'-end of mRNA and scans for the first AUG in a favorable sequence context to initiate translation. Most eukaryotic mRNAs therefore have a short 5'- untranslated region (5'-UTR) and no AUGs upstream of the translational start site; features that seem to assure efficient translation. However, approximately 5-10% of all eukaryotic mRNAs, particularly those encoding for regulatory proteins, have complex leader sequences that seem to compromise translational initiation. The retinoic-acid- receptor-beta 2 (RAR beta 2) mRNA is such a transcript with a long (461 nucleotides) 5'-UTR that contains five, partially overlapping, upstream open reading frames (uORFs) that precede the major ORF. We have begun to investigate the function of this complex 5'-UTR in transgenic mice, by introducing mutations in the start/stop codons of the uORFs in RAR beta 2-lacZ reporter constructs. When we compared the expression patterns of mutant and wild-type constructs we found that these mutations affected expression of the downstream RAR beta 2-ORF, resulting in an altered regulation of RAR beta 2-lacZ expression in heart and brain. Other tissues were unaffected. RNA analysis of adult tissues demonstrated that the uORFs act at the level of translation; adult brains and hearts of transgenic mice carrying a construct with either the wild-type or a mutant UTR, had the same levels of mRNA, but only the mutant produced protein. Our study outlines an unexpected role for uORFs: control of tissue-specific and developmentally regulated gene expression. PMID:7962071

  4. The Oenococcus oeni clpX Homologue Is a Heat Shock Gene Preferentially Expressed in Exponential Growth Phase

    PubMed Central

    Jobin, Michel-Philippe; Garmyn, Dominique; Diviès, Charles; Guzzo, Jean

    1999-01-01

    Using degenerated primers from conserved regions of previously studied clpX gene products, we cloned the clpX gene of the malolactic bacterium Oenococcus oeni. The clpX gene was sequenced, and the deduced protein of 413 amino acids (predicted molecular mass of 45,650 Da) was highly similar to previously analyzed clpX gene products from other organisms. An open reading frame located upstream of the clpX gene was identified as the tig gene by similarity of its predicted product to other bacterial trigger factors. ClpX was purified by using a maltose binding protein fusion system and was shown to possess an ATPase activity. Northern analyses indicated the presence of two independent 1.6-kb monocistronic clpX and tig mRNAs and also showed an increase in clpX mRNA amount after a temperature shift from 30 to 42°C. The clpX transcript is abundant in the early exponential growth phase and progressively declines to undetectable levels in the stationary phase. Thus, unlike hsp18, the gene encoding one of the major small heat shock proteins of Oenococcus oeni, clpX expression is related to the exponential growth phase and requires de novo protein synthesis. Primer extension analysis identified the 5′ end of clpX mRNA which is located 408 nucleotides upstream of a putative AUA start codon. The putative transcription start site allowed identification of a predicted promoter sequence with a high similarity to the consensus sequence found in the housekeeping gene promoter of gram-positive bacteria as well as Escherichia coli. PMID:10542163

  5. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  6. Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans.

    PubMed

    Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W; Grubert, Fabian; Candille, Sophie I; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L; Tang, Hua; Ricci, Emiliano; Snyder, Michael P

    2015-11-01

    Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy--many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. © 2015 Cenik et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Genomic localization of the Z/EG transgene in the mouse genome.

    PubMed

    Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel

    2010-02-01

    The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.

  8. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    PubMed

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  9. Similarity of Escherichia coli propanediol oxidoreductase (fucO product) and an unusual alcohol dehydrogenase from Zymomonas mobilis and Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Conway, T.; Ingram, L.O.

    1989-07-01

    The gene that encodes 1,2-propanediol oxidoreductase (fucO) from Escherichia coli was sequenced. The reading frame specified a protein of 383 amino acids (including the N-terminal methionine), with an aggregate molecular weight of 40,642. The induction of fucO transcription, which occurred in the presence of fucose, was confirmed by Northern blot analysis. In E. coli, the primary fucO transcript was approximately 2.1 kilobases in length. The 5{prime} end of the transcript began more than 0.7 kilobase upstream of the fucO start codon within or beyond the fucA gene. Propanediol oxidoreductase exhibited 41.7% identity with the iron-containing alcohol dehydrogenase II from Zymomonasmore » mobilis and 39.5% identity with ADH4 from Saccharomyces cerevisiae. These three proteins did not share homology with either short-chain or long-chain zinc-containing alcohol dehydrogenase enzymes. We propose that these three unusual alcohol dehydrogenases define a new family of enzymes.« less

  10. Molecular Structure and Transformation of the Glucose Dehydrogenase Gene in Drosophila Melanogaster

    PubMed Central

    Whetten, R.; Organ, E.; Krasney, P.; Cox-Foster, D.; Cavener, D.

    1988-01-01

    We have precisely mapped and sequenced the three 5' exons of the Drosophila melanogaster Gld gene and have identified the start sites for transcription and translation. The first exon is composed of 335 nucleotides and does not contain any putative translation start codons. The second exon is separated from the first exon by 8 kb and contains the Gld translation start codon. The inferred amino acid sequence of the amino terminus contains two unusual features: three tandem repeats of serine-alanine, and a relatively high density of cysteine residues. P element-mediated transformation experiments demonstrated that a 17.5-kb genomic fragment contains the functional and regulatory components of the Gld gene. PMID:3143620

  11. DifA, a methyl-accepting chemoreceptor protein-like sensory protein, uses a novel signaling mechanism to regulate exopolysaccharide production in Myxococcus xanthus.

    PubMed

    Xu, Qian; Black, Wesley P; Nascimi, Heidi M; Yang, Zhaomin

    2011-02-01

    DifA is a methyl-accepting chemotaxis protein (MCP)-like sensory transducer that regulates exopolysaccharide (EPS) production in Myxococcus xanthus. Here mutational analysis and molecular biology were used to probe the signaling mechanisms of DifA in EPS regulation. We first identified the start codon of DifA experimentally; this identification extended the N terminus of DifA for 45 amino acids (aa) from the previous bioinformatics prediction. This extension helped to address the outstanding question of how DifA receives input signals from type 4 pili without a prominent periplasmic domain. The results suggest that DifA uses its N-terminus extension to sense an upstream signal in EPS regulation. We suggest that the perception of the input signal by DifA is mediated by protein-protein interactions with upstream components. Subsequent signal transmission likely involves transmembrane signaling instead of direct intramolecular interactions between the input and the output modules in the cytoplasm. The basic functional unit of DifA for signal transduction is likely dimeric as mutational alteration of the predicted dimeric interface of DifA significantly affected EPS production. Deletions of 14-aa segments in the C terminus suggest that the newly defined flexible bundle subdomain in MCPs is likely critical for DifA function because shortening of this bundle can lead to constitutively active mutations.

  12. The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).

    PubMed

    Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai

    2014-12-01

    The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.

  13. The complete mitochondrial genome of the Korean skate: Hongeo koreana (Rajiformes, Rajidae).

    PubMed

    Jeong, Dageum; Kim, Sung; Kim, Choong-Gon; Lee, Youn-Ho

    2014-12-01

    The complete mitochondrial genome of the Korean skate, Hongeo koreana, the sole member of its genus, is investigated for the first time. The genome consists of 16,906 bp in length including 2 rRNA, 22 tRNA and 13 protein coding genes with the same gene order and structure of the genome as those of other Rajidae species. The overall nucleotide composition of the L-strand is A = 29.8%, C = 27.9%, T = 27.9% and G = 14.3%, showing a high A + T bias. The anti-G bias (6.0%) is more significant in the third codon position. Twelve of the 13 protein-coding genes use ATG as their start codon while the COX1 gene starts with GTG. For stop codon, ND3 and ND4 genes show incomplete stop codon T. The mitogenome sequence of H. koreana will provide important information on the evolution and the phylogenetic relation of the genus Hongeo in relation to the other genera of the family Rajidae.

  14. Expression of Human Hemojuvelin (HJV) Is Tightly Regulated by Two Upstream Open Reading Frames in HJV mRNA That Respond to Iron Overload in Hepatic Cells

    PubMed Central

    Onofre, Cláudia; Tomé, Filipa; Barbosa, Cristina; Silva, Ana Luísa

    2015-01-01

    The gene encoding human hemojuvelin (HJV) is one of the genes that, when mutated, can cause juvenile hemochromatosis, an early-onset inherited disorder associated with iron overload. The 5′ untranslated region of the human HJV mRNA has two upstream open reading frames (uORFs), with 28 and 19 codons formed by two upstream AUGs (uAUGs) sharing the same in-frame stop codon. Here we show that these uORFs decrease the translational efficiency of the downstream main ORF in HeLa and HepG2 cells. Indeed, ribosomal access to the main AUG is conditioned by the strong uAUG context, which results in the first uORF being translated most frequently. The reach of the main ORF is then achieved by ribosomes that resume scanning after uORF translation. Furthermore, the amino acid sequences of the uORF-encoded peptides also reinforce the translational repression of the main ORF. Interestingly, when iron levels increase, translational repression is relieved specifically in hepatic cells. The upregulation of protein levels occurs along with phosphorylation of the eukaryotic initiation factor 2α. Nevertheless, our results support a model in which the increasing recognition of the main AUG is mediated by a tissue-specific factor that promotes uORF bypass. These results support a tight HJV translational regulation involved in iron homeostasis. PMID:25666510

  15. The Bean Pod Mottle Virus RNA2-Encoded 58-Kilodalton Protein P58 Is Required in cis for RNA2 Accumulation

    PubMed Central

    Lin, Junyan; Guo, Jiangbo; Finer, John; Dorrance, Anne E.; Redinbaugh, Margaret G.

    2014-01-01

    ABSTRACT Bean pod mottle virus (BPMV) is a bipartite, positive-sense (+) RNA plant virus in the Secoviridae family. Its RNA1 encodes proteins required for genome replication, whereas RNA2 primarily encodes proteins needed for virion assembly and cell-to-cell movement. However, the function of a 58-kDa protein (P58) encoded by RNA2 has not been resolved. P58 and the movement protein (MP) of BPMV are two largely identical proteins differing only at their N termini, with P58 extending MP upstream by 102 amino acid residues. In this report, we unveil a unique role for P58. We show that BPMV RNA2 accumulation in infected cells was abolished when the start codon of P58 was eliminated. The role of P58 does not require the region shared by MP, as RNA2 accumulation in individual cells remained robust even when most of the MP coding sequence was removed. Importantly, the function of P58 required the P58 protein, rather than its coding RNA, as compensatory mutants could be isolated that restored RNA2 accumulation by acquiring new start codons upstream of the original one. Most strikingly, loss of P58 function could not be complemented by P58 provided in trans, suggesting that P58 functions in cis to selectively promote the accumulation of RNA2 copies that encode a functional P58 protein. Finally, we found that all RNA1-encoded proteins are cis-acting relative to RNA1. Together, our results suggest that P58 probably functions by recruiting the RNA1-encoded polyprotein to RNA2 to enable RNA2 reproduction. IMPORTANCE Bean pod mottle virus (BPMV) is one of the most important pathogens of the crop plant soybean, yet its replication mechanism is not well understood, hindering the development of knowledge-based control measures. The current study examined the replication strategy of BPMV RNA2, one of the two genomic RNA segments of this virus, and established an essential role for P58, one of the RNA2-encoded proteins, in the process of RNA2 replication. Our study demonstrates for the first time that P58 functions preferentially with the very RNA from which it is translated, thus greatly advancing our understanding of the replication mechanisms of this and related viruses. Furthermore, this study is important because it provides a potential target for BPMV-specific control, and hence could help to mitigate soybean production losses caused by this virus. PMID:24390330

  16. Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

    PubMed

    Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

    1996-10-01

    Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

  17. Dental anomalies in pediatric patients with familial adenomatous polyposis.

    PubMed

    Septer, Seth; Bohaty, Brenda; Onikul, Robin; Kumar, Vandana; Williams, Karen B; Attard, Thomas M; Friesen, Craig A; Friesen, Lynn Roosa

    2018-04-01

    Familial adenomatous polyposis patients often present with non-malignant extra-intestinal manifestations which include dental anomalies that may be evident prior to the appearance of the colonic adenomas. The aims of this study were to describe the prevalence and type of dental anomalies and the relationships between gene mutations and dental anomalies in these patients. Twenty-two pediatric familial adenomatous polyposis patients and 46 controls, who were age and gender matched participated. Familial adenomatous polyposis patient's had a dental examination with panoramic radiograph and medical record review for age at diagnosis, the presence of the adenomatous polyposis coli gene mutation, and determination of other extra-intestinal manifestations on the body. The control group was identified from a retrospective chart review and selected if there was a current panoramic radiograph. The only significant difference between familial adenomatous polyposis patients and controls were the presence of jaw osteomas and sclerosis (p = .0001). Patients with a mutation in, or upstream of codon 1309 had a higher frequency of osteomas (77.8%) and jaw-bone sclerosis (44.4%), and 77% of these had at least one dental anomaly. This preliminary study showed an association between a genetic variant at, or upstream of codon 1309, and radiographic dental anomalies.

  18. Comparative genomic analysis reveals a novel mitochondrial isoform of human rTS protein and unusual phylogenetic distribution of the rTS gene

    PubMed Central

    Liang, Ping; Nair, Jayakumar R; Song, Lei; McGuire, John J; Dolnick, Bruce J

    2005-01-01

    Background The rTS gene (ENOSF1), first identified in Homo sapiens as a gene complementary to the thymidylate synthase (TYMS) mRNA, is known to encode two protein isoforms, rTSα and rTSβ. The rTSβ isoform appears to be an enzyme responsible for the synthesis of signaling molecules involved in the down-regulation of thymidylate synthase, but the exact cellular functions of rTS genes are largely unknown. Results Through comparative genomic sequence analysis, we predicted the existence of a novel protein isoform, rTS, which has a 27 residue longer N-terminus by virtue of utilizing an alternative start codon located upstream of the start codon in rTSβ. We observed that a similar extended N-terminus could be predicted in all rTS genes for which genomic sequences are available and the extended regions are conserved from bacteria to human. Therefore, we reasoned that the protein with the extended N-terminus might represent an ancestral form of the rTS protein. Sequence analysis strongly predicts a mitochondrial signal sequence in the extended N-terminal of human rTSγ, which is absent in rTSβ. We confirmed the existence of rTS in human mitochondria experimentally by demonstrating the presence of both rTSγ and rTSβ proteins in mitochondria isolated by subcellular fractionation. In addition, our comprehensive analysis of rTS orthologous sequences reveals an unusual phylogenetic distribution of this gene, which suggests the occurrence of one or more horizontal gene transfer events. Conclusion The presence of two rTS isoforms in mitochondria suggests that the rTS signaling pathway may be active within mitochondria. Our report also presents an example of identifying novel protein isoforms and for improving gene annotation through comparative genomic analysis. PMID:16162288

  19. Novel expression of the stanniocalcin gene in fish.

    PubMed

    McCudden, C R; Kogon, M R; DiMattia, G E; Wagner, G F

    2001-10-01

    It is currently accepted that the fish stanniocalcin (STC) gene is expressed exclusively in the corpuscles of Stannius (CS), unique endocrine glands on the kidneys of bony fishes. In this study, we have re-examined the pattern of fish STC gene expression in the light of the recent evidence for widespread expression of the gene in mammals. Surprisingly, we found by Northern blotting that the fish gene was also expressed in the kidneys and gonads, in addition to the CS glands. Moreover, Southern blotting of RT-PCR products revealed STC mRNA transcripts in all tissues assayed, including brain, heart, gill, muscle and intestine. In situ hybridization studies using digoxigenin-labeled riboprobes localized STC mRNA to chondrocytes, and both mature and developing nephritic tubules. Immunocytochemical staining indicated that the STC protein was widespread in cells of the gill, kidney, brain, eye, pseudobranch and skin. We also characterized the salmon STC gene, establishing that it was comprised of five exons as opposed to four in mammals. A single transcription start site was identified by primer extension 99 bp upstream of the start codon. This is the first evidence of STC gene expression in fish tissues other than the CS glands and suggests that, as in mammals, fish STC operates via both local and endocrine pathways.

  20. The complete mitochondrial genome of Chinese green hydra, Hydra sinensis (Hydroida: Hydridae).

    PubMed

    Pan, Hong-Chun; Qian, Xiao-Cheng; Li, Ping; Li, Xiao-Fei; Wang, An-Tai

    2014-02-01

    The complete mitochondrial genome of Chinese green hydra, Hydra sinensis (Hydroida: Hydridae) is a linear molecule of 16,189 bp in length, containing 13 protein-coding genes, small and large subunit ribosomal RNAs, methionine and tryptophan transfer RNAs, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mitochondrial DNA. The A + T content of the overall base composition of H-strand is 77.2% (T: 41.7%; C: 10.9%; A: 35.5%; and G: 11.9%). COI and ND1 genes begin with GTG as start codon, while other 11 protein-coding genes start with a typical ATG initiation codon. COII, ATP8, ATP6, COIII, ND5, ND6, ND3, ND1, ND4 and COI genes are terminated with TAA as stop codon, ND4L ends with TAG, ND2 ends with TA and Cyt b ends with T.

  1. Analyses of frameshifting at UUU-pyrimidine sites.

    PubMed

    Schwartz, R; Curran, J F

    1997-05-15

    Others have recently shown that the UUU phenylalanine codon is highly frameshift-prone in the 3'(rightward) direction at pyrimidine 3'contexts. Here, several approaches are used to analyze frameshifting at such sites. The four permutations of the UUU/C (phenylalanine) and CGG/U (arginine) codon pairs were examined because they vary greatly in their expected frameshifting tendencies. Furthermore, these synonymous sites allow direct tests of the idea that codon usage can control frameshifting. Frameshifting was measured for these dicodons embedded within each of two broader contexts: the Escherichia coli prfB (RF2 gene) programmed frameshift site and a 'normal' message site. The principal difference between these contexts is that the programmed frameshift contains a purine-rich sequence upstream of the slippery site that can base pair with the 3'end of 16 S rRNA (the anti-Shine-Dalgarno) to enhance frameshifting. In both contexts frameshift frequencies are highest if the slippery tRNAPhe is capable of stable base pairing in the shifted reading frame. This requirement is less stringent in the RF2 context, as if the Shine-Dalgarno interaction can help stabilize a quasi-stable rephased tRNA:message complex. It was previously shown that frameshifting in RF2 occurs more frequently if the codon 3'to the slippery site is read by a rare tRNA. Consistent with that earlier work, in the RF2 context frameshifting occurs substantially more frequently if the arginine codon is CGG, which is read by a rare tRNA. In contrast, in the 'normal' context frameshifting is only slightly greater at CGG than at CGU. It is suggested that the Shine-Dalgarno-like interaction elevates frameshifting specifically during the pause prior to translation of the second codon, which makes frameshifting exquisitely sensitive to the rate of translation of that codon. In both contexts frameshifting increases in a mutant strain that fails to modify tRNA base A37, which is 3'of the anticodon. Thus, those base modifications may limit frameshifting at UUU codons. Finally, statistical analyses show that UUU Ynn dicodons are extremely rare in E.coli genes that have highly biased codon usage.

  2. Analyses of frameshifting at UUU-pyrimidine sites.

    PubMed Central

    Schwartz, R; Curran, J F

    1997-01-01

    Others have recently shown that the UUU phenylalanine codon is highly frameshift-prone in the 3'(rightward) direction at pyrimidine 3'contexts. Here, several approaches are used to analyze frameshifting at such sites. The four permutations of the UUU/C (phenylalanine) and CGG/U (arginine) codon pairs were examined because they vary greatly in their expected frameshifting tendencies. Furthermore, these synonymous sites allow direct tests of the idea that codon usage can control frameshifting. Frameshifting was measured for these dicodons embedded within each of two broader contexts: the Escherichia coli prfB (RF2 gene) programmed frameshift site and a 'normal' message site. The principal difference between these contexts is that the programmed frameshift contains a purine-rich sequence upstream of the slippery site that can base pair with the 3'end of 16 S rRNA (the anti-Shine-Dalgarno) to enhance frameshifting. In both contexts frameshift frequencies are highest if the slippery tRNAPhe is capable of stable base pairing in the shifted reading frame. This requirement is less stringent in the RF2 context, as if the Shine-Dalgarno interaction can help stabilize a quasi-stable rephased tRNA:message complex. It was previously shown that frameshifting in RF2 occurs more frequently if the codon 3'to the slippery site is read by a rare tRNA. Consistent with that earlier work, in the RF2 context frameshifting occurs substantially more frequently if the arginine codon is CGG, which is read by a rare tRNA. In contrast, in the 'normal' context frameshifting is only slightly greater at CGG than at CGU. It is suggested that the Shine-Dalgarno-like interaction elevates frameshifting specifically during the pause prior to translation of the second codon, which makes frameshifting exquisitely sensitive to the rate of translation of that codon. In both contexts frameshifting increases in a mutant strain that fails to modify tRNA base A37, which is 3'of the anticodon. Thus, those base modifications may limit frameshifting at UUU codons. Finally, statistical analyses show that UUU Ynn dicodons are extremely rare in E.coli genes that have highly biased codon usage. PMID:9115369

  3. Genomic context drives transcription of insertion sequences in the bacterial endosymbiont Wolbachia wVulC.

    PubMed

    Cerveau, Nicolas; Gilbert, Clément; Liu, Chao; Garrett, Roger A; Grève, Pierre; Bouchon, Didier; Cordaux, Richard

    2015-06-10

    Transposable elements (TEs) are DNA pieces that are present in almost all the living world at variable genomic density. Due to their mobility and density, TEs are involved in a large array of genomic modifications. In eukaryotes, TE expression has been studied in detail in several species. In prokaryotes, studies of IS expression are generally linked to particular copies that induce a modification of neighboring gene expression. Here we investigated global patterns of IS transcription in the Alphaproteobacterial endosymbiont Wolbachia wVulC, using both RT-PCR and bioinformatic analyses. We detected several transcriptional promoters in all IS groups. Nevertheless, only one of the potentially functional IS groups possesses a promoter located upstream of the transposase gene, that could lead up to the production of a functional protein. We found that the majority of IS groups are expressed whatever their functional status. RT-PCR analyses indicate that the transcription of two IS groups lacking internal promoters upstream of the transposase start codon may be driven by the genomic environment. We confirmed this observation with the transcription analysis of individual copies of one IS group. These results suggest that the genomic environment is important for IS expression and it could explain, at least partly, copy number variability of the various IS groups present in the wVulC genome and, more generally, in bacterial genomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Circuitry linking the global Csr and σE-dependent cell envelope stress response systems.

    PubMed

    Yakhnin, Helen; Aichele, Robert; Ades, Sarah E; Romeo, Tony; Babitzke, Paul

    2017-09-18

    CsrA of Escherichia coli is an RNA-binding protein that globally regulates a wide variety of cellular processes and behaviors including carbon metabolism, motility, biofilm formation, and the stringent response. CsrB and CsrC are sRNAs that sequester CsrA, thereby preventing CsrA-mRNA interaction. RpoE (σ E ) is the extracytoplasmic stress response sigma factor of E. coli Previous RNA-seq studies identified rpoE mRNA as a CsrA target. Here we explored the regulation of rpoE by CsrA and found that CsrA represses rpoE translation. Gel mobility shift, footprint and toeprint studies identified three CsrA binding sites in the rpoE leader transcript, one of which overlaps the rpoE Shine-Dalgarno (SD) sequence, while another overlaps the rpoE translation initiation codon. Coupled in vitro transcription-translation experiments showed that CsrA represses rpoE translation by binding to these sites. We further demonstrate that σ E indirectly activates transcription of csrB and csrC , leading to increased sequestration of CsrA such that repression of rpoE by CsrA is reduced. We propose that the Csr system fine-tunes the σ E -dependent cell envelope stress response. We also identified a 51 amino acid coding sequence whose stop codon overlaps the rpoE start codon, and demonstrate that rpoE is translationally coupled with this upstream open reading frame (ORF51). Loss of coupling reduces rpoE translation by more than 50%. Identification of a translationally coupled ORF upstream of rpoE suggests that this previously unannotated protein may participate in the cell envelope stress response. In keeping with existing nomenclature, we name ORF51 as rseD , resulting in an operon arrangement of rseD-rpoE-rseA-rseB-rseC IMPORTANCE CsrA posttranscriptionally represses genes required for bacterial stress responses, including the stringent response, catabolite repression, and the RpoS (σ S )-mediated general stress response. We show that CsrA represses translation of rpoE , encoding the extracytoplasmic stress response sigma factor and that σ E indirectly activates transcription of csrB and csrC , resulting in reciprocal regulation of these two global regulatory systems. These findings suggest that extracytoplasmic stress leads to derepression of rpoE translation by CsrA, and CsrA-mediated repression helps to reset RpoE abundance to pre-stress levels once envelope damage is repaired. The discovery of an ORF, RseD, translationally coupled with rpoE adds further complexity to translational control of rpoE . Copyright © 2017 American Society for Microbiology.

  5. Statistical Analysis of Readthrough Levels for Nonsense Mutations in Mammalian Cells Reveals a Major Determinant of Response to Gentamicin

    PubMed Central

    Floquet, Célia; Hatin, Isabelle; Rousset, Jean-Pierre; Bidou, Laure

    2012-01-01

    The efficiency of translation termination depends on the nature of the stop codon and the surrounding nucleotides. Some molecules, such as aminoglycoside antibiotics (gentamicin), decrease termination efficiency and are currently being evaluated for diseases caused by premature termination codons. However, the readthrough response to treatment is highly variable and little is known about the rules governing readthrough level and response to aminoglycosides. In this study, we carried out in-depth statistical analysis on a very large set of nonsense mutations to decipher the elements of nucleotide context responsible for modulating readthrough levels and gentamicin response. We quantified readthrough for 66 sequences containing a stop codon, in the presence and absence of gentamicin, in cultured mammalian cells. We demonstrated that the efficiency of readthrough after treatment is determined by the complex interplay between the stop codon and a larger sequence context. There was a strong positive correlation between basal and induced readthrough levels, and a weak negative correlation between basal readthrough level and gentamicin response (i.e. the factor of increase from basal to induced readthrough levels). The identity of the stop codon did not affect the response to gentamicin treatment. In agreement with a previous report, we confirm that the presence of a cytosine in +4 position promotes higher basal and gentamicin-induced readthrough than other nucleotides. We highlight for the first time that the presence of a uracil residue immediately upstream from the stop codon is a major determinant of the response to gentamicin. Moreover, this effect was mediated by the nucleotide itself, rather than by the amino-acid or tRNA corresponding to the −1 codon. Finally, we point out that a uracil at this position associated with a cytosine at +4 results in an optimal gentamicin-induced readthrough, which is the therapeutically relevant variable. PMID:22479203

  6. Defragged Binary I Ching Genetic Code Chromosomes Compared to Nirenberg’s and Transformed into Rotating 2D Circles and Squares and into a 3D 100% Symmetrical Tetrahedron Coupled to a Functional One to Discern Start From Non-Start Methionines through a Stella Octangula

    PubMed Central

    Castro-Chavez, Fernando

    2012-01-01

    Background Three binary representations of the genetic code according to the ancient I Ching of Fu-Xi will be presented, depending on their defragging capabilities by pairing based on three biochemical properties of the nucleic acids: H-bonds, Purine/Pyrimidine rings, and the Keto-enol/Amino-imino tautomerism, yielding the last pair a 32/32 single-strand self-annealed genetic code and I Ching tables. Methods Our working tool is the ancient binary I Ching's resulting genetic code chromosomes defragged by vertical and by horizontal pairing, reverse engineered into non-binaries of 2D rotating 4×4×4 circles and 8×8 squares and into one 3D 100% symmetrical 16×4 tetrahedron coupled to a functional tetrahedron with apical signaling and central hydrophobicity (codon formula: 4[1(1)+1(3)+1(4)+4(2)]; 5:5, 6:6 in man) forming a stella octangula, and compared to Nirenberg's 16×4 codon table (1965) pairing the first two nucleotides of the 64 codons in axis y. Results One horizontal and one vertical defragging had the start Met at the center. Two, both horizontal and vertical pairings produced two pairs of 2×8×4 genetic code chromosomes naturally arranged (M and I), rearranged by semi-introversion of central purines or pyrimidines (M' and I') and by clustering hydrophobic amino acids; their quasi-identity was disrupted by amino acids with odd codons (Met and Tyr pairing to Ile and TGA Stop); in all instances, the 64-grid 90° rotational ability was restored. Conclusions We defragged three I Ching representations of the genetic code while emphasizing Nirenberg's historical finding. The synthetic genetic code chromosomes obtained reflect the protective strategy of enzymes with a similar function, having both humans and mammals a biased G-C dominance of three H-bonds in the third nucleotide of their most used codons per amino acid, as seen in one chromosome of the i, M and M' genetic codes, while a two H-bond A-T dominance was found in their complementary chromosome, as seen in invertebrates and plants. The reverse engineering of chromosome I' into 2D rotating circles and squares was undertaken, yielding a 100% symmetrical 3D geometry which was coupled to a previously obtained genetic code tetrahedron in order to differentiate the start methionine from the methionine that is acting as a codifying non-start codon. PMID:23431415

  7. Peptide Conjugated Phosphorodiamidate Morpholino Oligomers Increase Survival of Mice Challenged with Ames Bacillus anthracis

    PubMed Central

    Geller, Bruce L.; Mellbye, Brett; Lane, Douglas; Iversen, Patrick L.; Bavari, Sina

    2012-01-01

    Targeting bacterial essential genes using antisense phosphorodiamidate morpholino oligomers (PMOs) represents an important strategy in the development of novel antibacterial therapeutics. PMOs are neutral DNA analogues that inhibit gene expression in a sequence-specific manner. In this study, several cationic, membrane-penetrating peptides were conjugated to PMOs (PPMOs) that target 2 bacterial essential genes: acyl carrier protein (acpP) and gyrase A (gyrA). These were tested for their ability to inhibit growth of Bacillus anthracis, a gram-positive spore-forming bacterium and causative agent of anthrax. PPMOs targeted upstream of both target gene start codons and conjugated with the bacterium-permeating peptide (RFF)3R were found to be most effective in inhibiting bacterial growth in vitro. Both of the gene-targeted PPMOs protected macrophages from B. anthracis induced cell death. Subsequent, in vivo testing of the PPMOs resulted in increased survival of mice challenged with the virulent Ames strain of B. anthracis. Together, these studies suggest that PPMOs targeting essential genes have the potential of being used as antisense antibiotics to treat B. anthracis infections. PMID:22978365

  8. Expression of different functional isoforms in haematopoiesis.

    PubMed

    Grech, Godfrey; Pollacco, Joel; Portelli, Mark; Sacco, Keith; Baldacchino, Shawn; Grixti, Justine; Saliba, Christian

    2014-01-01

    Haematopoiesis is a complex process regulated at various levels facilitating rapid responses to external factors including stress, modulation of lineage commitment and terminal differentiation of progenitors. Although the transcription program determines the RNA pool of a cell, various mRNA strands can be obtained from the same template, giving rise to multiple protein isoforms. The majority of variants and isoforms co-occur in normal haematopoietic cells or are differentially expressed at various maturity stages of progenitor maturation and cellular differentiation within the same lineage or across lineages. Genetic aberrations or specific cellular states result in the predominant expression of abnormal isoforms leading to deregulation and disease. The presence of upstream open reading frames (uORF) in 5' untranslated regions (UTRs) of a transcript, couples the utilization of start codons with the cellular status and availability of translation initiation factors (eIFs). In addition, tissue-specific and cell lineage-specific alternative promoter use, regulates several transcription factors producing transcript variants with variable 5' exons. In this review, we propose to give a detailed account of the differential isoform formation, causing haematological malignancies.

  9. Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

    PubMed

    Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

    1987-01-01

    The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

  10. Structure and Function of the Macrolide Biosensor Protein, MphR(A), with and without Erythromycin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Jianting; Sagar, Vatsala; Smolinsky, Adam

    2009-09-02

    The regulatory protein MphR(A) has recently seen extensive use in synthetic biological applications, such as metabolite sensing and exogenous control of gene expression. This protein negatively regulates the expression of a macrolide 2{prime}-phosphotransferase I resistance gene (mphA) via binding to a 35-bp DNA operator upstream of the start codon and is de-repressed by the presence of erythromycin. Here, we present the refined crystal structure of the MphR(A) protein free of erythromycin and that of the MphR(A) protein with bound erythromycin at 2.00- and 1.76-{angstrom} resolutions, respectively. We also studied the DNA binding properties of the protein and identified mutants ofmore » MphR(A) that are defective in gene repression and ligand binding in a cell-based reporter assay. The combination of these two structures illustrates the molecular basis of erythromycin-induced gene expression and provides a framework for additional applied uses of this protein in the isolation and engineered biosynthesis of polyketide natural products.« less

  11. Transcription and Regulation of the Bidirectional Hydrogenase in the Cyanobacterium Nostoc sp. Strain PCC 7120▿

    PubMed Central

    Sjöholm, Johannes; Oliveira, Paulo; Lindblad, Peter

    2007-01-01

    The filamentous, heterocystous cyanobacterium Nostoc sp. strain PCC 7120 (Anabaena sp. strain PCC 7120) possesses an uptake hydrogenase and a bidirectional enzyme, the latter being capable of catalyzing both H2 production and evolution. The completely sequenced genome of Nostoc sp. strain PCC 7120 reveals that the five structural genes encoding the bidirectional hydrogenase (hoxEFUYH) are separated in two clusters at a distance of approximately 8.8 kb. The transcription of the hox genes was examined under nitrogen-fixing conditions, and the results demonstrate that the cluster containing hoxE and hoxF can be transcribed as one polycistronic unit together with the open reading frame alr0750. The second cluster, containing hoxU, hoxY, and hoxH, is transcribed together with alr0763 and alr0765, located between the hox genes. Moreover, alr0760 and alr0761 form an additional larger operon. Nevertheless, Northern blot hybridizations revealed a rather complex transcription pattern in which the different hox genes are expressed differently. Transcriptional start points (TSPs) were identified 66 and 57 bp upstream from the start codon of alr0750 and hoxU, respectively. The transcriptions of the two clusters containing the hox genes are both induced under anaerobic conditions concomitantly with the induction of a higher level of hydrogenase activity. An additional TSP, within the annotated alr0760, 244 bp downstream from the suggested translation start codon, was identified. Electrophoretic mobility shift assays with purified LexA from Nostoc sp. strain PCC 7120 demonstrated specific interactions between the transcriptional regulator and both hox promoter regions. However, when LexA from Synechocystis sp. strain PCC 6803 was used, the purified protein interacted only with the promoter region of the alr0750-hoxE-hoxF operon. A search of the whole Nostoc sp. strain PCC 7120 genome demonstrated the presence of 216 putative LexA binding sites in total, including recA and recF. This indicates that, in addition to the bidirectional hydrogenase gene, a number of other genes, including open reading frames connected to DNA replication, recombination, and repair, may be part of the LexA regulatory network in Nostoc sp. strain PCC 7120. PMID:17630298

  12. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, S.P.; Robert, M.F.; Mitchell, G.A.

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither amore » TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.« less

  13. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove

    PubMed Central

    Filbin, Megan E.; Kieft, Jeffrey S.

    2011-01-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem–loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem–loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis. PMID:21606179

  14. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.

    PubMed

    Filbin, Megan E; Kieft, Jeffrey S

    2011-07-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis.

  15. DsrA regulatory RNA represses both hns and rbsD mRNAs through distinct mechanisms in Escherichia coli.

    PubMed

    Lalaouna, David; Morissette, Audrey; Carrier, Marie-Claude; Massé, Eric

    2015-10-01

    The 87 nucleotide long DsrA sRNA has been mostly studied for its translational activation of the transcriptional regulator RpoS. However, it also represses hns mRNA, which encodes H-NS, a major regulator that affects expression of nearly 5% of Escherichia coli genes. A speculative model previously suggested that DsrA would block hns mRNA translation by binding simultaneously to start and stop codon regions of hns mRNA (coaxial model). Here, we show that DsrA efficiently blocked translation of hns mRNA by base-pairing immediately downstream of the start codon. In addition, DsrA induced hns mRNA degradation by actively recruiting the RNA degradosome complex. Data presented here led to a model of DsrA action on hns mRNA, which supports a canonical mechanism of sRNA-induced mRNA degradation by binding to the translation initiation region. Furthermore, using MS2-affinity purification coupled with RNA sequencing technology (MAPS), we also demonstrated that DsrA targets rbsD mRNA, involved in ribose utilization. Surprisingly, DsrA base pairs far downstream of rbsD start codon and induces rapid degradation of the transcript. Thus, our study enables us to draw an extended DsrA targetome. © 2015 John Wiley & Sons Ltd.

  16. Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.

    PubMed Central

    Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B

    1990-01-01

    Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563

  17. Complete mitochondrial genome of Germain's Peacock-Pheasant Polyplectron germaini (Aves, Galliformes, Phasianidae).

    PubMed

    Omeire, Destiny; Abdin, Shaunte; Brooks, Daniel M; Miranda, Hector C

    2015-04-01

    The Germain's Peacock-Pheasant Polyplectron germaini (Aves, Galliformes, Phasianidae) is classified as Near Threatened on the IUCN Red List. The complete mitochondrial genome of P. germaini is 16,699 bp, consisting of 13 protein-coding genes, 2 rRNA, 22 tRNA genes and 1 control region. All of the 13 protein-coding genes have ATG as start codon. Eight of the 13 protein-coding genes have TAA as stop codon.

  18. Possibilities for the evolution of the genetic code from a preceding form

    NASA Technical Reports Server (NTRS)

    Jukes, T. H.

    1973-01-01

    Analysis of the interaction between mRNA codons and tRNA anticodons suggests a model for the evolution of the genetic code. Modification of the nucleic acid following the anticodon is at present essential in both eukaryotes and prokaryotes to ensure fidelity of translation of codons starting with A, and the amino acids which could be coded for before the evolution of the modifying enzymes can be deduced.

  19. vanC Cluster of Vancomycin-Resistant Enterococcus gallinarum BM4174

    PubMed Central

    Arias, Cesar A.; Courvalin, Patrice; Reynolds, Peter E.

    2000-01-01

    Glycopeptide-resistant enterococci of the VanC type synthesize UDP-muramyl-pentapeptide[d-Ser] for cell wall assembly and prevent synthesis of peptidoglycan precursors ending in d-Ala. The vanC cluster of Enterococcus gallinarum BM4174 consists of five genes: vanC-1, vanXYC, vanT, vanRC, and vanSC. Three genes are sufficient for resistance: vanC-1 encodes a ligase that synthesizes the dipeptide d-Ala-d-Ser for addition to UDP-MurNAc-tripeptide, vanXYC encodes a d,d-dipeptidase–carboxypeptidase that hydrolyzes d-Ala-d-Ala and removes d-Ala from UDP-MurNAc-pentapeptide[d-Ala], and vanT encodes a membrane-bound serine racemase that provides d-Ser for the synthetic pathway. The three genes are clustered: the start codons of vanXYC and vanT overlap the termination codons of vanC-1 and vanXYC, respectively. Two genes which encode proteins with homology to the VanS-VanR two-component regulatory system were present downstream from the resistance genes. The predicted amino acid sequence of VanRC exhibited 50% identity to VanR and 33% identity to VanRB. VanSC had 40% identity to VanS over a region of 308 amino acids and 24% identity to VanSB over a region of 285 amino acids. All residues with important functions in response regulators and histidine kinases were conserved in VanRC and VanSC, respectively. Induction experiments based on the determination of d,d-carboxypeptidase activity in cytoplasmic extracts confirmed that the genes were expressed constitutively. Using a promoter-probing vector, regions upstream from the resistance and regulatory genes were identified that have promoter activity. PMID:10817725

  20. Posttranscriptional mRNA processing as a mechanism for regulation of human A1 adenosine receptor expression.

    PubMed Central

    Ren, H; Stiles, G L

    1994-01-01

    The human A1 adenosine receptor gene contains six exons with exons 1, 2, 3, 4, and part of 5 representing 5' untranslated regions. Reverse transcription-PCR with exon-specific primers showed two distinct transcripts containing either exons 3, 5, and 6 or exons 4, 5, and 6, with exons 3 and 4 being mutually exclusive. No mature mRNAs containing exons 1 and 2 have been detected. All human tissues that express any A1 receptors contain mRNA with exons 4, 5, and 6. Tissues which express high levels of A1 receptors contain mRNA with exons 3, 5, and 6. Exon 4 contains two upstream ATG codons whereas exon 3 contains none. COS cells transfected with expression vectors containing exon 4 (exons 1-6, 3-6, or Ex4-6) express much lower levels of A1 receptors than vectors without exon 4 (exons 3, 5, and 6). Mutation of upstream ATG codons in exon 4 leads to 3- to 7-fold increased A1 receptor expression, up to the level seen with the construct containing exons 3, 5, and 6. Thus, in human tissues "basal" levels of A1 receptors can be expressed by use of mRNA containing exons 4, 5, and 6, but when high levels are needed, alternative transcripts with exons 3, 5, and 6 are produced. Images PMID:8197148

  1. Alignment-based and alignment-free methods converge with experimental data on amino acids coded by stop codons at split between nuclear and mitochondrial genetic codes.

    PubMed

    Seligmann, Hervé

    2018-05-01

    Genetic codes mainly evolve by reassigning punctuation codons, starts and stops. Previous analyses assuming that undefined amino acids translate stops showed greater divergence between nuclear and mitochondrial genetic codes. Here, three independent methods converge on which amino acids translated stops at split between nuclear and mitochondrial genetic codes: (a) alignment-free genetic code comparisons inserting different amino acids at stops; (b) alignment-based blast analyses of hypothetical peptides translated from non-coding mitochondrial sequences, inserting different amino acids at stops; (c) biases in amino acid insertions at stops in proteomic data. Hence short-term protein evolution models reconstruct long-term genetic code evolution. Mitochondria reassign stops to amino acids otherwise inserted at stops by codon-anticodon mismatches (near-cognate tRNAs). Hence dual function (translation termination and translation by codon-anticodon mismatch) precedes mitochondrial reassignments of stops to amino acids. Stop ambiguity increases coded information, compensates endocellular mitogenome reduction. Mitochondrial codon reassignments might prevent viral infections. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

    PubMed Central

    Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

    1985-01-01

    The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

  3. Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

    PubMed

    Sugita, M; Shinozaki, K; Sugiura, M

    1985-06-01

    The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

  4. A Stem-Loop Structure in Potato Leafroll Virus Open Reading Frame 5 (ORF5) Is Essential for Readthrough Translation of the Coat Protein ORF Stop Codon 700 Bases Upstream.

    PubMed

    Xu, Yi; Ju, Ho-Jong; DeBlasio, Stacy; Carino, Elizabeth J; Johnson, Richard; MacCoss, Michael J; Heck, Michelle; Miller, W Allen; Gray, Stewart M

    2018-06-01

    Translational readthrough of the stop codon of the capsid protein (CP) open reading frame (ORF) is used by members of the Luteoviridae to produce their minor capsid protein as a readthrough protein (RTP). The elements regulating RTP expression are not well understood, but they involve long-distance interactions between RNA domains. Using high-resolution mass spectrometry, glutamine and tyrosine were identified as the primary amino acids inserted at the stop codon of Potato leafroll virus (PLRV) CP ORF. We characterized the contributions of a cytidine-rich domain immediately downstream and a branched stem-loop structure 600 to 700 nucleotides downstream of the CP stop codon. Mutations predicted to disrupt and restore the base of the distal stem-loop structure prevented and restored stop codon readthrough. Motifs in the downstream readthrough element (DRTE) are predicted to base pair to a site within 27 nucleotides (nt) of the CP ORF stop codon. Consistent with a requirement for this base pairing, the DRTE of Cereal yellow dwarf virus was not compatible with the stop codon-proximal element of PLRV in facilitating readthrough. Moreover, deletion of the complementary tract of bases from the stop codon-proximal region or the DRTE of PLRV prevented readthrough. In contrast, the distance and sequence composition between the two domains was flexible. Mutants deficient in RTP translation moved long distances in plants, but fewer infection foci developed in systemically infected leaves. Selective 2'-hydroxyl acylation and primer extension (SHAPE) probing to determine the secondary structure of the mutant DRTEs revealed that the functional mutants were more likely to have bases accessible for long-distance base pairing than the nonfunctional mutants. This study reveals a heretofore unknown combination of RNA structure and sequence that reduces stop codon efficiency, allowing translation of a key viral protein. IMPORTANCE Programmed stop codon readthrough is used by many animal and plant viruses to produce key viral proteins. Moreover, such "leaky" stop codons are used in host mRNAs or can arise from mutations that cause genetic disease. Thus, it is important to understand the mechanism(s) of stop codon readthrough. Here, we shed light on the mechanism of readthrough of the stop codon of the coat protein ORFs of viruses in the Luteoviridae by identifying the amino acids inserted at the stop codon and RNA structures that facilitate this "leakiness" of the stop codon. Members of the Luteoviridae encode a C-terminal extension to the capsid protein known as the readthrough protein (RTP). We characterized two RNA domains in Potato leafroll virus (PLRV), located 600 to 700 nucleotides apart, that are essential for efficient RTP translation. We further determined that the PLRV readthrough process involves both local structures and long-range RNA-RNA interactions. Genetic manipulation of the RNA structure altered the ability of PLRV to translate RTP and systemically infect the plant. This demonstrates that plant virus RNA contains multiple layers of information beyond the primary sequence and extends our understanding of stop codon readthrough. Strategic targets that can be exploited to disrupt the virus life cycle and reduce its ability to move within and between plant hosts were revealed. Copyright © 2018 American Society for Microbiology.

  5. The complete mitochondrial genome of Setaria digitata (Nematoda: Filarioidea): Mitochondrial gene content, arrangement and composition compared with other nematodes.

    PubMed

    Yatawara, Lalani; Wickramasinghe, Susiji; Rajapakse, R P V J; Agatsuma, Takeshi

    2010-09-01

    In the present study, we determined the complete mitochondrial (mt) genome sequence (13,839bp) of parasitic nematode Setaria digitata and its structure and organization compared with Onchocerca volvulus, Dirofilaria immitis and Brugia malayi. The mt genome of S. digitata is slightly larger than the mt genomes of other filarial nematodes. S. digitata mt genome contains 36 genes (12 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs) that are typically found in metazoans. This genome contains a high A+T (75.1%) content and low G+C content (24.9%). The mt gene order for S. digitata is the same as those for O. volvulus, D. immitis and B. malayi but it is distinctly different from other nematodes compared. The start codons inferred in the mt genome of S. digitata are TTT, ATT, TTG, ATG, GTT and ATA. Interestingly, the initiation codon TTT is unique to S. digitata mt genome and four protein-coding genes use this codon as a translation initiation codon. Five protein-coding genes use TAG as a stop codon whereas three genes use TAA and four genes use T as a termination codon. Out of 64 possible codons, only 57 are used for mitochondrial protein-coding genes of S. digitata. T-rich codons such as TTT (18.9%), GTT (7.9%), TTG (7.8%), TAT (7%), ATT (5.7%), TCT (4.8%) and TTA (4.1%) are used more frequently. This pattern of codon usage reflects the strong bias for T in the mt genome of S. digitata. In conclusion, the present investigation provides new molecular data for future studies of the comparative mitochondrial genomics and systematic of parasitic nematodes of socio-economic importance. 2010 Elsevier B.V. All rights reserved.

  6. Function of the SpoVAEa and SpoVAF Proteins of Bacillus subtilis Spores

    DTIC Science & Technology

    2014-06-01

    outer surface of the spore’s inner membrane, as SpoVAEa was accessible to an external biotinylation agent in spores and SpoVAEa disappeared in parallel...codon was PCR amplified from PS832 chromosomal DNA with primers that inserted BamHI and PstI restriction sites upstream and downstream, respectively... chromosomal structure, and this strain was termed PS4348 (spoVAEa mutant). A B. subtilis strain with a deletion of the spoVF gene was constructed by a two

  7. RNA Editing and Its Molecular Mechanism in Plant Organelles

    PubMed Central

    Ichinose, Mizuho; Sugita, Mamoru

    2016-01-01

    RNA editing by cytidine (C) to uridine (U) conversions is widespread in plant mitochondria and chloroplasts. In some plant taxa, “reverse” U-to-C editing also occurs. However, to date, no instance of RNA editing has yet been reported in green algae and the complex thalloid liverworts. RNA editing may have evolved in early land plants 450 million years ago. However, in some plant species, including the liverwort, Marchantia polymorpha, editing may have been lost during evolution. Most RNA editing events can restore the evolutionarily conserved amino acid residues in mRNAs or create translation start and stop codons. Therefore, RNA editing is an essential process to maintain genetic information at the RNA level. Individual RNA editing sites are recognized by plant-specific pentatricopeptide repeat (PPR) proteins that are encoded in the nuclear genome. These PPR proteins are characterized by repeat elements that bind specifically to RNA sequences upstream of target editing sites. In flowering plants, non-PPR proteins also participate in multiple RNA editing events as auxiliary factors. C-to-U editing can be explained by cytidine deamination. The proteins discovered to date are important factors for RNA editing but a bona fide RNA editing enzyme has yet to be identified. PMID:28025543

  8. Retinoid regulation of the zebrafish cyp26a1 promoter.

    PubMed

    Hu, Ping; Tian, Miao; Bao, Jie; Xing, Guangdong; Gu, Xingxing; Gao, Xiang; Linney, Elwood; Zhao, Qingshun

    2008-12-01

    Cyp26A1 is a major enzyme that controls retinoic acid (RA) homeostasis by metabolizing RA into bio-inactive metabolites. Previous research revealed that the mouse Cyp26A1 promoter has two canonical RA response elements (RAREs) that underlie the regulation of the gene by RA. Analyzing the 2,533-base pairs (2.5 k) genomic sequence upstream of zebrafish cyp26a1 start codon, we report that the two RAREs are conserved in zebrafish cyp26a1 promoter. Mutagenesis demonstrated that the two RAREs work synergistically in RA inducibility of cyp26a1. Fusing the 2.5 k (kilobase pairs) fragment to the enhanced yellow fluorescent protein (eYFP) reporter gene, we have generated two transgenic lines of zebrafish [Tg(cyp26a1:eYFP)]. The transgenic zebrafish display expression patterns similar to that of cyp26a1 gene in vivo. Consistent with the in vitro results, the reporter activity is RA inducible in embryos. Taken together, our results demonstrate that the 2.5 k fragment underlies the regulation of the zebrafish cyp26a1 gene by RA. (c) 2008 Wiley-Liss, Inc.

  9. Identification and use of the putative Bacteroides ovatus xylanase promoter for the inducible production of recombinant human proteins.

    PubMed

    Hamady, Zaed Z R; Farrar, Mark D; Whitehead, Terence R; Holland, Keith T; Lodge, J Peter A; Carding, Simon R

    2008-10-01

    The use of genetically modified bacteria to deliver biologically active molecules directly to the gut has become an increasingly attractive area of investigation. The challenge of regulation of production of the therapeutic molecule and colonization of the bowel led us to investigate Bacteroides ovatus for the production of these molecules, due to its ability to colonize the colon and xylan utilization properties. Here we have identified the putative xylanase promoter. The 5' region of the corresponding mRNA was determined by 5'RACE analysis and the transcription initiation site was identified 216 bp upstream of the ATG start codon. The putative xylanase promoter was regulated by xylan in a dose- and time-dependent manner, and repressed by glucose. This promoter was subsequently used to direct the controlled expression of a gene encoding the human intestinal trefoil factor (TFF-3) after integration as a single copy into the chromosome of B. ovatus. The resulting strain produced biologically active TFF-3 in the presence of xylan. These findings identify the B. ovatus xylanase operon promoter and show that it can be utilized to direct xylan-inducible expression of heterologous eukaryotic genes in B. ovatus.

  10. Ribosome stalling and peptidyl-tRNA drop-off during translational delay at AGA codons

    PubMed Central

    Cruz-Vera, Luis Rogelio; Magos-Castro, Marco Antonio; Zamora-Romo, Efraín; Guarneros, Gabriel

    2004-01-01

    Minigenes encoding the peptide Met–Arg–Arg have been used to study the mechanism of toxicity of AGA codons proximal to the start codon or prior to the termination codon in bacteria. The codon sequences of the ‘mini-ORFs’ employed were initiator, combinations of AGA and CGA, and terminator. Both, AGA and CGA are low-usage Arg codons in ORFs of Escherichia coli but, whilst AGA is translated by the scarce tRNAArg4, CGA is recognized by the abundant tRNAArg2. Overexpression of minigenes harbouring AGA in the third position, next to a termination codon, was deleterious to the cell and led to the accumulation of peptidyl-tRNAArg4 and of the peptidyl-tRNA cognate to the preceding CGA or AGA Arg triplet. The minigenes carrying CGA in the third position were not toxic. Minigene-mediated toxicity and peptidyl-tRNA accumulation were suppressed by overproduction of tRNAArg4 but not by overproduction of peptidyl-tRNA hydrolase, an enzyme that is only active on substrates that have been released from the ribosome. Consistent with these findings, peptidyl-tRNAArg4 was identified to be mainly associated with ribosomes in a stand-by complex. These and previous results support the hypothesis that the primary mechanism of inhibition of protein synthesis by AGA triplets in pth+ cells involves sequestration of tRNAs as peptidyl-tRNA on the stalled ribosome. PMID:15317870

  11. The complete mitochondrial genome of the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae).

    PubMed

    Dai, Li-Shang; Zhu, Bao-Jian; Qian, Cen; Zhang, Cong-Fen; Li, Jun; Wang, Lei; Wei, Guo-Qing; Liu, Chao-Liang

    2016-01-01

    The complete mitochondrial genome (mitogenome) of Plutella xylostella (Lepidoptera: Plutellidae) was determined (GenBank accession No. KM023645). The length of this mitogenome is 16,014 bp with 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes and an A + T-rich region. It presents the typical gene organization and order for completely sequenced lepidopteran mitogenomes. The nucleotide composition of the genome is highly A + T biased, accounting for 81.48%, with a slightly positive AT skewness (0.005). All PCGs are initiated by typical ATN codons, except for the gene cox1, which uses CGA as its start codon. Some PCGs harbor TA (nad5) or incomplete termination codon T (cox1, cox2, nad2 and nad4), while others use TAA as their termination codons. The A + T-rich region is located between rrnS and trnM with a length of 888 bp.

  12. Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.

    PubMed Central

    Eriani, G; Dirheimer, G; Gangloff, J

    1989-01-01

    The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891

  13. NanI Sialidase, CcpA, and CodY Work Together To Regulate Epsilon Toxin Production by Clostridium perfringens Type D Strain CN3718.

    PubMed

    Li, Jihong; Freedman, John C; McClane, Bruce A

    2015-10-01

    Clostridium perfringens type D strains are usually associated with diseases of livestock, and their virulence requires the production of epsilon toxin (ETX). We previously showed (J. Li, S. Sayeed, S. Robertson, J. Chen, and B. A. McClane, PLoS Pathog 7:e1002429, 2011, http://dx.doi.org/10.1371/journal.ppat.1002429) that BMC202, a nanI null mutant of type D strain CN3718, produces less ETX than wild-type CN3718 does. The current study proved that the lower ETX production by strain BMC202 is due to nanI gene disruption, since both genetic and physical (NanI or sialic acid) complementation increased ETX production by BMC202. Furthermore, a sialidase inhibitor that interfered with NanI activity also reduced ETX production by wild-type CN3718. The NanI effect on ETX production was shown to involve reductions in codY and ccpA gene transcription levels in BMC202 versus wild-type CN3718. Similar to CodY, CcpA was found to positively control ETX production. A double codY ccpA null mutant produced even less ETX than a codY or ccpA single null mutant. CcpA bound directly to sequences upstream of the etx or codY start codon, and bioinformatics identified putative CcpA-binding cre sites immediately upstream of both the codY and etx start codons, suggesting possible direct CcpA regulatory effects. A ccpA mutation also decreased codY transcription, suggesting that CcpA effects on ETX production can be both direct and indirect, including effects on codY transcription. Collectively, these results suggest that NanI, CcpA, and CodY work together to regulate ETX production, with NanI-generated sialic acid from the intestines possibly signaling type D strains to upregulate their ETX production and induce disease. Clostridium perfringens NanI was previously shown to increase ETX binding to, and cytotoxicity for, MDCK host cells. The current study demonstrates that NanI also regulates ETX production via increased transcription of genes encoding the CodY and CcpA global regulators. Results obtained using single ccpA or codY null mutants and a ccpA codY double null mutant showed that codY and ccpA regulate ETX production independently of one another but that ccpA also affects codY transcription. Electrophoretic mobility shift assays and bioinformatic analyses suggest that both CodY and CcpA may directly regulate etx transcription. Collectively, results of this study suggest that sialic acid generated by NanI from intestinal sources signals ETX-producing C. perfringens strains, via CcpA and CodY, to upregulate ETX production and cause disease. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Damiani, R.D. Jr.; Wessler, S.R.

    1993-09-01

    The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open readingmore » frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.« less

  15. The complete mitochondrial genome of Gryllotalpa unispina Saussure, 1874 (Orthoptera: Gryllotalpoidea: Gryllotalpidae).

    PubMed

    Zhang, Yulong; Shao, Dandan; Cai, Miao; Yin, Hong; Zhang, Daochuan

    2016-01-01

    The complete mitochondrial genome of Gryllotalpa unispina was 15,513 bp in length and contained 70.9% AT. All G. unispina protein-coding sequences except for the nad2 started with a typical ATN codon. The usual termination codons (TAA) and incomplete stop codons (T) were found from 13 protein-coding genes. All tRNA genes were folded into the typical cloverleaf secondary structure, except trnS(AGN) lacking the dihydrouridine arm. The sizes of the large and small ribosomal RNA genes were 1245 and 725 bp, respectively. The A + T-rich region was 917 bp in length with 76.8%. The orientation and gene order of the G. unispina mitogenome were identical to the G. orientalis and G. pluvialis, there was no phenomenon of "DK rearrangement" which has been widely reported in Caelifera.

  16. Structure and evolution of the mitochondrial genome of Exorista sorbillans: the Tachinidae (Diptera: Calyptratae) perspective.

    PubMed

    Shao, Yuan-jun; Hu, Xian-qiong; Peng, Guang-da; Wang, Rui-xian; Gao, Rui-na; Lin, Chao; Shen, Wei-de; Li, Rui; Li, Bing

    2012-12-01

    The first complete mitochondrial genome (mitogenome) of Tachinidae Exorista sorbillans (Diptera) is sequenced by PCR-based approach. The circular mitogenome is 14,960 bp long and has the representative mitochondrial gene (mt gene) organization and order of Diptera. All protein-coding sequences are initiated with ATN codon; however, the only exception is Cox I gene, which has a 4-bp ATCG putative start codon. Ten of the thirteen protein-coding genes have a complete termination codon (TAA), but the rest are seated on the H strand with incomplete codons. The mitogenome of E. sorbillans is biased toward A+T content at 78.4 %, and the strand-specific bias is in reflection of the third codon positions of mt genes, and their T/C ratios as strand indictor are higher on the H strand more than those on the L strand pointing at any strain of seven Diptera flies. The length of the A+T-rich region of E. sorbillans is 106 bp, including a tandem triple copies of a13-bp fragment. Compared to Haematobia irritans, E. sorbillans holds distant relationship with Drosophila. Phylogenetic topologies based on the amino acid sequences, supporting that E. sorbillans (Tachinidae) is clustered with strains of Calliphoridae and Oestridae, and superfamily Oestroidea are polyphyletic groups with Muscidae in a clade.

  17. The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

    PubMed

    Mathew, Suneeth F; Crowe-McAuliffe, Caillan; Graves, Ryan; Cardno, Tony S; McKinney, Cushla; Poole, Elizabeth S; Tate, Warren P

    2015-01-01

    HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon') contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted) ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1.

  18. The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

    PubMed Central

    Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

    2008-01-01

    Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

  19. Transcriptional Regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK Operons and Their Role in Biofilm Formation

    PubMed Central

    Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.

    2013-01-01

    Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm formation of the ΔlsrR, ΔlsrRK, and Δcrp mutants was significantly reduced relative to that of the wild type, indicating that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. PMID:23104800

  20. Phenotypic Characterization of pncA Mutants of Mycobacterium tuberculosis

    PubMed Central

    Morlock, Glenn P.; Crawford, Jack T.; Butler, W. Ray; Brim, Suzanne E.; Sikes, David; Mazurek, Gerald H.; Woodley, Charles L.; Cooksey, Robert C.

    2000-01-01

    We examined the correlation of mutations in the pyrazinamidase (PZase) gene (pncA) with the pyrazinamide (PZA) resistance phenotype with 60 Mycobacterium tuberculosis isolates. PZase activity was determined by the method of Wayne (L. G. Wayne, Am. Rev. Respir. Dis. 109:147–151, 1974), and the entire pncA nucleotide sequence, including the 74 bp upstream of the start codon, was determined. PZA susceptibility testing was performed by the method of proportions on modified Middlebrook and Cohn 7H10 medium. The PZA MICs were ≥100 μg/ml for 37 isolates, 34 of which had alterations in the pncA gene. These mutations included missense substitutions for 24 isolates, nonsense substitutions for 3 isolates, frameshifts by deletion for 4 isolates, a three-codon insertion for 1 isolate, and putative regulatory mutations for 2 isolates. Among 21 isolates for which PZA MICs were <100 μg/ml, 3 had the same mutation (Thr47→Ala) and 18 had the wild-type sequence. For the three Thr47→Ala mutants PZA MICs were 12.5 μg/ml by the method of proportions on 7H10 agar; two of these were resistant to 100 μg of PZA per ml and the third was resistant to 800 μg of PZA per ml by the BACTEC method. In all, 30 different pncA mutations were found among the 37 pncA mutants. No PZase activity was detected in 35 of 37 strains that were resistant to ≥100 μg of PZA per ml or in 34 of 37 pncA mutants. Reduced PZase activity was found in the three mutants with the Thr47→Ala mutation. This study demonstrates that mutations in the pncA gene may serve as a reliable indicator of resistance to ≥100 μg of PZA per ml. PMID:10952570

  1. [Prediction of Promoter Motifs in Virophages].

    PubMed

    Gong, Chaowen; Zhou, Xuewen; Pan, Yingjie; Wang, Yongjie

    2015-07-01

    Virophages have crucial roles in ecosystems and are the transport vectors of genetic materials. To shed light on regulation and control mechanisms in virophage--host systems as well as evolution between virophages and their hosts, the promoter motifs of virophages were predicted on the upstream regions of start codons using an analytical tool for prediction of promoter motifs: Multiple EM for Motif Elicitation. Seventeen potential promoter motifs were identified based on the E-value, location, number and length of promoters in genomes. Sputnik and zamilon motif 2 with AT-rich regions were distributed widely on genomes, suggesting that these motifs may be associated with regulation of the expression of various genes. Motifs containing the TCTA box were predicted to be late promoter motif in mavirus; motifs containing the ATCT box were the potential late promoter motif in the Ace Lake mavirus . AT-rich regions were identified on motif 2 in the Organic Lake virophage, motif 3 in Yellowstone Lake virophage (YSLV)1 and 2, motif 1 in YSLV3, and motif 1 and 2 in YSLV4, respectively. AT-rich regions were distributed widely on the genomes of virophages. All of these motifs may be promoter motifs of virophages. Our results provide insights into further exploration of temporal expression of genes in virophages as well as associations between virophages and giant viruses.

  2. Consequences of germline variation disrupting the constitutional translational initiation codon start sites of MLH1 and BRCA2: use of potential alternative start sites and implications for predicting variant pathogenicity

    PubMed Central

    Parsons, Michael T.; Whiley, Phillip J.; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A.; Marquart, Louise; Hopper, John L.; Jenkins, Mark A.; Brown, Melissa A.; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D.; Spurdle, Amanda B.

    2014-01-01

    Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. PMID:24302565

  3. Self-organizing approach for meta-genomes.

    PubMed

    Zhu, Jianfeng; Zheng, Wei-Mou

    2014-12-01

    We extend the self-organizing approach for annotation of a bacterial genome to analyze the raw sequencing data of the human gut metagenome without sequence assembling. The original approach divides the genomic sequence of a bacterium into non-overlapping segments of equal length and assigns to each segment one of seven 'phases', among which one is for the noncoding regions, three for the direct coding regions to indicate the three possible codon positions of the segment starting site, and three for the reverse coding regions. The noncoding phase and the six coding phases are described by two frequency tables of the 64 triplet types or 'codon usages'. A set of codon usages can be used to update the phase assignment and vice versa. An iteration after an initialization leads to a convergent phase assignment to give an annotation of the genome. In the extension of the approach to a metagenome, we consider a mixture model of a number of categories described by different codon usages. The Illumina Genome Analyzer sequencing data of the total DNA from faecal samples are then examined to understand the diversity of the human gut microbiome. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. The complete mitochondrial genome of Plodia interpunctella (Lepidoptera: Pyralidae) and comparison with other Pyraloidea insects.

    PubMed

    Liu, Qiu-Ning; Chai, Xin-Yue; Bian, Dan-Dan; Zhou, Chun-Lin; Tang, Bo-Ping

    2016-01-01

    The mitochondrial (mt) genome can provide important information for the understanding of phylogenetic relationships. The complete mt genome of Plodia interpunctella (Lepidoptera: Pyralidae) has been sequenced. The circular genome is 15 287 bp in size, encoding 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and a control region. The AT skew of this mt genome is slightly negative, and the nucleotide composition is biased toward A+T nucleotides (80.15%). All PCGs start with the typical ATN (ATA, ATC, ATG, and ATT) codons, except for the cox1 gene which may start with the CGA codon. Four of the 13 PCGs harbor the incomplete termination codon T or TA. All the tRNA genes are folded into the typical clover-leaf structure of mitochondrial tRNA, except for trnS1 (AGN) in which the DHU arm fails to form a stable stem-loop structure. The overlapping sequences are 35 bp in total and are found in seven different locations. A total of 240 bp of intergenic spacers are scattered in 16 regions. The control region of the mt genome is 327 bp in length and consisted of several features common to the sequenced lepidopteran insects. Phylogenetic analysis based on 13 PCGs using the Maximum Likelihood method shows that the placement of P. interpunctella was within the Pyralidae.

  5. The complete mitochondrial genome of the American black flour beetle Tribolium audax (Coleoptera: Tenebrionidae).

    PubMed

    Ou, Jing; Liu, Jin-Bo; Yao, Fu-Jiao; Wang, Xin-Guo; Wei, Zhao-Ming

    2016-01-01

    Flour beetles of the genus Tribolium are all pests of stored products and cause severe economic losses every year. The American black flour beetle Tribolium audax is one of the important pest species of flour beetle, and it is also an important quarantine insect. Here we sequenced and characterized the complete mitochondrial genome of T. audax, which was intercepted by Huangpu Custom in maize from America. The complete circular mitochondrial genome (mitogenome) of T. audax was 15,924 bp in length, containing 37 typical coding genes and one non-coding AT-rich region. The mitogenome of T. audax exhibits a gene arrangement and content identical to the most common type in insects. All protein coding genes (PCGs) are start with a typical ATN initiation codon, except for the cox1, which use AAC as its start codon instead of ATN. Eleven genes use standard complete termination codon (nine TAA, two TAG), whereas the nad4 and nad5 genes end with single T. Except for trnS1 (AGN), all tRNA genes display typical secondary cloverleaf structures as those of other insects. The sizes of the large and small ribosomal RNA genes are 1288 and 780 bp, respectively. The AT content of the AT-rich region is 81.36%. The 5 bp conserved motif TACTA was found in the intergenic region between trnS2 (UCN) and nad1.

  6. Structure of a human cap-dependent 48S translation pre-initiation complex

    PubMed Central

    Eliseev, Boris; Yeramala, Lahari; Leitner, Alexander; Karuppasamy, Manikandan; Raimondeau, Etienne; Huard, Karine; Alkalaeva, Elena; Aebersold, Ruedi

    2018-01-01

    Abstract Eukaryotic translation initiation is tightly regulated, requiring a set of conserved initiation factors (eIFs). Translation of a capped mRNA depends on the trimeric eIF4F complex and eIF4B to load the mRNA onto the 43S pre-initiation complex comprising 40S and initiation factors 1, 1A, 2, 3 and 5 as well as initiator-tRNA. Binding of the mRNA is followed by mRNA scanning in the 48S pre-initiation complex, until a start codon is recognised. Here, we use a reconstituted system to prepare human 48S complexes assembled on capped mRNA in the presence of eIF4B and eIF4F. The highly purified h-48S complexes are used for cross-linking/mass spectrometry, revealing the protein interaction network in this complex. We report the electron cryo-microscopy structure of the h-48S complex at 6.3 Å resolution. While the majority of eIF4B and eIF4F appear to be flexible with respect to the ribosome, additional density is detected at the entrance of the 40S mRNA channel which we attribute to the RNA-recognition motif of eIF4B. The eight core subunits of eIF3 are bound at the 40S solvent-exposed side, as well as the subunits eIF3d, eIF3b and eIF3i. elF2 and initiator-tRNA bound to the start codon are present at the 40S intersubunit side. This cryo-EM structure represents a molecular snap-shot revealing the h-48S complex following start codon recognition. PMID:29401259

  7. Use of signal sequences as an in situ removable sequence element to stimulate protein synthesis in cell-free extracts

    PubMed Central

    Ahn, Jin-Ho; Hwang, Mi-Yeon; Lee, Kyung-Ho; Choi, Cha-Yong; Kim, Dong-Myung

    2007-01-01

    This study developed a method to boost the expression of recombinant proteins in a cell-free protein synthesis system without leaving additional amino acid residues. It was found that the nucleotide sequences of the signal peptides serve as an efficient downstream box to stimulate protein synthesis when they were fused upstream of the target genes. The extent of stimulation was critically affected by the identity of the second codons of the signal sequences. Moreover, the yield of the synthesized protein was enhanced by as much as 10 times in the presence of an optimal second codon. The signal peptides were in situ cleaved and the target proteins were produced in their native sizes by carrying out the cell-free synthesis reactions in the presence of Triton X-100, most likely through the activation of signal peptidase in the S30 extract. The amplification of the template DNA and the addition of the signal sequences were accomplished by PCR. Hence, elevated levels of recombinant proteins were generated within several hours. PMID:17185295

  8. Complete mitochondrial genome of yellow meal worm(Tenebrio molitor)

    PubMed Central

    LIU, Li-Na; WANG, Cheng-Ye

    2014-01-01

    The yellow meal worm(Tenebrio molitor L.) is an important resource insect typically used as animal feed additive. It is also widely used for biological research. The first complete mitochondrial genome of T. molitor was determined for the first time by long PCR and conserved primer walking approaches. The results showed that the entire mitogenome of T. molitor was 15 785 bp long, with 72.35% A+T content [deposited in GenBank with accession number KF418153]. The gene order and orientation were the same as the most common type suggested as ancestral for insects. Two protein-coding genes used atypical start codons(CTA in ND2 and AAT in COX1), and the remaining 11 protein-coding genes started with a typical insect initiation codon ATN. All tRNAs showed standard clover-leaf structure, except for tRNASer(AGN), which lacked a dihydrouridine(DHU) arm. The newly added T. molitor mitogenome could provide information for future studies on yellow meal worm. PMID:25465087

  9. Complete mitochondrial genome of yellow meal worm (Tenebrio molitor).

    PubMed

    Liu, Li-Na; Wang, Cheng-Ye

    2014-11-18

    The yellow meal worm (Tenebrio molitor L.) is an important resource insect typically used as animal feed additive. It is also widely used for biological research. The first complete mitochondrial genome of T. molitor was determined for the first time by long PCR and conserved primer walking approaches. The results showed that the entire mitogenome of T. molitor was 15 785 bp long, with 72.35% A+T content [deposited in GenBank with accession number KF418153]. The gene order and orientation were the same as the most common type suggested as ancestral for insects. Two protein-coding genes used atypical start codons (CTA in ND2 and AAT in COX1), and the remaining 11 protein-coding genes started with a typical insect initiation codon ATN. All tRNAs showed standard clover-leaf structure, except for tRNA(Ser) (AGN), which lacked a dihydrouridine (DHU) arm. The newly added T. molitor mitogenome could provide information for future studies on yellow meal worm.

  10. The complete mitochondrial genome of the pink stem borer, Sesamia inferens, in comparison with four other Noctuid moths.

    PubMed

    Chai, Huan-Na; Du, Yu-Zhou

    2012-01-01

    The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; cox1, cox2, and nad4 genes had the truncated termination codon T in the S. inferens mitogenome. All of the tRNA genes had typical cloverleaf secondary structures except for trnS1(AGN), in which the dihydrouridine (DHU) arm did not form a stable stem-loop structure. Both the secondary structures of rrnL and rrnS genes inferred from the S. inferens mitogenome closely resembled those of other noctuid moths. In the A+T-rich region, the conserved motif "ATAGA" followed by a long T-stretch was observed in all noctuid moths, but other specific tandem-repeat elements were more variable. Additionally, the S. inferens mitogenome contained a potential stem-loop structure, a duplicated 17-bp repeat element, a decuplicated segment, and a microsatellite "(AT)(7)", without a poly-A element upstream of the trnM in the A+T-rich region. Finally, the phylogenetic relationships were reconstructed based on amino acid sequences of mitochondrial 13 PCGs, which support the traditional morphologically based view of relationships within the Noctuidae.

  11. The Complete Mitochondrial Genome of the Pink Stem Borer, Sesamia inferens, in Comparison with Four Other Noctuid Moths

    PubMed Central

    Chai, Huan-Na; Du, Yu-Zhou

    2012-01-01

    The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; cox1, cox2, and nad4 genes had the truncated termination codon T in the S. inferens mitogenome. All of the tRNA genes had typical cloverleaf secondary structures except for trnS1(AGN), in which the dihydrouridine (DHU) arm did not form a stable stem-loop structure. Both the secondary structures of rrnL and rrnS genes inferred from the S. inferens mitogenome closely resembled those of other noctuid moths. In the A+T-rich region, the conserved motif “ATAGA” followed by a long T-stretch was observed in all noctuid moths, but other specific tandem-repeat elements were more variable. Additionally, the S. inferens mitogenome contained a potential stem-loop structure, a duplicated 17-bp repeat element, a decuplicated segment, and a microsatellite “(AT)7”, without a poly-A element upstream of the trnM in the A+T-rich region. Finally, the phylogenetic relationships were reconstructed based on amino acid sequences of mitochondrial 13 PCGs, which support the traditional morphologically based view of relationships within the Noctuidae. PMID:22949858

  12. Genetic hotels for the standard genetic code: evolutionary analysis based upon novel three-dimensional algebraic models.

    PubMed

    José, Marco V; Morgado, Eberto R; Govezensky, Tzipe

    2011-07-01

    Herein, we rigorously develop novel 3-dimensional algebraic models called Genetic Hotels of the Standard Genetic Code (SGC). We start by considering the primeval RNA genetic code which consists of the 16 codons of type RNY (purine-any base-pyrimidine). Using simple algebraic operations, we show how the RNA code could have evolved toward the current SGC via two different intermediate evolutionary stages called Extended RNA code type I and II. By rotations or translations of the subset RNY, we arrive at the SGC via the former (type I) or via the latter (type II), respectively. Biologically, the Extended RNA code type I, consists of all codons of the type RNY plus codons obtained by considering the RNA code but in the second (NYR type) and third (YRN type) reading frames. The Extended RNA code type II, comprises all codons of the type RNY plus codons that arise from transversions of the RNA code in the first (YNY type) and third (RNR) nucleotide bases. Since the dimensions of remarkable subsets of the Genetic Hotels are not necessarily integer numbers, we also introduce the concept of algebraic fractal dimension. A general decoding function which maps each codon to its corresponding amino acid or the stop signals is also derived. The Phenotypic Hotel of amino acids is also illustrated. The proposed evolutionary paths are discussed in terms of the existing theories of the evolution of the SGC. The adoption of 3-dimensional models of the Genetic and Phenotypic Hotels will facilitate the understanding of the biological properties of the SGC.

  13. Defect in the GTPase activating protein (GAP) function of eIF5 causes repression of GCN4 translation.

    PubMed

    Antony A, Charles; Alone, Pankaj V

    2017-05-13

    In eukaryotes, the eIF5 protein plays an important role in translation start site selection by providing the GAP (GTPase activating protein) function. However, in yeast translation initiation fidelity defective eIF5 G31R mutant causes preferential utilization of UUG as initiation codon and is termed as Suppressor of initiation codon (Sui - ) phenotype due to its hyper GTPase activity. The eIF5 G31R mutant dominantly represses GCN4 expression and confers sensitivity to 3-Amino-1,2,4-Trizole (3AT) induced starvation. The down-regulation of the GCN4 expression (Gcn - phenotype) in the eIF5 G31R mutant was not because of leaky scanning defects; rather was due to the utilization of upUUG initiation codons at the 5' regulatory region present between uORF1 and the main GCN4 ORF. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Sequence Analysis of Mitochondrial Genome of Toxascaris leonina from a South China Tiger.

    PubMed

    Li, Kangxin; Yang, Fang; Abdullahi, A Y; Song, Meiran; Shi, Xianli; Wang, Minwei; Fu, Yeqi; Pan, Weida; Shan, Fang; Chen, Wu; Li, Guoqing

    2016-12-01

    Toxascaris leonina is a common parasitic nematode of wild mammals and has significant impacts on the protection of rare wild animals. To analyze population genetic characteristics of T. leonina from South China tiger, its mitochondrial (mt) genome was sequenced. Its complete circular mt genome was 14,277 bp in length, including 12 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 2 non-coding regions. The nucleotide composition was biased toward A and T. The most common start codon and stop codon were TTG and TAG, and 4 genes ended with an incomplete stop codon. There were 13 intergenic regions ranging 1 to 10 bp in size. Phylogenetically, T. leonina from a South China tiger was close to canine T. leonina . This study reports for the first time a complete mt genome sequence of T. leonina from the South China tiger, and provides a scientific basis for studying the genetic diversity of nematodes between different hosts.

  15. Evidence for the recent origin of a bacterial protein-coding, overlapping orphan gene by evolutionary overprinting.

    PubMed

    Fellner, Lea; Simon, Svenja; Scherling, Christian; Witting, Michael; Schober, Steffen; Polte, Christine; Schmitt-Kopplin, Philippe; Keim, Daniel A; Scherer, Siegfried; Neuhaus, Klaus

    2015-12-18

    Gene duplication is believed to be the classical way to form novel genes, but overprinting may be an important alternative. Overprinting allows entirely novel proteins to evolve de novo, i.e., formerly non-coding open reading frames within functional genes become expressed. Only three cases have been described for Escherichia coli. Here, a fourth example is presented. RNA sequencing revealed an open reading frame weakly transcribed in cow dung, coding for 101 residues and embedded completely in the -2 reading frame of citC in enterohemorrhagic E. coli. This gene is designated novel overlapping gene, nog1. The promoter region fused to gfp exhibits specific activities and 5' rapid amplification of cDNA ends indicated the transcriptional start 40-bp upstream of the start codon. nog1 was strand-specifically arrested in translation by a nonsense mutation silent in citC. This Nog1-mutant showed a phenotype in competitive growth against wild type in the presence of MgCl2. Small differences in metabolite concentrations were also found. Bioinformatic analyses propose Nog1 to be inner membrane-bound and to possess at least one membrane-spanning domain. A phylogenetic analysis suggests that the orphan gene nog1 arose by overprinting after Escherichia/Shigella separated from the other γ-proteobacteria. Since nog1 is of recent origin, non-essential, short, weakly expressed and only marginally involved in E. coli's central metabolism, we propose that this gene is in an initial stage of evolution. While we present specific experimental evidence for the existence of a fourth overlapping gene in enterohemorrhagic E. coli, we believe that this may be an initial finding only and overlapping genes in bacteria may be more common than is currently assumed by microbiologists.

  16. Structure of the 5' region of the Hst70 gene transcription unit: presence of an intron and multiple transcription initiation sites.

    PubMed Central

    Scieglinska, D; Widłak, W; Konopka, W; Poutanen, M; Rahman, N; Huhtaniemi, I; Krawczyk, Z

    2001-01-01

    The rat Hst70 gene and its mouse counterpart Hsp70.2 belong to the family of Hsp70 heat shock genes and are specifically expressed in male germ cells. Previous studies regarding the structure of the 5' region of the transcription unit of these genes as well as localization of the 'cis' elements conferring their testis-specific expression gave contradictory results [Widlak, Markkula, Krawczyk, Kananen and Huhtaniemi (1995) Biochim. Biophys. Acta 1264, 191-200; Dix, Rosario-Herrle, Gotoh, Mori, Goulding, Barret and Eddy (1996) Dev. Biol. 174, 310-321]. In the present paper we solve these controversies and show that the 5' untranslated region (UTR) of the Hst70 gene contains an intron which is localized similar to that of the mouse Hsp70.2 gene. Reverse transcriptase-mediated PCR, Northern blotting and RNase protection analysis revealed that the transcription initiation of both genes starts at two main distant sites, and one of them is localized within the intron. As a result two populations of Hst70 gene transcripts with similar sizes but different 5' UTR structures can be detected in total testicular RNA. Functional analysis of the Hst70 gene promoter in transgenic mice and transient transfection assays proved that the DNA fragment of approx. 360 bp localized upstream of the ATG transcription start codon is the minimal promoter required for testis-specific expression of the HST70/chloramphenicol acetyltransferase transgene. These experiments also suggest that the expression of the gene may depend on 'cis' regulatory elements localized within exon 1 and the intron sequences. PMID:11563976

  17. Cu,Zn superoxide dismutase: cloning and analysis of the Taenia solium gene and Taenia crassiceps cDNA.

    PubMed

    Parra-Unda, Ricardo; Vaca-Paniagua, Felipe; Jiménez, Lucia; Landa, Abraham

    2012-01-01

    Cytosolic Cu,Zn superoxide dismutase (Cu,Zn-SOD) catalyzes the dismutation of superoxide (O(2)(-)) to oxygen and hydrogen peroxide (H(2)O(2)) and plays an important role in the establishment and survival of helminthes in their hosts. In this work, we describe the Taenia solium Cu,Zn-SOD gene (TsCu,Zn-SOD) and a Taenia crassiceps (TcCu,Zn-SOD) cDNA. TsCu,Zn-SOD gene that spans 2.841 kb, and has three exons and two introns; the splicing junctions follow the GT-AG rule. Analysis in silico of the gene revealed that the 5'-flanking region has three putative TATA and CCAAT boxes, and transcription factor binding sites for NF1 and AP1. The transcription start site was a C, located at 22 nucleotides upstream of the translation start codon (ATG). Southern blot analysis showed that TcCu,Zn-SOD and TsCu,Zn-SOD genes are encoded by a single copy. The deduced amino acid sequences of TsCu,Zn-SOD gene and TcCu,Zn-SOD cDNA reveal 98.47% of identity, and the characteristic motives, including the catalytic site and β-barrel structure of the Cu,Zn-SOD. Proteomic and immunohistochemical analysis indicated that Cu,Zn-SOD does not have isoforms, is distributed throughout the bladder wall and is concentrated in the tegument of T. solium and T. crassiceps cysticerci. Expression analysis revealed that TcCu,Zn-SOD mRNA and protein expression levels do not change in cysticerci, even upon exposure to O(2)(-) (0-3.8 nmol/min) and H(2)O(2) (0-2mM), suggesting that this gene is constitutively expressed in these parasites. Published by Elsevier Inc.

  18. PHENOTYPIC VARIABILITY IN INDIVIDUALS WITH TYPE V OSTEOGENESIS IMPERFECTA WITH IDENTICAL IFITM5 MUTATIONS

    PubMed Central

    Fitzgerald, Jamie; Holden, Paul; Wright, Hollis; Wilmot, Beth; Hata, Abigail; Steiner, Robert D.; Basel, Don

    2016-01-01

    Background Osteogenesis imperfecta (OI) type V is a dominantly inherited skeletal dysplasia characterized by fractures and progressive deformity of long bones. In addition, patients often present with radial head dislocation, hyperplastic callus, and calcification of the forearm interosseous membrane. Recently, a specific mutation in the IFITM5 gene was found to be responsible for OI type V. This mutation, a C to T transition 14 nucleotides upstream from the endogenous start codon, creates a new start methionine that appears to be preferentially used by the translational machinery. However, the mechanism by which the lengthened protein results in a dominant type of OI is unknown. Methods and Results We report 7 ethnically diverse (African-American, Caucasian, Hispanic, and African) individuals with OI type V from 2 families and 2 sporadic cases. Exome sequencing failed to identify a causative mutation. Using Sanger sequencing, we found that all affected individuals in our cohort possess the c.−14 IFITM5 variant, further supporting the notion that OI type V is caused by a single, discrete mutation. Our patient cohort demonstrated inter-and intrafamilial phenotypic variability, including a father with classic OI type V whose daughter had a phenotype similar to OI type I. This clinical variability suggests that modifier genes influence the OI type V phenotype. We also confirm that the mutation creates an aberrant IFITM5 protein containing an additional 5 amino acids at the N-terminus. Conclusions The variable clinical signs in these cases illustrate the significant variability of the OI type V phenotype caused by the c.−14 IFITM5 mutation. The affected individuals are more ethnically diverse than previously reported. PMID:28824928

  19. Role of extracytoplasmic function sigma factor PG1660 (RpoE) in the oxidative stress resistance regulatory network of Porphyromonas gingivalis

    PubMed Central

    Dou, Y.; Rutanhira, H.; Chen, X.; Mishra, A.; Wang, C.; Fletcher, H.M.

    2018-01-01

    Summary In Porphyromonas gingivalis, the protein PG1660, composed of 174 amino acids, is annotated as an extracytoplasmic function (ECF) sigma factor (RpoE homologue-σ24). Because PG1660 can modulate several virulence factors and responds to environmental signals in P. gingivalis, its genetic properties were evaluated. PG1660 is co-transcribed with its downstream gene PG1659, and the transcription start site was identified as adenine residue 54-nucleotides upstream of the ATG translation start codon. In addition to binding its own promoter, using the purified rPG1660 and RNAP core enzyme from Escherichia coli with the PG1660 promoter DNA as template, the function of PG1660 as a sigma factor was demonstrated in an in vitro transcription assay. Transcriptome analyses of a P. gingivalis PG1660-defective isogenic mutant revealed that under oxidative stress conditions 176 genes including genes involved in secondary metabolism were downregulated more than two-fold compared with the parental strain. The rPG1660 protein also showed the ability to bind to the promoters of the highly downregulated genes in the PG1660-deficient mutant. As the ECF sigma factor PG0162 has a 29% identity with PG1660 and can modulate its expression, the cross-talk between their regulatory networks was explored. The expression profile of the PG0162PG1660-deficient mutant (P. gingivalis FLL356) revealed that the type IX secretion system genes and several virulence genes were downregulated under hydrogen peroxide stress conditions. Taken together, we have confirmed that PG1660 can function as a sigma factor, and plays an important regulatory role in the oxidative stress and virulence regulatory network of P. gingivalis. PMID:29059500

  20. Beyond the Triplet Code: Context Cues Transform Translation.

    PubMed

    Brar, Gloria A

    2016-12-15

    The elucidation of the genetic code remains among the most influential discoveries in biology. While innumerable studies have validated the general universality of the code and its value in predicting and analyzing protein coding sequences, established and emerging work has also suggested that full genome decryption may benefit from a greater consideration of a codon's neighborhood within an mRNA than has been broadly applied. This Review examines the evidence for context cues in translation, with a focus on several recent studies that reveal broad roles for mRNA context in programming translation start sites, the rate of translation elongation, and stop codon identity. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Insights into factorless translational initiation by the tRNA-like pseudoknot domain of a viral IRES.

    PubMed

    Au, Hilda H T; Jan, Eric

    2012-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae family adopts an overlapping triple pseudoknot structure to directly recruit the 80S ribosome in the absence of initiation factors. The pseudoknot I (PKI) domain of the IRES mimics a tRNA-like codon:anticodon interaction in the ribosomal P site to direct translation initiation from a non-AUG initiation codon in the A site. In this study, we have performed a comprehensive mutational analysis of this region to delineate the molecular parameters that drive IRES translation. We demonstrate that IRES-mediated translation can initiate at an alternate adjacent and overlapping start site, provided that basepairing interactions within PKI remain intact. Consistent with this, IGR IRES translation tolerates increases in the variable loop region that connects the anticodon- and codon-like elements within the PKI domain, as IRES activity remains relatively robust up to a 4-nucleotide insertion in this region. Finally, elements from an authentic tRNA anticodon stem-loop can functionally supplant corresponding regions within PKI. These results verify the importance of the codon:anticodon interaction of the PKI domain and further define the specific elements within the tRNA-like domain that contribute to optimal initiator Met-tRNA(i)-independent IRES translation.

  2. Insights into Factorless Translational Initiation by the tRNA-Like Pseudoknot Domain of a Viral IRES

    PubMed Central

    Au, Hilda H. T.; Jan, Eric

    2012-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae family adopts an overlapping triple pseudoknot structure to directly recruit the 80S ribosome in the absence of initiation factors. The pseudoknot I (PKI) domain of the IRES mimics a tRNA-like codon:anticodon interaction in the ribosomal P site to direct translation initiation from a non-AUG initiation codon in the A site. In this study, we have performed a comprehensive mutational analysis of this region to delineate the molecular parameters that drive IRES translation. We demonstrate that IRES-mediated translation can initiate at an alternate adjacent and overlapping start site, provided that basepairing interactions within PKI remain intact. Consistent with this, IGR IRES translation tolerates increases in the variable loop region that connects the anticodon- and codon-like elements within the PKI domain, as IRES activity remains relatively robust up to a 4-nucleotide insertion in this region. Finally, elements from an authentic tRNA anticodon stem-loop can functionally supplant corresponding regions within PKI. These results verify the importance of the codon:anticodon interaction of the PKI domain and further define the specific elements within the tRNA-like domain that contribute to optimal initiator Met-tRNAi-independent IRES translation. PMID:23236506

  3. Purification and characterization of an endoglucanase from Streptomyces lividans 66 and DNA sequence of the gene.

    PubMed Central

    Théberge, M; Lacaze, P; Shareck, F; Morosoli, R; Kluepfel, D

    1992-01-01

    The endoglucanase isolated from culture filtrates of Streptomyces lividans IAF74 was shown to have an Mr of 46,000 and a pI of 3.3. The specific enzyme activity of 539 IU/mg, determined by the reducing assay method on carboxymethyl cellulose, is among the highest reported in the literature. The cellulase showed typical endo-type activity when reacting on oligocellodextrins. Optimal enzyme activity was obtained at 50 degrees C and pH 5.5. The kinetic constants for this endoglucanase, determined with carboxymethyl cellulose as the substrate, were a Vmax of 24.9 IU/mg of enzyme and a Km of 4.2 mg/ml. Activity was found against neither methylumbelliferyl- nor p-nitrophenyl-cellobiopyranoside nor with xylan. The DNA sequence contains one possible reading frame validated by the N terminus of the mature purified protein. However, neither ATG nor GTG starting codons were identified near the ribosome-binding site. A putative TTG codon was found as a good candidate for the start codon. Comparison of the primary amino acid sequence of the endoglucanase of S. lividans revealed that the N terminus contains a bacterial cellulose-binding domain. The catalytic domain at the C terminus showed similarity to endoglucanases from a Bacillus sp. Thus, the endoglucanase CelA belongs to family A of cellulases as described before (N. R. Gilkes, B. Henrissat, D. G. Kilburn, R. C. Miller, Jr., and R. A. J. Warren, Microbiol. Rev. 55:303-315, 1991. Images PMID:1575483

  4. Complete Mitochondrial Genome of Suwallia teleckojensis (Plecoptera: Chloroperlidae) and Implications for the Higher Phylogeny of Stoneflies

    PubMed Central

    Cao, Jin-Jun; Li, Wei-Hai

    2018-01-01

    Stoneflies comprise an ancient group of insects, but the phylogenetic position of Plecoptera and phylogenetic relations within Plecoptera have long been controversial, and more molecular data is required to reconstruct precise phylogeny. Herein, we present the complete mitogenome of a stonefly, Suwallia teleckojensis, which is 16146 bp in length and consists of 13 protein-coding genes (PCGs), 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and a control region (CR). Most PCGs initiate with the standard start codon ATN. However, ND5 and ND1 started with GTG and TTG. Typical termination codons TAA and TAG were found in eleven PCGs, and the remaining two PCGs (COII and ND5) have incomplete termination codons. All transfer RNA genes (tRNAs) have the classic cloverleaf secondary structures, with the exception of tRNASer(AGN), which lacks the dihydrouridine (DHU) arm. Secondary structures of the two ribosomal RNAs were shown referring to previous models. A large tandem repeat region, two potential stem-loop (SL) structures, Poly N structure (2 poly-A, 1 poly-T and 1 poly-C), and four conserved sequence blocks (CSBs) were detected in the control region. Finally, both maximum likelihood (ML) and Bayesian inference (BI) analyses suggested that the Capniidae was monophyletic, and the other five stonefly families form a monophyletic group. In this study, S. teleckojensis was closely related to Sweltsa longistyla, and Chloroperlidae and Perlidae were herein supported to be a sister group. PMID:29495588

  5. Complete Mitochondrial Genome of Suwallia teleckojensis (Plecoptera: Chloroperlidae) and Implications for the Higher Phylogeny of Stoneflies.

    PubMed

    Wang, Ying; Cao, Jin-Jun; Li, Wei-Hai

    2018-02-28

    Stoneflies comprise an ancient group of insects, but the phylogenetic position of Plecoptera and phylogenetic relations within Plecoptera have long been controversial, and more molecular data is required to reconstruct precise phylogeny. Herein, we present the complete mitogenome of a stonefly, Suwallia teleckojensis , which is 16146 bp in length and consists of 13 protein-coding genes (PCGs), 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and a control region (CR). Most PCGs initiate with the standard start codon ATN. However, ND5 and ND1 started with GTG and TTG. Typical termination codons TAA and TAG were found in eleven PCGs, and the remaining two PCGs ( COII and ND5 ) have incomplete termination codons. All transfer RNA genes (tRNAs) have the classic cloverleaf secondary structures, with the exception of tRNA Ser(AGN) , which lacks the dihydrouridine (DHU) arm. Secondary structures of the two ribosomal RNAs were shown referring to previous models. A large tandem repeat region, two potential stem-loop (SL) structures, Poly N structure (2 poly-A, 1 poly-T and 1 poly-C), and four conserved sequence blocks (CSBs) were detected in the control region. Finally, both maximum likelihood (ML) and Bayesian inference (BI) analyses suggested that the Capniidae was monophyletic, and the other five stonefly families form a monophyletic group. In this study, S. teleckojensis was closely related to Sweltsa longistyla , and Chloroperlidae and Perlidae were herein supported to be a sister group.

  6. Constitutive expression of catABC genes in the aniline-assimilating bacterium Rhodococcus species AN-22: production, purification, characterization and gene analysis of CatA, CatB and CatC

    PubMed Central

    Matsumura, Eitaro; Sakai, Masashi; Hayashi, Katsuaki; Murakami, Shuichiro; Takenaka, Shinji; Aoki, Kenji

    2005-01-01

    The aniline-assimilating bacterium Rhodococcus sp. AN-22 was found to constitutively synthesize CatB (cis,cis-muconate cycloisomerase) and CatC (muconolactone isomerase) in its cells growing on non-aromatic substrates, in addition to the previously reported CatA (catechol 1,2-dioxygenase). The bacterium maintained the specific activity of the three enzymes at an almost equal level during cultivation on succinate. CatB and CatC were purified to homogeneity and characterized. CatB was a monomer with a molecular mass of 44 kDa. The enzyme was activated by Mn2+, Co2+ and Mg2+. Native CatC was a homo-octamer with a molecular mass of 100 kDa. The enzyme was stable between pH 7.0 and 10.5 and was resistant to heating up to 90 °C. Genes coding for CatA, CatB and CatC were cloned and named catA, catB and catC respectively. The catABC genes were transcribed as one operon. The deduced amino acid sequences of CatA, CatB and CatC showed high identities with those from other Gram-positive micro-organisms. A regulator gene such as catR encoding a regulatory protein was not observed around the cat gene cluster of Rhodococcus sp. AN-22, but a possible relic of catR was found in the upstream region of catA. Reverse transcriptase-PCR and primer extension analyses showed that the transcriptional start site of the cat gene cluster was located 891 bp upstream of the catA initiation codon in the AN-22 strain growing on both aniline and succinate. Based on these data, we concluded that the bacterium constitutively transcribed the catABC genes and translated its mRNA into CatA, CatB and CatC. PMID:16156722

  7. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Ribosome Profiling Reveals a Cell-Type-Specific Translational Landscape in Brain Tumors

    PubMed Central

    Gonzalez, Christian; Sims, Jennifer S.; Hornstein, Nicholas; Mela, Angeliki; Garcia, Franklin; Lei, Liang; Gass, David A.; Amendolara, Benjamin; Bruce, Jeffrey N.

    2014-01-01

    Glioma growth is driven by signaling that ultimately regulates protein synthesis. Gliomas are also complex at the cellular level and involve multiple cell types, including transformed and reactive cells in the brain tumor microenvironment. The distinct functions of the various cell types likely lead to different requirements and regulatory paradigms for protein synthesis. Proneural gliomas can arise from transformation of glial progenitors that are driven to proliferate via mitogenic signaling that affects translation. To investigate translational regulation in this system, we developed a RiboTag glioma mouse model that enables cell-type-specific, genome-wide ribosome profiling of tumor tissue. Infecting glial progenitors with Cre-recombinant retrovirus simultaneously activates expression of tagged ribosomes and delivers a tumor-initiating mutation. Remarkably, we find that although genes specific to transformed cells are highly translated, their translation efficiencies are low compared with normal brain. Ribosome positioning reveals sequence-dependent regulation of ribosomal activity in 5′-leaders upstream of annotated start codons, leading to differential translation in glioma compared with normal brain. Additionally, although transformed cells express a proneural signature, untransformed tumor-associated cells, including reactive astrocytes and microglia, express a mesenchymal signature. Finally, we observe the same phenomena in human disease by combining ribosome profiling of human proneural tumor and non-neoplastic brain tissue with computational deconvolution to assess cell-type-specific translational regulation. PMID:25122893

  9. Characterization of the human peroxisome proliferator activated receptor delta gene and its expression.

    PubMed

    Skogsberg, J; Kannisto, K; Roshani, L; Gagne, E; Hamsten, A; Larsson, C; Ehrenborg, E

    2000-07-01

    Peroxisome proliferator activated receptors (PPARs) are nuclear receptors regulating the expression of genes involved in lipid and glucose metabolism. Three different PPARs; alpha (PPARA), gamma (PPARG) and delta (PPARD) have been characterized and they are distinguished from each other by tissue distribution and cell activation. In this study, the structure and detailed chromosomal localization of the human PPARD gene was determined. Three genomic clones containing the PPARD gene was isolated from a human P1 library. The gene spans approximately 85 kb of DNA and consists of 9 exons and 8 introns with exons ranging in size from 84 bp to 2.3 kb and introns ranging from 180 bp to 50 kb. All splice acceptor and donor sites conform to the consensus sequences including the AG-GT motif. Although PPARD lacks a TATA box, the gene is transcribed from a unique start site located 380 bp upstream of the ATG initiation codon. The 5' and 3' ends were mapped by rapid amplification of cDNA ends and the mRNA size of PPARD based upon the structure of the gene is 3803 bp. In addition, the chromosomal sublocalization of PPARD was determined by radiation hybrid mapping. The PPARD gene is located at 14 cR from the colipase gene and 15 cR from the serine kinase gene at chromosomal region 6p21.2.

  10. Bm91 is an envelope component of ODV but is dispensable for the propagation of Bombyx mori nucleopolyhedrovirus.

    PubMed

    Tang, Qi; Li, Guohui; Yao, Qin; Chen, Liang; Lv, Peng; Lian, Chaoqun; Chen, Keping

    2013-05-01

    Orf91 (Bm91) of Bombyx mori nucleopolyhedrovirus (BmNPV) is a highly conserved gene that encodes a predicted 105-amino-acid protein, but its function remains unknown. In the current study, 5'-RACE revealed that the transcription initiation site of Bm91 was - 12 nucleotides upstream of the start codon ATG, transcription of Bm91 was detected from 12 to 96 h postinfection (p.i.) and Bm91 protein was detected from 24 to 96 h p.i. in BmNPV-infected BmN cells. Furthermore, Western blot analysis revealed that Bm91 was in occlusion-derived virus (ODV) but not in budded virus (BV). To investigate the role of Bm91 in baculovirus life cycle, a Bm91-knockout virus was constructed by bacmid recombination in E. coli. Fluorescence and light microscopy showed that the production of BV and occlusion bodies (OBs) in Bm91-deficient-virus-infected BmN cells were similar to those in wild-type-virus-infected ones. Bioassay results showed that genetic deletion of Bm91 did not significantly affect BmNPV infectivity, but extended the median lethal time (LT50). Taken together, these results indicate that Bm91 is not essential for viral propagation in vitro, but absence of the gene may affect the virulence of ODVs in silkworm larvae. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Bioinformatic analysis suggests that the Orbivirus VP6 cistron encodes an overlapping gene

    PubMed Central

    Firth, Andrew E

    2008-01-01

    Background The genus Orbivirus includes several species that infect livestock – including Bluetongue virus (BTV) and African horse sickness virus (AHSV). These viruses have linear dsRNA genomes divided into ten segments, all of which have previously been assumed to be monocistronic. Results Bioinformatic evidence is presented for a short overlapping coding sequence (CDS) in the Orbivirus genome segment 9, overlapping the VP6 cistron in the +1 reading frame. In BTV, a 77–79 codon AUG-initiated open reading frame (hereafter ORFX) is present in all 48 segment 9 sequences analysed. The pattern of base variations across the 48-sequence alignment indicates that ORFX is subject to functional constraints at the amino acid level (even when the constraints due to coding in the overlapping VP6 reading frame are taken into account; MLOGD software). In fact the translated ORFX shows greater amino acid conservation than the overlapping region of VP6. The ORFX AUG codon has a strong Kozak context in all 48 sequences. Each has only one or two upstream AUG codons, always in the VP6 reading frame, and (with a single exception) always with weak or medium Kozak context. Thus, in BTV, ORFX may be translated via leaky scanning. A long (83–169 codon) ORF is present in a corresponding location and reading frame in all other Orbivirus species analysed except Saint Croix River virus (SCRV; the most divergent). Again, the pattern of base variations across sequence alignments indicates multiple coding in the VP6 and ORFX reading frames. Conclusion At ~9.5 kDa, the putative ORFX product in BTV is too small to appear on most published protein gels. Nonetheless, a review of past literature reveals a number of possible detections. We hope that presentation of this bioinformatic analysis will stimulate an attempt to experimentally verify the expression and functional role of ORFX, and hence lead to a greater understanding of the molecular biology of these important pathogens. PMID:18489030

  12. Global translational impacts of the loss of the tRNA modification t6A in yeast.

    PubMed

    Thiaville, Patrick C; Legendre, Rachel; Rojas-Benítez, Diego; Baudin-Baillieu, Agnès; Hatin, Isabelle; Chalancon, Guilhem; Glavic, Alvaro; Namy, Olivier; de Crécy-Lagard, Valérie

    2016-01-01

    The universal tRNA modification t 6 A is found at position 37 of nearly all tRNAs decoding ANN codons. The absence of t 6 A 37 leads to severe growth defects in baker's yeast, phenotypes similar to those caused by defects in mcm 5 s 2 U 34 synthesis. Mutants in mcm 5 s 2 U 34 can be suppressed by overexpression of tRNA Lys UUU , but we show t 6 A phenotypes could not be suppressed by expressing any individual ANN decoding tRNA, and t 6 A and mcm 5 s 2 U are not determinants for each other's formation. Our results suggest that t 6 A deficiency, like mcm 5 s 2 U deficiency, leads to protein folding defects, and show that the absence of t 6 A led to stress sensitivities (heat, ethanol, salt) and sensitivity to TOR pathway inhibitors. Additionally, L-homoserine suppressed the slow growth phenotype seen in t 6 A-deficient strains, and proteins aggregates and Advanced Glycation End-products (AGEs) were increased in the mutants. The global consequences on translation caused by t 6 A absence were examined by ribosome profiling. Interestingly, the absence of t 6 A did not lead to global translation defects, but did increase translation initiation at upstream non-AUG codons and increased frame-shifting in specific genes. Analysis of codon occupancy rates suggests that one of the major roles of t 6 A is to homogenize the process of elongation by slowing the elongation rate at codons decoded by high abundance tRNAs and I 34 :C 3 pairs while increasing the elongation rate of rare tRNAs and G 34 :U 3 pairs. This work reveals that the consequences of t 6 A absence are complex and multilayered and has set the stage to elucidate the molecular basis of the observed phenotypes.

  13. Problem-Based Test: An "In Vitro" Experiment to Analyze the Genetic Code

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2010-01-01

    Terms to be familiar with before you start to solve the test: genetic code, translation, synthetic polynucleotide, leucine, serine, filter precipitation, radioactivity measurement, template, mRNA, tRNA, rRNA, aminoacyl-tRNA synthesis, ribosomes, degeneration of the code, wobble, initiation, and elongation of protein synthesis, initiation codon.…

  14. Conformational Differences between Open and Closed States of the Eukaryotic Translation Initiation Complex

    PubMed Central

    Llácer, Jose L.; Hussain, Tanweer; Marler, Laura; Aitken, Colin Echeverría; Thakur, Anil; Lorsch, Jon R.; Hinnebusch, Alan G.; Ramakrishnan, V.

    2015-01-01

    Summary Translation initiation in eukaryotes begins with the formation of a pre-initiation complex (PIC) containing the 40S ribosomal subunit, eIF1, eIF1A, eIF3, ternary complex (eIF2-GTP-Met-tRNAi), and eIF5. The PIC, in an open conformation, attaches to the 5′ end of the mRNA and scans to locate the start codon, whereupon it closes to arrest scanning. We present single particle cryo-electron microscopy (cryo-EM) reconstructions of 48S PICs from yeast in these open and closed states, at 6.0 Å and 4.9 Å, respectively. These reconstructions show eIF2β as well as a configuration of eIF3 that appears to encircle the 40S, occupying part of the subunit interface. Comparison of the complexes reveals a large conformational change in the 40S head from an open mRNA latch conformation to a closed one that constricts the mRNA entry channel and narrows the P site to enclose tRNAi, thus elucidating key events in start codon recognition. PMID:26212456

  15. Identification of a splicing enhancer in MLH1 using COMPARE a new assay for determination of relative RNA splicing efficiencies

    PubMed Central

    Xu, Dong-Qing; Mattox, William

    2006-01-01

    Exonic splicing enhancers (ESEs) are sequences that facilitate recognition of splice sites and prevent exon-skipping. Because ESEs are often embedded within proteincoding sequences, alterations in them can also often be interpreted as nonsense, missense or silent mutations. To correctly interpret exonic mutations and their roles in disease, it is important to develop strategies that identify ESE mutations. Potential ESEs can be found computationally in many exons but it has proven difficult to predict if a given mutation will have effects on splicing based on sequence alone. Here we describe a flexible in vitro method that can be used to functionally compare the effects of multiple sequence variants on ESE activity in a single in vitro splicing reaction. We have applied this method in parallel with conventional splicing assays to test for a splicing enhancer in exon 17 of the human MLH1 gene. Point mutations associated with hereditary nonpolyposis colorectal cancer (HNPCC) have previously been found to correlate with exon-skipping in both lymphocytes and tumors from patients. We show that sequences from this exon can replace an ESE from the mouse IgM gene to support RNA splicing in HeLa nuclear extracts. ESE activity was reduced by HNPCC point mutations in codon 659 indicating that their primary effect is on splicing. Surprisingly the strongest enhancer function mapped to a different region of the exon upstream of this codon. Together our results indicate that HNPCC point mutations in codon 659 affect an auxillary element that augments the enhancer function to ensure exon inclusion. PMID:16357104

  16. Two novel mutations in the alpha-galactosidase gene in Japanese classical hemizygotes with Fabry disease.

    PubMed

    Okumiya, T; Takenaka, T; Ishii, S; Kase, R; Kamei, S; Sakuraba, H

    1996-09-01

    Four alpha-galactosidase gene mutations were identified in Japanese male patients with Fabry disease who had no detectable alpha-galactosidase activity. Two of them were novel mutations, an 11-bp deletion in exon 2 and a g-1 to t substitution at the 3' end of the splice acceptor site in intron 1. The former caused a frameshift and led to the creation of a new stop codon at codon 118. The latter was predicted to provoke aberrant mRNA splicing followed by accelerated degradation of the mRNA. A nonsense mutation, R301X, and a 2-bp deletion starting at nucleotide position 718, which were reported previously, were also identified in unrelated patients.

  17. A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.

    PubMed

    Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R

    2001-01-01

    Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.

  18. Inability of Prevotella bryantii to Form a Functional Shine-Dalgarno Interaction Reflects Unique Evolution of Ribosome Binding Sites in Bacteroidetes

    PubMed Central

    Accetto, Tomaž; Avguštin, Gorazd

    2011-01-01

    The Shine-Dalgarno (SD) sequence is a key element directing the translation to initiate at the authentic start codons and also enabling translation initiation to proceed in 5′ untranslated mRNA regions (5′-UTRs) containing moderately strong secondary structures. Bioinformatic analysis of almost forty genomes from the major bacterial phylum Bacteroidetes revealed, however, a general absence of SD sequence, drop in GC content and consequently reduced tendency to form secondary structures in 5′-UTRs. The experiments using the Prevotella bryantii TC1-1 expression system were in agreement with these findings: neither addition nor omission of SD sequence in the unstructured 5′-UTR affected the level of the reporter protein, non-specific nuclease NucB. Further, NucB level in P. bryantii TC1-1, contrary to hMGFP level in Escherichia coli, was five times lower when SD sequence formed part of the secondary structure with a folding energy -5,2 kcal/mol. Also, the extended SD sequences did not affect protein levels as in E. coli. It seems therefore that a functional SD interaction does not take place during the translation initiation in P. bryanttii TC1-1 and possibly other members of phylum Bacteroidetes although the anti SD sequence is present in 16S rRNA genes of their genomes. We thus propose that in the absence of the SD sequence interaction, the selection of genuine start codons in Bacteroidetes is accomplished by binding of ribosomal protein S1 to unstructured 5′-UTR as opposed to coding region which is inaccessible due to mRNA secondary structure. Additionally, we found that sequence logos of region preceding the start codons may be used as taxonomical markers. Depending on whether complete sequence logo or only part of it, such as information content and base proportion at specific positions, is used, bacterial genera or families and in some cases even bacterial phyla can be distinguished. PMID:21857964

  19. GTG mutation in the start codon of the androgen receptor gene in a family of horses with 64,XY disorder of sex development.

    PubMed

    Révay, T; Villagómez, D A F; Brewer, D; Chenier, T; King, W A

    2012-01-01

    Genetic sex in mammals is determined by the sex chromosomal composition of the zygote. The X and Y chromosomes are responsible for numerous factors that must work in close concert for the proper development of a healthy sexual phenotype. The role of androgens in case of XY chromosomal constitution is crucial for normal male sex differentiation. The intracellular androgenic action is mediated by the androgen receptor (AR), and its impaired function leads to a myriad of syndromes with severe clinical consequences, most notably androgen insensitivity syndrome and prostate cancer. In this paper, we investigated the possibility that an alteration of the equine AR gene explains a recently described familial XY, SRY + disorder of sex development. We uncovered a transition in the first nucleotide of the AR start codon (c.1A>G). To our knowledge, this represents the first causative AR mutation described in domestic animals. It is also a rarely observed mutation in eukaryotes and is unique among the >750 entries of the human androgen receptor mutation database. In addition, we found another quiet missense mutation in exon 1 (c.322C>T). Transcription of AR was confirmed by RT-PCR amplification of several exons. Translation of the full-length AR protein from the initiating GTG start codon was confirmed by Western blot using N- and C-terminal-specific antibodies. Two smaller peptides (25 and 14 amino acids long) were identified from the middle of exon 1 and across exons 5 and 6 by mass spectrometry. Based upon our experimental data and the supporting literature, it appears that the AR is expressed as a full-length protein and in a functional form, and the observed phenotype is the result of reduced AR protein expression levels. Copyright © 2011 S. Karger AG, Basel.

  20. Complete DNA sequence of the mitochondrial genome of the treehopper Leptobelus gazella (Membracoidea: Hemiptera).

    PubMed

    Zhao, Xing; Liang, Ai-Ping

    2016-09-01

    The first complete DNA sequence of the mitochondrial genome (mitogenome) of Leptobelus gazelle (Membracoidea: Hemiptera) is determined in this study. The circular molecule is 16,007 bp in its full length, which encodes a set of 37 genes, including 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs, and contains an A + T-rich region (CR). The gene numbers, content, and organization of L. gazelle are similar to other typical metazoan mitogenomes. Twelve of the 13 PCGs are initiated with ATR methionine or ATT isoleucine codons, except the atp8 gene that uses the ATC isoleucine as start signal. Ten of the 13 PCGs have complete termination codons, either TAA (nine genes) or TAG (cytb). The remaining 3 PCGs (cox1, cox2 and nad5) have incomplete termination codons T (AA). All of the 22 tRNAs can be folded in the form of a typical clover-leaf structure. The complete mitogenome sequence data of L. gazelle is useful for the phylogenetic and biogeographic studies of the Membracoidea and Hemiptera.

  1. The mitochondrial genome of the multicolored Asian lady beetle Harmonia axyridis (Pallas) and a phylogenetic analysis of the Polyphaga (Insecta: Coleoptera).

    PubMed

    Niu, Fang-Fang; Zhu, Liang; Wang, Su; Wei, Shu-Jun

    2016-07-01

    Here, we report the mitochondrial genome sequence of the multicolored Asian lady beetle Harmonia axyridis (Pallas, 1773) (Coleoptera: Coccinellidae) (GenBank accession No. KR108208). This is the first species with sequenced mitochondrial genome from the genus Harmonia. The current length with partitial A + T-rich region of this mitochondrial genome is 16,387 bp. All the typical genes were sequenced except the trnI and trnQ. As in most other sequenced mitochondrial genomes of Coleoptera, there is no re-arrangement in the sequenced region compared with the pupative ancestral arrangement of insects. All protein-coding genes start with ATN codons. Five, five and three protein-coding genes stop with termination codon TAA, TA and T, respectively. Phylogenetic analysis using Bayesian method based on the first and second codon positions of the protein-coding genes supported that the Scirtidae is a basal lineage of Polyphaga. The Harmonia and the Coccinella form a sister lineage. The monophyly of Staphyliniformia, Scarabaeiformia and Cucujiformia was supported. The Buprestidae was found to be a sister group to the Bostrichiformia.

  2. Differential regulation of hepatitis B virus core protein expression and genome replication by a small upstream open reading frame and naturally occurring mutations in the precore region.

    PubMed

    Zong, Li; Qin, Yanli; Jia, Haodi; Ye, Lei; Wang, Yongxiang; Zhang, Jiming; Wands, Jack R; Tong, Shuping; Li, Jisu

    2017-05-01

    Hepatitis B virus (HBV) transcribes two subsets of 3.5-kb RNAs: precore RNA for hepatitis B e antigen (HBeAg) expression, and pregenomic RNA for core and P protein translation as well as genome replication. HBeAg expression could be prevented by mutations in the precore region, while an upstream open reading frame (uORF) has been proposed as a negative regulator of core protein translation. We employed replication competent HBV DNA constructs and transient transfection experiments in Huh7 cells to verify the uORF effect and to explore the alternative function of precore RNA. Optimized Kozak sequence for the uORF or extra ATG codons as present in some HBV genotypes reduced core protein expression. G1896A nonsense mutation promoted more efficient core protein expression than mutated precore ATG, while a +1 frameshift mutation was ineffective. In conclusion, various HBeAg-negative precore mutations and mutations affecting uORF differentially regulate core protein expression and genome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. The Complete Mitochondrial Genome of the Rice Moth, Corcyra cephalonica

    PubMed Central

    Wu, Yu-Peng; Li, Jie; Zhao, Jin-Liang; Su, Tian-Juan; Luo, A-Rong; Fan, Ren-Jun; Chen, Ming-Chang; Wu, Chun-Sheng; Zhu, Chao-Dong

    2012-01-01

    The complete mitochondrial genome (mitogenome) of the rice moth, Corcyra cephalonica Stainton (Lepidoptera: Pyralidae) was determined as a circular molecular of 15,273 bp in size. The mitogenome composition (37 genes) and gene order are the same as the other lepidopterans. Nucleotide composition of the C. cephalonica mitogenome is highly A+T biased (80.43%) like other insects. Twelve protein-coding genes start with a typical ATN codon, with the exception of coxl gene, which uses CGA as the initial codon. Nine protein-coding genes have the common stop codon TAA, and the nad2, cox1, cox2, and nad4 have single T as the incomplete stop codon. 22 tRNA genes demonstrated cloverleaf secondary structure. The mitogenome has several large intergenic spacer regions, the spacer1 between trnQ gene and nad2 gene, which is common in Lepidoptera. The spacer 3 between trnE and trnF includes microsatellite-like repeat regions (AT)18 and (TTAT)3. The spacer 4 (16 bp) between trnS2 gene and nad1 gene has a motif ATACTAT; another species, Sesamia inferens encodes ATCATAT at the same position, while other lepidopteran insects encode a similar ATACTAA motif. The spacer 6 is A+T rich region, include motif ATAGA and a 20-bp poly(T) stretch and two microsatellite (AT)9, (AT)8 elements. PMID:23413968

  4. The complete mitochondrial genome of the rice moth, Corcyra cephalonica.

    PubMed

    Wu, Yu-Peng; Li, Jie; Zhao, Jin-Liang; Su, Tian-Juan; Luo, A-Rong; Fan, Ren-Jun; Chen, Ming-Chang; Wu, Chun-Sheng; Zhu, Chao-Dong

    2012-01-01

    The complete mitochondrial genome (mitogenome) of the rice moth, Corcyra cephalonica Stainton (Lepidoptera: Pyralidae) was determined as a circular molecular of 15,273 bp in size. The mitogenome composition (37 genes) and gene order are the same as the other lepidopterans. Nucleotide composition of the C. cephalonica mitogenome is highly A+T biased (80.43%) like other insects. Twelve protein-coding genes start with a typical ATN codon, with the exception of coxl gene, which uses CGA as the initial codon. Nine protein-coding genes have the common stop codon TAA, and the nad2, cox1, cox2, and nad4 have single T as the incomplete stop codon. 22 tRNA genes demonstrated cloverleaf secondary structure. The mitogenome has several large intergenic spacer regions, the spacer1 between trnQ gene and nad2 gene, which is common in Lepidoptera. The spacer 3 between trnE and trnF includes microsatellite-like repeat regions (AT)18 and (TTAT)(3). The spacer 4 (16 bp) between trnS2 gene and nad1 gene has a motif ATACTAT; another species, Sesamia inferens encodes ATCATAT at the same position, while other lepidopteran insects encode a similar ATACTAA motif. The spacer 6 is A+T rich region, include motif ATAGA and a 20-bp poly(T) stretch and two microsatellite (AT)(9), (AT)(8) elements.

  5. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  6. Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

    PubMed

    Li, Shisheng; Smerdon, Michael J

    2004-04-02

    Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

  7. The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

    1994-12-31

    Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

  8. Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

    PubMed Central

    Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

    2004-01-01

    Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

  9. Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

    PubMed

    Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

    2004-05-01

    Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

  10. An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

    PubMed Central

    Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.

    2014-01-01

    Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698

  11. β-Glucuronidase as a Sensitive and Versatile Reporter in Actinomycetes ▿

    PubMed Central

    Myronovskyi, Maksym; Welle, Elisabeth; Fedorenko, Viktor; Luzhetskyy, Andriy

    2011-01-01

    Here we describe a versatile and sensitive reporter system for actinomycetes that is based on gusA, which encodes the β-glucuronidase enzyme. A series of gusA-containing transcriptional and translational fusion vectors were constructed and utilized to study the regulatory cascade of the phenalinolactone biosynthetic gene cluster. Furthermore, these vectors were used to study the efficiency of translation initiation at the ATG, GTG, TTG, and CTG start codons. Surprisingly, constructs using a TTG start codon showed the best activity, whereas those using ATG or GTG were approximately one-half or one-third as active, respectively. The CTG fusion showed only 5% of the activity of the TTG fusion. A suicide vector, pKGLP2, carrying gusA in its backbone was used to visually detect merodiploid formation and resolution, making gene targeting in actinomycetes much faster and easier. Three regulatory genes, plaR1, plaR2, and plaR3, involved in phenalinolactone biosynthesis were efficiently replaced with an apramycin resistance marker using this system. Finally, we expanded the genetic code of actinomycetes by introducing the nonproteinogenic amino acid N-epsilon-cyclopentyloxycarbonyl-l-lysine with the GusA protein as a reporter. PMID:21685164

  12. Two Isoforms of Geobacter sulfurreducens PilA Have Distinct Roles in Pilus Biogenesis, Cytochrome Localization, Extracellular Electron Transfer, and Biofilm Formation

    PubMed Central

    Richter, Lubna V.; Sandler, Steven J.

    2012-01-01

    Type IV pili of Geobacter sulfurreducens are composed of PilA monomers and are essential for long-range extracellular electron transfer to insoluble Fe(III) oxides and graphite anodes. A previous analysis of pilA expression indicated that transcription was initiated at two positions, with two predicted ribosome-binding sites and translation start codons, potentially producing two PilA preprotein isoforms. The present study supports the existence of two functional translation start codons for pilA and identifies two isoforms (short and long) of the PilA preprotein. The short PilA isoform is found predominantly in an intracellular fraction. It seems to stabilize the long isoform and to influence the secretion of several outer-surface c-type cytochromes. The long PilA isoform is required for secretion of PilA to the outer cell surface, a process that requires coexpression of pilA with nine downstream genes. The long isoform was determined to be essential for biofilm formation on certain surfaces, for optimum current production in microbial fuel cells, and for growth on insoluble Fe(III) oxides. PMID:22408162

  13. Start codon targeted (SCoT) and target region amplification polymorphism (TRAP) for evaluating the genetic relationship of Dendrobium species.

    PubMed

    Feng, Shangguo; He, Refeng; Yang, Sai; Chen, Zhe; Jiang, Mengying; Lu, Jiangjie; Wang, Huizhong

    2015-08-10

    Two molecular marker systems, start codon targeted (SCoT) and target region amplification polymorphism (TRAP), were used for genetic relationship analysis of 36 Dendrobium species collected from China. Twenty-two selected SCoT primers produced 337 loci, of which 324 (96%) were polymorphic, whereas 13 TRAP primer combinations produced a total of 510 loci, with 500 (97.8%) of them being polymorphic. An average polymorphism information content of 0.953 and 0.983 was detected using the SCoT and TRAP primers, respectively, showing that a high degree of genetic diversity exists among Chinese Dendrobium species. The partition of clusters in the unweighted pair group method with arithmetic mean dendrogram and principal coordinate analysis plot based on the SCoT and TRAP markers was similar and clustered the 36 Dendrobium species into four main groups. Our results will provide useful information for resource protection and will also be useful to improve the current Dendrobium breeding programs. Our results also demonstrate that SCoT and TRAP markers are informative and can be used to evaluate genetic relationships between Dendrobium species. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. In-cell SHAPE uncovers dynamic interactions between the untranslated regions of the foot-and-mouth disease virus RNA.

    PubMed

    Diaz-Toledano, Rosa; Lozano, Gloria; Martinez-Salas, Encarnacion

    2017-02-17

    The genome of RNA viruses folds into 3D structures that include long-range RNA–RNA interactions relevant to control critical steps of the viral cycle. In particular, initiation of translation driven by the IRES element of foot-and-mouth disease virus is stimulated by the 3΄UTR. Here we sought to investigate the RNA local flexibility of the IRES element and the 3΄UTR in living cells. The SHAPE reactivity observed in vivo showed statistically significant differences compared to the free RNA, revealing protected or exposed positions within the IRES and the 3΄UTR. Importantly, the IRES local flexibility was modified in the presence of the 3΄UTR, showing significant protections at residues upstream from the functional start codon. Conversely, presence of the IRES element in cis altered the 3΄UTR local flexibility leading to an overall enhanced reactivity. Unlike the reactivity changes observed in the IRES element, the SHAPE differences of the 3΄UTR were large but not statistically significant, suggesting multiple dynamic RNA interactions. These results were supported by covariation analysis, which predicted IRES-3΄UTR conserved helices in agreement with the protections observed by SHAPE probing. Mutational analysis suggested that disruption of one of these interactions could be compensated by alternative base pairings, providing direct evidences for dynamic long-range interactions between these distant elements of the viral genome.

  15. Development of a transgenic zebrafish model expressing GFP in the notochord, somite and liver directed by the hfe2 gene promoter.

    PubMed

    Bian, Yue-Hong; Xu, Cheng; Li, Junling; Xu, Jin; Zhang, Hongwei; Du, Shao Jun

    2011-08-01

    Hemojuvelin, also known as RGMc, is encoded by hfe2 gene that plays an important role in iron homeostasis. hfe2 is specifically expressed in the notochord, developing somite and skeletal muscles during development. The molecular regulation of hfe2 expression is, however, not clear. We reported here the characterization of hfe2 gene expression and the regulation of its tissue-specific expression in zebrafish embryos. We demonstrated that the 6 kb 5'-flanking sequence upstream of the ATG start codon in the zebrafish hfe2 gene could direct GFP specific expression in the notochord, somites, and skeletal muscle of zebrafish embryos, recapitulating the expression pattern of the endogenous gene. However, the Tg(hfe2:gfp) transgene is also expressed in the liver of fish embryos, which did not mimic the expression of the endogenous hfe2 at the early stage. Nevertheless, the Tg(hfe2:gfp) transgenic zebrafish provides a useful model to study liver development. Treating Tg(hfe2:gfp) transgenic zebrafish embryos with valproic acid, a liver development inhibitor, significantly inhibited GFP expression in zebrafish. Together, these data indicate that the tissue specific expression of hfe2 in the notochord, somites and muscles is regulated by regulatory elements within the 6 kb 5'-flanking sequence of the hfe2 gene. Moreover, the Tg(hfe2:gfp) transgenic zebrafish line provides a useful model system for analyzing liver development in zebrafish.

  16. Nucleotide sequence of the beta-lactamase gene from Enterococcus faecalis HH22 and its similarity to staphylococcal beta-lactamase genes.

    PubMed Central

    Zscheck, K K; Murray, B E

    1991-01-01

    The nucleotide sequence of the constitutively produced beta-lactamase (Bla) gene from Enterococcus faecalis HH22 was shown to be identical to the published sequences of three of four staphylococcal type A beta-lactamase genes; more differences were seen with the genes for staphylococcal type C and D enzymes. One hundred forty nucleotides upstream of the beta-lactamase start codon were determined for an inducible staphylococcal beta-lactamase and were identical to those of the constitutively expressed enterococcal gene, indicating that the changes resulting in constitutive expression are not due to changes in the promoter or operator region. Moreover, complementation studies indicated that production of the enterococcal enzyme could be repressed. The genes for the enterococcal Bla and an inducible staphylococcal Bla were each cloned into a shuttle vector and transformed into enterococcal and staphylococcal recipients. The major difference between the backgrounds of the two hosts was that more enzyme was produced by the staphylococcal host, regardless of the source of the gene. The location of the enzyme was found to be host dependent, since each cloned gene generated extracellular (free) enzyme in the staphylococcus and cell-bound enzyme in the enterococcus. On the basis of the identities of the enterococcal Bla and several staphylococcal Bla sequences, these data suggest the recent spread of beta-lactamase to enterococci and also suggest the loss of a functional repressor. PMID:1952840

  17. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  18. Rhodobase, a meta-analytical tool for reconstructing gene regulatory networks in a model photosynthetic bacterium.

    PubMed

    Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark

    2011-02-01

    We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  19. [Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

    PubMed

    Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

    2003-02-01

    Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

  20. Mitochondrial genome of Pteronotus personatus (Chiroptera: Mormoopidae): comparison with selected bats and phylogenetic considerations.

    PubMed

    López-Wilchis, Ricardo; Del Río-Portilla, Miguel Ángel; Guevara-Chumacero, Luis Manuel

    2017-02-01

    We described the complete mitochondrial genome (mitogenome) of the Wagner's mustached bat, Pteronotus personatus, a species belonging to the family Mormoopidae, and compared it with other published mitogenomes of bats (Chiroptera). The mitogenome of P. personatus was 16,570 bp long and contained a typically conserved structure including 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, and one control region (D-loop). Most of the genes were encoded on the H-strand, except for eight tRNA and the ND6 genes. The order of protein-coding and rRNA genes was highly conserved in all mitogenomes. All protein-coding genes started with an ATG codon, except for ND2, ND3, and ND5, which initiated with ATA, and terminated with the typical stop codon TAA/TAG or the codon AGA. Phylogenetic trees constructed using Maximum Parsimony, Maximum Likelihood, and Bayesian inference methods showed an identical topology and indicated the monophyly of different families of bats (Mormoopidae, Phyllostomidae, Vespertilionidae, Rhinolophidae, and Pteropopidae) and the existence of two major clades corresponding to the suborders Yangochiroptera and Yinpterochiroptera. The mitogenome sequence provided here will be useful for further phylogenetic analyses and population genetic studies in mormoopid bats.

  1. The mitochondrial genome of Polistes jokahamae and a phylogenetic analysis of the Vespoidea (Insecta: Hymenoptera).

    PubMed

    Song, Sheng-Nan; Chen, Peng-Yan; Wei, Shu-Jun; Chen, Xue-Xin

    2016-07-01

    The mitochondrial genome sequence of Polistes jokahamae (Radoszkowski, 1887) (Hymenoptera: Vespidae) (GenBank accession no. KR052468) was sequenced. The current length with partial A + T-rich region of this mitochondrial genome is 16,616 bp. All the typical mitochondrial genes were sequenced except for three tRNAs (trnI, trnQ, and trnY) located between the A + T-rich region and nad2. At least three rearrangement events occurred in the sequenced region compared with the pupative ancestral arrangement of insects, corresponding to the shuffling of trnK and trnD, translocation or remote inversion of tnnY and translocation of trnL1. All protein-coding genes start with ATN codons. Eleven, one, and another one protein-coding genes stop with termination codon TAA, TA, and T, respectively. Phylogenetic analysis using the Bayesian method based on all codon positions of the 13 protein-coding genes supports the monophyly of Vespidae and Formicidae. Within the Formicidae, the Myrmicinae and Formicinae form a sister lineage and then sister to the Dolichoderinae, while within the Vespidae, the Eumeninae is sister to the lineage of Vespinae + Polistinae.

  2. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

    PubMed

    Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2008-04-30

    The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

  3. Massive programmed translational jumping in mitochondria

    PubMed Central

    Lang, B. Franz; Jakubkova, Michaela; Hegedusova, Eva; Daoud, Rachid; Forget, Lise; Brejova, Brona; Vinar, Tomas; Kosa, Peter; Fricova, Dominika; Nebohacova, Martina; Griac, Peter; Tomaska, Lubomir; Burger, Gertraud; Nosek, Jozef

    2014-01-01

    Programmed translational bypassing is a process whereby ribosomes “ignore” a substantial interval of mRNA sequence. Although discovered 25 y ago, the only experimentally confirmed example of this puzzling phenomenon is expression of the bacteriophage T4 gene 60. Bypassing requires translational blockage at a “takeoff codon” immediately upstream of a stop codon followed by a hairpin, which causes peptidyl-tRNA dissociation and reassociation with a matching “landing triplet” 50 nt downstream, where translation resumes. Here, we report 81 translational bypassing elements (byps) in mitochondria of the yeast Magnusiomyces capitatus and demonstrate in three cases, by transcript analysis and proteomics, that byps are retained in mitochondrial mRNAs but not translated. Although mitochondrial byps resemble the bypass sequence in the T4 gene 60, they utilize unused codons instead of stops for translational blockage and have relaxed matching rules for takeoff/landing sites. We detected byp-like sequences also in mtDNAs of several Saccharomycetales, indicating that byps are mobile genetic elements. These byp-like sequences lack bypassing activity and are tolerated when inserted in-frame in variable protein regions. We hypothesize that byp-like elements have the potential to contribute to evolutionary diversification of proteins by adding new domains that allow exploration of new structures and functions. PMID:24711422

  4. SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

    PubMed Central

    Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

    2007-01-01

    Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

  5. Thiamine-responsive megaloblastic anemia: early diagnosis may be effective in preventing deafness.

    PubMed

    Onal, Hasan; Bariş, Safa; Ozdil, Mine; Yeşil, Gözde; Altun, Gürkan; Ozyilmaz, Isa; Aydin, Ahmet; Celkan, Tiraje

    2009-01-01

    Thiamine-responsive megaloblastic anemia syndrome is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural hearing loss. Mutations in the SLC19A2 gene, encoding a high-affinity thiamine transporter protein, THTR-1, are responsible for the clinical features associated with thiamine-responsive megaloblastic anemia syndrome in which treatment with pharmacological doses of thiamine correct the megaloblastic anemia and diabetes mellitus. The anemia can recur when thiamine is withdrawn. Thiamine may be effective in preventing deafness if started before two months. Our patient was found homozygous for a mutation, 242insA, in the nucleic acid sequence of exon B, with insertion of an adenine introducing a stop codon at codon 52 in the high-affinity thiamine transporter gene, SLC19A2, on chromosome 1q23.3.

  6. Thermostable proteins bioprocesses: The activity of restriction endonuclease-methyltransferase from Thermus thermophilus (RM.TthHB27I) cloned in Escherichia coli is critically affected by the codon composition of the synthetic gene.

    PubMed

    Krefft, Daria; Papkov, Aliaksei; Zylicz-Stachula, Agnieszka; Skowron, Piotr M

    2017-01-01

    Obtaining thermostable enzymes (thermozymes) is an important aspect of biotechnology. As thermophiles have adapted their genomes to high temperatures, their cloned genes' expression in mesophiles is problematic. This is mainly due to their high GC content, which leads to the formation of unfavorable secondary mRNA structures and codon usage in Escherichia coli (E. coli). RM.TthHB27I is a member of a family of bifunctional thermozymes, containing a restriction endonuclease (REase) and a methyltransferase (MTase) in a single polypeptide. Thermus thermophilus HB27 (T. thermophilus) produces low amounts of RM.TthHB27I with a unique DNA cleavage specificity. We have previously cloned the wild type (wt) gene into E. coli, which increased the production of RM.TthHB27I over 100-fold. However, its enzymatic activities were extremely low for an ORF expressed under a T7 promoter. We have designed and cloned a fully synthetic tthHB27IRM gene, using a modified 'codon randomization' strategy. Codons with a high GC content and of low occurrence in E. coli were eliminated. We incorporated a stem-loop circuit, devised to negatively control the expression of this highly toxic gene by partially hiding the ribosome-binding site (RBS) and START codon in mRNA secondary structures. Despite having optimized 59% of codons, the amount of produced RM.TthHB27I protein was similar for both recombinant tthHB27IRM gene variants. Moreover, the recombinant wt RM.TthHB27I is very unstable, while the RM.TthHB27I resulting from the expression of the synthetic gene exhibited enzymatic activities and stability equal to the native thermozyme isolated from T. thermophilus. Thus, we have developed an efficient purification protocol using the synthetic tthHB27IRM gene variant only. This suggests the effect of co-translational folding kinetics, possibly affected by the frequency of translational errors. The availability of active RM.TthHB27I is of practical importance in molecular biotechnology, extending the palette of available REase specificities.

  7. Environmental regulation of the long polar fimbriae 2 of enterohemorrhagic Escherichia coli O157:H7

    PubMed Central

    Arenas-Hernández, Margarita M.P.; Rojas-López, Maricarmen; Medrano-López, Abraham; Nuñez-Reza, Karen J.; Puente, José Luis; Martínez-Laguna, Ygnacio; Torres, Alfredo G.

    2014-01-01

    The molecular mechanisms controlling expression of the Long Polar Fimbriae 2 (Lpf2) of enterohemorrhagic E. coli (EHEC) O157:H7 were evaluated. Primer extension was used to locate the lpfA2 transcriptional start site in EHEC strain EDL933 at 171 bp upstream of the lpfA2 start codon. Semi-quantitative RT-PCR demonstrated that the highest lpfA2 expression occurs between an OD600 of 1.0 and 1.2 in DMEM at pH 6.5 and 37°C. The level of lpfA2 transcription at OD600 1.2 and pH 6.5 was 4-times greater than that at pH 7.2. Although lpfA2 expression was decreased under iron-depleted conditions, its expression was increased in a Ferric-uptake-regulator (Fur) mutant strain. The lpfA2 transcript was 0.7 and 2-times more abundant in wt EHEC grown in DMEM pH 6.5 plus iron and MacConkey broth at 25°C, respectively, than in DMEM at pH 6.5. The lpf2 expression in DMEM pH 6.5 plus iron and bile salts was 2.7-times more abundant and similar to MacConkey. Further, transcription in the EDL933Δfur was 0.6 and 0.8-times higher as compared to the wt strain grown in DMEM pH 6.5 plus iron and MacConkey broth, respectively. Electrophoretic mobility shift assays (EMSA) showed that purified Fur interacts with the lpf2 regulatory region, indicating that Fur-repression is exerted by direct binding to the promoter region. In summary, we demonstrated that the EHEC lpf2 operon is regulated in response to temperature, pH, bile salts and iron, during exponential phase of growth, and controlled by Fur. PMID:24966050

  8. STARTING EXCAVATION PIER 2. This view is roughly northeast, with ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    STARTING EXCAVATION PIER 2. This view is roughly northeast, with Pier 2 on the Trinity County end of the bridge. The old suspension bridge, at upper right, was upstream of new bridge - South Fork Trinity River Bridge, State Highway 299 spanning South Fork Trinity River, Salyer, Trinity County, CA

  9. Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, C.H.; Wei, Li-Na; Copeland, N.G.

    We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

  10. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

    PubMed Central

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-01-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome. PMID:20392818

  11. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

    PubMed

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-08-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

  12. Gene expression regulation by upstream open reading frames and human disease.

    PubMed

    Barbosa, Cristina; Peixeiro, Isabel; Romão, Luísa

    2013-01-01

    Upstream open reading frames (uORFs) are major gene expression regulatory elements. In many eukaryotic mRNAs, one or more uORFs precede the initiation codon of the main coding region. Indeed, several studies have revealed that almost half of human transcripts present uORFs. Very interesting examples have shown that these uORFs can impact gene expression of the downstream main ORF by triggering mRNA decay or by regulating translation. Also, evidence from recent genetic and bioinformatic studies implicates disturbed uORF-mediated translational control in the etiology of many human diseases, including malignancies, metabolic or neurologic disorders, and inherited syndromes. In this review, we will briefly present the mechanisms through which uORFs regulate gene expression and how they can impact on the organism's response to different cell stress conditions. Then, we will emphasize the importance of these structures by illustrating, with specific examples, how disturbed uORF-mediated translational control can be involved in the etiology of human diseases, giving special importance to genotype-phenotype correlations. Identifying and studying more cases of uORF-altering mutations will help us to understand and establish genotype-phenotype associations, leading to advancements in diagnosis, prognosis, and treatment of many human disorders.

  13. Positions of Trp Codons in the Leader Peptide-Coding Region of the at Operon Influence Anti-Trap Synthesis and trp Operon Expression in Bacillus licheniformis▿

    PubMed Central

    Levitin, Anastasia; Yanofsky, Charles

    2010-01-01

    Tryptophan, phenylalanine, tyrosine, and several other metabolites are all synthesized from a common precursor, chorismic acid. Since tryptophan is a product of an energetically expensive biosynthetic pathway, bacteria have developed sensing mechanisms to downregulate synthesis of the enzymes of tryptophan formation when synthesis of the amino acid is not needed. In Bacillus subtilis and some other Gram-positive bacteria, trp operon expression is regulated by two proteins, TRAP (the tryptophan-activated RNA binding protein) and AT (the anti-TRAP protein). TRAP is activated by bound tryptophan, and AT synthesis is increased upon accumulation of uncharged tRNATrp. Tryptophan-activated TRAP binds to trp operon leader RNA, generating a terminator structure that promotes transcription termination. AT binds to tryptophan-activated TRAP, inhibiting its RNA binding ability. In B. subtilis, AT synthesis is upregulated both transcriptionally and translationally in response to the accumulation of uncharged tRNATrp. In this paper, we focus on explaining the differences in organization and regulatory functions of the at operon's leader peptide-coding region, rtpLP, of B. subtilis and Bacillus licheniformis. Our objective was to correlate the greater growth sensitivity of B. licheniformis to tryptophan starvation with the spacing of the three Trp codons in its at operon leader peptide-coding region. Our findings suggest that the Trp codon location in rtpLP of B. licheniformis is designed to allow a mild charged-tRNATrp deficiency to expose the Shine-Dalgarno sequence and start codon for the AT protein, leading to increased AT synthesis. PMID:20061467

  14. How the Sequence of a Gene Specifies Structural Symmetry in Proteins

    PubMed Central

    Shen, Xiaojuan; Huang, Tongcheng; Wang, Guanyu; Li, Guanglin

    2015-01-01

    Internal symmetry is commonly observed in the majority of fundamental protein folds. Meanwhile, sufficient evidence suggests that nascent polypeptide chains of proteins have the potential to start the co-translational folding process and this process allows mRNA to contain additional information on protein structure. In this paper, we study the relationship between gene sequences and protein structures from the viewpoint of symmetry to explore how gene sequences code for structural symmetry in proteins. We found that, for a set of two-fold symmetric proteins from left-handed beta-helix fold, intragenic symmetry always exists in their corresponding gene sequences. Meanwhile, codon usage bias and local mRNA structure might be involved in modulating translation speed for the formation of structural symmetry: a major decrease of local codon usage bias in the middle of the codon sequence can be identified as a common feature; and major or consecutive decreases in local mRNA folding energy near the boundaries of the symmetric substructures can also be observed. The results suggest that gene duplication and fusion may be an evolutionarily conserved process for this protein fold. In addition, the usage of rare codons and the formation of higher order of secondary structure near the boundaries of symmetric substructures might have coevolved as conserved mechanisms to slow down translation elongation and to facilitate effective folding of symmetric substructures. These findings provide valuable insights into our understanding of the mechanisms of translation and its evolution, as well as the design of proteins via symmetric modules. PMID:26641668

  15. Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

    PubMed Central

    Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

    1997-01-01

    GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

  16. The complete mitochondrial genome and phylogenetic analysis of the giant panda (Ailuropoda melanoleuca).

    PubMed

    Peng, Rui; Zeng, Bo; Meng, Xiuxiang; Yue, Bisong; Zhang, Zhihe; Zou, Fangdong

    2007-08-01

    The complete mitochondrial genome sequence of the giant panda, Ailuropoda melanoleuca, was determined by the long and accurate polymerase chain reaction (LA-PCR) with conserved primers and primer walking sequence methods. The complete mitochondrial DNA is 16,805 nucleotides in length and contains two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one control region. The total length of the 13 protein-coding genes is longer than the American black bear, brown bear and polar bear by 3 amino acids at the end of ND5 gene. The codon usage also followed the typical vertebrate pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 5 (ND5) gene. The molecular phylogenetic analysis was performed on the sequences of 12 concatenated heavy-strand encoded protein-coding genes, and suggested that the giant panda is most closely related to bears.

  17. A high-level prokaryotic expression system: synthesis of human interleukin 1 alpha and its receptor antagonist.

    PubMed

    Birikh, K R; Lebedenko, E N; Boni, I V; Berlin, Y A

    1995-10-27

    Synthetic intronless genes, coding for human interleukin 1 alpha (IL 1 alpha) and interleukin 1 receptor antagonist (IL1ra), have been expressed efficiently in a specially designed prokaryotic vector, pGMCE (a pGEM1 derivative), where the target gene forms the second part of a two-cistron system. The first part of the system is a translation enhancer-containing mini-cistron, whose termination codon overlaps the start codon of the target gene. In the case of the IL1 alpha gene, the high expression level is largely due to the direct efficient translation initiation at the second cistron, whereas with the IL1ra gene in the same system, the proximal translation initiation region (TIR) provides a high level of coupled expression of the target gene. Thus, pGMCE is a potentially versatile vector for direct prokaryotic expression.

  18. Complete mitochondrial genome of the Freshwater Whipray Himantura dalyensis.

    PubMed

    Feutry, Pierre; Kyne, Peter M; Peng, Zaiqing; Pan, Lianghao; Chen, Xiao

    2016-05-01

    The complete mitochondrial genome of the Freshwater Whipray Himantura dalyensis is presented in this study. It is 17,693 bp in length and contains 37 genes in typical gene order and transcriptional orientation observed in vertebrates. There were a total of 86 bp short intergenic spacers and 22 bp overlaps in the genome. The overall base composition was 31.4% A, 25.5% C, 13.2% G and 29.9% T. Two start codons (GTG and ATG) and two stop codons (TAG and TAA/T) were found in 13 protein-coding genes. The length of 22 tRNA genes ranged from 68 (tRNA-Cys and tRNA-Ser2) to 75 bp (tRNA-Leu1). The origin of L-strand replication (OL) was found between the tRNA-Asn and tRNA-Cys genes. The base composition of the control region (1940 bp) was similar to the whole mitogenome.

  19. Hypothesis Formation and Qualitative Reasoning in Molecular Biology

    DTIC Science & Technology

    1989-06-01

    presents studies of the trp operon in the bacterium S . Marcescens . In vitro transcription studies showed that transcription termination does occur in...observed was that there are two 4.4. ANNOTATED CHRONOLOGY OF THE RESEARCH 135 translation-start codons in the S . marcescens leader region. The authors...of leader-region mRNA secondary structures in attenuation in the S . marcescens trp operon. A different bac- terium was used because it included

  20. ClubSub-P: Cluster-Based Subcellular Localization Prediction for Gram-Negative Bacteria and Archaea

    PubMed Central

    Paramasivam, Nagarajan; Linke, Dirk

    2011-01-01

    The subcellular localization (SCL) of proteins provides important clues to their function in a cell. In our efforts to predict useful vaccine targets against Gram-negative bacteria, we noticed that misannotated start codons frequently lead to wrongly assigned SCLs. This and other problems in SCL prediction, such as the relatively high false-positive and false-negative rates of some tools, can be avoided by applying multiple prediction tools to groups of homologous proteins. Here we present ClubSub-P, an online database that combines existing SCL prediction tools into a consensus pipeline from more than 600 proteomes of fully sequenced microorganisms. On top of the consensus prediction at the level of single sequences, the tool uses clusters of homologous proteins from Gram-negative bacteria and from Archaea to eliminate false-positive and false-negative predictions. ClubSub-P can assign the SCL of proteins from Gram-negative bacteria and Archaea with high precision. The database is searchable, and can easily be expanded using either new bacterial genomes or new prediction tools as they become available. This will further improve the performance of the SCL prediction, as well as the detection of misannotated start codons and other annotation errors. ClubSub-P is available online at http://toolkit.tuebingen.mpg.de/clubsubp/ PMID:22073040

  1. Complete mitochondrial genome sequence of Urechis caupo, a representative of the phylum Echiura

    PubMed Central

    Boore, Jeffrey L

    2004-01-01

    Background Mitochondria contain small genomes that are physically separate from those of nuclei. Their comparison serves as a model system for understanding the processes of genome evolution. Although hundreds of these genome sequences have been reported, the taxonomic sampling is highly biased toward vertebrates and arthropods, with many whole phyla remaining unstudied. This is the first description of a complete mitochondrial genome sequence of a representative of the phylum Echiura, that of the fat innkeeper worm, Urechis caupo. Results This mtDNA is 15,113 nts in length and 62% A+T. It contains the 37 genes that are typical for animal mtDNAs in an arrangement somewhat similar to that of annelid worms. All genes are encoded by the same DNA strand which is rich in A and C relative to the opposite strand. Codons ending with the dinucleotide GG are more frequent than would be expected from apparent mutational biases. The largest non-coding region is only 282 nts long, is 71% A+T, and has potential for secondary structures. Conclusions Urechis caupo mtDNA shares many features with those of the few studied annelids, including the common usage of ATG start codons, unusual among animal mtDNAs, as well as gene arrangements, tRNA structures, and codon usage biases. PMID:15369601

  2. [Possible role of genetic factors on reduced risk for gastric cancer among duodenal ulcer patients].

    PubMed

    Matsuda, Koichi; Tanikawa, Chizu; Nakamura, Yusuke

    2013-08-01

    Although H. pylori causes both gastric cancer and peptic ulcer, duodenal ulcer patients were known to have low risk for gastric cancer. Recently the association of PSCA and ABO with duodenal ulcer were identified by GWAS in the Japanese population. A T-allele of SNP rs2294008 in the PSCA promoter creates the upstream translational initiation codon and affects the protein localization from cytoplasm to cell surface. A T-allele of SNP rs2294008 increased gastric cancer risk but reduced duodenal ulcer risk. In addition, blood type O was shown to increase risk for duodenal ulcer, while blood type A was associated with gastric cancer risk in the Caucasian population. Our finding would partially explain low risk of gastric cancer among duodenal ulcer patients.

  3. Development of a Tightly Controlled Off Switch for Saccharomyces cerevisiae Regulated by Camphor, a Low-Cost Natural Product

    PubMed Central

    Ikushima, Shigehito; Zhao, Yu; Boeke, Jef D.

    2015-01-01

    Here we describe the engineering of a distant homolog of the Tet repressor, CamR, isolated from Pseudomonas putida, that is regulated by camphor, a very inexpensive small molecule (at micromolar concentrations) for use in Saccharomyces cerevisiae. The repressor was engineered by expression from a constitutive yeast promoter, fusion to a viral activator protein cassette, and codon optimization. A suitable promoter responsive to the CamR fusion protein was engineered by embedding a P. putida operator binding sequence within an upstream activating sequence (UAS)-less CYC1 promoter from S. cerevisiae. The switch, named the Camphor-Off switch, activates expression of a reporter gene in camphor-free media and represses it with micromolar concentrations of camphor. PMID:26206350

  4. DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

    PubMed Central

    Link, Gerhard

    1984-01-01

    A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  6. Thyroglobulin Represents a Novel Molecular Architecture of Vertebrates.

    PubMed

    Holzer, Guillaume; Morishita, Yoshiaki; Fini, Jean-Baptiste; Lorin, Thibault; Gillet, Benjamin; Hughes, Sandrine; Tohmé, Marie; Deléage, Gilbert; Demeneix, Barbara; Arvan, Peter; Laudet, Vincent

    2016-08-05

    Thyroid hormones modulate not only multiple functions in vertebrates (energy metabolism, central nervous system function, seasonal changes in physiology, and behavior) but also in some non-vertebrates where they control critical post-embryonic developmental transitions such as metamorphosis. Despite their obvious biological importance, the thyroid hormone precursor protein, thyroglobulin (Tg), has been experimentally investigated only in mammals. This may bias our view of how thyroid hormones are produced in other organisms. In this study we searched genomic databases and found Tg orthologs in all vertebrates including the sea lamprey (Petromyzon marinus). We cloned a full-size Tg coding sequence from western clawed frog (Xenopus tropicalis) and zebrafish (Danio rerio). Comparisons between the representative mammal, amphibian, teleost fish, and basal vertebrate indicate that all of the different domains of Tg, as well as Tg regional structure, are conserved throughout the vertebrates. Indeed, in Xenopus, zebrafish, and lamprey Tgs, key residues, including the hormonogenic tyrosines and the disulfide bond-forming cysteines critical for Tg function, are well conserved despite overall divergence of amino acid sequences. We uncovered upstream sequences that include start codons of zebrafish and Xenopus Tgs and experimentally proved that these are full-length secreted proteins, which are specifically recognized by antibodies against rat Tg. By contrast, we have not been able to find any orthologs of Tg among non-vertebrate species. Thus, Tg appears to be a novel protein elaborated as a single event at the base of vertebrates and virtually unchanged thereafter. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Factors affecting expression of the recF gene of Escherichia coli K-12.

    PubMed

    Sandler, S J; Clark, A J

    1990-01-31

    This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

  8. Monoamine oxidase A expression is suppressed in human cholangiocarcinoma via coordinated epigenetic and IL-6-driven events

    PubMed Central

    Huang, Li; Frampton, Gabriel; Rao, Arundhati; Zhang, Kun-song; Chen, Wei; Lai, Jia-ming; Yin, Xiao-yu; Walker, Kimberly; Culbreath, Brianne; Leyva-Illades, Dinorah; Quinn, Matthew; McMillin, Matthew; Bradley, Michelle; Liang, Li-Jian; DeMorrow, Sharon

    2014-01-01

    Objectives The secretion of dopamine and serotonin is increased in cholangiocarcinoma, which has growth-promoting effects. Monoamine oxidase A (MAOA), the degradation enzyme of serotonin and dopamine, is suppressed in cholangiocarcinoma via an unknown mechanism. The aims of this study were to (i) correlate MAOA immunoreactivity with pathophysiological parameters of cholangiocarcinoma, (ii) determine the mechanism by which MAOA expression is suppressed and (iii) evaluate the consequences of restored MAOA expression in cholangiocarcinoma. Design MAOA expression was assessed in cholangiocarcinoma and non-malignant controls. The control of MAOA expression by promoter hypermethylation was evaluated and the contribution of IL-6 signaling to the suppression of MAOA expression was determined. The effects of MAOA overexpression on cholangiocarcinoma growth and invasion were also assessed. Results MAOA expression is correlated with differentiation, invasion and survival in cholangiocarcinoma. The MAOA promoter was hypermethylated immediately upstream of the start codon in cholangiocarcinoma samples and cell lines but not in non-malignant counterparts. IL-6 signaling also decreased MAOA expression via a mechanism independent of hypermethylation, involving the regulation of the balance between SP-1 transcriptional activity and its inhibitor, R1 repressor. Inhibition of both IL-6 signaling and DNA methylation restored MAOA levels to those observed in cholangiocytes. Forced MAOA overexpression inhibited cholangiocarcinoma growth and invasion. Conclusions MAOA expression is suppressed by the coordinated control of promoter hypermethylation and IL-6 signaling. MAOA may be a useful prognostic marker in the management of cholangiocarcinoma, and therapies designed to increase MAOA expression might prove beneficial in the treatment of cholangiocarcinoma. PMID:22906985

  9. Genetic analysis of the dsz promoter and associated regulatory regions of Rhodococcus erythropolis IGTS8.

    PubMed Central

    Li, M Z; Squires, C H; Monticello, D J; Childs, J D

    1996-01-01

    The dsz gene cluster of Rhodococcus erythropolis IGTS8 comprises three genes, dszA, dszB, and dszC, whose products are involved in the conversion of dibenzothiophene (DBT) to 2-hydroxybiphenyl and sulfite. This organism can use DBT as the sole sulfur source but not as a carbon source. Dsz activity is repressed by methionine, cysteine, Casamino Acids, and sulfate but not by DBT or dimethyl sulfoxide. We cloned 385 bp of the DNA immediately 5' to dszA in front of the reporter gene lacZ of Escherichia coli. We showed that this region contains a Rhodococcus promoter and at least three dsz regulatory regions. After hydrazine mutagenesis of this DNA, colonies that were able to express beta-galactosidase in the presence of Casamino Acids were isolated. Sequencing of these mutants revealed two possible regulatory regions. One is at -263 to -244, and the other is at -93 to -38, where -1 is the base preceding the A of the initiation codon ATG of dszA. An S1 nuclease protection assay showed that the start of the dsz promoter is the G at -46 and that transcription is repressed by sulfate and cysteine but not by dimethyl sulfoxide. The promoter encompasses a region of potential diad symmetry that may contain an operator. Immediately upstream of the promoter is a protein-binding domain between -146 and -121. Deletion of this region did not affect repression, but promoter activity appeared to be reduced by threefold. Thus, it could be an activator binding site or an enhancer region. PMID:8932295

  10. Monoamine oxidase A expression is suppressed in human cholangiocarcinoma via coordinated epigenetic and IL-6-driven events.

    PubMed

    Huang, Li; Frampton, Gabriel; Rao, Arundhati; Zhang, Kun-song; Chen, Wei; Lai, Jia-ming; Yin, Xiao-yu; Walker, Kimberly; Culbreath, Brianne; Leyva-Illades, Dinorah; Quinn, Matthew; McMillin, Matthew; Bradley, Michelle; Liang, Li-Jian; DeMorrow, Sharon

    2012-10-01

    The secretion of dopamine and serotonin is increased in cholangiocarcinoma, which has growth-promoting effects. Monoamine oxidase A (MAOA), the degradation enzyme of serotonin and dopamine, is suppressed in cholangiocarcinoma via an unknown mechanism. The aims of this study were to (i) correlate MAOA immunoreactivity with pathophysiological parameters of cholangiocarcinoma, (ii) determine the mechanism by which MAOA expression is suppressed and (iii) evaluate the consequences of restored MAOA expression in cholangiocarcinoma. MAOA expression was assessed in cholangiocarcinoma and nonmalignant controls. The control of MAOA expression by promoter hypermethylation was evaluated and the contribution of interleukin-6 (IL-6) signaling to the suppression of MAOA expression was determined. The effects of MAOA overexpression on cholangiocarcinoma growth and invasion were also assessed. MAOA expression is correlated with differentiation, invasion and survival in cholangiocarcinoma. The MAOA promoter was hypermethylated immediately upstream of the start codon in cholangiocarcinoma samples and cell lines but not in nonmalignant counterparts. IL-6 signaling also decreased MAOA expression via a mechanism independent of hypermethylation, involving the regulation of the balance between SP-1 transcriptional activity and its inhibitor, R1 repressor. Inhibition of both IL-6 signaling and DNA methylation restored MAOA levels to those observed in cholangiocytes. Forced MAOA overexpression inhibited cholangiocarcinoma growth and invasion. MAOA expression is suppressed by the coordinated control of promoter hypermethylation and IL-6 signaling. MAOA may be a useful prognostic marker in the management of cholangiocarcinoma, and therapies designed to increase MAOA expression might prove beneficial in the treatment of cholangiocarcinoma.

  11. Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

    1990-01-01

    A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

  12. Elevated breast cancer risk in irradiated BALB/c mice associates with unique functional polymorphism of the Prkdc (DNA-dependent protein kinase catalytic subunit) gene

    NASA Technical Reports Server (NTRS)

    Yu, Y.; Okayasu, R.; Weil, M. M.; Silver, A.; McCarthy, M.; Zabriskie, R.; Long, S.; Cox, R.; Ullrich, R. L.

    2001-01-01

    Female BALB/c mice are unusually radiosensitive and more susceptible than C57BL/6 and other tested inbred mice to ionizing radiation (IR)-induced mammary tumors. This breast cancer susceptibility is correlated with elevated susceptibility for mammary cell transformation and genomic instability following irradiation. In this study, we report the identification of two BALB/c strain-specific polymorphisms in the coding region of Prkdc, the gene encoding the DNA-dependent protein kinase catalytic subunit, which is known to be involved in DNA double-stranded break repair and post-IR signal transduction. First, we identified an A --> G transition at base 11530 resulting in a Met --> Val conversion at codon 3844 (M3844V) in the phosphatidylinositol 3-kinase domain upstream of the scid mutation (Y4046X). Second, we identified a C --> T transition at base 6418 resulting in an Arg --> Cys conversion at codon 2140 (R2140C) downstream of the putative leucine zipper domain. This unique PrkdcBALB variant gene is shown to be associated with decreased DNA-dependent protein kinase catalytic subunit activity and with increased susceptibility to IR-induced genomic instability in primary mammary epithelial cells. The data provide the first evidence that naturally arising allelic variation in a mouse DNA damage response gene may associate with IR response and breast cancer risk.

  13. Functional Analyses of c.2268dup in Thyroid Peroxidase Gene Associated with Goitrous Congenital Hypothyroidism

    PubMed Central

    Harun, Fatimah; Jalaludin, Muhammad Yazid; Lim, Chor Yin; Ng, Khoon Leong

    2014-01-01

    The c.2268dup mutation in thyroid peroxidase (TPO) gene was reported to be a founder mutation in Taiwanese patients with dyshormonogenetic congenital hypothyroidism (CH). The functional impact of the mutation is not well documented. In this study, homozygous c.2268dup mutation was detected in two Malaysian-Chinese sisters with goitrous CH. Normal and alternatively spliced TPO mRNA transcripts were present in thyroid tissues of the two sisters. The abnormal transcript contained 34 nucleotides originating from intron 12. The c.2268dup is predicted to generate a premature termination codon (PTC) at position 757 (p.Glu757X). Instead of restoring the normal reading frame, the alternatively spliced transcript has led to another stop codon at position 740 (p.Asp739ValfsX740). The two PTCs are located at 116 and 201 nucleotides upstream of the exons 13/14 junction fulfilling the requirement for a nonsense-mediated mRNA decay (NMD). Quantitative RT-PCR revealed an abundance of unidentified transcripts believed to be associated with the NMD. TPO enzyme activity was not detected in both patients, even though a faint TPO band of about 80 kD was present. In conclusion, the c.2268dup mutation leads to the formation of normal and alternatively spliced TPO mRNA transcripts with a consequential loss of TPO enzymatic activity in Malaysian-Chinese patients with goitrous CH. PMID:24745015

  14. Complete mitochondrial genome of the agarophyte red alga Gelidium vagum (Gelidiales).

    PubMed

    Yang, Eun Chan; Kim, Kyeong Mi; Boo, Ga Hun; Lee, Jung-Hyun; Boo, Sung Min; Yoon, Hwan Su

    2014-08-01

    We describe the first complete mitochondrial genome of Gelidium vagum (Gelidiales) (24,901 bp, 30.4% GC content), an agar-producing red alga. The circular mitochondrial genome contains 43 genes, including 23 protein-coding, 18 tRNA and 2 rRNA genes. All the protein-coding genes have a typical ATG start codon. No introns were found. Two genes, secY and rps12, were overlapped by 41 bp.

  15. RHIC Prefire Protection Masks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drees, A.; Biscardi, C.; Curcio, T.

    2015-01-07

    The protection of the RHIC experimental detectors from damage due to beam hitting close upstream elements in cases of abort kicker prefires requires some dedicated precautionary measures with two general options: to bring the beam close to a limiting aperture (i.e. the beam pipe wall), as far upstream of the detector components as possible or, alternatively, to bring a limiting aperture close to the circulating beam. During the FY 2014 RHIC Heavy Ion run the first option was chosen because of the limited time available for preparation before the start of the run. For future runs the second option, inmore » this case the installation of dual-sided movable masks, is preferred. The installation of the masks, one per ring, is planned before the start of the FY 2015 run.« less

  16. Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

    PubMed Central

    Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

    1984-01-01

    Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

  17. The first report of prion-related protein gene (PRNT) polymorphisms in goat.

    PubMed

    Kim, Yong-Chan; Jeong, Byung-Hoon

    2017-06-01

    Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

  18. The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae)

    PubMed Central

    Liao, Fang; Wang, Lin; Wu, Song; Li, Yu-Ping; Zhao, Lei; Huang, Guo-Ming; Niu, Chun-Jing; Liu, Yan-Qun; Li, Ming-Gang

    2010-01-01

    The complete mitochondrial genome (mitogenome) of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae) was determined. The genome is a circular molecule 15 481 bp long. It presents a typical gene organization and order for completely sequenced lepidopteran mitogenomes, but differs from the insect ancestral type for the placement of tRNAMet. The nucleotide composition of the genome is also highly A + T biased, accounting for 80.38%, with a slightly positive AT skewness (0.010), indicating the occurrence of more As than Ts, as found in the Noctuoidea species. All protein-coding genes (PCGs) are initiated by ATN codons, except for COI, which is tentatively designated by the CGA codon as observed in other lepidopterans. Four of 13 PCGs harbor the incomplete termination codon, T or TA. All tRNAs have a typical clover-leaf structure of mitochondrial tRNAs, except for tRNASer(AGN), the DHU arm of which could not form a stable stem-loop structure. The intergenic spacer sequence between tRNASer(AGN) and ND1 also contains the ATACTAA motif, which is conserved across the Lepidoptera order. The H. cunea A+T-rich region of 357 bp is comprised of non-repetitive sequences, but harbors several features common to the Lepidoptera insects, including the motif ATAGA followed by an 18 bp poly-T stretch, a microsatellite-like (AT)8 element preceded by the ATTTA motif, an 11 bp poly-A present immediately upstream tRNAMet. The phylogenetic analyses support the view that the H. cunea is closerly related to the Lymantria dispar than Ochrogaster lunifer, and support the hypothesis that Noctuoidea (H. cunea, L. dispar, and O. lunifer) and Geometroidea (Phthonandria atrilineata) are monophyletic. However, in the phylogenetic trees based on mitogenome sequences among the lepidopteran superfamilies, Papillonoidea (Artogeia melete, Acraea issoria, and Coreana raphaelis) joined basally within the monophyly of Lepidoptera, which is different to the traditional classification. PMID:20376208

  19. Analysis of synonymous codon usage patterns in the genus Rhizobium.

    PubMed

    Wang, Xinxin; Wu, Liang; Zhou, Ping; Zhu, Shengfeng; An, Wei; Chen, Yu; Zhao, Lin

    2013-11-01

    The codon usage patterns of rhizobia have received increasing attention. However, little information is available regarding the conserved features of the codon usage patterns in a typical rhizobial genus. The codon usage patterns of six completely sequenced strains belonging to the genus Rhizobium were analysed as model rhizobia in the present study. The relative neutrality plot showed that selection pressure played a role in codon usage in the genus Rhizobium. Spearman's rank correlation analysis combined with correspondence analysis (COA) showed that the codon adaptation index and the effective number of codons (ENC) had strong correlation with the first axis of the COA, which indicated the important role of gene expression level and the ENC in the codon usage patterns in this genus. The relative synonymous codon usage of Cys codons had the strongest correlation with the second axis of the COA. Accordingly, the usage of Cys codons was another important factor that shaped the codon usage patterns in Rhizobium genomes and was a conserved feature of the genus. Moreover, the comparison of codon usage between highly and lowly expressed genes showed that 20 unique preferred codons were shared among Rhizobium genomes, revealing another conserved feature of the genus. This is the first report of the codon usage patterns in the genus Rhizobium.

  20. An Upstream Open Reading Frame Is Essential for Feedback Regulation of Ascorbate Biosynthesis in Arabidopsis

    PubMed Central

    Laing, William A.; Martínez-Sánchez, Marcela; Wright, Michele A.; Bulley, Sean M.; Brewster, Di; Dare, Andrew P.; Rassam, Maysoon; Wang, Daisy; Storey, Roy; Macknight, Richard C.; Hellens, Roger P.

    2015-01-01

    Ascorbate (vitamin C) is an essential antioxidant and enzyme cofactor in both plants and animals. Ascorbate concentration is tightly regulated in plants, partly to respond to stress. Here, we demonstrate that ascorbate concentrations are determined via the posttranscriptional repression of GDP-l-galactose phosphorylase (GGP), a major control enzyme in the ascorbate biosynthesis pathway. This regulation requires a cis-acting upstream open reading frame (uORF) that represses the translation of the downstream GGP open reading frame under high ascorbate concentration. Disruption of this uORF stops the ascorbate feedback regulation of translation and results in increased ascorbate concentrations in leaves. The uORF is predicted to initiate at a noncanonical codon (ACG rather than AUG) and encode a 60- to 65-residue peptide. Analysis of ribosome protection data from Arabidopsis thaliana showed colocation of high levels of ribosomes with both the uORF and the main coding sequence of GGP. Together, our data indicate that the noncanonical uORF is translated and encodes a peptide that functions in the ascorbate inhibition of translation. This posttranslational regulation of ascorbate is likely an ancient mechanism of control as the uORF is conserved in GGP genes from mosses to angiosperms. PMID:25724639

  1. An upstream open reading frame is essential for feedback regulation of ascorbate biosynthesis in Arabidopsis.

    PubMed

    Laing, William A; Martínez-Sánchez, Marcela; Wright, Michele A; Bulley, Sean M; Brewster, Di; Dare, Andrew P; Rassam, Maysoon; Wang, Daisy; Storey, Roy; Macknight, Richard C; Hellens, Roger P

    2015-03-01

    Ascorbate (vitamin C) is an essential antioxidant and enzyme cofactor in both plants and animals. Ascorbate concentration is tightly regulated in plants, partly to respond to stress. Here, we demonstrate that ascorbate concentrations are determined via the posttranscriptional repression of GDP-l-galactose phosphorylase (GGP), a major control enzyme in the ascorbate biosynthesis pathway. This regulation requires a cis-acting upstream open reading frame (uORF) that represses the translation of the downstream GGP open reading frame under high ascorbate concentration. Disruption of this uORF stops the ascorbate feedback regulation of translation and results in increased ascorbate concentrations in leaves. The uORF is predicted to initiate at a noncanonical codon (ACG rather than AUG) and encode a 60- to 65-residue peptide. Analysis of ribosome protection data from Arabidopsis thaliana showed colocation of high levels of ribosomes with both the uORF and the main coding sequence of GGP. Together, our data indicate that the noncanonical uORF is translated and encodes a peptide that functions in the ascorbate inhibition of translation. This posttranslational regulation of ascorbate is likely an ancient mechanism of control as the uORF is conserved in GGP genes from mosses to angiosperms. © 2015 American Society of Plant Biologists. All rights reserved.

  2. Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

    NASA Astrophysics Data System (ADS)

    Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

    2016-04-01

    The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

  3. Genome-wide comparative analysis of codon usage bias and codon context patterns among cyanobacterial genomes.

    PubMed

    Prabha, Ratna; Singh, Dhananjaya P; Sinha, Swati; Ahmad, Khurshid; Rai, Anil

    2017-04-01

    With the increasing accumulation of genomic sequence information of prokaryotes, the study of codon usage bias has gained renewed attention. The purpose of this study was to examine codon selection pattern within and across cyanobacterial species belonging to diverse taxonomic orders and habitats. We performed detailed comparative analysis of cyanobacterial genomes with respect to codon bias. Our analysis reflects that in cyanobacterial genomes, A- and/or T-ending codons were used predominantly in the genes whereas G- and/or C-ending codons were largely avoided. Variation in the codon context usage of cyanobacterial genes corresponded to the clustering of cyanobacteria as per their GC content. Analysis of codon adaptation index (CAI) and synonymous codon usage order (SCUO) revealed that majority of genes are associated with low codon bias. Codon selection pattern in cyanobacterial genomes reflected compositional constraints as major influencing factor. It is also identified that although, mutational constraint may play some role in affecting codon usage bias in cyanobacteria, compositional constraint in terms of genomic GC composition coupled with environmental factors affected codon selection pattern in cyanobacterial genomes. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Codon usage bias in prokaryotic pyrimidine-ending codons is associated with the degeneracy of the encoded amino acids

    PubMed Central

    Wald, Naama; Alroy, Maya; Botzman, Maya; Margalit, Hanah

    2012-01-01

    Synonymous codons are unevenly distributed among genes, a phenomenon termed codon usage bias. Understanding the patterns of codon bias and the forces shaping them is a major step towards elucidating the adaptive advantage codon choice can confer at the level of individual genes and organisms. Here, we perform a large-scale analysis to assess codon usage bias pattern of pyrimidine-ending codons in highly expressed genes in prokaryotes. We find a bias pattern linked to the degeneracy of the encoded amino acid. Specifically, we show that codon-pairs that encode two- and three-fold degenerate amino acids are biased towards the C-ending codon while codons encoding four-fold degenerate amino acids are biased towards the U-ending codon. This codon usage pattern is widespread in prokaryotes, and its strength is correlated with translational selection both within and between organisms. We show that this bias is associated with an improved correspondence with the tRNA pool, avoidance of mis-incorporation errors during translation and moderate stability of codon–anticodon interaction, all consistent with more efficient translation. PMID:22581775

  5. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

    1980-01-01

    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  6. Integrated analysis of individual codon contribution to protein biosynthesis reveals a new approach to improving the basis of rational gene design

    PubMed Central

    Villada, Juan C.; Brustolini, Otávio José Bernardes

    2017-01-01

    Abstract Gene codon optimization may be impaired by the misinterpretation of frequency and optimality of codons. Although recent studies have revealed the effects of codon usage bias (CUB) on protein biosynthesis, an integrated perspective of the biological role of individual codons remains unknown. Unlike other previous studies, we show, through an integrated framework that attributes of codons such as frequency, optimality and positional dependency should be combined to unveil individual codon contribution for protein biosynthesis. We designed a codon quantification method for assessing CUB as a function of position within genes with a novel constraint: the relativity of position-dependent codon usage shaped by coding sequence length. Thus, we propose a new way of identifying the enrichment, depletion and non-uniform positional distribution of codons in different regions of yeast genes. We clustered codons that shared attributes of frequency and optimality. The cluster of non-optimal codons with rare occurrence displayed two remarkable characteristics: higher codon decoding time than frequent–non-optimal cluster and enrichment at the 5′-end region, where optimal codons with the highest frequency are depleted. Interestingly, frequent codons with non-optimal adaptation to tRNAs are uniformly distributed in the Saccharomyces cerevisiae genes, suggesting their determinant role as a speed regulator in protein elongation. PMID:28449100

  7. Integrated analysis of individual codon contribution to protein biosynthesis reveals a new approach to improving the basis of rational gene design.

    PubMed

    Villada, Juan C; Brustolini, Otávio José Bernardes; Batista da Silveira, Wendel

    2017-08-01

    Gene codon optimization may be impaired by the misinterpretation of frequency and optimality of codons. Although recent studies have revealed the effects of codon usage bias (CUB) on protein biosynthesis, an integrated perspective of the biological role of individual codons remains unknown. Unlike other previous studies, we show, through an integrated framework that attributes of codons such as frequency, optimality and positional dependency should be combined to unveil individual codon contribution for protein biosynthesis. We designed a codon quantification method for assessing CUB as a function of position within genes with a novel constraint: the relativity of position-dependent codon usage shaped by coding sequence length. Thus, we propose a new way of identifying the enrichment, depletion and non-uniform positional distribution of codons in different regions of yeast genes. We clustered codons that shared attributes of frequency and optimality. The cluster of non-optimal codons with rare occurrence displayed two remarkable characteristics: higher codon decoding time than frequent-non-optimal cluster and enrichment at the 5'-end region, where optimal codons with the highest frequency are depleted. Interestingly, frequent codons with non-optimal adaptation to tRNAs are uniformly distributed in the Saccharomyces cerevisiae genes, suggesting their determinant role as a speed regulator in protein elongation. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  8. Partial attenuation of Marek's disease virus by manipulation of Di-codon bias

    USDA-ARS?s Scientific Manuscript database

    All species studied to date demonstrate a preference for certain codons over other synonymous codons (codon bias), a preference which is also observed for pairs of codons (di-codon bias). Previous studies using poliovirus and influenza virus as models have demonstrated the ability to cause attenuat...

  9. Multiple Transcript Properties Related to Translation Affect mRNA Degradation Rates in Saccharomyces cerevisiae

    PubMed Central

    Neymotin, Benjamin; Ettorre, Victoria; Gresham, David

    2016-01-01

    Degradation of mRNA contributes to variation in transcript abundance. Studies of individual mRNAs have shown that both cis and trans factors affect mRNA degradation rates. However, the factors underlying transcriptome-wide variation in mRNA degradation rates are poorly understood. We investigated the contribution of different transcript properties to transcriptome-wide degradation rate variation in the budding yeast, Saccharomyces cerevisiae, using multiple regression analysis. We find that multiple transcript properties are significantly associated with variation in mRNA degradation rates, and that a model incorporating these properties explains ∼50% of the genome-wide variance. Predictors of mRNA degradation rates include transcript length, ribosome density, biased codon usage, and GC content of the third position in codons. To experimentally validate these factors, we studied individual transcripts expressed from identical promoters. We find that decreasing ribosome density by mutating the first translational start site of a transcript increases its degradation rate. Using coding sequence variants of green fluorescent protein (GFP) that differ only at synonymous sites, we show that increased GC content of the third position of codons results in decreased rates of mRNA degradation. Thus, in steady-state conditions, a large fraction of genome-wide variation in mRNA degradation rates is determined by inherent properties of transcripts, many of which are related to translation, rather than specific regulatory mechanisms. PMID:27633789

  10. Transcriptome Analysis of Core Dinoflagellates Reveals a Universal Bias towards "GC" Rich Codons.

    PubMed

    Williams, Ernest; Place, Allen; Bachvaroff, Tsvetan

    2017-04-27

    Although dinoflagellates are a potential source of pharmaceuticals and natural products, the mechanisms for regulating and producing these compounds are largely unknown because of extensive post-transcriptional control of gene expression. One well-documented mechanism for controlling gene expression during translation is codon bias, whereby specific codons slow or even terminate protein synthesis. Approximately 10,000 annotatable genes from fifteen "core" dinoflagellate transcriptomes along a range of overall guanine and cytosine (GC) content were used for codonW analysis to determine the relative synonymous codon usage (RSCU) and the GC content at each codon position. GC bias in the analyzed dataset and at the third codon position varied from 51% and 54% to 66% and 88%, respectively. Codons poor in GC were observed to be universally absent, but bias was most pronounced for codons ending in uracil followed by adenine (UA). GC bias at the third codon position was able to explain low abundance codons as well as the low effective number of codons. Thus, we propose that a bias towards codons rich in GC bases is a universal feature of core dinoflagellates, possibly relating to their unique chromosome structure, and not likely a major mechanism for controlling gene expression.

  11. Multiple Evolutionary Selections Involved in Synonymous Codon Usages in the Streptococcus agalactiae Genome.

    PubMed

    Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Liu, Zhen-Xing; Hao, Le; Ma, Jiang-Yao; Li, Yu-Gu

    2016-02-24

    Streptococcus agalactiae is an important human and animal pathogen. To better understand the genetic features and evolution of S. agalactiae, multiple factors influencing synonymous codon usage patterns in S. agalactiae were analyzed in this study. A- and U-ending rich codons were used in S. agalactiae function genes through the overall codon usage analysis, indicating that Adenine (A)/Thymine (T) compositional constraints might contribute an important role to the synonymous codon usage pattern. The GC3% against the effective number of codon (ENC) value suggested that translational selection was the important factor for codon bias in the microorganism. Principal component analysis (PCA) showed that (i) mutational pressure was the most important factor in shaping codon usage of all open reading frames (ORFs) in the S. agalactiae genome; (ii) strand specific mutational bias was not capable of influencing the codon usage bias in the leading and lagging strands; and (iii) gene length was not the important factor in synonymous codon usage pattern in this organism. Additionally, the high correlation between tRNA adaptation index (tAI) value and codon adaptation index (CAI), frequency of optimal codons (Fop) value, reinforced the role of natural selection for efficient translation in S. agalactiae. Comparison of synonymous codon usage pattern between S. agalactiae and susceptible hosts (human and tilapia) showed that synonymous codon usage of S. agalactiae was independent of the synonymous codon usage of susceptible hosts. The study of codon usage in S. agalactiae may provide evidence about the molecular evolution of the bacterium and a greater understanding of evolutionary relationships between S. agalactiae and its hosts.

  12. Multiple Evolutionary Selections Involved in Synonymous Codon Usages in the Streptococcus agalactiae Genome

    PubMed Central

    Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Liu, Zhen-Xing; Hao, Le; Ma, Jiang-Yao; Li, Yu-Gu

    2016-01-01

    Streptococcus agalactiae is an important human and animal pathogen. To better understand the genetic features and evolution of S. agalactiae, multiple factors influencing synonymous codon usage patterns in S. agalactiae were analyzed in this study. A- and U-ending rich codons were used in S. agalactiae function genes through the overall codon usage analysis, indicating that Adenine (A)/Thymine (T) compositional constraints might contribute an important role to the synonymous codon usage pattern. The GC3% against the effective number of codon (ENC) value suggested that translational selection was the important factor for codon bias in the microorganism. Principal component analysis (PCA) showed that (i) mutational pressure was the most important factor in shaping codon usage of all open reading frames (ORFs) in the S. agalactiae genome; (ii) strand specific mutational bias was not capable of influencing the codon usage bias in the leading and lagging strands; and (iii) gene length was not the important factor in synonymous codon usage pattern in this organism. Additionally, the high correlation between tRNA adaptation index (tAI) value and codon adaptation index (CAI), frequency of optimal codons (Fop) value, reinforced the role of natural selection for efficient translation in S. agalactiae. Comparison of synonymous codon usage pattern between S. agalactiae and susceptible hosts (human and tilapia) showed that synonymous codon usage of S. agalactiae was independent of the synonymous codon usage of susceptible hosts. The study of codon usage in S. agalactiae may provide evidence about the molecular evolution of the bacterium and a greater understanding of evolutionary relationships between S. agalactiae and its hosts. PMID:26927064

  13. File Compression and Expansion of the Genetic Code by the use of the Yin/Yang Directions to find its Sphered Cube

    PubMed Central

    Castro-Chavez, Fernando

    2014-01-01

    Objective The objective of this article is to demonstrate that the genetic code can be studied and represented in a 3-D Sphered Cube for bioinformatics and for education by using the graphical help of the ancient “Book of Changes” or I Ching for the comparison, pair by pair, of the three basic characteristics of nucleotides: H-bonds, molecular structure, and their tautomerism. Methods The source of natural biodiversity is the high plasticity of the genetic code, analyzable with a reverse engineering of its 2-D and 3-D representations (here illustrated), but also through the classical 64-hexagrams of the ancient I Ching, as if they were the 64-codons or words of the genetic code. Results In this article, the four elements of the Yin/Yang were found by correlating the 3×2=6 sets of Cartesian comparisons of the mentioned properties of nucleic acids, to the directionality of their resulting blocks of codons grouped according to their resulting amino acids and/or functions, integrating a 384-codon Sphered Cube whose function is illustrated by comparing six brain peptides and a promoter of osteoblasts from Humans versus Neanderthal, as well as to Negadi’s work on the importance of the number 384 within the genetic code. Conclusions Starting with the codon/anticodon correlation of Nirenberg, published in full here for the first time, and by studying the genetic code and its 3-D display, the buffers of reiteration within codons codifying for the same amino acid, displayed the two long (binary number one) and older Yin/Yang arrows that travel in opposite directions, mimicking the parental DNA strands, while annealing to the two younger and broken (binary number zero) Yin/Yang arrows, mimicking the new DNA strands; the graphic analysis of the of the genetic code and its plasticity was helpful to compare compatible sequences (human compatible to human versus neanderthal compatible to neanderthal), while further exploring the wondrous biodiversity of nature for educational purposes. PMID:25340175

  14. Translation efficiencies of synonymous codons are not always correlated with codon usage in tobacco chloroplasts.

    PubMed

    Nakamura, Masayuki; Sugiura, Masahiro

    2007-01-01

    Codon usage in chloroplasts is different from that in prokaryotic and eukaryotic nuclear genomes. However, no experimental approach has been made to analyse the translation efficiency of individual codons in chloroplasts. We devised an in vitro assay for translation efficiencies using synthetic mRNAs, and measured the translation efficiencies of five synonymous codon groups in tobacco chloroplasts. Among four alanine codons (GCN, where N is U, C, A or G), GCU was the most efficient for translation, whereas the chloroplast genome lacks tRNA genes corresponding to GCU. Phenylalanine and tyrosine are each encoded by two codons (UUU/C and UAU/C, respectively). Phenylalanine UUC and tyrosine UAC were translated more than twice as efficiently than UUU and UAU, respectively, contrary to their codon usage, whereas translation efficiencies of synonymous codons for alanine, aspartic acid and asparagine were parallel to their codon usage. These observations indicate that translation efficiencies of individual codons are not always correlated with codon usage in vitro in chloroplasts. This raises an important issue for foreign gene expression in chloroplasts.

  15. Functional Versatility of AGY Serine Codons in Immunoglobulin Variable Region Genes

    PubMed Central

    Detanico, Thiago; Phillips, Matthew; Wysocki, Lawrence J.

    2016-01-01

    In systemic autoimmunity, autoantibodies directed against nuclear antigens (Ags) often arise by somatic hypermutation (SHM) that converts AGT and AGC (AGY) Ser codons into Arg codons. This can occur by three different single-base changes. Curiously, AGY Ser codons are far more abundant in complementarity-determining regions (CDRs) of IgV-region genes than expected for random codon use or from species-specific codon frequency data. CDR AGY codons are also more abundant than TCN Ser codons. We show that these trends hold even in cartilaginous fishes. Because AGC is a preferred target for SHM by activation-induced cytidine deaminase, we asked whether the AGY abundance was solely due to a selection pressure to conserve high mutability in CDRs regardless of codon context but found that this was not the case. Instead, AGY triplets were selectively enriched in the Ser codon reading frame. Motivated by reports implicating a functional role for poly/autoreactive specificities in antiviral antibodies, we also analyzed mutations at AGY in antibodies directed against a number of different viruses and found that mutations producing Arg codons in antiviral antibodies were indeed frequent. Unexpectedly, however, we also found that AGY codons mutated often to encode nearly all of the amino acids that are reported to provide the most frequent contacts with Ag. In many cases, mutations producing codons for these alternative amino acids in antiviral antibodies were more frequent than those producing Arg codons. Mutations producing each of these key amino acids required only single-base changes in AGY. AGY is the only codon group in which two-thirds of random mutations generate codons for these key residues. Finally, by directly analyzing X-ray structures of immune complexes from the RCSB protein database, we found that Ag-contact residues generated via SHM occurred more often at AGY than at any other codon group. Thus, preservation of AGY codons in antibody genes appears to have been driven by their exceptional functional versatility, despite potential autoreactive consequences. PMID:27920779

  16. The complete mitochondrial genome of Pomacea canaliculata (Gastropoda: Ampullariidae).

    PubMed

    Zhou, Xuming; Chen, Yu; Zhu, Shanliang; Xu, Haigen; Liu, Yan; Chen, Lian

    2016-01-01

    The mitochondrial genome of Pomacea canaliculata (Gastropoda: Ampullariidae) is the first complete mtDNA sequence reported in the genus Pomacea. The total length of mtDNA is 15,707 bp, which containing 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a 359 bp non-coding region. The A + T content of the overall base composition of H-strand is 71.7% (T: 41%, C: 12.7%, A: 30.7%, G: 15.6%). ATP6, ATP8, CO1, CO2, ND1-3, ND5, ND6, ND4L and Cyt b genes begin with ATG as start codon, CO3 and ND4 begin with ATA. ATP8, CO2-3, ND4L, ND2-6 and Cyt b genes are terminated with TAA as stop codon, ATP6, ND1, and CO1 end with TAG. A long non-coding region is found and a 23 bp repeat unit repeat 11 times in this region.

  17. The complete mitochondrial genome of the Aluterus monoceros.

    PubMed

    Li, Wenshen; Zhang, Guoqing; Wen, Xin; Wang, Qian; Chen, Guohua

    2016-07-01

    The complete mitochondrial genome of Aluterus monoceros (A. monoceros) has been sequenced. The mitochondrial genome of A. monoceros is 16,429 bp in length, consisting of 22 tRNA genes, 2 rRNA genes, 13 protein-coding genes and a D-loop region (Gen Bank accession number KP637022). The base A + T of the mitochondrial genome is 63.25%, including 33.16% of A, 30.09% of T and 20.74% of C. Twelve protein-coding genes start with a standard ATG as the initiation codon, expect for the COXI, which begins with GTG. Some of the termination codons are incomplete T or TA, except for the ND1, COXI, ATP8, ND4L1, ND5 and ND6, which stop with TAA. Construction of phylogenetic trees based on the entire mitochondrial genome sequence of 14 Tetrodontiformes species constructed has suggested that A. monoceros has closer relationship with Acreichthys tomentosus and Monacanthus chinensis, and they constitute a sister group.

  18. Systematic bacterialization of yeast genes identifies a near-universally swappable pathway

    PubMed Central

    Kachroo, Aashiq H; Laurent, Jon M; Akhmetov, Azat; Szilagyi-Jones, Madelyn; McWhite, Claire D; Zhao, Alice; Marcotte, Edward M

    2017-01-01

    Eukaryotes and prokaryotes last shared a common ancestor ~2 billion years ago, and while many present-day genes in these lineages predate this divergence, the extent to which these genes still perform their ancestral functions is largely unknown. To test principles governing retention of ancient function, we asked if prokaryotic genes could replace their essential eukaryotic orthologs. We systematically replaced essential genes in yeast by their 1:1 orthologs from Escherichia coli. After accounting for mitochondrial localization and alternative start codons, 31 out of 51 bacterial genes tested (61%) could complement a lethal growth defect and replace their yeast orthologs with minimal effects on growth rate. Replaceability was determined on a pathway-by-pathway basis; codon usage, abundance, and sequence similarity contributed predictive power. The heme biosynthesis pathway was particularly amenable to inter-kingdom exchange, with each yeast enzyme replaceable by its bacterial, human, or plant ortholog, suggesting it as a near-universally swappable pathway. DOI: http://dx.doi.org/10.7554/eLife.25093.001 PMID:28661399

  19. Complete mitochondrial genome of the Yellow-spotted skate Okamejei hollandi (Rajiformes: Rajidae).

    PubMed

    Li, Weidong; Chen, Xiao; Liu, Wenai; Sun, Renjie; Zhou, Haolang

    2016-07-01

    The complete mitochondrial genome of the Yellow-spotted skate Okamejei hollandi was determined in this study. It is 16,974 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes, and one putative control region. The overall base composition is 30.5% A, 27.8% C, 14.0% G, and 27.8% T. There are 28 bp short intergenic spaces located in 12 gene junctions and 31 bp overlaps located in nine gene junctions in the whole mitogenome. Two start codons (ATG and GTG) and two stop codons (TAG and TAA/T) were used in the protein-coding genes. The lengths of 22 tRNA genes range from 68 (tRNA-Ser2) to 75 (tRNA-Leu1) bp. The origin of L-strand replication (OL) sequence (37 bp) was identified between the tRNA-Asn and tRNA-Cys genes. The control region is 1311 bp in length with high A + T and poor G content.

  20. Complete mitochondrial genome of the mottled skate: Raja pulchra (Rajiformes, Rajidae).

    PubMed

    Jeong, Dageum; Kim, Sung; Kim, Choong-Gon; Myoung, Jung-Goo; Lee, Youn-Ho

    2016-05-01

    The complete sequence of mitochondrial DNA of a mottled skate, Raja pulchra was sequenced as being circular molecules of 16,907 bp including 2 rRNA, 22 tRNA, 13 protein-coding genes (PCGs), and an AT-rich control region. The organization of the PCGs is the same as those found in other Rajidae species. The nucleotide of L-strand is composed of 29.8% A, 28.0% C, 27.9% T, and 14.3% G with a bias toward A + T slightly. Twelve of 13 PCGs are initiated by the ATG codon while COX1 starts with GTG. Only ND4 harbors the incomplete termination codon, TA. All tRNA genes have a typical clover-leaf structure of mitochondrial tRNA with the exception of [Formula: see text] which has a reduced DHU arm. This mitogenome will provide essential information for better phylogenetic resolution and precision of the family Rajidae and the genus Raja as well as for establishment of a fish stock recovery plan of the species.

  1. Chloroplast DNA codon use: evidence for selection at the psb A locus based on tRNA availability.

    PubMed

    Morton, B R

    1993-09-01

    Codon use in the three sequenced chloroplast genomes (Marchantia, Oryza, and Nicotiana) is examined. The chloroplast has a bias in that codons NNA and NNT are favored over synonymous NNC and NNG codons. This appears to be a consequence of an overall high A + T content of the genome. This pattern of codon use is not followed by the psb A gene of all three genomes and other psb A sequences examined. In this gene, the codon use favors NNC over NNT for twofold degenerate amino acids. In each case the only tRNA coded by the genome is complementary to the NNC codon. This codon use is similar to the codon use by chloroplast genes examined from Chlamydomonas reinhardtii. Since psb A is the major translation product of the chloroplast, this suggests that selection is acting on the codon use of this gene to adapt codons to tRNA availability, as previously suggested for unicellular organisms.

  2. Genomic analysis of codon usage shows influence of mutation pressure, natural selection, and host features on Marburg virus evolution.

    PubMed

    Nasrullah, Izza; Butt, Azeem M; Tahir, Shifa; Idrees, Muhammad; Tong, Yigang

    2015-08-26

    The Marburg virus (MARV) has a negative-sense single-stranded RNA genome, belongs to the family Filoviridae, and is responsible for several outbreaks of highly fatal hemorrhagic fever. Codon usage patterns of viruses reflect a series of evolutionary changes that enable viruses to shape their survival rates and fitness toward the external environment and, most importantly, their hosts. To understand the evolution of MARV at the codon level, we report a comprehensive analysis of synonymous codon usage patterns in MARV genomes. Multiple codon analysis approaches and statistical methods were performed to determine overall codon usage patterns, biases in codon usage, and influence of various factors, including mutation pressure, natural selection, and its two hosts, Homo sapiens and Rousettus aegyptiacus. Nucleotide composition and relative synonymous codon usage (RSCU) analysis revealed that MARV shows mutation bias and prefers U- and A-ended codons to code amino acids. Effective number of codons analysis indicated that overall codon usage among MARV genomes is slightly biased. The Parity Rule 2 plot analysis showed that GC and AU nucleotides were not used proportionally which accounts for the presence of natural selection. Codon usage patterns of MARV were also found to be influenced by its hosts. This indicates that MARV have evolved codon usage patterns that are specific to both of its hosts. Moreover, selection pressure from R. aegyptiacus on the MARV RSCU patterns was found to be dominant compared with that from H. sapiens. Overall, mutation pressure was found to be the most important and dominant force that shapes codon usage patterns in MARV. To our knowledge, this is the first detailed codon usage analysis of MARV and extends our understanding of the mechanisms that contribute to codon usage and evolution of MARV.

  3. Transcriptome Analysis of Core Dinoflagellates Reveals a Universal Bias towards “GC” Rich Codons

    PubMed Central

    Williams, Ernest; Place, Allen; Bachvaroff, Tsvetan

    2017-01-01

    Although dinoflagellates are a potential source of pharmaceuticals and natural products, the mechanisms for regulating and producing these compounds are largely unknown because of extensive post-transcriptional control of gene expression. One well-documented mechanism for controlling gene expression during translation is codon bias, whereby specific codons slow or even terminate protein synthesis. Approximately 10,000 annotatable genes from fifteen “core” dinoflagellate transcriptomes along a range of overall guanine and cytosine (GC) content were used for codonW analysis to determine the relative synonymous codon usage (RSCU) and the GC content at each codon position. GC bias in the analyzed dataset and at the third codon position varied from 51% and 54% to 66% and 88%, respectively. Codons poor in GC were observed to be universally absent, but bias was most pronounced for codons ending in uracil followed by adenine (UA). GC bias at the third codon position was able to explain low abundance codons as well as the low effective number of codons. Thus, we propose that a bias towards codons rich in GC bases is a universal feature of core dinoflagellates, possibly relating to their unique chromosome structure, and not likely a major mechanism for controlling gene expression. PMID:28448468

  4. Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

    PubMed Central

    Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

    2010-01-01

    Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

  5. Characterization of the porcine epidemic diarrhea virus codon usage bias.

    PubMed

    Chen, Ye; Shi, Yuzhen; Deng, Hongjuan; Gu, Ting; Xu, Jian; Ou, Jinxin; Jiang, Zhiguo; Jiao, Yiren; Zou, Tan; Wang, Chong

    2014-12-01

    Porcine epidemic diarrhea virus (PEDV) has been responsible for several recent outbreaks of porcine epidemic diarrhea (PED) and has caused great economic loss in the swine-raising industry. Considering the significance of PEDV, a systemic analysis was performed to study its codon usage patterns. The relative synonymous codon usage value of each codon revealed that codon usage bias exists and that PEDV tends to use codons that end in T. The mean ENC value of 47.91 indicates that the codon usage bias is low. However, we still wanted to identify the cause of this codon usage bias. A correlation analysis between the codon compositions (A3s, T3s, G3s, C3s, and GC3s), the ENC values, and the nucleotide contents (A%, T%, G%, C%, and GC%) indicated that mutational bias plays role in shaping the PEDV codon usage bias. This was further confirmed by a principal component analysis between the codon compositions and the axis values. Using the Gravy, Aroma, and CAI values, a role of natural selection in the PEDV codon usage pattern was also identified. Neutral analysis indicated that natural selection pressure plays a more important role than mutational bias in codon usage bias. Natural selection also plays an increasingly significant role during PEDV evolution. Additionally, gene function and geographic distribution also influence the codon usage bias to a degree. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Burkholderia Mallei tssM Encodes a Secreted Deubiquitinase that is Expressed Inside Infected RAW 264.7 Murine Macrophages

    DTIC Science & Technology

    2008-10-13

    Furthermore, the encoded protein of this gene is only 30 kDa. A potential GTG start codon at position 625 also encodes a protein that is too small...horizontal bar and putative alternate translation initiation sites (ATG, GTG , and TTG) are indicated. The sizes and locations of the proteins encoded... gray line with rounded rectangles showing sequence features and motifs, including the Ala- and Pro-rich N-terminal region and the C-terminal Cys and

  7. Novel Immune Modulating Cellular Vaccine for Prostate Cancer

    DTIC Science & Technology

    2014-10-01

    restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal

  8. Effect of Estrogen on Mutagenesis in Human Mammary Epithelial Cells

    DTIC Science & Technology

    2005-06-01

    instability remains undefined in most human cancers, it appears to arise from subtle, intragenic mutations of the genes , whose products play a key role in...cells and is less labor-intensive. A G-G or T-G mismatch was introduced into ATG start codon of the enhanced green fluorescent protein (EGFP) gene ...Repair of the G-G or T-G mismatch to G-C or T-A, respectively in the heteroduplex plasmid generates a functional EGFP gene expression. The heteroduplex

  9. Genome-wide analysis of codon usage bias in Ebolavirus.

    PubMed

    Cristina, Juan; Moreno, Pilar; Moratorio, Gonzalo; Musto, Héctor

    2015-01-22

    Ebola virus (EBOV) is a member of the family Filoviridae and its genome consists of a 19-kb, single-stranded, negative sense RNA. EBOV is subdivided into five distinct species with different pathogenicities, being Zaire ebolavirus (ZEBOV) the most lethal species. The interplay of codon usage among viruses and their hosts is expected to affect overall viral survival, fitness, evasion from host's immune system and evolution. In the present study, we performed comprehensive analyses of codon usage and composition of ZEBOV. Effective number of codons (ENC) indicates that the overall codon usage among ZEBOV strains is slightly biased. Different codon preferences in ZEBOV genes in relation to codon usage of human genes were found. Highly preferred codons are all A-ending triplets, which strongly suggests that mutational bias is a main force shaping codon usage in ZEBOV. Dinucleotide composition also plays a role in the overall pattern of ZEBOV codon usage. ZEBOV does not seem to use the most abundant tRNAs present in the human cells for most of their preferred codons. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Synonymous codon usage of genes in polymerase complex of Newcastle disease virus.

    PubMed

    Kumar, Chandra Shekhar; Kumar, Sachin

    2017-06-01

    Newcastle disease virus (NDV) is pathogenic to both avian and non-avian species but extensively finds poultry as its primary host and causes heavy economic losses in the poultry industry. In this study, a total of 186 polymerase complex comprising of nucleoprotein (N), phosphoprotein (P), and large polymerase (L) genes of NDV was analyzed for synonymous codon usage. The relative synonymous codon usage and effective number of codons (ENC) values were used to estimate codon usage variation in each gene. Correspondence analysis (COA) was used to study the major trend in codon usage variation. Analyzing the ENC plot values against GC3s (at synonymous third codon position) we concluded that mutational pressure was the main factor determining codon usage bias than translational selection in NDV N, P, and L genes. Moreover, correlation analysis indicated, that aromaticity of N, P, and L genes also influenced the codon usage variation. The varied distribution of pathotypes for N, P, and L gene clearly suggests that change in codon usage for NDV is pathotype specific. The codon usage preference similarity in N, P, and L gene might be detrimental for polymerase complex functioning. The study represents a comprehensive analysis to date of N, P, and L genes codon usage pattern of NDV and provides a basic understanding of the mechanisms for codon usage bias. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Evolution of Synonymous Codon Usage in Neurospora tetrasperma and Neurospora discreta

    PubMed Central

    Whittle, C. A.; Sun, Y.; Johannesson, H.

    2011-01-01

    Neurospora comprises a primary model system for the study of fungal genetics and biology. In spite of this, little is known about genome evolution in Neurospora. For example, the evolution of synonymous codon usage is largely unknown in this genus. In the present investigation, we conducted a comprehensive analysis of synonymous codon usage and its relationship to gene expression and gene length (GL) in Neurospora tetrasperma and Neurospora discreta. For our analysis, we examined codon usage among 2,079 genes per organism and assessed gene expression using large-scale expressed sequenced tag (EST) data sets (279,323 and 453,559 ESTs for N. tetrasperma and N. discreta, respectively). Data on relative synonymous codon usage revealed 24 codons (and two putative codons) that are more frequently used in genes with high than with low expression and thus were defined as optimal codons. Although codon-usage bias was highly correlated with gene expression, it was independent of selectively neutral base composition (introns); thus demonstrating that translational selection drives synonymous codon usage in these genomes. We also report that GL (coding sequences [CDS]) was inversely associated with optimal codon usage at each gene expression level, with highly expressed short genes having the greatest frequency of optimal codons. Optimal codon frequency was moderately higher in N. tetrasperma than in N. discreta, which might be due to variation in selective pressures and/or mating systems. PMID:21402862

  12. Codon usage bias in phylum Actinobacteria: relevance to environmental adaptation and host pathogenicity.

    PubMed

    Lal, Devi; Verma, Mansi; Behura, Susanta K; Lal, Rup

    2016-10-01

    Actinobacteria are Gram-positive bacteria commonly found in soil, freshwater and marine ecosystems. In this investigation, bias in codon usages of ninety actinobacterial genomes was analyzed by estimating different indices of codon bias such as Nc (effective number of codons), SCUO (synonymous codon usage order), RSCU (relative synonymous codon usage), as well as sequence patterns of codon contexts. The results revealed several characteristic features of codon usage in Actinobacteria, as follows: 1) C- or G-ending codons are used frequently in comparison with A- and U ending codons; 2) there is a direct relationship of GC content with use of specific amino acids such as alanine, proline and glycine; 3) there is an inverse relationship between GC content and Nc estimates, 4) there is low SCUO value (<0.5) for most genes; and 5) GCC-GCC, GCC-GGC, GCC-GAG and CUC-GAC are the frequent context sequences among codons. This study highlights the fact that: 1) in Actinobacteria, extreme GC content and codon bias are driven by mutation rather than natural selection; (2) traits like aerobicity are associated with effective natural selection and therefore low GC content and low codon bias, demonstrating the role of both mutational bias and translational selection in shaping the habitat and phenotype of actinobacterial species. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  13. Analysis of transcriptome data reveals multifactor constraint on codon usage in Taenia multiceps.

    PubMed

    Huang, Xing; Xu, Jing; Chen, Lin; Wang, Yu; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2017-04-20

    Codon usage bias (CUB) is an important evolutionary feature in genomes that has been widely observed in many organisms. However, the synonymous codon usage pattern in the genome of T. multiceps remains to be clarified. In this study, we analyzed the codon usage of T. multiceps based on the transcriptome data to reveal the constraint factors and to gain an improved understanding of the mechanisms that shape synonymous CUB. Analysis of a total of 8,620 annotated mRNA sequences from T. multiceps indicated only a weak codon bias, with mean GC and GC3 content values of 49.29% and 51.43%, respectively. Our analysis indicated that nucleotide composition, mutational pressure, natural selection, gene expression level, amino acids with grand average of hydropathicity (GRAVY) and aromaticity (Aromo) and the effective selection of amino-acids all contributed to the codon usage in T. multiceps. Among these factors, natural selection was implicated as the major factor affecting the codon usage variation in T. multiceps. The codon usage of ribosome genes was affected mainly by mutations, while the essential genes were affected mainly by selection. In addition, 21codons were identified as "optimal codons". Overall, the optimal codons were GC-rich (GC:AU, 41:22), and ended with G or C (except CGU). Furthermore, different degrees of variation in codon usage were found between T. multiceps and Escherichia coli, yeast, Homo sapiens. However, little difference was found between T. multiceps and Taenia pisiformis. In this study, the codon usage pattern of T. multiceps was analyzed systematically and factors affected CUB were also identified. This is the first study of codon biology in T. multiceps. Understanding the codon usage pattern in T. multiceps can be helpful for the discovery of new genes, molecular genetic engineering and evolutionary studies.

  14. Codon usage patterns in Nematoda: analysis based on over 25 million codons in thirty-two species

    PubMed Central

    2006-01-01

    Background Codon usage has direct utility in molecular characterization of species and is also a marker for molecular evolution. To understand codon usage within the diverse phylum Nematoda, we analyzed a total of 265,494 expressed sequence tags (ESTs) from 30 nematode species. The full genomes of Caenorhabditis elegans and C. briggsae were also examined. A total of 25,871,325 codons were analyzed and a comprehensive codon usage table for all species was generated. This is the first codon usage table available for 24 of these organisms. Results Codon usage similarity in Nematoda usually persists over the breadth of a genus but then rapidly diminishes even within each clade. Globodera, Meloidogyne, Pristionchus, and Strongyloides have the most highly derived patterns of codon usage. The major factor affecting differences in codon usage between species is the coding sequence GC content, which varies in nematodes from 32% to 51%. Coding GC content (measured as GC3) also explains much of the observed variation in the effective number of codons (R = 0.70), which is a measure of codon bias, and it even accounts for differences in amino acid frequency. Codon usage is also affected by neighboring nucleotides (N1 context). Coding GC content correlates strongly with estimated noncoding genomic GC content (R = 0.92). On examining abundant clusters in five species, candidate optimal codons were identified that may be preferred in highly expressed transcripts. Conclusion Evolutionary models indicate that total genomic GC content, probably the product of directional mutation pressure, drives codon usage rather than the converse, a conclusion that is supported by examination of nematode genomes. PMID:26271136

  15. A detailed analysis of codon usage patterns and influencing factors in Zika virus.

    PubMed

    Singh, Niraj K; Tyagi, Anuj

    2017-07-01

    Recent outbreaks of Zika virus (ZIKV) in Africa, Latin America, Europe, and Southeast Asia have resulted in serious health concerns. To understand more about evolution and transmission of ZIKV, detailed codon usage analysis was performed for all available strains. A high effective number of codons (ENC) value indicated the presence of low codon usage bias in ZIKV. The effect of mutational pressure on codon usage bias was confirmed by significant correlations between nucleotide compositions at third codon positions and ENCs. Correlation analysis between Gravy values, Aroma values and nucleotide compositions at third codon positions also indicated some influence of natural selection. However, the low codon adaptation index (CAI) value of ZIKV with reference to human and mosquito indicated poor adaptation of ZIKV codon usage towards its hosts, signifying that natural selection has a weaker influence than mutational pressure. Additionally, relative dinucleotide frequencies, geographical distribution, and evolutionary processes also influenced the codon usage pattern to some extent.

  16. Human fructose-1,6-bisphosphatase gene (FBP1): Exon-intron organization, localization to chromosome bands 9q22.2-q22.3, and mutation screening in subjects with fructose-1,6-bisphosphatase deficiency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Maghrabi, M.R.; Jiang, W.

    1995-06-10

    Fructose-1,6-bisphosphatase (EC 3.1.3.11) is a key regulatory enzyme of gluconeogenesis that catalyzes the hydrolysis of fructose-1,6-bisphosphate to generate fructose-6-phosphate and inorganic phosphate. Deficiency of fructose-1,6-bisphosphatase is associated with fasting hypoglycemia and metabolic acidosis because of impaired gluconeogenesis. We have cloned and characterized the human liver fructose-1,6-bisphosphatase gene (FBP1). FBP1, localized to chromosome bands 9q22.2-q22.3 by fluorescence in situ hybridization, consists of seven exons that span > 31 kb, and the six introns are in the same position as in the rat gene. FBP1 was screened for mutations in two subjects with fructose-1,6-bisphosphatase deficiency. Four nucleotide substitutions were identified, two ofmore » which were silent mutations in the codons for Ala-216 (GCT {yields} GCC) and Gly-319 (GGG {yields} GGA). The other substitutions were in intron 3, a C {yields} T substitution 7 nucleotides downstream from the splice donor site, and in the promoter region, an A {yields} T substitution 188 nucleotides upstream from the start of transcription. These nucleotide substitutions were also found in normal unaffected subjects and thus are not the cause of fructose-1,6-bisphosphatase deficiency in the two subjects studied. The molecular basis of hepatic fructose-1,6-bisphosphatase deficiency in these subjects remains undetermined but could result from unidentified mutations in the promoter that decrease expression or from mutations in another gene that indirectly lead to decreased fructose-1,6-bisphosphatase activity. 18 refs., 3 figs., 3 tabs.« less

  17. Identification of full length bovine TLR1 and functional characterization of lipopeptide recognition by bovine TLR2/1 heterodimer

    PubMed Central

    Farhat, Katja; Riekenberg, Sabine; Jung, Günther; Wiesmüller, Karl-Heinz; Jungi, Thomas W.; Ulmer, Artur J.

    2010-01-01

    Toll-like receptors (TLR) are highly conserved pattern recognition receptors of the innate immune system. Toll-like receptor 2 (TLR2) recognizes bacterial lipopeptides in a heterodimeric complex with TLR6 or TLR1, thereby discriminating between di- or triacylated lipopeptides, respectively. Previously, we found that HEK293 cells transfected with bovine TLR2 (boTLR2) were able to respond to diacylated lipopeptides but did not recognize triacylated lipopeptides, even after cotransfection with the so far published sequence of boTLR1. In this study we now could show that primary bovine cells were in general able to detect triacylated lipopetides. A closer investigation of the boTLR1 gene locus revealed an additional ATG 195 base pairs upstream from the published start codon. Its transcription would result in an N-terminus with high identity to human and murine TLR1 (huTLR1, muTLR1). Cloning and cotransfection of this longer boTLR1 with boTLR2 now resulted in the recognition of triacylated lipopeptides by HEK293 cells, thereby resembling the ex vivo observation. Analysis of the structure-activity relationship showed that the ester-bound acid chains of these lipopeptides need to consist of at least 12 carbon atoms to activate the bovine heterodimer showing similarity to the recognition by huTLR2/huTLR1. In contrast, HEK293 cell cotransfected with muTLR2 and muTLR1 could already be activated by lipopeptides with shorter fatty acids of only 6 carbon atoms. Thus, our data indicate that the additional N-terminal nucleotides belong to the full length and functionally active boTLR1 (boTLR1-fl) which participates in a species-specific recognition of bacterial lipopeptides. PMID:20167196

  18. Comparative analysis of the full genome sequence of European bat lyssavirus type 1 and type 2 with other lyssaviruses and evidence for a conserved transcription termination and polyadenylation motif in the G-L 3' non-translated region.

    PubMed

    Marston, D A; McElhinney, L M; Johnson, N; Müller, T; Conzelmann, K K; Tordo, N; Fooks, A R

    2007-04-01

    We report the first full-length genomic sequences for European bat lyssavirus type-1 (EBLV-1) and type-2 (EBLV-2). The EBLV-1 genomic sequence was derived from a virus isolated from a serotine bat in Hamburg, Germany, in 1968 and the EBLV-2 sequence was derived from a virus isolate from a human case of rabies that occurred in Scotland in 2002. A long-distance PCR strategy was used to amplify the open reading frames (ORFs), followed by standard and modified RACE (rapid amplification of cDNA ends) techniques to amplify the 3' and 5' ends. The lengths of each complete viral genome for EBLV-1 and EBLV-2 were 11 966 and 11 930 base pairs, respectively, and follow the standard rhabdovirus genome organization of five viral proteins. Comparison with other lyssavirus sequences demonstrates variation in degrees of homology, with the genomic termini showing a high degree of complementarity. The nucleoprotein was the most conserved, both intra- and intergenotypically, followed by the polymerase (L), matrix and glyco- proteins, with the phosphoprotein being the most variable. In addition, we have shown that the two EBLVs utilize a conserved transcription termination and polyadenylation (TTP) motif, approximately 50 nt upstream of the L gene start codon. All available lyssavirus sequences to date, with the exception of Pasteur virus (PV) and PV-derived isolates, use the second TTP site. This observation may explain differences in pathogenicity between lyssavirus strains, dependent on the length of the untranslated region, which might affect transcriptional activity and RNA stability.

  19. The activity of the artemisinic aldehyde Δ11(13) reductase promoter is important for artemisinin yield in different chemotypes of Artemisia annua L.

    PubMed

    Yang, Ke; Monfared, Sajad Rashidi; Monafared, Rashidi Sajad; Wang, Hongzhen; Lundgren, Anneli; Brodelius, Peter E

    2015-07-01

    The artemisinic aldehyde double bond reductase (DBR2) plays an important role in the biosynthesis of the antimalarial artemisinin in Artemisia annua. Artemisinic aldehyde is reduced into dihydroartemisinic aldehyde by DBR2. Artemisinic aldehyde can also be oxidized by amorpha-4,11-diene 12-hydroxylase and/or aldehyde dehydrogenase 1 to artemisinic acid, a precursor of arteannuin B. In order to better understand the effects of DBR2 expression on the flow of artemisinic aldehyde into either artemisinin or arteannuin B, we determined the content of dihydroartemisinic aldehyde, artemisinin, artemisinic acid and arteannuin B content of A. annua varieties sorted into two chemotypes. The high artemisinin producers (HAPs), which includes the '2/39', 'Chongqing' and 'Anamed' varieties, produce more artemisinin than arteannuin B; the low artemisinin producers (LAPs), which include the 'Meise', 'Iran#8', 'Iran#14', 'Iran#24' and 'Iran#47' varieties, produce more arteannuin B than artemisinin. Quantitative PCR showed that the relative expression of DBR2 was significantly higher in the HAP varieties. We cloned and sequenced the promoter of the DBR2 gene from varieties of both the LAP and the HAP groups. There were deletions/insertions in the region just upstream of the ATG start codon in the LAP varities, which might be the reason for the different promoter activities of the HAP and LAP varieties. The relevance of promoter variation, DBR2 expression levels and artemisinin biosynthesis capabilities are discussed and a selection method for HAP varieties with a DNA marker is suggested. Furthermore, putative cis-acting regulatory elements differ between the HAP and LAP varieties.

  20. Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.

    PubMed

    Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping

    2017-04-01

    The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.

  1. Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

    PubMed Central

    Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

    1982-01-01

    The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

  2. Transforming Growth Factor-β/SMAD Target Gene SKIL Is Negatively Regulated by the Transcriptional Cofactor Complex SNON-SMAD4*

    PubMed Central

    Tecalco-Cruz, Angeles C.; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

    2012-01-01

    The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified. PMID:22674574

  3. Chromobacterium spp. harbour Ambler class A β-lactamases showing high identity with KPC.

    PubMed

    Gudeta, Dereje Dadi; Bortolaia, Valeria; Jayol, Aurélie; Poirel, Laurent; Nordmann, Patrice; Guardabassi, Luca

    2016-06-01

    The origin of KPC is unknown. The aim of this study was to detect progenitors of KPC in silico and to functionally verify their β-lactam hydrolysis activity. The sequence of KPC-2 was used to mine the NCBI protein sequence database. The best non-KPC hits were analysed by amino acid (aa) alignment and phylogenetic tree construction. Genes encoding KPC-2 homologues were expressed in Escherichia coli. The carbapenemase activities of the recombinant strains were characterized by the CarbaNP test and UV spectrophotometry and MICs of selected β-lactams were determined. Genes encoding the closest KPC-2 homologues were identified on the chromosome of Chromobacterium piscinae strain ND17 (CRP-1, 76% aa identity), Chromobacterium sp. C-61 (CRS-1, 70% aa identity) and Chromobacterium haemolyticum DSM19808 (CRH-1, 69% aa identity). All three Chromobacterium β-lactamases were phylogenetically more related to KPC than to other Ambler class A β-lactamases. The 27 bp region preceding the start codon of blaCRP-1 displayed high nucleotide identity to the corresponding region upstream from blaKPC (74%). Heterologous expression of blaCRP-1 and to a lesser extent of blaCRH-1 in E. coli significantly increased the MICs of meropenem and most cephalosporins. The CarbaNP test was positive for both recombinant strains, but spectrophotometric analysis confirmed higher carbapenemase activity for CRP-1-producing clones. The recovery of three class A β-lactamases with up to 76% aa identity to KPC from distinct Chromobacterium species is highly indicative of the role played by this genus in the evolution of KPC. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.

    PubMed

    Ding, Yiliang; Tang, Yin; Kwok, Chun Kit; Zhang, Yu; Bevilacqua, Philip C; Assmann, Sarah M

    2014-01-30

    RNA structure has critical roles in processes ranging from ligand sensing to the regulation of translation, polyadenylation and splicing. However, a lack of genome-wide in vivo RNA structural data has limited our understanding of how RNA structure regulates gene expression in living cells. Here we present a high-throughput, genome-wide in vivo RNA structure probing method, structure-seq, in which dimethyl sulphate methylation of unprotected adenines and cytosines is identified by next-generation sequencing. Application of this method to Arabidopsis thaliana seedlings yielded the first in vivo genome-wide RNA structure map at nucleotide resolution for any organism, with quantitative structural information across more than 10,000 transcripts. Our analysis reveals a three-nucleotide periodic repeat pattern in the structure of coding regions, as well as a less-structured region immediately upstream of the start codon, and shows that these features are strongly correlated with translation efficiency. We also find patterns of strong and weak secondary structure at sites of alternative polyadenylation, as well as strong secondary structure at 5' splice sites that correlates with unspliced events. Notably, in vivo structures of messenger RNAs annotated for stress responses are poorly predicted in silico, whereas mRNA structures of genes related to cell function maintenance are well predicted. Global comparison of several structural features between these two categories shows that the mRNAs associated with stress responses tend to have more single-strandedness, longer maximal loop length and higher free energy per nucleotide, features that may allow these RNAs to undergo conformational changes in response to environmental conditions. Structure-seq allows the RNA structurome and its biological roles to be interrogated on a genome-wide scale and should be applicable to any organism.

  5. Transforming growth factor-β/SMAD Target gene SKIL is negatively regulated by the transcriptional cofactor complex SNON-SMAD4.

    PubMed

    Tecalco-Cruz, Angeles C; Sosa-Garrocho, Marcela; Vázquez-Victorio, Genaro; Ortiz-García, Layla; Domínguez-Hüttinger, Elisa; Macías-Silva, Marina

    2012-08-03

    The human SKI-like (SKIL) gene encodes the SMAD transcriptional corepressor SNON that antagonizes TGF-β signaling. SNON protein levels are tightly regulated by the TGF-β pathway: whereas a short stimulation with TGF-β decreases SNON levels by its degradation via the proteasome, longer TGF-β treatment increases SNON levels by inducing SKIL gene expression. Here, we investigated the molecular mechanisms involved in the self-regulation of SKIL gene expression by SNON. Bioinformatics analysis showed that the human SKIL gene proximal promoter contains a TGF-β response element (TRE) bearing four groups of SMAD-binding elements that are also conserved in mouse. Two regions of 408 and 648 bp of the human SKIL gene (∼2.4 kb upstream of the ATG initiation codon) containing the core promoter, transcription start site, and the TRE were cloned for functional analysis. Binding of SMAD and SNON proteins to the TRE region of the SKIL gene promoter after TGF-β treatment was demonstrated by ChIP and sequential ChIP assays. Interestingly, the SNON-SMAD4 complex negatively regulated basal SKIL gene expression through binding the promoter and recruiting histone deacetylases. In response to TGF-β signal, SNON is removed from the SKIL gene promoter, and then the activated SMAD complexes bind the promoter to induce SKIL gene expression. Subsequently, the up-regulated SNON protein in complex with SMAD4 represses its own expression as part of the negative feedback loop regulating the TGF-β pathway. Accordingly, when the SNON-SMAD4 complex is absent as in some cancer cells lacking SMAD4 the regulation of some TGF-β target genes is modified.

  6. Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors.

    PubMed

    López-Lastra, M; Gabus, C; Darlix, J L

    1997-11-01

    The murine leukemia virus (MLV)-related type C viruses constitute a major class of retroviruses that includes numerous endogenous and exogenous mammalian viruses and the related avian spleen necrosis virus (SNV). The MLV-related viruses possess a long and multifunctional 5' untranslated leader involved in key steps of the viral life cycle--splicing, translation, RNA dimerization, encapsidation, and reverse transcription. Recent studies have shown that the 5' leader of Friend murine leukemia virus and Moloney murine leukemia virus can direct cap independent translation of gag precursor proteins (Berlioz et al., 1995; Vagner et al., 1995b). These data, together with structural homology studies (Koning et al., 1992), prompted us to undertake a search for new internal ribosome entry segment (IRES) of retroviral origin. Here we describe an IRES element within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. Data show that the REV-A 5' IRES element maps downstream of the packaging/dimerization (E/DLS) sequence (Watanabe and Temin, 1982; Darlix et al., 1992) and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452-580) of the 5' leader, immediately upstream of the gag AUG codon. The REV-A IRES has been successfully utilized in the construction of novel high titer MLV-based retroviral vectors, containing one or more IRES elements of retroviral origin. These retroviral constructs, which represent a starting point for the design of novel vectors suitable for gene therapy, are also of interest as a model system of internal translation initiation and its possible regulation during development, cancer, or virus infection.

  7. Translational control of small heat shock genes in mesophilic and thermophilic cyanobacteria by RNA thermometers

    PubMed Central

    Cimdins, Annika; Klinkert, Birgit; Aschke-Sonnenborn, Ursula; Kaiser, Friederike M; Kortmann, Jens; Narberhaus, Franz

    2014-01-01

    Cyanobacteria constitute a heterogeneous phylum of oxygen-producing, photosynthetic prokaryotes. They are susceptible to various stress conditions like heat, salt, or light stress, all inducing the cyanobacterial heat shock response (HSR). Cyanobacterial small heat shock proteins (sHsps) are known to preserve thylakoid membrane integrity under stress conditions, thereby protecting the photosynthesis machinery. In Synechocystis sp PCC 6803, synthesis of the sHsp Hsp17 is regulated by an RNA thermometer (RNAT) in the 5′-untranslated region (5′-UTR) of the hsp17 mRNA. RNATs are direct temperature sensors that control expression of many bacterial heat shock and virulence genes. They hinder translation at low temperatures by base pairing, thus blocking ribosome access to the mRNA.   To explore the temperature range in which RNATs act, we studied various RNAT candidates upstream of sHsp genes from mesophilic and thermophilic cyanobacteria. The mesophilic cyanobacteria Anabaena variabilis and Nostoc sp chromosomally encode two sHsps each. Reporter gene studies suggested RNAT-mediated post-transcriptional regulation of shsp expression in both organisms. Detailed structural analysis of the two A. variabilis candidates revealed two novel RNAT types. The first, avashort, regulates translation primarily by masking of the AUG translational start codon. The second, featuring an extended initial hairpin, thus named avalong, presumably makes use of complex tertiary interaction. The 5′-UTR of the small heat shock gene hspA in the thermophile Thermosynechococcus elongatus is predicted to adopt an extended secondary structure. Structure probing revealed that the ribosome binding site was blocked at temperatures below 55 °C. The results of this study demonstrate that cyanobacteria commonly use RNATs to control expression of their small heat shock genes. PMID:24755616

  8. Molecular cloning and characterization of a membrane associated NAC family gene, SiNAC from foxtail millet [Setaria italica (L.) P. Beauv].

    PubMed

    Puranik, Swati; Bahadur, Ranjit Prasad; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The plant-specific NAC (NAM, ATAF, and CUC) transcription factors have diverse role in development and stress regulation. A transcript encoding NAC protein, termed SiNAC was identified from a salt stress subtractive cDNA library of S. italica seedling (Puranik et al., J Plant Physiol 168:280-287, 2011). This single/low copy gene containing four exons and four introns within the genomic-sequence encoded a protein of 462 amino acids. Structural analysis revealed that highly divergent C terminus contains a transmembrane domain. The NAC domain consisted of a twisted antiparallel beta-sheet packing against N terminal alpha helix on one side and a shorter helix on the other side. The domain was predicted to homodimerize and control DNA-binding specificity. The physicochemical features of the SiNAC homodimer interface justified the dimeric form of the predicted model. A 1539 bp fragment upstream to the start codon of SiNAC gene was cloned and in silico analysis revealed several putative cis-acting regulatory elements within the promoter sequence. Transactivation analysis indicated that SiNAC activated expression of reporter gene and the activation domain lied at the C terminal. The SiNAC:GFP was detected in the nucleus and cytoplasm while SiNAC ΔC(1-158):GFP was nuclear localized in onion epidermal cells. SiNAC transcripts mostly accumulated in young spikes and were strongly induced by dehydration, salinity, ethephon, and methyl jasmonate. These results suggest that SiNAC encodes a membrane associated NAC-domain protein that may function as a transcriptional activator in response to stress and developmental regulation in plants.

  9. Switches in Genomic GC Content Drive Shifts of Optimal Codons under Sustained Selection on Synonymous Sites

    PubMed Central

    Sun, Yu; Tamarit, Daniel

    2017-01-01

    Abstract The major codon preference model suggests that codons read by tRNAs in high concentrations are preferentially utilized in highly expressed genes. However, the identity of the optimal codons differs between species although the forces driving such changes are poorly understood. We suggest that these questions can be tackled by placing codon usage studies in a phylogenetic framework and that bacterial genomes with extreme nucleotide composition biases provide informative model systems. Switches in the background substitution biases from GC to AT have occurred in Gardnerella vaginalis (GC = 32%), and from AT to GC in Lactobacillus delbrueckii (GC = 62%) and Lactobacillus fermentum (GC = 63%). We show that despite the large effects on codon usage patterns by these switches, all three species evolve under selection on synonymous sites. In G. vaginalis, the dramatic codon frequency changes coincide with shifts of optimal codons. In contrast, the optimal codons have not shifted in the two Lactobacillus genomes despite an increased fraction of GC-ending codons. We suggest that all three species are in different phases of an on-going shift of optimal codons, and attribute the difference to a stronger background substitution bias and/or longer time since the switch in G. vaginalis. We show that comparative and correlative methods for optimal codon identification yield conflicting results for genomes in flux and discuss possible reasons for the mispredictions. We conclude that switches in the direction of the background substitution biases can drive major shifts in codon preference patterns even under sustained selection on synonymous codon sites. PMID:27540085

  10. CodonLogo: a sequence logo-based viewer for codon patterns.

    PubMed

    Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V

    2012-07-15

    Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.

  11. Forced Ambiguity of the Leucine Codons for Multiple-Site-Specific Incorporation of a Noncanonical Amino Acid

    PubMed Central

    Kwon, Inchan; Choi, Eun Sil

    2016-01-01

    Multiple-site-specific incorporation of a noncanonical amino acid into a recombinant protein would be a very useful technique to generate multiple chemical handles for bioconjugation and multivalent binding sites for the enhanced interaction. Previously combination of a mutant yeast phenylalanyl-tRNA synthetase variant and the yeast phenylalanyl-tRNA containing the AAA anticodon was used to incorporate a noncanonical amino acid into multiple UUU phenylalanine (Phe) codons in a site-specific manner. However, due to the less selective codon recognition of the AAA anticodon, there was significant misincorporation of a noncanonical amino acid into unwanted UUC Phe codons. To enhance codon selectivity, we explored degenerate leucine (Leu) codons instead of Phe degenerate codons. Combined use of the mutant yeast phenylalanyl-tRNA containing the CAA anticodon and the yPheRS_naph variant allowed incorporation of a phenylalanine analog, 2-naphthylalanine, into murine dihydrofolate reductase in response to multiple UUG Leu codons, but not to other Leu codon sites. Despite the moderate UUG codon occupancy by 2-naphthylalaine, these results successfully demonstrated that the concept of forced ambiguity of the genetic code can be achieved for the Leu codons, available for multiple-site-specific incorporation. PMID:27028506

  12. Forced Ambiguity of the Leucine Codons for Multiple-Site-Specific Incorporation of a Noncanonical Amino Acid.

    PubMed

    Kwon, Inchan; Choi, Eun Sil

    2016-01-01

    Multiple-site-specific incorporation of a noncanonical amino acid into a recombinant protein would be a very useful technique to generate multiple chemical handles for bioconjugation and multivalent binding sites for the enhanced interaction. Previously combination of a mutant yeast phenylalanyl-tRNA synthetase variant and the yeast phenylalanyl-tRNA containing the AAA anticodon was used to incorporate a noncanonical amino acid into multiple UUU phenylalanine (Phe) codons in a site-specific manner. However, due to the less selective codon recognition of the AAA anticodon, there was significant misincorporation of a noncanonical amino acid into unwanted UUC Phe codons. To enhance codon selectivity, we explored degenerate leucine (Leu) codons instead of Phe degenerate codons. Combined use of the mutant yeast phenylalanyl-tRNA containing the CAA anticodon and the yPheRS_naph variant allowed incorporation of a phenylalanine analog, 2-naphthylalanine, into murine dihydrofolate reductase in response to multiple UUG Leu codons, but not to other Leu codon sites. Despite the moderate UUG codon occupancy by 2-naphthylalaine, these results successfully demonstrated that the concept of forced ambiguity of the genetic code can be achieved for the Leu codons, available for multiple-site-specific incorporation.

  13. The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

    PubMed Central

    White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

    1991-01-01

    By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

  14. Molecular basis and consequences of a deletion in the amelogenin gene, analyzed by capture PCR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lagerstroem-Fermer, M.; Pettersson, U.; Landegren, U.

    1993-07-01

    A mutation that disrupts the gene for one of the major proteins in tooth enamel has been investigated. The mutation is located in the amelogenin gene and causes X-linked amelogenesis imperfecta, characterized by defective mineralization of tooth enamel. The authors have isolated the breakpoints of a 5-kb deletion in the amelogenin gene on the basis of nucleotide sequence information located upstream of the lesion, using a technique termed capture PCR. The deletion removes five of the seven exons, spanning from the second intron to the last exon. Only the first two codons for the mature protein remain, consistent with themore » relatively severe phenotype of affected individuals in the present family. The mutation appears to have arisen as an illegitimate recombination event since of 11 nucleotide positions immediately surrounding the two breakpoints, 9 are identical. 17 refs., 3 figs., 1 tab.« less

  15. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed

    Levis, R; Schlesinger, S; Huang, H V

    1990-04-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

  16. Genome-wide analysis of codon usage bias in four sequenced cotton species.

    PubMed

    Wang, Liyuan; Xing, Huixian; Yuan, Yanchao; Wang, Xianlin; Saeed, Muhammad; Tao, Jincai; Feng, Wei; Zhang, Guihua; Song, Xianliang; Sun, Xuezhen

    2018-01-01

    Codon usage bias (CUB) is an important evolutionary feature in a genome which provides important information for studying organism evolution, gene function and exogenous gene expression. The CUB and its shaping factors in the nuclear genomes of four sequenced cotton species, G. arboreum (A2), G. raimondii (D5), G. hirsutum (AD1) and G. barbadense (AD2) were analyzed in the present study. The effective number of codons (ENC) analysis showed the CUB was weak in these four species and the four subgenomes of the two tetraploids. Codon composition analysis revealed these four species preferred to use pyrimidine-rich codons more frequently than purine-rich codons. Correlation analysis indicated that the base content at the third position of codons affect the degree of codon preference. PR2-bias plot and ENC-plot analyses revealed that the CUB patterns in these genomes and subgenomes were influenced by combined effects of translational selection, directional mutation and other factors. The translational selection (P2) analysis results, together with the non-significant correlation between GC12 and GC3, further revealed that translational selection played the dominant role over mutation pressure in the codon usage bias. Through relative synonymous codon usage (RSCU) analysis, we detected 25 high frequency codons preferred to end with T or A, and 31 low frequency codons inclined to end with C or G in these four species and four subgenomes. Finally, 19 to 26 optimal codons with 19 common ones were determined for each species and subgenomes, which preferred to end with A or T. We concluded that the codon usage bias was weak and the translation selection was the main shaping factor in nuclear genes of these four cotton genomes and four subgenomes.

  17. Codon 219 polymorphism of PRNP in healthy caucasians and Creutzfeldt-Jakob disease patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Petraroli, R.; Pocchiari, M.

    1996-04-01

    A number of point and insert mutations of the PrP gene (PRNP) have been linked to familial Creutzfeldt-Jakob disease (CJD) and Gerstmann-Straussler-Scheinker disease (GSS). Moreover, the methionine/valine homozygosity at the polymorphic codon 129 of PRNP may cause a predisposition to sporadic and iatrogenic CJD or may control the age at onset of familial cases carrying either the 144-bp insertion or codon 178, codon 198, and codon 210 pathogenic mutations in PRNP. In addition, the association of methionine or valine at codon 129 and the point mutation at codon 178 on the same allele seem to play an important role inmore » determining either fatal familial insomnia or CJD. However, it is noteworthy that a relationship between codon 129 polymorphism and accelerated pathogenesis (early age at onset or shorter duration of the disease) has not been seen in familial CJD patients with codon 200 mutation or in GSS patients with codon 102 mutation, arguing that other, as yet unidentified, gene products or environmental factors, or both, may influence the clinical expression of these diseases. 17 refs.« less

  18. The mitochondrial genome of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae).

    PubMed

    Yang, Ming Ru; Zhou, Zhi Jun; Chang, Yan Lin; Zhao, Le Hong

    2012-08-01

    To help determine whether the typical arthropod arrangement was a synapomorphy for the whole Tettigoniidae, we sequenced the mitochondrial genome (mitogenome) of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae). The 16,166-bp nucleotide sequences of X. fascipes mitogenome contains the typical gene content, gene order, base composition, and codon usage found in arthropod mitogenomes. As a whole, the X. fascipes mitogenome contains a lower A+T content (70.2%) found in the complete orthopteran mitogenomes determined to date. All protein-coding genes started with a typical ATN codon. Ten of the 13 protein-coding genes have a complete termination codon, but the remaining three genes (COIII, ND5 and ND4) terminate with incomplete T. All tRNAs have the typical clover-leaf structure of mitogenome tRNA, except for tRNA(Ser(AGN)), in which lengthened anticodon stem (9 bp) with a bulged nuleotide in the middle, an unusual T-stem (6 bp in constrast to the normal 5 bp), a mini DHU arm (2 bp) and no connector nucleotides. In the A+T-rich region, two (TA)n conserved blocks that were previously described in Ensifera and two 150-bp tandem repeats plus a partial copy of the composed at 61 bp of the beginning were present. Phylogenetic analysis found: i) the monophyly of Conocephalinae was interrupted by Elimaea cheni from Phaneropterinae; and ii) Meconematinae was the most basal group among these five subfamilies.

  19. Origin, antigenicity, and function of a secreted form of ORF2 in hepatitis E virus infection.

    PubMed

    Yin, Xin; Ying, Dong; Lhomme, Sébastien; Tang, Zimin; Walker, Christopher M; Xia, Ningshao; Zheng, Zizheng; Feng, Zongdi

    2018-05-01

    The enterically transmitted hepatitis E virus (HEV) adopts a unique strategy to exit cells by cloaking its capsid (encoded by the viral ORF2 gene) and circulating in the blood as "quasi-enveloped" particles. However, recent evidence suggests that the majority of the ORF2 protein present in the patient serum and supernatants of HEV-infected cell culture exists in a free form and is not associated with virus particles. The origin and biological functions of this secreted form of ORF2 (ORF2 S ) are unknown. Here we show that production of ORF2 S results from translation initiated at the previously presumed AUG start codon for the capsid protein, whereas translation of the actual capsid protein (ORF2 C ) is initiated at a previously unrecognized internal AUG codon (15 codons downstream of the first AUG). The addition of 15 amino acids to the N terminus of the capsid protein creates a signal sequence that drives ORF2 S secretion via the secretory pathway. Unlike ORF2 C , ORF2 S is glycosylated and exists as a dimer. Nonetheless, ORF2 S exhibits substantial antigenic overlap with the capsid, but the epitopes predicted to bind the putative cell receptor are lost. Consistent with this, ORF2 S does not block HEV cell entry but inhibits antibody-mediated neutralization. These results reveal a previously unrecognized aspect in HEV biology and shed new light on the immune evasion mechanisms and pathogenesis of this virus.

  20. Polymorphisms upstream of the melanocortin-1 receptor coding region are associated with human pigmentation variation in a Brazilian population.

    PubMed

    Neitzke-Montinelli, Vanessa; Urmenyi, Turan P; Rondinelli, Edson; Cabello, Pedro Hernan; Silva, Rosane; Moura-Neto, Rodrigo S

    2012-01-01

    We describe an association of two SNPs, rs3212345:C>T and rs3212346:G>A, located approximately 2.5 kb upstream of the melanocortin-1 receptor (MC1R) translation initiation codon, with pigmentation phenotype variation in a Southeast Brazilian miscegenated population. One hundred thirty-eight genetically unrelated subjects, with multicolor phenotype, were selected from the southeast region of Brazil. Skin, hair and eye color, and tanning ability were rated. Genotypes for each SNP (rs3212345:C>T and rs3212346:G>A) were determined. A logistic regression analysis was performed with the additive model to determine which of the polymorphisms contributed to a specific phenotype. We found that the rs3212345:C>T is associated with light skin, red hair, and poor tanning ability, while the rs3212346:G>A is associated with dark skin, black hair, and strong tanning ability. The presence of rs3212345-C and rs3212346-A alleles in human, chimpanzee, gorilla, orangutan, and marmoset genomes suggests that they are the ancestral alleles. These data suggest that the rs3212345-T and rs3212346-G alleles may have contributed to lighter pigmentation phenotypes in modern humans. Genotyping for these SNPs may prove useful to the fields of molecular anthropology and forensic genetics. Copyright © 2012 Wiley Periodicals, Inc.

  1. Potential of Start Codon Targeted (SCoT) markers for DNA fingerprinting of newly synthesized tritordeums and their respective parents.

    PubMed

    Cabo, Sandra; Ferreira, Luciana; Carvalho, Ana; Martins-Lopes, Paula; Martín, António; Lima-Brito, José Eduardo

    2014-08-01

    Hexaploid tritordeum (H(ch)H(ch)AABB; 2n = 42) results from the cross between Hordeum chilense (H(ch)H(ch); 2n = 14) and cultivated durum wheat (Triticum turgidum ssp. durum (AABB; 2n = 28). Morphologically, tritordeum resembles the wheat parent, showing promise for agriculture and wheat breeding. Start Codon Targeted (SCoT) polymorphism is a recently developed technique that generates gene-targeted markers. Thus, we considered it interesting to evaluate its potential for the DNA fingerprinting of newly synthesized hexaploid tritordeums and their respective parents. In this study, 60 SCoT primers were tested, and 18 and 19 of them revealed SCoT polymorphisms in the newly synthesized tritordeum lines HT27 and HT22, respectively, and their parents. An analysis of the presence/absence of bands among tritordeums and their parents revealed three types of polymorphic markers: (i) shared by tritordeums and one of their parents, (ii) exclusively amplified in tritordeums, and (iii) exclusively amplified in the parents. No polymorphism was detected among individuals of each parental species. Three SCoT markers were exclusively amplified in tritordeums of lines HT22 and HT27, being considered as polyploidization-induced rearrangements. About 70% of the SCoT markers of H. chilense origin were not transmitted to the allopolyploids of both lines, and most of the SCoTs scored in the newly synthesized allopolyploids originated from wheat, reinforcing the potential use of tritordeum as an alternative crop.

  2. Start Codon Targeted (SCoT) marker reveals genetic diversity of Dendrobium nobile Lindl., an endangered medicinal orchid species.

    PubMed

    Bhattacharyya, Paromik; Kumaria, Suman; Kumar, Shrawan; Tandon, Pramod

    2013-10-15

    Genetic variability in the wild genotypes of Dendrobium nobile Lindl. collected from different parts of Northeast India, was analyzed using a Start Codon Targeted (SCoT) marker system. A total of sixty individuals comprising of six natural populations were investigated for the existing natural genetic diversity. One hundred and thirty two (132) amplicons were produced by SCoT marker generating 96.21% polymorphism. The PIC value of the SCoT marker system was 0.78 and the Rp values of the primers ranged between 4.43 and 7.50. The percentage of polymorphic loci (Pp) ranging from 25% to 56.82%, Nei's gene diversity (h) from 0.08 to 0.15 with mean Nei's gene diversity of 0.28, and Shannon's information index (I) values ranging from 0.13 to 0.24 with an average value of 0.43 were recorded. The gene flow value (0.37) and the diversity among populations (0.57) demonstrated higher genetic variation among the populations. Analysis of molecular variance (AMOVA) showed 43.37% of variation within the populations, whereas 56.63% variation was recorded among the populations. Cluster analysis also reveals high genetic variation among the genotypes. Present investigation suggests the effectiveness of SCoT marker system to estimate the genetic diversity of D. nobile and that it can be seen as a preliminary point for future research on the population and evolutionary genetics of this endangered orchid species of medicinal importance. © 2013.

  3. Emergent rules for codon choice elucidated by editing rare arginine codons in Escherichia coli

    PubMed Central

    Napolitano, Michael G.; Landon, Matthieu; Gregg, Christopher J.; Lajoie, Marc J.; Govindarajan, Lakshmi; Mosberg, Joshua A.; Kuznetsov, Gleb; Goodman, Daniel B.; Vargas-Rodriguez, Oscar; Isaacs, Farren J.; Söll, Dieter; Church, George M.

    2016-01-01

    The degeneracy of the genetic code allows nucleic acids to encode amino acid identity as well as noncoding information for gene regulation and genome maintenance. The rare arginine codons AGA and AGG (AGR) present a case study in codon choice, with AGRs encoding important transcriptional and translational properties distinct from the other synonymous alternatives (CGN). We created a strain of Escherichia coli with all 123 instances of AGR codons removed from all essential genes. We readily replaced 110 AGR codons with the synonymous CGU codons, but the remaining 13 “recalcitrant” AGRs required diversification to identify viable alternatives. Successful replacement codons tended to conserve local ribosomal binding site-like motifs and local mRNA secondary structure, sometimes at the expense of amino acid identity. Based on these observations, we empirically defined metrics for a multidimensional “safe replacement zone” (SRZ) within which alternative codons are more likely to be viable. To evaluate synonymous and nonsynonymous alternatives to essential AGRs further, we implemented a CRISPR/Cas9-based method to deplete a diversified population of a wild-type allele, allowing us to evaluate exhaustively the fitness impact of all 64 codon alternatives. Using this method, we confirmed the relevance of the SRZ by tracking codon fitness over time in 14 different genes, finding that codons that fall outside the SRZ are rapidly depleted from a growing population. Our unbiased and systematic strategy for identifying unpredicted design flaws in synthetic genomes and for elucidating rules governing codon choice will be crucial for designing genomes exhibiting radically altered genetic codes. PMID:27601680

  4. Exploring codon context bias for synthetic gene design of a thermostable invertase in Escherichia coli.

    PubMed

    Pek, Han Bin; Klement, Maximilian; Ang, Kok Siong; Chung, Bevan Kai-Sheng; Ow, Dave Siak-Wei; Lee, Dong-Yup

    2015-01-01

    Various isoforms of invertases from prokaryotes, fungi, and higher plants has been expressed in Escherichia coli, and codon optimisation is a widely-adopted strategy for improvement of heterologous enzyme expression. Successful synthetic gene design for recombinant protein expression can be done by matching its translational elongation rate against heterologous host organisms via codon optimization. Amongst the various design parameters considered for the gene synthesis, codon context bias has been relatively overlooked compared to individual codon usage which is commonly adopted in most of codon optimization tools. In addition, matching the rates of transcription and translation based on secondary structure may lead to enhanced protein folding. In this study, we evaluated codon context fitness as design criterion for improving the expression of thermostable invertase from Thermotoga maritima in Escherichia coli and explored the relevance of secondary structure regions for folding and expression. We designed three coding sequences by using (1) a commercial vendor optimized gene algorithm, (2) codon context for the whole gene, and (3) codon context based on the secondary structure regions. Then, the codon optimized sequences were transformed and expressed in E. coli. From the resultant enzyme activities and protein yield data, codon context fitness proved to have the highest activity as compared to the wild-type control and other criteria while secondary structure-based strategy is comparable to the control. Codon context bias was shown to be a relevant parameter for enhancing enzyme production in Escherichia coli by codon optimization. Thus, we can effectively design synthetic genes within heterologous host organisms using this criterion. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Generate Optimized Genetic Rhythm for Enzyme Expression in Non-native systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    2016-11-03

    Most amino acids are represented by more than one codon, resulting in redundancy in the genetic code. Silent codon substitutions that do not alter the amino acid sequence still have an effect on protein expression. We have developed an algorithm, GoGREEN, to enhance the expression of foreign proteins in a host organism. GoGREEN selects codons according to frequency patterns seen in the gene of interest using the codon usage table from the host organism. GoGREEN is also designed to accommodate gaps in the sequence.This software takes for input (1) the aligned protein sequences for genes the user wishes to express,more » (2) the codon usage table for the host organism, (3) and the DNA sequence for the target protein found in the host organism. The program will select codons based on codon usage patterns for the target DNA sequence. The program will also select codons for “gaps” found in the aligned protein sequences using the codon usage table from the host organism.« less

  6. Analysis of the complete genome of peach chlorotic mottle virus: identification of non-AUG start codons, in vitro coat protein expression, and elucidation of serological cross-reactions.

    PubMed

    James, D; Varga, A; Croft, H

    2007-01-01

    The entire genome of peach chlorotic mottle virus (PCMV), originally identified as Prunus persica cv. Agua virus (4N6), was sequenced and analysed. PCMV cross-reacts with antisera to diverse viruses, such as plum pox virus (PPV), genus Potyvirus, family Potyviridae; and apple stem pitting virus (ASPV), genus Foveavirus, family Flexiviridae. The PCMV genome consists of 9005 nucleotides (nts), excluding a poly(A) tail at the 3' end of the genome. Five open reading frames (ORFs) were identified with four untranslated regions (UTR) including a 5', a 3', and two intergenic UTRs. The genome organisation of PCMV is similar to that of ASPV and the two genomes share a nucleotide (nt) sequence identity of 58%. PCMV ORF1 encodes the replication-associated protein complex (Mr 241,503), ORF2-ORF4 code for the triple gene block proteins (TGBp; Mr 24,802, 12,370, and 7320, respectively), and ORF5 encodes the coat protein (CP) (Mr 42,505). Two non-AUG start codons participate in the initiation of translation: 35AUC and 7676AUA initiate translation of ORF1 and ORF5. In vitro expression with subsequent Western blot analysis confirmed ORF5 as the CP-encoding gene and confirmed that the codon AUA is able to initiate translation of the CP. Expression of a truncated CP fragment (Mr 39, 689) was demonstrated, and both proteins are expressed in vivo, since both were observed in Western blot analysis of PCMV-infected peach and Nicotiana occidentalis. The expressed proteins cross-reacted with an antiserum against ASPV. The amino acid sequences of the CPs of PCMV and ASPV CP share only 37% identity, but there are 11 shared peptides 4-8 aa residues long. These may constitute linear epitopes responsible for ASPV antiserum cross reactions. No significant common linear epitopes were associated with PPV. Extensive phylogenetic analysis indicates that PCMV is closely related to ASPV and is a new and distinct member of the genus Foveavirus.

  7. SENCA: A Multilayered Codon Model to Study the Origins and Dynamics of Codon Usage

    PubMed Central

    Pouyet, Fanny; Bailly-Bechet, Marc; Mouchiroud, Dominique; Guéguen, Laurent

    2016-01-01

    Gene sequences are the target of evolution operating at different levels, including the nucleotide, codon, and amino acid levels. Disentangling the impact of those different levels on gene sequences requires developing a probabilistic model with three layers. Here we present SENCA (site evolution of nucleotides, codons, and amino acids), a codon substitution model that separately describes 1) nucleotide processes which apply on all sites of a sequence such as the mutational bias, 2) preferences between synonymous codons, and 3) preferences among amino acids. We argue that most synonymous substitutions are not neutral and that SENCA provides more accurate estimates of selection compared with more classical codon sequence models. We study the forces that drive the genomic content evolution, intraspecifically in the core genome of 21 prokaryotes and interspecifically for five Enterobacteria. We retrieve the existence of a universal mutational bias toward AT, and that taking into account selection on synonymous codon usage has consequences on the measurement of selection on nonsynonymous substitutions. We also confirm that codon usage bias is mostly driven by selection on preferred codons. We propose new summary statistics to measure the relative importance of the different evolutionary processes acting on sequences. PMID:27401173

  8. Amino acid repeats avert mRNA folding through conservative substitutions and synonymous codons, regardless of codon bias.

    PubMed

    Barik, Sailen

    2017-12-01

    A significant number of proteins in all living species contains amino acid repeats (AARs) of various lengths and compositions, many of which play important roles in protein structure and function. Here, I have surveyed select homopolymeric single [(A)n] and double [(AB)n] AARs in the human proteome. A close examination of their codon pattern and analysis of RNA structure propensity led to the following set of empirical rules: (1) One class of amino acid repeats (Class I) uses a mixture of synonymous codons, some of which approximate the codon bias ratio in the overall human proteome; (2) The second class (Class II) disregards the codon bias ratio, and appears to have originated by simple repetition of the same codon (or just a few codons); and finally, (3) In all AARs (including Class I, Class II, and the in-betweens), the codons are chosen in a manner that precludes the formation of RNA secondary structure. It appears that the AAR genes have evolved by orchestrating a balance between codon usage and mRNA secondary structure. The insights gained here should provide a better understanding of AAR evolution and may assist in designing synthetic genes.

  9. Complex codon usage pattern and compositional features of retroviruses.

    PubMed

    RoyChoudhury, Sourav; Mukherjee, Debaprasad

    2013-01-01

    Retroviruses infect a wide range of organisms including humans. Among them, HIV-1, which causes AIDS, has now become a major threat for world health. Some of these viruses are also potential gene transfer vectors. In this study, the patterns of synonymous codon usage in retroviruses have been studied through multivariate statistical methods on ORFs sequences from the available 56 retroviruses. The principal determinant for evolution of the codon usage pattern in retroviruses seemed to be the compositional constraints, while selection for translation of the viral genes plays a secondary role. This was further supported by multivariate analysis on relative synonymous codon usage. Thus, it seems that mutational bias might have dominated role over translational selection in shaping the codon usage of retroviruses. Codon adaptation index was used to identify translationally optimal codons among genes from retroviruses. The comparative analysis of the preferred and optimal codons among different retroviral groups revealed that four codons GAA, AAA, AGA, and GGA were significantly more frequent in most of the retroviral genes inspite of some differences. Cluster analysis also revealed that phylogenetically related groups of retroviruses have probably evolved their codon usage in a concerted manner under the influence of their nucleotide composition.

  10. Synonymous codon usage patterns in different parasitic platyhelminth mitochondrial genomes.

    PubMed

    Chen, L; Yang, D Y; Liu, T F; Nong, X; Huang, X; Xie, Y; Fu, Y; Zheng, W P; Zhang, R H; Wu, X H; Gu, X B; Wang, S X; Peng, X R; Yang, G Y

    2013-02-27

    We analyzed synonymous codon usage patterns of the mitochondrial genomes of 43 parasitic platyhelminth species. The relative synonymous codon usage, the effective number of codons (NC) and the frequency of G+C at the third synonymously variable coding position were calculated. Correspondence analysis was used to determine the major variation trends shaping the codon usage patterns. Among the mitochondrial genomes of 19 trematode species, the GC content of third codon positions varied from 0.151 to 0.592, with a mean of 0.295 ± 0.116. In cestodes, the mean GC content of third codon positions was 0.254 ± 0.044. A comparison of the nucleotide composition at 4-fold synonymous sites revealed that, on average, there was a greater abundance of codons ending on U (51.9%) or A (22.7%) than on C (6.3%) or G (19.14%). Twenty-two codons, including UUU, UUA and UUG, were frequently used. In the NC-plot, most of points were distributed well below or around the expected NC curve. In addition to compositional constraints, the degree of hydrophobicity and the aromatic amino acids also influenced codon usage in the mitochondrial genomes of these 43 parasitic platyhelminth species.

  11. An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations

    PubMed Central

    Kuhlmann, Micki M.; Chattopadhyay, Maitreyi; Stupina, Vera A.; Gao, Feng

    2016-01-01

    ABSTRACT Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3′ end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro. The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. IMPORTANCE Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to recoding. We provide evidence that most of the TCV RSE adopts an alternative structure that extends an upstream conserved hairpin and that this alternative structure, and not the phylogenetically conserved structure, is the predominant form of the RSE in RNA synthesized in vitro and in plant cells. The TCV RSE also contains an internal pseudoknot that is not compatible with the phylogenetically conserved structure and an RNA bridge to the 3′ end. These data suggest that the TCV RSE is structurally dynamic and that multiple conformations are likely required to regulate ribosomal readthrough. PMID:27440887

  12. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

    PubMed Central

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-01-01

    Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

  13. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

    PubMed

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-04-28

    In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

  14. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

  15. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    PubMed Central

    2010-01-01

    Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

  16. Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

    PubMed

    Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

    2010-07-04

    Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  17. Codon usage bias: causative factors, quantification methods and genome-wide patterns: with emphasis on insect genomes.

    PubMed

    Behura, Susanta K; Severson, David W

    2013-02-01

    Codon usage bias refers to the phenomenon where specific codons are used more often than other synonymous codons during translation of genes, the extent of which varies within and among species. Molecular evolutionary investigations suggest that codon bias is manifested as a result of balance between mutational and translational selection of such genes and that this phenomenon is widespread across species and may contribute to genome evolution in a significant manner. With the advent of whole-genome sequencing of numerous species, both prokaryotes and eukaryotes, genome-wide patterns of codon bias are emerging in different organisms. Various factors such as expression level, GC content, recombination rates, RNA stability, codon position, gene length and others (including environmental stress and population size) can influence codon usage bias within and among species. Moreover, there has been a continuous quest towards developing new concepts and tools to measure the extent of codon usage bias of genes. In this review, we outline the fundamental concepts of evolution of the genetic code, discuss various factors that may influence biased usage of synonymous codons and then outline different principles and methods of measurement of codon usage bias. Finally, we discuss selected studies performed using whole-genome sequences of different insect species to show how codon bias patterns vary within and among genomes. We conclude with generalized remarks on specific emerging aspects of codon bias studies and highlight the recent explosion of genome-sequencing efforts on arthropods (such as twelve Drosophila species, species of ants, honeybee, Nasonia and Anopheles mosquitoes as well as the recent launch of a genome-sequencing project involving 5000 insects and other arthropods) that may help us to understand better the evolution of codon bias and its biological significance. © 2012 The Authors. Biological Reviews © 2012 Cambridge Philosophical Society.

  18. Pandemic influenza A virus codon usage revisited: biases, adaptation and implications for vaccine strain development

    PubMed Central

    2012-01-01

    Background Influenza A virus (IAV) is a member of the family Orthomyxoviridae and contains eight segments of a single-stranded RNA genome with negative polarity. The first influenza pandemic of this century was declared in April of 2009, with the emergence of a novel H1N1 IAV strain (H1N1pdm) in Mexico and USA. Understanding the extent and causes of biases in codon usage is essential to the understanding of viral evolution. A comprehensive study to investigate the effect of selection pressure imposed by the human host on the codon usage of an emerging, pandemic IAV strain and the trends in viral codon usage involved over the pandemic time period is much needed. Results We performed a comprehensive codon usage analysis of 310 IAV strains from the pandemic of 2009. Highly biased codon usage for Ala, Arg, Pro, Thr and Ser were found. Codon usage is strongly influenced by underlying biases in base composition. When correspondence analysis (COA) on relative synonymous codon usage (RSCU) is applied, the distribution of IAV ORFs in the plane defined by the first two major dimensional factors showed that different strains are located at different places, suggesting that IAV codon usage also reflects an evolutionary process. Conclusions A general association between codon usage bias, base composition and poor adaptation of the virus to the respective host tRNA pool, suggests that mutational pressure is the main force shaping H1N1 pdm IAV codon usage. A dynamic process is observed in the variation of codon usage of the strains enrolled in these studies. These results suggest a balance of mutational bias and natural selection, which allow the virus to explore and re-adapt its codon usage to different environments. Recoding of IAV taking into account codon bias, base composition and adaptation to host tRNA may provide important clues to develop new and appropriate vaccines. PMID:23134595

  19. Evaluating Sense Codon Reassignment with a Simple Fluorescence Screen.

    PubMed

    Biddle, Wil; Schmitt, Margaret A; Fisk, John D

    2015-12-22

    Understanding the interactions that drive the fidelity of the genetic code and the limits to which modifications can be made without breaking the translational system has practical implications for understanding the molecular mechanisms of evolution as well as expanding the set of encodable amino acids, particularly those with chemistries not provided by Nature. Because 61 sense codons encode 20 amino acids, reassigning the meaning of sense codons provides an avenue for biosynthetic modification of proteins, furthering both fundamental and applied biochemical research. We developed a simple screen that exploits the absolute requirement for fluorescence of an active site tyrosine in green fluorescent protein (GFP) to probe the pliability of the degeneracy of the genetic code. Our screen monitors the restoration of the fluorophore of GFP by incorporation of a tyrosine in response to a sense codon typically assigned another meaning in the genetic code. We evaluated sense codon reassignment at four of the 21 sense codons read through wobble interactions in Escherichia coli using the Methanocaldococcus jannaschii orthogonal tRNA/aminoacyl tRNA synthetase pair originally developed and commonly used for amber stop codon suppression. By changing only the anticodon of the orthogonal tRNA, we achieved sense codon reassignment efficiencies between 1% (Phe UUU) and 6% (Lys AAG). Each of the orthogonal tRNAs preferentially decoded the codon traditionally read via a wobble interaction in E. coli with the exception of the orthogonal tRNA with an AUG anticodon, which incorporated tyrosine in response to both the His CAU and His CAC codons with approximately equal frequencies. We applied our screen in a high-throughput manner to evaluate a 10(9)-member combined tRNA/aminoacyl tRNA synthetase library to identify improved sense codon reassigning variants for the Lys AAG codon. A single rapid screen with the ability to broadly evaluate reassignable codons will facilitate identification and improvement of the combinations of sense codons and orthogonal pairs that display efficient reassignment.

  20. Revelation of Influencing Factors in Overall Codon Usage Bias of Equine Influenza Viruses

    PubMed Central

    Bhatia, Sandeep; Sood, Richa; Selvaraj, Pavulraj

    2016-01-01

    Equine influenza viruses (EIVs) of H3N8 subtype are culprits of severe acute respiratory infections in horses, and are still responsible for significant outbreaks worldwide. Adaptability of influenza viruses to a particular host is significantly influenced by their codon usage preference, due to an absolute dependence on the host cellular machinery for their replication. In the present study, we analyzed genome-wide codon usage patterns in 92 EIV strains, including both H3N8 and H7N7 subtypes by computing several codon usage indices and applying multivariate statistical methods. Relative synonymous codon usage (RSCU) analysis disclosed bias of preferred synonymous codons towards A/U-ended codons. The overall codon usage bias in EIVs was slightly lower, and mainly affected by the nucleotide compositional constraints as inferred from the RSCU and effective number of codon (ENc) analysis. Our data suggested that codon usage pattern in EIVs is governed by the interplay of mutation pressure, natural selection from its hosts and undefined factors. The H7N7 subtype was found less fit to its host (horse) in comparison to H3N8, by possessing higher codon bias, lower mutation pressure and much less adaptation to tRNA pool of equine cells. To the best of our knowledge, this is the first report describing the codon usage analysis of the complete genomes of EIVs. The outcome of our study is likely to enhance our understanding of factors involved in viral adaptation, evolution, and fitness towards their hosts. PMID:27119730

  1. Molecular identification of Mango, Mangifera indica L.var. totupura

    PubMed Central

    Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar

    2011-01-01

    Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885

  2. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis.

    PubMed

    Legnini, Ivano; Di Timoteo, Gaia; Rossi, Francesca; Morlando, Mariangela; Briganti, Francesca; Sthandier, Olga; Fatica, Alessandro; Santini, Tiziana; Andronache, Adrian; Wade, Mark; Laneve, Pietro; Rajewsky, Nikolaus; Bozzoni, Irene

    2017-04-06

    Circular RNAs (circRNAs) constitute a family of transcripts with unique structures and still largely unknown functions. Their biogenesis, which proceeds via a back-splicing reaction, is fairly well characterized, whereas their role in the modulation of physiologically relevant processes is still unclear. Here we performed expression profiling of circRNAs during in vitro differentiation of murine and human myoblasts, and we identified conserved species regulated in myogenesis and altered in Duchenne muscular dystrophy. A high-content functional genomic screen allowed the study of their functional role in muscle differentiation. One of them, circ-ZNF609, resulted in specifically controlling myoblast proliferation. Circ-ZNF609 contains an open reading frame spanning from the start codon, in common with the linear transcript, and terminating at an in-frame STOP codon, created upon circularization. Circ-ZNF609 is associated with heavy polysomes, and it is translated into a protein in a splicing-dependent and cap-independent manner, providing an example of a protein-coding circRNA in eukaryotes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Identification of a novel mutation in a patient with pseudohypoparathyroidism type Ia

    PubMed Central

    Lee, Ye Seung; Kim, Hui Kwon; Kim, Hye Rim; Lee, Jong Yoon; Choi, Joong Wan; Bae, Eun Ju; Oh, Phil Soo; Park, Won Il; Ki, Chang Seok

    2014-01-01

    Pseudohypoparathyroidism type Ia (PHP Ia) is a disorder characterized by multiform hormonal resistance including parathyroid hormone (PTH) resistance and Albright hereditary osteodystrophy (AHO). It is caused by heterozygous inactivating mutations within the Gs alpha-encoding GNAS exons. A 9-year-old boy presented with clinical and laboratory abnormalities including hypocalcemia, hyperphosphatemia, PTH resistance, multihormone resistance and AHO (round face, short stature, obesity, brachydactyly and osteoma cutis) which were typical of PHP Ia. He had a history of repeated convulsive episodes that started from the age of 2 months. A cranial computed tomography scan showed bilateral calcifications in the basal ganglia and his intelligence quotient testing indicated mild mental retardation. Family history revealed that the patient's maternal relatives, including his grandmother and 2 of his mother's siblings, had features suggestive of AHO. Sequencing of the GNAS gene of the patient identified a heterozygous nonsense mutation within exon 11 (c.637 C>T). The C>T transversion results in an amino acid substitution from Gln to stop codon at codon 213 (p.Gln213*). To our knowledge, this is a novel mutation in GNAS. PMID:25045367

  4. The high-level expression of human tissue plasminogen activator in the milk of transgenic mice with hybrid gene locus strategy.

    PubMed

    Zhou, Yanrong; Lin, Yanli; Wu, Xiaojie; Xiong, Fuyin; Lv, Yuemeng; Zheng, Tao; Huang, Peitang; Chen, Hongxing

    2012-02-01

    Transgene expression for the mammary gland bioreactor aimed at producing recombinant proteins requires optimized expression vector construction. Previously we presented a hybrid gene locus strategy, which was originally tested with human lactoferrin (hLF) as target transgene, and an extremely high-level expression of rhLF ever been achieved as to 29.8 g/l in mice milk. Here to demonstrate the broad application of this strategy, another 38.4 kb mWAP-htPA hybrid gene locus was constructed, in which the 3-kb genomic coding sequence in the 24-kb mouse whey acidic protein (mWAP) gene locus was substituted by the 17.4-kb genomic coding sequence of human tissue plasminogen activator (htPA), exactly from the start codon to the end codon. Corresponding five transgenic mice lines were generated and the highest expression level of rhtPA in the milk attained as to 3.3 g/l. Our strategy will provide a universal way for the large-scale production of pharmaceutical proteins in the mammary gland of transgenic animals.

  5. The complete genome sequence of freesia mosaic virus and its relationship to other potyviruses.

    PubMed

    Choi, H I; Lim, H R; Song, Y S; Kim, M J; Choi, S H; Song, Y S; Bae, S C; Ryu, K H

    2010-07-01

    We have completed the genomic sequence of a potyvirus, freesia mosaic virus (FreMV), and compared it to those of other known potyviruses. The full-length genome sequence of FreMV consists of 9,489 nucleotides. The large protein contains 3,077 amino acids, with an AUG start codon and UAA stop codon, containing one open reading frame typical of a potyvirus polyprotein. The polyprotein of FreMV-Kr gives rise to eleven proteins (P1, HC-pro, P3, PIPO, 6K1, CI, 6K2, VPg, NIa, NIb and CP), and putative cleavage sites of each protein were identified by sequence comparison to those of other known potyviruses. Phylogenetic analysis of the polyprotein revealed that FreMV-Kr was most closely related to PeMoV and was related to BtMV, BaRMV and PeLMV, which belong to the BCMV subgroup. This is the first information on the complete genome structure of FreMV, and the sequence information clearly supports the status of FreMV as a member of a distinct species in the genus Potyvirus.

  6. Complete mitochondrial genome of the Kwangtung skate: Dipturus kwangtungensis (Rajiformes, Rajidae).

    PubMed

    Jeong, Dageum; Kim, Sung; Kim, Choong-Gon; Lee, Youn-Ho

    2015-01-01

    The complete sequence of mitochondrial DNA of a Kwangtung skate, Dipturus kwangtungensis, was determined as being circular molecules of 16,912 bp including 2 rRNA, 22 tRNA, 13 protein coding genes (PCGs) and a control region. The arrangement of the PCGs is the same as that found in other Rajidae species. The nucleotide of L-strand which encodes most of the proteins is composed of 30.2% A, 27.4% C, 28.2% T and 14.2% G with a bias toward A+T slightly. Twelve of 13 PCGs are initiated by the ATG codon while COX1 starts with GTG. Only ND4 harbors the incomplete termination codon, TA. All tRNA genes have a typical clover-leaf structure of mitochondrial tRNA with the exception of tRNA(Ser)AGY, which has a reduced DHU arm. This mitogenome is the first report for a species of the genus Dipturus, which will become an important source of information on the phylogenetic relationship and the evolution of the genus Dipturus within the family Rajidae.

  7. Codon usage affects the structure and function of the Drosophila circadian clock protein PERIOD.

    PubMed

    Fu, Jingjing; Murphy, Katherine A; Zhou, Mian; Li, Ying H; Lam, Vu H; Tabuloc, Christine A; Chiu, Joanna C; Liu, Yi

    2016-08-01

    Codon usage bias is a universal feature of all genomes, but its in vivo biological functions in animal systems are not clear. To investigate the in vivo role of codon usage in animals, we took advantage of the sensitivity and robustness of the Drosophila circadian system. By codon-optimizing parts of Drosophila period (dper), a core clock gene that encodes a critical component of the circadian oscillator, we showed that dper codon usage is important for circadian clock function. Codon optimization of dper resulted in conformational changes of the dPER protein, altered dPER phosphorylation profile and stability, and impaired dPER function in the circadian negative feedback loop, which manifests into changes in molecular rhythmicity and abnormal circadian behavioral output. This study provides an in vivo example that demonstrates the role of codon usage in determining protein structure and function in an animal system. These results suggest a universal mechanism in eukaryotes that uses a codon usage "code" within genetic codons to regulate cotranslational protein folding. © 2016 Fu et al.; Published by Cold Spring Harbor Laboratory Press.

  8. Analyses of clinicopathological, molecular, and prognostic associations of KRAS codon 61 and codon 146 mutations in colorectal cancer: cohort study and literature review

    PubMed Central

    2014-01-01

    Background KRAS mutations in codons 12 and 13 are established predictive biomarkers for anti-EGFR therapy in colorectal cancer. Previous studies suggest that KRAS codon 61 and 146 mutations may also predict resistance to anti-EGFR therapy in colorectal cancer. However, clinicopathological, molecular, and prognostic features of colorectal carcinoma with KRAS codon 61 or 146 mutation remain unclear. Methods We utilized a molecular pathological epidemiology database of 1267 colon and rectal cancers in the Nurse’s Health Study and the Health Professionals Follow-up Study. We examined KRAS mutations in codons 12, 13, 61 and 146 (assessed by pyrosequencing), in relation to clinicopathological features, and tumor molecular markers, including BRAF and PIK3CA mutations, CpG island methylator phenotype (CIMP), LINE-1 methylation, and microsatellite instability (MSI). Survival analyses were performed in 1067 BRAF-wild-type cancers to avoid confounding by BRAF mutation. Cox proportional hazards models were used to compute mortality hazard ratio, adjusting for potential confounders, including disease stage, PIK3CA mutation, CIMP, LINE-1 hypomethylation, and MSI. Results KRAS codon 61 mutations were detected in 19 cases (1.5%), and codon 146 mutations in 40 cases (3.2%). Overall KRAS mutation prevalence in colorectal cancers was 40% (=505/1267). Of interest, compared to KRAS-wild-type, overall, KRAS-mutated cancers more frequently exhibited cecal location (24% vs. 12% in KRAS-wild-type; P < 0.0001), CIMP-low (49% vs. 32% in KRAS-wild-type; P < 0.0001), and PIK3CA mutations (24% vs. 11% in KRAS-wild-type; P < 0.0001). These trends were evident irrespective of mutated codon, though statistical power was limited for codon 61 mutants. Neither KRAS codon 61 nor codon 146 mutation was significantly associated with clinical outcome or prognosis in univariate or multivariate analysis [colorectal cancer-specific mortality hazard ratio (HR) = 0.81, 95% confidence interval (CI) = 0.29-2.26 for codon 61 mutation; colorectal cancer-specific mortality HR = 0.86, 95% CI = 0.42-1.78 for codon 146 mutation]. Conclusions Tumors with KRAS mutations in codons 61 and 146 account for an appreciable proportion (approximately 5%) of colorectal cancers, and their clinicopathological and molecular features appear generally similar to KRAS codon 12 or 13 mutated cancers. To further assess clinical utility of KRAS codon 61 and 146 testing, large-scale trials are warranted. PMID:24885062

  9. Codon adaptation and synonymous substitution rate in diatom plastid genes.

    PubMed

    Morton, Brian R; Sorhannus, Ulf; Fox, Martin

    2002-07-01

    Diatom plastid genes are examined with respect to codon adaptation and rates of silent substitution (Ks). It is shown that diatom genes follow the same pattern of codon usage as other plastid genes studied previously. Highly expressed diatom genes display codon adaptation, or a bias toward specific major codons, and these major codons are the same as those in red algae, green algae, and land plants. It is also found that there is a strong correlation between Ks and variation in codon adaptation across diatom genes, providing the first evidence for such a relationship in the algae. It is argued that this finding supports the notion that the correlation arises from selective constraints, not from variation in mutation rate among genes. Finally, the diatom genes are examined with respect to variation in Ks among different synonymous groups. Diatom genes with strong codon adaptation do not show the same variation in synonymous substitution rate among codon groups as the flowering plant psbA gene which, previous studies have shown, has strong codon adaptation but unusually high rates of silent change in certain synonymous groups. The lack of a similar finding in diatoms supports the suggestion that the feature is unique to the flowering plant psbA due to recent relaxations in selective pressure in that lineage.

  10. Genetic Code Optimization for Cotranslational Protein Folding: Codon Directional Asymmetry Correlates with Antiparallel Betasheets, tRNA Synthetase Classes.

    PubMed

    Seligmann, Hervé; Warthi, Ganesh

    2017-01-01

    A new codon property, codon directional asymmetry in nucleotide content (CDA), reveals a biologically meaningful genetic code dimension: palindromic codons (first and last nucleotides identical, codon structure XZX) are symmetric (CDA = 0), codons with structures ZXX/XXZ are 5'/3' asymmetric (CDA = - 1/1; CDA = - 0.5/0.5 if Z and X are both purines or both pyrimidines, assigning negative/positive (-/+) signs is an arbitrary convention). Negative/positive CDAs associate with (a) Fujimoto's tetrahedral codon stereo-table; (b) tRNA synthetase class I/II (aminoacylate the 2'/3' hydroxyl group of the tRNA's last ribose, respectively); and (c) high/low antiparallel (not parallel) betasheet conformation parameters. Preliminary results suggest CDA-whole organism associations (body temperature, developmental stability, lifespan). Presumably, CDA impacts spatial kinetics of codon-anticodon interactions, affecting cotranslational protein folding. Some synonymous codons have opposite CDA sign (alanine, leucine, serine, and valine), putatively explaining how synonymous mutations sometimes affect protein function. Correlations between CDA and tRNA synthetase classes are weaker than between CDA and antiparallel betasheet conformation parameters. This effect is stronger for mitochondrial genetic codes, and potentially drives mitochondrial codon-amino acid reassignments. CDA reveals information ruling nucleotide-protein relations embedded in reversed (not reverse-complement) sequences (5'-ZXX-3'/5'-XXZ-3').

  11. Development of a codon optimization strategy using the efor RED reporter gene as a test case

    NASA Astrophysics Data System (ADS)

    Yip, Chee-Hoo; Yarkoni, Orr; Ajioka, James; Wan, Kiew-Lian; Nathan, Sheila

    2018-04-01

    Synthetic biology is a platform that enables high-level synthesis of useful products such as pharmaceutically related drugs, bioplastics and green fuels from synthetic DNA constructs. Large-scale expression of these products can be achieved in an industrial compliant host such as Escherichia coli. To maximise the production of recombinant proteins in a heterologous host, the genes of interest are usually codon optimized based on the codon usage of the host. However, the bioinformatics freeware available for standard codon optimization might not be ideal in determining the best sequence for the synthesis of synthetic DNA. Synthesis of incorrect sequences can prove to be a costly error and to avoid this, a codon optimization strategy was developed based on the E. coli codon usage using the efor RED reporter gene as a test case. This strategy replaces codons encoding for serine, leucine, proline and threonine with the most frequently used codons in E. coli. Furthermore, codons encoding for valine and glycine are substituted with the second highly used codons in E. coli. Both the optimized and original efor RED genes were ligated to the pJS209 plasmid backbone using Gibson Assembly and the recombinant DNAs were transformed into E. coli E. cloni 10G strain. The fluorescence intensity per cell density of the optimized sequence was improved by 20% compared to the original sequence. Hence, the developed codon optimization strategy is proposed when designing an optimal sequence for heterologous protein production in E. coli.

  12. Analysis of Synonymous Codon Usage Bias of Zika Virus and Its Adaption to the Hosts

    PubMed Central

    Wang, Hongju; Liu, Siqing; Zhang, Bo

    2016-01-01

    Zika virus (ZIKV) is a mosquito-borne virus (arbovirus) in the family Flaviviridae, and the symptoms caused by ZIKV infection in humans include rash, fever, arthralgia, myalgia, asthenia and conjunctivitis. Codon usage bias analysis can reveal much about the molecular evolution and host adaption of ZIKV. To gain insight into the evolutionary characteristics of ZIKV, we performed a comprehensive analysis on the codon usage pattern in 46 ZIKV strains by calculating the effective number of codons (ENc), codon adaptation index (CAI), relative synonymous codon usage (RSCU), and other indicators. The results indicate that the codon usage bias of ZIKV is relatively low. Several lines of evidence support the hypothesis that translational selection plays a role in shaping the codon usage pattern of ZIKV. The results from a correspondence analysis (CA) indicate that other factors, such as base composition, aromaticity, and hydrophobicity may also be involved in shaping the codon usage pattern of ZIKV. Additionally, the results from a comparative analysis of RSCU between ZIKV and its hosts suggest that ZIKV tends to evolve codon usage patterns that are comparable to those of its hosts. Moreover, selection pressure from Homo sapiens on the ZIKV RSCU patterns was found to be dominant compared with that from Aedes aegypti and Aedes albopictus. Taken together, both natural translational selection and mutation pressure are important for shaping the codon usage pattern of ZIKV. Our findings contribute to understanding the evolution of ZIKV and its adaption to its hosts. PMID:27893824

  13. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed Central

    Levis, R; Schlesinger, S; Huang, H V

    1990-01-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

  14. Codon Optimization to Enhance Expression Yields Insights into Chloroplast Translation1[OPEN

    PubMed Central

    Chan, Hui-Ting; Williams-Carrier, Rosalind; Barkan, Alice

    2016-01-01

    Codon optimization based on psbA genes from 133 plant species eliminated 105 (human clotting factor VIII heavy chain [FVIII HC]) and 59 (polio VIRAL CAPSID PROTEIN1 [VP1]) rare codons; replacement with only the most highly preferred codons decreased transgene expression (77- to 111-fold) when compared with the codon usage hierarchy of the psbA genes. Targeted proteomic quantification by parallel reaction monitoring analysis showed 4.9- to 7.1-fold or 22.5- to 28.1-fold increase in FVIII or VP1 codon-optimized genes when normalized with stable isotope-labeled standard peptides (or housekeeping protein peptides), but quantitation using western blots showed 6.3- to 8-fold or 91- to 125-fold increase of transgene expression from the same batch of materials, due to limitations in quantitative protein transfer, denaturation, solubility, or stability. Parallel reaction monitoring, to our knowledge validated here for the first time for in planta quantitation of biopharmaceuticals, is especially useful for insoluble or multimeric proteins required for oral drug delivery. Northern blots confirmed that the increase of codon-optimized protein synthesis is at the translational level rather than any impact on transcript abundance. Ribosome footprints did not increase proportionately with VP1 translation or even decreased after FVIII codon optimization but is useful in diagnosing additional rate-limiting steps. A major ribosome pause at CTC leucine codons in the native gene of FVIII HC was eliminated upon codon optimization. Ribosome stalls observed at clusters of serine codons in the codon-optimized VP1 gene provide an opportunity for further optimization. In addition to increasing our understanding of chloroplast translation, these new tools should help to advance this concept toward human clinical studies. PMID:27465114

  15. Codon usage regulates protein structure and function by affecting translation elongation speed in Drosophila cells.

    PubMed

    Zhao, Fangzhou; Yu, Chien-Hung; Liu, Yi

    2017-08-21

    Codon usage biases are found in all eukaryotic and prokaryotic genomes and have been proposed to regulate different aspects of translation process. Codon optimality has been shown to regulate translation elongation speed in fungal systems, but its effect on translation elongation speed in animal systems is not clear. In this study, we used a Drosophila cell-free translation system to directly compare the velocity of mRNA translation elongation. Our results demonstrate that optimal synonymous codons speed up translation elongation while non-optimal codons slow down translation. In addition, codon usage regulates ribosome movement and stalling on mRNA during translation. Finally, we show that codon usage affects protein structure and function in vitro and in Drosophila cells. Together, these results suggest that the effect of codon usage on translation elongation speed is a conserved mechanism from fungi to animals that can affect protein folding in eukaryotic organisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Synonymous codon choices in the extremely GC-poor genome of Plasmodium falciparum: compositional constraints and translational selection.

    PubMed

    Musto, H; Romero, H; Zavala, A; Jabbari, K; Bernardi, G

    1999-07-01

    We have analyzed the patterns of synonymous codon preferences of the nuclear genes of Plasmodium falciparum, a unicellular parasite characterized by an extremely GC-poor genome. When all genes are considered, codon usage is strongly biased toward A and T in third codon positions, as expected, but multivariate statistical analysis detects a major trend among genes. At one end genes display codon choices determined mainly by the extreme genome composition of this parasite, and very probably their expression level is low. At the other end a few genes exhibit an increased relative usage of a particular subset of codons, many of which are C-ending. Since the majority of these few genes is putatively highly expressed, we postulate that the increased C-ending codons are translationally optimal. In conclusion, while codon usage of the majority of P. falciparum genes is determined mainly by compositional constraints, a small number of genes exhibit translational selection.

  17. Most Used Codons per Amino Acid and per Genome in the Code of Man Compared to Other Organisms According to the Rotating Circular Genetic Code

    PubMed Central

    Castro-Chavez, Fernando

    2011-01-01

    My previous theoretical research shows that the rotating circular genetic code is a viable tool to make easier to distinguish the rules of variation applied to the amino acid exchange; it presents a precise and positional bio-mathematical balance of codons, according to the amino acids they codify. Here, I demonstrate that when using the conventional or classic circular genetic code, a clearer pattern for the human codon usage per amino acid and per genome emerges. The most used human codons per amino acid were the ones ending with the three hydrogen bond nucleotides: C for 12 amino acids and G for the remaining 8, plus one codon for arginine ending in A that was used approximately with the same frequency than the one ending in G for this same amino acid (plus *). The most used codons in man fall almost all the time at the rightmost position, clockwise, ending either in C or in G within the circular genetic code. The human codon usage per genome is compared to other organisms such as fruit flies (Drosophila melanogaster), squid (Loligo pealei), and many others. The biosemiotic codon usage of each genomic population or ‘Theme’ is equated to a ‘molecular language’. The C/U choice or difference, and the G/A difference in the third nucleotide of the most used codons per amino acid are illustrated by comparing the most used codons per genome in humans and squids. The human distribution in the third position of most used codons is a 12-8-2, C-G-A, nucleotide ending signature, while the squid distribution in the third position of most used codons was an odd, or uneven, distribution in the third position of its most used codons: 13-6-3, U-A-G, as its nucleotide ending signature. These findings may help to design computational tools to compare human genomes, to determine the exchangeability between compatible codons and amino acids, and for the early detection of incompatible changes leading to hereditary diseases. PMID:22997484

  18. Vertebrate codon bias indicates a highly GC-rich ancestral genome.

    PubMed

    Nabiyouni, Maryam; Prakash, Ashwin; Fedorov, Alexei

    2013-04-25

    Two factors are thought to have contributed to the origin of codon usage bias in eukaryotes: 1) genome-wide mutational forces that shape overall GC-content and create context-dependent nucleotide bias, and 2) positive selection for codons that maximize efficient and accurate translation. Particularly in vertebrates, these two explanations contradict each other and cloud the origin of codon bias in the taxon. On the one hand, mutational forces fail to explain GC-richness (~60%) of third codon positions, given the GC-poor overall genomic composition among vertebrates (~40%). On the other hand, positive selection cannot easily explain strict regularities in codon preferences. Large-scale bioinformatic assessment, of nucleotide composition of coding and non-coding sequences in vertebrates and other taxa, suggests a simple possible resolution for this contradiction. Specifically, we propose that the last common vertebrate ancestor had a GC-rich genome (~65% GC). The data suggest that whole-genome mutational bias is the major driving force for generating codon bias. As the bias becomes prominent, it begins to affect translation and can result in positive selection for optimal codons. The positive selection can, in turn, significantly modulate codon preferences. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. The Relation of Codon Bias to Tissue-Specific Gene Expression in Arabidopsis thaliana

    PubMed Central

    Camiolo, Salvatore; Farina, Lorenzo; Porceddu, Andrea

    2012-01-01

    The codon composition of coding sequences plays an important role in the regulation of gene expression. Herein, we report systematic differences in the usage of synonymous codons among Arabidopsis thaliana genes that are expressed specifically in distinct tissues. Although we observed that both regionally and transcriptionally associated mutational biases were associated significantly with codon bias, they could not explain the observed differences fully. Similarly, given that transcript abundances did not account for the differences in codon usage, it is unlikely that selection for translational efficiency can account exclusively for the observed codon bias. Thus, we considered the possible evolution of codon bias as an adaptive response to the different abundances of tRNAs in different tissues. Our analysis demonstrated that in some cases, codon usage in genes that were expressed in a broad range of tissues was influenced primarily by the tissue in which the gene was expressed maximally. On the basis of this finding we propose that genes that are expressed in certain tissues might show a tissue-specific compositional signature in relation to codon usage. These findings might have implications for the design of transgenes in relation to optimizing their expression. PMID:22865738

  20. Analysis of the synonymous codon usage bias in recently emerged enterovirus D68 strains.

    PubMed

    Karniychuk, Uladzimir U

    2016-09-02

    Understanding the codon usage pattern of a pathogen and relationship between pathogen and host's codon usage patterns has fundamental and applied interests. Enterovirus D68 (EV-D68) is an emerging pathogen with a potentially high public health significance. In the present study, the synonymous codon usage bias of 27 recently emerged, and historical EV-D68 strains was analyzed. In contrast to previously studied enteroviruses (enterovirus 71 and poliovirus), EV-D68 and human host have a high discrepancy between favored codons. Analysis of viral synonymous codon usage bias metrics, viral nucleotide/dinucleotide compositional parameters, and viral protein properties showed that mutational pressure is more involved in shaping the synonymous codon usage bias of EV-D68 than translation selection. Computation of codon adaptation indices allowed to estimate expression potential of the EV-D68 genome in several commonly used laboratory animals. This approach requires experimental validation and may provide an auxiliary tool for the rational selection of laboratory animals to model emerging viral diseases. Enterovirus D68 genome compositional and codon usage data can be useful for further pathogenesis, animal model, and vaccine design studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Differences in codon bias cannot explain differences in translational power among microbes.

    PubMed

    Dethlefsen, Les; Schmidt, Thomas M

    2005-01-06

    Translational power is the cellular rate of protein synthesis normalized to the biomass invested in translational machinery. Published data suggest a previously unrecognized pattern: translational power is higher among rapidly growing microbes, and lower among slowly growing microbes. One factor known to affect translational power is biased use of synonymous codons. The correlation within an organism between expression level and degree of codon bias among genes of Escherichia coli and other bacteria capable of rapid growth is commonly attributed to selection for high translational power. Conversely, the absence of such a correlation in some slowly growing microbes has been interpreted as the absence of selection for translational power. Because codon bias caused by translational selection varies between rapidly growing and slowly growing microbes, we investigated whether observed differences in translational power among microbes could be explained entirely by differences in the degree of codon bias. Although the data are not available to estimate the effect of codon bias in other species, we developed an empirically-based mathematical model to compare the translation rate of E. coli to the translation rate of a hypothetical strain which differs from E. coli only by lacking codon bias. Our reanalysis of data from the scientific literature suggests that translational power can differ by a factor of 5 or more between E. coli and slowly growing microbial species. Using empirical codon-specific in vivo translation rates for 29 codons, and several scenarios for extrapolating from these data to estimates over all codons, we find that codon bias cannot account for more than a doubling of the translation rate in E. coli, even with unrealistic simplifying assumptions that exaggerate the effect of codon bias. With more realistic assumptions, our best estimate is that codon bias accelerates translation in E. coli by no more than 60% in comparison to microbes with very little codon bias. While codon bias confers a substantial benefit of faster translation and hence greater translational power, the magnitude of this effect is insufficient to explain observed differences in translational power among bacterial and archaeal species, particularly the differences between slowly growing and rapidly growing species. Hence, large differences in translational power suggest that the translational apparatus itself differs among microbes in ways that influence translational performance.

  2. TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants.

    PubMed Central

    Leskiw, B K; Lawlor, E J; Fernandez-Abalos, J M; Chater, K F

    1991-01-01

    In Streptomyces coelicolor A3(2) and the related species Streptomyces lividans 66, aerial mycelium formation and antibiotic production are blocked by mutations in bldA, which specifies a tRNA(Leu)-like gene product which would recognize the UUA codon. Here we show that phenotypic expression of three disparate genes (carB, lacZ, and ampC) containing TTA codons depends strongly on bldA. Site-directed mutagenesis of carB, changing its two TTA codons to CTC (leucine) codons, resulted in bldA-independent expression; hence the bldA product is the principal tRNA for the UUA codon. Two other genes (hyg and aad) containing TTA codons show a medium-dependent reduction in phenotypic expression (hygromycin resistance and spectinomycin resistance, respectively) in bldA mutants. For hyg, evidence is presented that the UUA codon is probably being translated by a tRNA with an imperfectly matched anticodon, giving very low levels of gene product but relatively high resistance to hygromycin. It is proposed that TTA codons may be generally absent from genes expressed during vegetative growth and from the structural genes for differentiation and antibiotic production but present in some regulatory and resistance genes associated with the latter processes. The codon may therefore play a role in developmental regulation. Images PMID:1826053

  3. Analysis of codon usage bias of envelope glycoprotein genes in nuclear polyhedrosis virus (NPV) and its relation to evolution.

    PubMed

    Zhao, Yongchao; Zheng, Hao; Xu, Anying; Yan, Donghua; Jiang, Zijian; Qi, Qi; Sun, Jingchen

    2016-08-24

    Analysis of codon usage bias is an extremely versatile method using in furthering understanding of the genetic and evolutionary paths of species. Codon usage bias of envelope glycoprotein genes in nuclear polyhedrosis virus (NPV) has remained largely unexplored at present. Hence, the codon usage bias of NPV envelope glycoprotein was analyzed here to reveal the genetic and evolutionary relationships between different viral species in baculovirus genus. A total of 9236 codons from 18 different species of NPV of the baculovirus genera were used to perform this analysis. Glycoprotein of NPV exhibits weaker codon usage bias. Neutrality plot analysis and correlation analysis of effective number of codons (ENC) values indicate that natural selection is the main factor influencing codon usage bias, and that the impact of mutation pressure is relatively smaller. Another cluster analysis shows that the kinship or evolutionary relationships of these viral species can be divided into two broad categories despite all of these 18 species are from the same baculovirus genus. There are many elements that can affect codon bias, such as the composition of amino acids, mutation pressure, natural selection, gene expression level, and etc. In the meantime, cluster analysis also illustrates that codon usage bias of virus envelope glycoprotein can serve as an effective means of evolutionary classification in baculovirus genus.

  4. Codon usage analysis of photolyase encoding genes of cyanobacteria inhabiting diverse habitats.

    PubMed

    Rajneesh; Pathak, Jainendra; Kannaujiya, Vinod K; Singh, Shailendra P; Sinha, Rajeshwar P

    2017-07-01

    Nucleotide and amino acid compositions were studied to determine the genomic and structural relationship of photolyase gene in freshwater, marine and hot spring cyanobacteria. Among three habitats, photolyase encoding genes from hot spring cyanobacteria were found to have highest GC content. The genomic GC content was found to influence the codon usage and amino acid variability in photolyases. The third position of codon was found to have more effect on amino acid variability in photolyases than the first and second positions of codon. The variation of amino acids Ala, Asp, Glu, Gly, His, Leu, Pro, Gln, Arg and Val in photolyases of three different habitats was found to be controlled by first position of codon (G1C1). However, second position (G2C2) of codon regulates variation of Ala, Cys, Gly, Pro, Arg, Ser, Thr and Tyr contents in photolyases. Third position (G3C3) of codon controls incorporation of amino acids such as Ala, Phe, Gly, Leu, Gln, Pro, Arg, Ser, Thr and Tyr in photolyases from three habitats. Photolyase encoding genes of hot spring cyanobacteria have 85% codons with G or C at third position, whereas marine and freshwater cyanobacteria showed 82 and 60% codons, respectively, with G or C at third position. Principal component analysis (PCA) showed that GC content has a profound effect in separating the genes along the first major axis according to their RSCU (relative synonymous codon usage) values, and neutrality analysis indicated that mutational pressure has resulted in codon bias in photolyase genes of cyanobacteria.

  5. Reconnaissance of sedimentation in the Rio Pilcomayo Basin, May 1975, Argentina, Bolivia, and Paraguay

    USGS Publications Warehouse

    Ritter, John R.

    1977-01-01

    The Río Pilcomayo "Alto" (Bolivia) and "Superior" (Bolivia, Argentina, and Paraguay) transport large quantities of sediment for the size of the basin. The Río Pilcomayo "Inferior" (Argentina and Paraguay) seems to carry little sediment. The large loads of the "Alto" and "Superior" must be considered before dams or irrigation projects are started. The shifting channel and flooding of the Río Pilcomayo "Superior" also are problems to be considered before development. The Río Pilcomayo "Alto" basin has relatively little deposition whereas the "Superior" basin has considerable deposition. A part of the "Superior" channel is filled with sediment to the top of its banks. The upstream limit of filling is moving farther upstream each year causing the place of overbank flooding to move upstream also.More data must be collected and more observations made before a complete analysis of the sediment movement in the basin can be made.

  6. Cloning and Expression Analysis of Genes Encoding Lytic Endopeptidases L1 and L5 from Lysobacter sp. Strain XL1

    PubMed Central

    Lapteva, Y. S.; Zolova, O. E.; Shlyapnikov, M. G.; Tsfasman, I. M.; Muranova, T. A.; Stepnaya, O. A.; Kulaev, I. S.

    2012-01-01

    Lytic enzymes are the group of hydrolases that break down structural polymers of the cell walls of various microorganisms. In this work, we determined the nucleotide sequences of the Lysobacter sp. strain XL1 alpA and alpB genes, which code for, respectively, secreted lytic endopeptidases L1 (AlpA) and L5 (AlpB). In silico analysis of their amino acid sequences showed these endopeptidases to be homologous proteins synthesized as precursors similar in structural organization: the mature enzyme sequence is preceded by an N-terminal signal peptide and a pro region. On the basis of phylogenetic analysis, endopeptidases AlpA and AlpB were assigned to the S1E family [clan PA(S)] of serine peptidases. Expression of the alpA and alpB open reading frames (ORFs) in Escherichia coli confirmed that they code for functionally active lytic enzymes. Each ORF was predicted to have the Shine-Dalgarno sequence located at a canonical distance from the start codon and a potential Rho-independent transcription terminator immediately after the stop codon. The alpA and alpB mRNAs were experimentally found to be monocistronic; transcription start points were determined for both mRNAs. The synthesis of the alpA and alpB mRNAs was shown to occur predominantly in the late logarithmic growth phase. The amount of alpA mRNA in cells of Lysobacter sp. strain XL1 was much higher, which correlates with greater production of endopeptidase L1 than of L5. PMID:22865082

  7. Cloning and expression analysis of genes encoding lytic endopeptidases L1 and L5 from Lysobacter sp. strain XL1.

    PubMed

    Lapteva, Y S; Zolova, O E; Shlyapnikov, M G; Tsfasman, I M; Muranova, T A; Stepnaya, O A; Kulaev, I S; Granovsky, I E

    2012-10-01

    Lytic enzymes are the group of hydrolases that break down structural polymers of the cell walls of various microorganisms. In this work, we determined the nucleotide sequences of the Lysobacter sp. strain XL1 alpA and alpB genes, which code for, respectively, secreted lytic endopeptidases L1 (AlpA) and L5 (AlpB). In silico analysis of their amino acid sequences showed these endopeptidases to be homologous proteins synthesized as precursors similar in structural organization: the mature enzyme sequence is preceded by an N-terminal signal peptide and a pro region. On the basis of phylogenetic analysis, endopeptidases AlpA and AlpB were assigned to the S1E family [clan PA(S)] of serine peptidases. Expression of the alpA and alpB open reading frames (ORFs) in Escherichia coli confirmed that they code for functionally active lytic enzymes. Each ORF was predicted to have the Shine-Dalgarno sequence located at a canonical distance from the start codon and a potential Rho-independent transcription terminator immediately after the stop codon. The alpA and alpB mRNAs were experimentally found to be monocistronic; transcription start points were determined for both mRNAs. The synthesis of the alpA and alpB mRNAs was shown to occur predominantly in the late logarithmic growth phase. The amount of alpA mRNA in cells of Lysobacter sp. strain XL1 was much higher, which correlates with greater production of endopeptidase L1 than of L5.

  8. A Mutation in the Start Codon of γ-Crystallin D Leads to Nuclear Cataracts in the Dahl SS/Jr-Ctr Strain

    PubMed Central

    Johnson, Ashley C.; Lee, Jonathan W.; Harmon, Ashlyn C.; Morris, Zaliya; Wang, Xuexiang; Fratkin, Jonathan; Rapp, John P.; Gomez-Sanchez, Elise; Garrett, Michael R.

    2013-01-01

    Cataracts are a major cause of blindness. The most common forms of cataracts are age and UV related and develops mostly in the elderly, while congenital cataracts appear at birth or in early childhood. The Dahl salt-sensitive (SS/Jr) rat is an extensively used model of salt-sensitive hypertension that exhibits concomitant renal disease. In the mid 1980’s, cataracts appeared in a few animals in the Dahl S colony, presumably the result of a spontaneous mutation. The mutation was fixed and bred to establish the SS/Jr-Ctr substrain. The SS/Jr-Ctr substrain has been exclusively used by a single investigator to study the role of steroids and hypertension. Using a classical positional cloning approach, we localized the cataract gene with high-resolution to a less than 1 Mbp region on chromosome 9 using an F1 (SS/Jr-Ctr X SHR) X SHR backcross population. The 1 Mbp region contained only 13 genes, including 4 genes from the γ-crystallins (Cryg) gene family which are known to play a role in cataract formation. All of the γ-crystallins were sequenced and a novel point mutation in the start codon (ATG → GTG) of the Crygd gene was identified which led to the complete absence of CRYGD protein in the eyes of the SS/Jr-Ctr strain. In summary, the identification of the genetic cause in this novel cataract model may provide an opportunity to better understand the development of cataracts, particularly in the context of hypertension. PMID:23404175

  9. Production of 2-ketoisocaproate with Corynebacterium glutamicum strains devoid of plasmids and heterologous genes.

    PubMed

    Vogt, Michael; Haas, Sabine; Polen, Tino; van Ooyen, Jan; Bott, Michael

    2015-03-01

    2-Ketoisocaproate (KIC), the last intermediate in l-leucine biosynthesis, has various medical and industrial applications. After deletion of the ilvE gene for transaminase B in l-leucine production strains of Corynebacterium glutamicum, KIC became the major product, however, the strains were auxotrophic for l-isoleucine. To avoid auxotrophy, reduction of IlvE activity by exchanging the ATG start codon of ilvE by GTG was tested instead of an ilvE deletion. The resulting strains were indeed able to grow in glucose minimal medium without amino acid supplementation, but at the cost of lowered growth rates and KIC production parameters. The best production performance was obtained with strain MV-KICF1, which carried besides the ilvE start codon exchange three copies of a gene for a feedback-resistant 2-isopropylmalate synthase, one copy of a gene for a feedback-resistant acetohydroxyacid synthase and deletions of ltbR and iolR encoding transcriptional regulators. In the presence of 1 mM l-isoleucine, MV-KICF1 accumulated 47 mM KIC (6.1 g l(-1)) with a yield of 0.20 mol/mol glucose and a volumetric productivity of 1.41 mmol KIC l(-1)  h(-1). Since MV-KICF1 is plasmid free and lacks heterologous genes, it is an interesting strain for industrial application and as platform for the production of KIC-derived compounds, such as 3-methyl-1-butanol. © 2014 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  10. Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position.

    PubMed

    Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y; Tor, Yitzhak; Cooperman, Barry S

    2017-08-29

    Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon University of California base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5'- and 3'-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix.

  11. Balanced Codon Usage Optimizes Eukaryotic Translational Efficiency

    PubMed Central

    Qian, Wenfeng; Yang, Jian-Rong; Pearson, Nathaniel M.; Maclean, Calum; Zhang, Jianzhi

    2012-01-01

    Cellular efficiency in protein translation is an important fitness determinant in rapidly growing organisms. It is widely believed that synonymous codons are translated with unequal speeds and that translational efficiency is maximized by the exclusive use of rapidly translated codons. Here we estimate the in vivo translational speeds of all sense codons from the budding yeast Saccharomyces cerevisiae. Surprisingly, preferentially used codons are not translated faster than unpreferred ones. We hypothesize that this phenomenon is a result of codon usage in proportion to cognate tRNA concentrations, the optimal strategy in enhancing translational efficiency under tRNA shortage. Our predicted codon–tRNA balance is indeed observed from all model eukaryotes examined, and its impact on translational efficiency is further validated experimentally. Our study reveals a previously unsuspected mechanism by which unequal codon usage increases translational efficiency, demonstrates widespread natural selection for translational efficiency, and offers new strategies to improve synthetic biology. PMID:22479199

  12. Tail-extension following the termination codon is critical for release of the nascent chain from membrane-bound ribosomes in a reticulocyte lysate cell-free system.

    PubMed

    Takahara, Michiyo; Sakaue, Haruka; Onishi, Yukiko; Yamagishi, Marifu; Kida, Yuichiro; Sakaguchi, Masao

    2013-01-11

    Nascent chain release from membrane-bound ribosomes by the termination codon was investigated using a cell-free translation system from rabbit supplemented with rough microsomal membrane vesicles. Chain release was extremely slow when mRNA ended with only the termination codon. Tail extension after the termination codon enhanced the release of the nascent chain. Release reached plateau levels with tail extension of 10 bases. This requirement was observed with all termination codons: TAA, TGA and TAG. Rapid release was also achieved by puromycin even in the absence of the extension. Efficient translation termination cannot be achieved in the presence of only a termination codon on the mRNA. Tail extension might be required for correct positioning of the termination codon in the ribosome and/or efficient recognition by release factors. Copyright © 2012. Published by Elsevier Inc.

  13. A common periodic table of codons and amino acids.

    PubMed

    Biro, J C; Benyó, B; Sansom, C; Szlávecz, A; Fördös, G; Micsik, T; Benyó, Z

    2003-06-27

    A periodic table of codons has been designed where the codons are in regular locations. The table has four fields (16 places in each) one with each of the four nucleotides (A, U, G, C) in the central codon position. Thus, AAA (lysine), UUU (phenylalanine), GGG (glycine), and CCC (proline) were placed into the corners of the fields as the main codons (and amino acids) of the fields. They were connected to each other by six axes. The resulting nucleic acid periodic table showed perfect axial symmetry for codons. The corresponding amino acid table also displaced periodicity regarding the biochemical properties (charge and hydropathy) of the 20 amino acids and the position of the stop signals. The table emphasizes the importance of the central nucleotide in the codons and predicts that purines control the charge while pyrimidines determine the polarity of the amino acids. This prediction was experimentally tested.

  14. Codon usage and amino acid usage influence genes expression level.

    PubMed

    Paul, Prosenjit; Malakar, Arup Kumar; Chakraborty, Supriyo

    2018-02-01

    Highly expressed genes in any species differ in the usage frequency of synonymous codons. The relative recurrence of an event of the favored codon pair (amino acid pairs) varies between gene and genomes due to varying gene expression and different base composition. Here we propose a new measure for predicting the gene expression level, i.e., codon plus amino bias index (CABI). Our approach is based on the relative bias of the favored codon pair inclination among the genes, illustrated by analyzing the CABI score of the Medicago truncatula genes. CABI showed strong correlation with all other widely used measures (CAI, RCBS, SCUO) for gene expression analysis. Surprisingly, CABI outperforms all other measures by showing better correlation with the wet-lab data. This emphasizes the importance of the neighboring codons of the favored codon in a synonymous group while estimating the expression level of a gene.

  15. Large-Scale Genomic Analysis of Codon Usage in Dengue Virus and Evaluation of Its Phylogenetic Dependence

    PubMed Central

    Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro

    2014-01-01

    The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631

  16. Di-codon Usage for Gene Classification

    NASA Astrophysics Data System (ADS)

    Nguyen, Minh N.; Ma, Jianmin; Fogel, Gary B.; Rajapakse, Jagath C.

    Classification of genes into biologically related groups facilitates inference of their functions. Codon usage bias has been described previously as a potential feature for gene classification. In this paper, we demonstrate that di-codon usage can further improve classification of genes. By using both codon and di-codon features, we achieve near perfect accuracies for the classification of HLA molecules into major classes and sub-classes. The method is illustrated on 1,841 HLA sequences which are classified into two major classes, HLA-I and HLA-II. Major classes are further classified into sub-groups. A binary SVM using di-codon usage patterns achieved 99.95% accuracy in the classification of HLA genes into major HLA classes; and multi-class SVM achieved accuracy rates of 99.82% and 99.03% for sub-class classification of HLA-I and HLA-II genes, respectively. Furthermore, by combining codon and di-codon usages, the prediction accuracies reached 100%, 99.82%, and 99.84% for HLA major class classification, and for sub-class classification of HLA-I and HLA-II genes, respectively.

  17. tRNA1Ser(G34) with the anticodon GGA can recognize not only UCC and UCU codons but also UCA and UCG codons.

    PubMed

    Yamada, Yuko; Matsugi, Jitsuhiro; Ishikura, Hisayuki

    2003-04-15

    The tRNA1Ser (anticodon VGA, V=uridin-5-oxyacetic acid) is essential for translation of the UCA codon in Escherichia coli. Here, we studied the translational abilities of serine tRNA derivatives, which have different bases from wild type at the first positions of their anticodons, using synthetic mRNAs containing the UCN (N=A, G, C, or U) codon. The tRNA1Ser(G34) having the anticodon GGA was able to read not only UCC and UCU codons but also UCA and UCG codons. This means that the formation of G-A or G-G pair allowed at the wobble position and these base pairs are noncanonical. The translational efficiency of the tRNA1Ser(G34) for UCA or UCG codon depends on the 2'-O-methylation of the C32 (Cm). The 2'-O-methylation of C32 may give rise to the space necessary for G-A or G-G base pair formation between the first position of anticodon and the third position of codon.

  18. Comparative evolutionary genomics of Corynebacterium with special reference to codon and amino acid usage diversities.

    PubMed

    Pal, Shilpee; Sarkar, Indrani; Roy, Ayan; Mohapatra, Pradeep K Das; Mondal, Keshab C; Sen, Arnab

    2018-02-01

    The present study has been aimed to the comparative analysis of high GC composition containing Corynebacterium genomes and their evolutionary study by exploring codon and amino acid usage patterns. Phylogenetic study by MLSA approach, indel analysis and BLAST matrix differentiated Corynebacterium species in pathogenic and non-pathogenic clusters. Correspondence analysis on synonymous codon usage reveals that, gene length, optimal codon frequencies and tRNA abundance affect the gene expression of Corynebacterium. Most of the optimal codons as well as translationally optimal codons are C ending i.e. RNY (R-purine, N-any nucleotide base, and Y-pyrimidine) and reveal translational selection pressure on codon bias of Corynebacterium. Amino acid usage is affected by hydrophobicity, aromaticity, protein energy cost, etc. Highly expressed genes followed the cost minimization hypothesis and are less diverged at their synonymous positions of codons. Functional analysis of core genes shows significant difference in pathogenic and non-pathogenic Corynebacterium. The study reveals close relationship between non-pathogenic and opportunistic pathogenic Corynebaterium as well as between molecular evolution and survival niches of the organism.

  19. Codes in the codons: construction of a codon/amino acid periodic table and a study of the nature of specific nucleic acid-protein interactions.

    PubMed

    Benyo, B; Biro, J C; Benyo, Z

    2004-01-01

    The theory of "codon-amino acid coevolution" was first proposed by Woese in 1967. It suggests that there is a stereochemical matching - that is, affinity - between amino acids and certain of the base triplet sequences that code for those amino acids. We have constructed a common periodic table of codons and amino acids, where the nucleic acid table showed perfect axial symmetry for codons and the corresponding amino acid table also displayed periodicity regarding the biochemical properties (charge and hydrophobicity) of the 20 amino acids and the position of the stop signals. The table indicates that the middle (2/sup nd/) amino acid in the codon has a prominent role in determining some of the structural features of the amino acids. The possibility that physical contact between codons and amino acids might exist was tested on restriction enzymes. Many recognition site-like sequences were found in the coding sequences of these enzymes and as many as 73 examples of codon-amino acid co-location were observed in the 7 known 3D structures (December 2003) of endonuclease-nucleic acid complexes. These results indicate that the smallest possible units of specific nucleic acid-protein interaction are indeed the stereochemically compatible codons and amino acids.

  20. Codon usage bias and tRNA over-expression in Buchnera aphidicola after aromatic amino acid nutritional stress on its host Acyrthosiphon pisum.

    PubMed

    Charles, Hubert; Calevro, Federica; Vinuelas, José; Fayard, Jean-Michel; Rahbe, Yvan

    2006-01-01

    Codon usage bias and relative abundances of tRNA isoacceptors were analysed in the obligate intracellular symbiotic bacterium, Buchnera aphidicola from the aphid Acyrthosiphon pisum, using a dedicated 35mer oligonucleotide microarray. Buchnera is archetypal of organisms living with minimal metabolic requirements and presents a reduced genome with high-evolutionary rate. Codonusage in Buchnera has been overcome by the high mutational bias towards AT bases. However, several lines of evidence for codon usage selection are given here. A significant correlation was found between tRNA relative abundances and codon composition of Buchnera genes. A significant codon usage bias was found for the choice of rare codons in Buchnera: C-ending codons are preferred in highly expressed genes, whereas G-ending codons are avoided. This bias is not explained by GC skew in the bacteria and might correspond to a selection for perfect matching between codon-anticodon pairs for some essential amino acids in Buchnera proteins. Nutritional stress applied to the aphid host induced a significant overexpression of most of the tRNA isoacceptors in bacteria. Although, molecular regulation of the tRNA operons in Buchnera was not investigated, a correlation between relative expression levels and organization in transcription unit was found in the genome of Buchnera.

  1. Codon optimization of the adenoviral fiber negatively impacts structural protein expression and viral fitness

    NASA Astrophysics Data System (ADS)

    Villanueva, Eneko; Martí-Solano, Maria; Fillat, Cristina

    2016-06-01

    Codon usage adaptation of lytic viruses to their hosts is determinant for viral fitness. In this work, we analyzed the codon usage of adenoviral proteins by principal component analysis and assessed their codon adaptation to the host. We observed a general clustering of adenoviral proteins according to their function. However, there was a significant variation in the codon preference between the host-interacting fiber protein and the rest of structural late phase proteins, with a non-optimal codon usage of the fiber. To understand the impact of codon bias in the fiber, we optimized the Adenovirus-5 fiber to the codon usage of the hexon structural protein. The optimized fiber displayed increased expression in a non-viral context. However, infection with adenoviruses containing the optimized fiber resulted in decreased expression of the fiber and of wild-type structural proteins. Consequently, this led to a drastic reduction in viral release. The insertion of an exogenous optimized protein as a late gene in the adenovirus with the optimized fiber further interfered with viral fitness. These results highlight the importance of balancing codon usage in viral proteins to adequately exploit cellular resources for efficient infection and open new opportunities to regulate viral fitness for virotherapy and vaccine development.

  2. A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes

    PubMed Central

    Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

    2016-01-01

    The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including “codon capture,” “genome streamlining,” and “ambiguous intermediate” theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNAAla containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. PMID:27197221

  3. ChloroMitoCU: Codon patterns across organelle genomes for functional genomics and evolutionary applications.

    PubMed

    Sablok, Gaurav; Chen, Ting-Wen; Lee, Chi-Ching; Yang, Chi; Gan, Ruei-Chi; Wegrzyn, Jill L; Porta, Nicola L; Nayak, Kinshuk C; Huang, Po-Jung; Varotto, Claudio; Tang, Petrus

    2017-06-01

    Organelle genomes are widely thought to have arisen from reduction events involving cyanobacterial and archaeal genomes, in the case of chloroplasts, or α-proteobacterial genomes, in the case of mitochondria. Heterogeneity in base composition and codon preference has long been the subject of investigation of topics ranging from phylogenetic distortion to the design of overexpression cassettes for transgenic expression. From the overexpression point of view, it is critical to systematically analyze the codon usage patterns of the organelle genomes. In light of the importance of codon usage patterns in the development of hyper-expression organelle transgenics, we present ChloroMitoCU, the first-ever curated, web-based reference catalog of the codon usage patterns in organelle genomes. ChloroMitoCU contains the pre-compiled codon usage patterns of 328 chloroplast genomes (29,960 CDS) and 3,502 mitochondrial genomes (49,066 CDS), enabling genome-wide exploration and comparative analysis of codon usage patterns across species. ChloroMitoCU allows the phylogenetic comparison of codon usage patterns across organelle genomes, the prediction of codon usage patterns based on user-submitted transcripts or assembled organelle genes, and comparative analysis with the pre-compiled patterns across species of interest. ChloroMitoCU can increase our understanding of the biased patterns of codon usage in organelle genomes across multiple clades. ChloroMitoCU can be accessed at: http://chloromitocu.cgu.edu.tw/. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  4. Efficient Reassignment of a Frequent Serine Codon in Wild-Type Escherichia coli.

    PubMed

    Ho, Joanne M; Reynolds, Noah M; Rivera, Keith; Connolly, Morgan; Guo, Li-Tao; Ling, Jiqiang; Pappin, Darryl J; Church, George M; Söll, Dieter

    2016-02-19

    Expansion of the genetic code through engineering the translation machinery has greatly increased the chemical repertoire of the proteome. This has been accomplished mainly by read-through of UAG or UGA stop codons by the noncanonical aminoacyl-tRNA of choice. While stop codon read-through involves competition with the translation release factors, sense codon reassignment entails competition with a large pool of endogenous tRNAs. We used an engineered pyrrolysyl-tRNA synthetase to incorporate 3-iodo-l-phenylalanine (3-I-Phe) at a number of different serine and leucine codons in wild-type Escherichia coli. Quantitative LC-MS/MS measurements of amino acid incorporation yields carried out in a selected reaction monitoring experiment revealed that the 3-I-Phe abundance at the Ser208AGU codon in superfolder GFP was 65 ± 17%. This method also allowed quantification of other amino acids (serine, 33 ± 17%; phenylalanine, 1 ± 1%; threonine, 1 ± 1%) that compete with 3-I-Phe at both the aminoacylation and decoding steps of translation for incorporation at the same codon position. Reassignments of different serine (AGU, AGC, UCG) and leucine (CUG) codons with the matching tRNA(Pyl) anticodon variants were met with varying success, and our findings provide a guideline for the choice of sense codons to be reassigned. Our results indicate that the 3-iodo-l-phenylalanyl-tRNA synthetase (IFRS)/tRNA(Pyl) pair can efficiently outcompete the cellular machinery to reassign select sense codons in wild-type E. coli.

  5. KRAS exon 2 codon 13 mutation is associated with a better prognosis than codon 12 mutation following lung metastasectomy in colorectal cancer

    PubMed Central

    Renaud, Stéphane; Guerrera, Francesco; Seitlinger, Joseph; Costardi, Lorena; Schaeffer, Mickaël; Romain, Benoit; Mossetti, Claudio; Claire-Voegeli, Anne; Filosso, Pier Luigi; Legrain, Michèle; Ruffini, Enrico; Falcoz, Pierre-Emmanuel; Oliaro, Alberto; Massard, Gilbert

    2017-01-01

    Introduction The utilization of molecular markers as routinely used biomarkers is steadily increasing. We aimed to evaluate the potential different prognostic values of KRAS exon 2 codons 12 and 13 after lung metastasectomy in colorectal cancer (CRC). Results KRAS codon 12 mutations were observed in 116 patients (77%), whereas codon 13 mutations were observed in 34 patients (23%). KRAS codon 13 mutations were associated with both longer time to pulmonary recurrence (TTPR) (median TTPR: 78 months (95% CI: 50.61–82.56) vs 56 months (95% CI: 68.71–127.51), P = 0.008) and improved overall survival (OS) (median OS: 82 months vs 54 months (95% CI: 48.93–59.07), P = 0.009). Multivariate analysis confirmed that codon 13 mutations were associated with better outcomes (TTPR: HR: 0.40 (95% CI: 0.17–0.93), P = 0.033); OS: HR: 0.39 (95% CI: 0.14–1.07), P = 0.07). Otherwise, no significant difference in OS (P = 0.78) or TTPR (P = 0.72) based on the type of amino-acid substitutions was observed among KRAS codon 12 mutations. Materials and Methods We retrospectively reviewed data from 525 patients who underwent a lung metastasectomy for CRC in two departments of thoracic surgery from 1998 to 2015 and focused on 150 patients that had KRAS exon 2 codon 12/13 mutations. Conclusions KRAS exon 2 codon 13 mutations, compared to codon 12 mutations, seem to be associated with better outcomes following lung metastasectomy in CRC. Prospective multicenter studies are necessary to fully understand the prognostic value of KRAS mutations in the lung metastases of CRC. PMID:27911859

  6. Bicluster Pattern of Codon Context Usages between Flavivirus and Vector Mosquito Aedes aegypti: Relevance to Infection and Transcriptional Response of Mosquito Genes

    PubMed Central

    Behura, Susanta K.; Severson, David W.

    2014-01-01

    The mosquito Aedes aegypti is the primary vector of dengue virus (DENV) infection in most of the subtropical and tropical countries. Besides DENV, yellow fever virus (YFV) is also transmitted by A. aegypti. Susceptibility of A. aegypti to West Nile virus (WNV) has also been confirmed. Although studies have indicated correlation of codon bias between flaviviridae and their animal/insect hosts, it is not clear if codon sequences have any relation to susceptibility of A. aegypti to DENV, YFV and WNV. In the current study, usages of codon context sequences (codon pairs for neighboring amino acids) of the vector (A. aegypti) genome as well as the flaviviral genomes are investigated. We used bioinformatics methods to quantify codon context bias in a genome-wide manner of A. aegypti as well as DENV, WNV and YFV sequences. Mutual information statistics was applied to perform bicluster analysis of codon context bias between vector and flaviviral sequences. Functional relevance of the bicluster pattern was inferred from published microarray data. Our study shows that codon context bias of DENV, WNV and YFV sequences varies in a bicluster manner with that of specific sets of genes of A. aegypti. Many of these mosquito genes are known to be differentially expressed in response to flaviviral infection suggesting that codon context sequences of A. aegypti and the flaviviruses may play a role in the susceptible interaction between flaviviruses and this mosquito. The bias inusages of codon context sequences likely has a functional association with susceptibility of A. aegypti to flaviviral infection. The results from this study will allow us to conduct hypothesis driven tests to examine the role of codon contexts bias in evolution of vector-virus interactions at the molecular level. PMID:24838953

  7. Nonstructural proteins nsP3 and nsP4 of Ross River and O'Nyong-nyong viruses: sequence and comparison with those of other alphaviruses.

    PubMed

    Strauss, E G; Levinson, R; Rice, C M; Dalrymple, J; Strauss, J H

    1988-05-01

    We have sequenced the nsP3 and nsP4 region of two alphaviruses, Ross River virus and O'Nyong-nyong virus, in order to examine these viruses for the presence or absence of an opal termination codon present between nsP3 and nsP4 in many alphaviruses. We found that Ross River virus possesses an in-phase opal termination codon between nsP3 and nsP4, whereas in O'Nyong-nyong virus this termination codon is replaced by an arginine codon. Previous studies have shown that two other alphaviruses, Sindbis virus and Middelburg virus, possess an opal termination codon separating nsP3 and nsP4 [E.G. Strauss, C.M. Rice, and J.H. Strauss (1983), Proc. Natl. Acad. Sci. USA 80, 5271-5275], whereas Semliki Forest virus possesses an arginine codon in lieu of the opal codon [K. Takkinen (1986), Nucleic Acids Res. 14, 5667-5682]. Thus, of the five alphaviruses examined to date, three possess the opal codon and two do not. Production of nsP4 requires readthrough of the opal codon in those alphaviruses that possess this termination codon and the function of the termination codon may be to regulate the amount of nsP4 produced. It is an open question then as to whether alphaviruses with no termination codon use other mechanisms to regulate the activity of this gene. The nsP4s of these five alphaviruses are highly conserved, sharing 71-76% amino acid sequence similarity, and all five contain the Gly-Asp-Asp motif found in many RNA virus replicases. The nsP3s are somewhat less conserved, sharing 52-73% amino acid sequence similarity throughout most of the protein, but each possesses a nonconserved C-terminal domain of 134 to 246 amino acids of unknown function.

  8. Non-uniqueness of factors constraint on the codon usage in Bombyx mori.

    PubMed

    Jia, Xian; Liu, Shuyu; Zheng, Hao; Li, Bo; Qi, Qi; Wei, Lei; Zhao, Taiyi; He, Jian; Sun, Jingchen

    2015-05-06

    The analysis of codon usage is a good way to understand the genetic and evolutionary characteristics of an organism. However, there are only a few reports related with the codon usage of the domesticated silkworm, Bombyx mori (B. mori). Hence, the codon usage of B. mori was analyzed here to reveal the constraint factors and it could be helpful to improve the bioreactor based on B. mori. A total of 1,097 annotated mRNA sequences from B. mori were analyzed, revealing there is only a weak codon bias. It also shows that the gene expression level is related to the GC content, and the amino acids with higher general average hydropathicity (GRAVY) and aromaticity (Aromo). And the genes on the primary axis are strongly positively correlated with the GC content, and GC3s. Meanwhile, the effective number of codons (ENc) is strongly correlated with codon adaptation index (CAI), gene length, and Aromo values. However, the ENc values are correlated with the second axis, which indicates that the codon usage in B. mori is affected by not only mutation pressure and natural selection, but also nucleotide composition and the gene expression level. It is also associated with Aromo values, and gene length. Additionally, B. mori has a greater relative discrepancy in codon preferences with Drosophila melanogaster (D. melanogaster) or Saccharomyces cerevisiae (S. cerevisiae) than with Arabidopsis thaliana (A. thaliana), Escherichia coli (E. coli), or Caenorhabditis elegans (C. elegans). The codon usage bias in B. mori is relatively weak, and many influence factors are found here, such as nucleotide composition, mutation pressure, natural selection, and expression level. Additionally, it is also associated with Aromo values, and gene length. Among them, natural selection might play a major role. Moreover, the "optimal codons" of B. mori are all encoded by G and C, which provides useful information for enhancing the gene expression in B. mori through codon optimization.

  9. Proteomic identification of an embryo-specific 1Cys-Prx promoter and analysis of its activity in transgenic rice.

    PubMed

    Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh

    2011-04-29

    Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. [A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

    PubMed

    Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

    2003-01-01

    To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

  11. Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position

    PubMed Central

    Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y.; Tor, Yitzhak; Cooperman, Barry S.

    2017-01-01

    Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5′- and 3′-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix. PMID:28850078

  12. A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes.

    PubMed

    Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

    2016-07-01

    The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including "codon capture," "genome streamlining," and "ambiguous intermediate" theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNA(Ala) containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. © 2016 Mühlhausen et al.; Published by Cold Spring Harbor Laboratory Press.

  13. A Major Controversy in Codon-Anticodon Adaptation Resolved by a New Codon Usage Index

    PubMed Central

    Xia, Xuhua

    2015-01-01

    Two alternative hypotheses attribute different benefits to codon-anticodon adaptation. The first assumes that protein production is rate limited by both initiation and elongation and that codon-anticodon adaptation would result in higher elongation efficiency and more efficient and accurate protein production, especially for highly expressed genes. The second claims that protein production is rate limited only by initiation efficiency but that improved codon adaptation and, consequently, increased elongation efficiency have the benefit of increasing ribosomal availability for global translation. To test these hypotheses, a recent study engineered a synthetic library of 154 genes, all encoding the same protein but differing in degrees of codon adaptation, to quantify the effect of differential codon adaptation on protein production in Escherichia coli. The surprising conclusion that “codon bias did not correlate with gene expression” and that “translation initiation, not elongation, is rate-limiting for gene expression” contradicts the conclusion reached by many other empirical studies. In this paper, I resolve the contradiction by reanalyzing the data from the 154 sequences. I demonstrate that translation elongation accounts for about 17% of total variation in protein production and that the previous conclusion is due to the use of a codon adaptation index (CAI) that does not account for the mutation bias in characterizing codon adaptation. The effect of translation elongation becomes undetectable only when translation initiation is unrealistically slow. A new index of translation elongation ITE is formulated to facilitate studies on the efficiency and evolution of the translation machinery. PMID:25480780

  14. Exploring synonymous codon usage preferences of disulfide-bonded and non-disulfide bonded cysteines in the E. coli genome.

    PubMed

    Song, Jiangning; Wang, Minglei; Burrage, Kevin

    2006-07-21

    High-quality data about protein structures and their gene sequences are essential to the understanding of the relationship between protein folding and protein coding sequences. Firstly we constructed the EcoPDB database, which is a high-quality database of Escherichia coli genes and their corresponding PDB structures. Based on EcoPDB, we presented a novel approach based on information theory to investigate the correlation between cysteine synonymous codon usages and local amino acids flanking cysteines, the correlation between cysteine synonymous codon usages and synonymous codon usages of local amino acids flanking cysteines, as well as the correlation between cysteine synonymous codon usages and the disulfide bonding states of cysteines in the E. coli genome. The results indicate that the nearest neighboring residues and their synonymous codons of the C-terminus have the greatest influence on the usages of the synonymous codons of cysteines and the usage of the synonymous codons has a specific correlation with the disulfide bond formation of cysteines in proteins. The correlations may result from the regulation mechanism of protein structures at gene sequence level and reflect the biological function restriction that cysteines pair to form disulfide bonds. The results may also be helpful in identifying residues that are important for synonymous codon selection of cysteines to introduce disulfide bridges in protein engineering and molecular biology. The approach presented in this paper can also be utilized as a complementary computational method and be applicable to analyse the synonymous codon usages in other model organisms.

  15. Developmental stage related patterns of codon usage and genomic GC content: searching for evolutionary fingerprints with models of stem cell differentiation

    PubMed Central

    2007-01-01

    Background The usage of synonymous codons shows considerable variation among mammalian genes. How and why this usage is non-random are fundamental biological questions and remain controversial. It is also important to explore whether mammalian genes that are selectively expressed at different developmental stages bear different molecular features. Results In two models of mouse stem cell differentiation, we established correlations between codon usage and the patterns of gene expression. We found that the optimal codons exhibited variation (AT- or GC-ending codons) in different cell types within the developmental hierarchy. We also found that genes that were enriched (developmental-pivotal genes) or specifically expressed (developmental-specific genes) at different developmental stages had different patterns of codon usage and local genomic GC (GCg) content. Moreover, at the same developmental stage, developmental-specific genes generally used more GC-ending codons and had higher GCg content compared with developmental-pivotal genes. Further analyses suggest that the model of translational selection might be consistent with the developmental stage-related patterns of codon usage, especially for the AT-ending optimal codons. In addition, our data show that after human-mouse divergence, the influence of selective constraints is still detectable. Conclusion Our findings suggest that developmental stage-related patterns of gene expression are correlated with codon usage (GC3) and GCg content in stem cell hierarchies. Moreover, this paper provides evidence for the influence of natural selection at synonymous sites in the mouse genome and novel clues for linking the molecular features of genes to their patterns of expression during mammalian ontogenesis. PMID:17349061

  16. Distance between RBS and AUG plays an important role in overexpression of recombinant proteins.

    PubMed

    Berwal, Sunil K; Sreejith, R K; Pal, Jayanta K

    2010-10-15

    The spacing between ribosome binding site (RBS) and AUG is crucial for efficient overexpression of genes when cloned in prokaryotic expression vectors. We undertook a brief study on the overexpression of genes cloned in Escherichia coli expression vectors, wherein the spacing between the RBS and the start codon was varied. SDS-PAGE and Western blot analysis indicated a high level of protein expression only in constructs where the spacing between RBS and AUG was approximately 40 nucleotides or more, despite the synthesis of the transcripts in the representative cases investigated. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Two novel mutations in the Norrie disease gene associated with the classical ocular phenotype.

    PubMed

    Caballero, M; Veske, A; Rodriguez, J J; Lugo, N; Schroeder, B; Hesse, L; Gal, A

    1996-12-01

    Norrie disease (ND) is a rare X-linked recessive disorder characterized by congenital blindness due to a degenerative and proliferative dysplasia of the neuroretina and, occasionally, by deafness and mental handicap. Here, we report two novel mutations detected in patients with the classical eye features of ND. Both the one-base pair insertion in exon II (544/545 insA) and the two-base pair deletion in the start codon (418delTG) of the ND gene predict a functional 'null allele', i.e. the complete absence of the corresponding gene product.

  18. EUGENE'HOM: A generic similarity-based gene finder using multiple homologous sequences.

    PubMed

    Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

    2003-07-01

    EUGENE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGENE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGENE'HOM to handle sequences from a variety of organisms. The current target of EUGENE'HOM is plant sequences. The EUGENE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl.

  19. Characterization of codon usage pattern and influencing factors in Japanese encephalitis virus.

    PubMed

    Singh, Niraj K; Tyagi, Anuj; Kaur, Rajinder; Verma, Ramneek; Gupta, Praveen K

    2016-08-02

    Recently, several outbreaks of Japanese encephalitis (JE), caused by Japanese encephalitis virus (JEV), have been reported and it has become cause of concern across the world. In this study, detailed analysis of JEV codon usage pattern was performed. The relative synonymous codon usage (RSCU) values along with mean effective number of codons (ENC) value of 55.30 indicated the presence of low codon usages bias in JEV. The effect of mutational pressure on codon usage bias was confirmed by significant correlations of A3s, U3s, G3s, C3s, GC3s, ENC values, with overall nucleotide contents (A%, U%, G%, C%, and GC%). The correlation analysis of A3s, U3s, G3s, C3s, GC3s, with axis values of correspondence analysis (CoA) further confirmed the role of mutational pressure. However, the correlation analysis of Gravy values and Aroma values with A3s, U3s, G3s, C3s, and GC3s, indicated the presence of natural selection on codon usage bias in addition to mutational pressure. The natural selection was further confirmed by codon adaptation index (CAI) analysis. Additionally, relative dinucleotide frequencies, geographical distribution, and evolutionary processes also influenced the codon usage pattern to some extent. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Spawning chronology, nest site selection and nest success of smallmouth bass during benign streamflow conditions

    USGS Publications Warehouse

    Dauwalter, D.C.; Fisher, W.L.

    2007-01-01

    We documented the nesting chronology, nest site selection and nest success of smallmouth bass Micropterus dolomieu in an upstream (4th order) and downstream (5th order) reach of Baron Fork Creek, Oklahoma. Males started nesting in mid-Apr. when water temperatures increased to 16.9 C upstream, and in late-Apr. when temperatures increased to 16.2 C downstream. Streamflows were low (77% upstream to 82% downstream of mean Apr. streamflow, and 12 and 18% of meanjun. streamflow; 47 and 55 y of record), and decreased throughout the spawning period. Larger males nested first upstream, as has been observed in other populations, but not downstream. Upstream, progeny in 62 of 153 nests developed to swim-up stage. Downstream, progeny in 31 of 73 nests developed to swim-up. Nesting densities upstream (147/km) and downstream (100/km) were both higher than any densities previously reported. Males selected nest sites with intermediate water depths, low water velocity and near cover, behavior that is typical of smallmouth bass. Documented nest failures resulted from human disturbance, angling, and longear sunfish predation. Logistic exposure models showed that water velocity at the nest was negatively related and length of the guarding male was positively related to nest success upstream. Male length and number of degree days were both positively related to nest success downstream. Our results, and those of other studies, suggest that biological factors account for most nest failures during benign (stable, low flow) streamflow conditions, whereas nest failures attributed to substrate mobility or nest abandonment dominate when harsh streamflow conditions (spring floods) coincide with the spawning season.

  1. tRNA-mediated codon-biased translation in mycobacterial hypoxic persistence

    NASA Astrophysics Data System (ADS)

    Chionh, Yok Hian; McBee, Megan; Babu, I. Ramesh; Hia, Fabian; Lin, Wenwei; Zhao, Wei; Cao, Jianshu; Dziergowska, Agnieszka; Malkiewicz, Andrzej; Begley, Thomas J.; Alonso, Sylvie; Dedon, Peter C.

    2016-11-01

    Microbial pathogens adapt to the stress of infection by regulating transcription, translation and protein modification. We report that changes in gene expression in hypoxia-induced non-replicating persistence in mycobacteria--which models tuberculous granulomas--are partly determined by a mechanism of tRNA reprogramming and codon-biased translation. Mycobacterium bovis BCG responded to each stage of hypoxia and aerobic resuscitation by uniquely reprogramming 40 modified ribonucleosides in tRNA, which correlate with selective translation of mRNAs from families of codon-biased persistence genes. For example, early hypoxia increases wobble cmo5U in tRNAThr(UGU), which parallels translation of transcripts enriched in its cognate codon, ACG, including the DosR master regulator of hypoxic bacteriostasis. Codon re-engineering of dosR exaggerates hypoxia-induced changes in codon-biased DosR translation, with altered dosR expression revealing unanticipated effects on bacterial survival during hypoxia. These results reveal a coordinated system of tRNA modifications and translation of codon-biased transcripts that enhance expression of stress response proteins in mycobacteria.

  2. tRNA-mediated codon-biased translation in mycobacterial hypoxic persistence

    PubMed Central

    Chionh, Yok Hian; McBee, Megan; Babu, I. Ramesh; Hia, Fabian; Lin, Wenwei; Zhao, Wei; Cao, Jianshu; Dziergowska, Agnieszka; Malkiewicz, Andrzej; Begley, Thomas J.; Alonso, Sylvie; Dedon, Peter C.

    2016-01-01

    Microbial pathogens adapt to the stress of infection by regulating transcription, translation and protein modification. We report that changes in gene expression in hypoxia-induced non-replicating persistence in mycobacteria—which models tuberculous granulomas—are partly determined by a mechanism of tRNA reprogramming and codon-biased translation. Mycobacterium bovis BCG responded to each stage of hypoxia and aerobic resuscitation by uniquely reprogramming 40 modified ribonucleosides in tRNA, which correlate with selective translation of mRNAs from families of codon-biased persistence genes. For example, early hypoxia increases wobble cmo5U in tRNAThr(UGU), which parallels translation of transcripts enriched in its cognate codon, ACG, including the DosR master regulator of hypoxic bacteriostasis. Codon re-engineering of dosR exaggerates hypoxia-induced changes in codon-biased DosR translation, with altered dosR expression revealing unanticipated effects on bacterial survival during hypoxia. These results reveal a coordinated system of tRNA modifications and translation of codon-biased transcripts that enhance expression of stress response proteins in mycobacteria. PMID:27834374

  3. Codon optimization underpins generalist parasitism in fungi

    PubMed Central

    Badet, Thomas; Peyraud, Remi; Mbengue, Malick; Navaud, Olivier; Derbyshire, Mark; Oliver, Richard P; Barbacci, Adelin; Raffaele, Sylvain

    2017-01-01

    The range of hosts that parasites can infect is a key determinant of the emergence and spread of disease. Yet, the impact of host range variation on the evolution of parasite genomes remains unknown. Here, we show that codon optimization underlies genome adaptation in broad host range parasites. We found that the longer proteins encoded by broad host range fungi likely increase natural selection on codon optimization in these species. Accordingly, codon optimization correlates with host range across the fungal kingdom. At the species level, biased patterns of synonymous substitutions underpin increased codon optimization in a generalist but not a specialist fungal pathogen. Virulence genes were consistently enriched in highly codon-optimized genes of generalist but not specialist species. We conclude that codon optimization is related to the capacity of parasites to colonize multiple hosts. Our results link genome evolution and translational regulation to the long-term persistence of generalist parasitism. DOI: http://dx.doi.org/10.7554/eLife.22472.001 PMID:28157073

  4. Ribosomes slide on lysine-encoding homopolymeric A stretches

    PubMed Central

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  5. Synonymous codon changes in the oncogenes of the cottontail rabbit papillomavirus lead to increased oncogenicity and immunogenicity of the virus

    PubMed Central

    Cladel, Nancy M.; Budgeon, Lynn R.; Hu, Jiafen; Balogh, Karla K.; Christensen, Neil D.

    2013-01-01

    Papillomaviruses use rare codons with respect to the host. The reasons for this are incompletely understood but among the hypotheses is the concept that rare codons result in low protein production and this allows the virus to escape immune surveillance. We changed rare codons in the oncogenes E6 and E7 of the cottontail rabbit papillomavirus to make them more mammalian-like and tested the mutant genomes in our in vivo animal model. While the amino acid sequences of the proteins remained unchanged, the oncogenic potential of some of the altered genomes increased dramatically. In addition, increased immunogenicity, as measured by spontaneous regression, was observed as the numbers of codon changes increased. This work suggests that codon usage may modify protein production in ways that influence disease outcome and that evaluation of synonymous codons should be included in the analysis of genetic variants of infectious agents and their association with disease. PMID:23433866

  6. The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

    PubMed

    Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

    2005-07-01

    Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

  7. Deep intronic GPR143 mutation in a Japanese family with ocular albinism

    PubMed Central

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-01-01

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease. PMID:26061757

  8. Deep intronic GPR143 mutation in a Japanese family with ocular albinism.

    PubMed

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-06-10

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease.

  9. Nuclear localization of Merkel cell polyomavirus large T antigen in Merkel cell carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamura, Tomoyuki; Sato, Yuko; Watanabe, Daisuke

    2010-03-15

    To clarify whether mutations in the large T gene encoded by Merkel cell polyomavirus affect the expression and function of large T antigen in Merkel cell carcinoma cases, we investigated the expression of large T antigen in vitro and in vivo. Immunohistochemistry using a rabbit polyclonal antibody revealed that large T antigen was expressed in the nuclei of Merkel cell carcinoma cells with Merkel cell polyomavirus infection. Deletion mutant analyses identified an Arg-Lys-Arg-Lys sequence (amino acids 277-280) as a nuclear localization signal in large T antigen. Sequence analyses revealed that there were no mutations in the nuclear localization signal inmore » any of the eleven Merkel cell polyomavirus strains examined. Furthermore, stop codons were not observed in the upstream of the nuclear localization signal in any of the Merkel cell carcinoma cases examined. These data suggest that the nuclear localization signal is highly conserved and functional in Merkel cell carcinoma cases.« less

  10. DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

    PubMed Central

    Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

    1991-01-01

    The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

  11. Complete Mitochondrial Genome of the Red Fox (Vuples vuples) and Phylogenetic Analysis with Other Canid Species.

    PubMed

    Zhong, Hua-Ming; Zhang, Hong-Hai; Sha, Wei-Lai; Zhang, Cheng-De; Chen, Yu-Cai

    2010-04-01

    The whole mitochondrial genome sequence of red fox (Vuples vuples) was determined. It had a total length of 16 723 bp. As in most mammal mitochondrial genome, it contained 13 protein coding genes, two ribosome RNA genes, 22 transfer RNA genes and one control region. The base composition was 31.3% A, 26.1% C, 14.8% G and 27.8% T, respectively. The codon usage of red fox, arctic fox, gray wolf, domestic dog and coyote followed the same pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 3 gene in the red fox. A long tandem repeat rich in AC was found between conserved sequence block 1 and 2 in the control region. In order to confirm the phylogenetic relationships of red fox to other canids, phylogenetic trees were reconstructed by neighbor-joining and maximum parsimony methods using 12 concatenated heavy-strand protein-coding genes. The result indicated that arctic fox was the sister group of red fox and they both belong to the red fox-like clade in family Canidae, while gray wolf, domestic dog and coyote belong to wolf-like clade. The result was in accordance with existing phylogenetic results.

  12. Analysis of polyglutamine-coding repeats in the TATA-binding protein in different human populations and in patients with schizophrenia an bipolar affective disorder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rubinsztein, D.C.; Leggo, J.; Crow, T.J.

    A new class of disease (including Huntington disease, Kennedy disease, and spinocerebellar ataxias types 1 and 3) results from abnormal expansions of CAG trinucleotides in the coding regions of genes. In all of these diseases the CAG repeats are thought to be translated into polyglutamine tracts. There is accumulating evidence arguing for CAG trinucleotide expansions as one of the causative disease mutations in schizophrenia and bipolar affective disorder. We and others believe that the TATA-binding protein (TBP) is an important candidate to investigate in these diseases as it contains a highly polymorphic stretch of glutamine codons, which are close tomore » the threshold length where the polyglutamine tracts start to be associated with disease. Thus, we examined the lengths of this polyglutamine repeat in normal unrelated East Anglians, South African Blacks, sub-Saharan Africans mainly from Nigeria, and Asian Indians. We also examined 43 bipolar affective disorder patients and 65 schizophrenic patients. The range of polyglutamine tract-lengths that we found in humans was from 26-42 codons. No patients with bipolar affective disorder and schizophrenia had abnormal expansions at this locus. 22 refs., 1 tab.« less

  13. A single U/C nucleotide substitution changing alanine to valine in the beet necrotic yellow vein virus P25 protein promotes increased virus accumulation in roots of mechanically inoculated, partially resistant sugar beet seedlings.

    PubMed

    Koenig, R; Loss, S; Specht, J; Varrelmann, M; Lüddecke, P; Deml, G

    2009-03-01

    Beet necrotic yellow vein virus (BNYVV) A type isolates E12 and S8, originating from areas where resistance-breaking had or had not been observed, respectively, served as starting material for studying the influence of sequence variations in BNYVV RNA 3 on virus accumulation in partially resistant sugar beet varieties. Sub-isolates containing only RNAs 1 and 2 were obtained by serial local lesion passages; biologically active cDNA clones were prepared for RNAs 3 which differed in their coding sequences for P25 aa 67, 68 and 129. Sugar beet seedlings were mechanically inoculated with RNA 1+2/RNA 3 pseudorecombinants. The origin of RNAs 1+2 had little influence on virus accumulation in rootlets. E12 RNA 3 coding for V(67)C(68)Y(129) P25, however, enabled a much higher virus accumulation than S8 RNA 3 coding for A(67)H(68)H(129) P25. Mutants revealed that this was due only to the V(67) 'GUU' codon as opposed to the A(67) 'GCU' codon.

  14. The mitochondrial genome of Cethosia biblis (Drury) (Lepidoptera: Nymphalidae).

    PubMed

    Xin, Tianrong; Li, Lei; Yao, Chengyi; Wang, Yayu; Zou, Zhiwen; Wang, Jing; Xia, Bin

    2016-07-01

    We present the complete mitogenome of Cethosia biblis (Drury) (Lepidoptera: Nymphalidae) in this article. The mitogenome was a circle molecular consisting of 15,286 nucleotides, 37 genes, and an A + T-rich region. The order of 37 genes was typical of insect mitochondrial DNA sequences described to date. The overall base composition of the genome is A (37.41%), T (42.80%), C (11.87%), and G (7.91%) with an A + T-rich hallmark as that of other invertebrate mitochondrial genomes. The start codon was mainly ATA in most of the mitochondrial protein-coding genes such as ND2, COI, ATP8, ND3, ND5, ND4, ND6, and ND1, but COII, ATP6, COIII, ND4L, and Cob genes employing ATG. The stop codon was TAA in all the protein-coding genes. The A + T region is located between 12S rRNA and tRNA(M)(et). The phylogenetic relationships of Lepidoptera species were constructed based on the nucleotides sequences of 13 PCGs of mitogenomes using the neighbor-joining method. The molecular-based phylogeny supported the traditional morphological classification on relationships within Lepidoptera species.

  15. Complete mitochondrial genome of Taharana fasciana (Insecta, Hemiptera: Cicadellidae) and comparison with other Cicadellidae insects.

    PubMed

    Wang, Jiajia; Li, Hu; Dai, Renhuai

    2017-12-01

    Here, we describe the first complete mitochondrial genome (mitogenome) sequence of the leafhopper Taharana fasciana (Coelidiinae). The mitogenome sequence contains 15,161 bp with an A + T content of 77.9%. It includes 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one non-coding (A + T-rich) region; in addition, a repeat region is also present (GenBank accession no. KY886913). These genes/regions are in the same order as in the inferred insect ancestral mitogenome. All protein-coding genes have ATN as the start codon, and TAA or single T as the stop codons, except the gene ND3, which ends with TAG. Furthermore, we predicted the secondary structures of the rRNAs in T. fasciana. Six domains (domain III is absent in arthropods) and 41 helices were predicted for 16S rRNA, and 12S rRNA comprised three structural domains and 24 helices. Phylogenetic tree analysis confirmed that T. fasciana and other members of the Cicadellidae are clustered into a clade, and it identified the relationships among the subfamilies Deltocephalinae, Coelidiinae, Idiocerinae, Cicadellinae, and Typhlocybinae.

  16. The expression of full length Gp91-phox protein is associated with reduced amphotropic retroviral production.

    PubMed

    Bellantuono, I; Lashford, L S; Rafferty, J A; Fairbairn, L J

    2000-05-01

    As a single gene defect in mature bone marrow cells, chronic granulomatous disease (X-CGD) represents a disorder which may be amenable to gene therapy by the transfer of the missing subunit into hemopoietic stem cells. In the majority of cases lack of Gp91-phox causes the disease. So far, studies involving transfer of Gp91-phox cDNA, including a phase I clinical trial, have yielded disappointing results. Most often, low titers of virus have been reported. In the present study we investigated the possible reasons for low titer amphotropic viral production. To investigate the effect of Gp91 cDNA on the efficiency of retroviral production from the packaging cell line, GP+envAm12, we constructed vectors containing either the native cDNA, truncated versions of the cDNA or a mutated form (LATG) in which the natural translational start codon was changed to a stop codon. Following derivation of clonal packaging cell lines, these were assessed for viral titer by RNA slot blot and analyzed by non-parametrical statistical analysis (Whitney-Mann U-test). An improvement in viral titer of just over two-fold was found in packaging cells containing the start-codon mutant of Gp91 and no evidence of truncated viral RNA was seen in these cells. Further analysis revealed the presence of rearranged forms of the provirus in Gp91-expressing cells, and the production of truncated, unpackaged viral RNA. Protein analysis revealed that LATG-transduced cells did not express full-length Gp91-phox, whereas those containing the wild-type cDNA did. However, a truncated protein was seen in ATG-transduced cells which was also present in wild type cells. No evidence for the presence of a negative transcriptional regulatory element was found from studies with the deletion mutants. A statistically significant effect of protein production on the production of virus from Gp91-expressing cells was found. Our data point to a need to restrict expression of the Gp91-phox protein and its derivatives in order to enhance retroviral production and suggest that improvements in current vectors for CGD gene therapy may need to include controlled, directed expression only in mature neutrophils.

  17. Genetic, immunological, and clinical features of patients with bacterial and fungal infections due to inherited IL-17RA deficiency

    PubMed Central

    Lévy, Romain; Okada, Satoshi; Béziat, Vivien; Moriya, Kunihiko; Liu, Caini; Chai, Louis Yi Ann; Migaud, Mélanie; Hauck, Fabian; Al Ali, Amein; Cyrus, Cyril; Vatte, Chittibabu; Patiroglu, Turkan; Unal, Ekrem; Ferneiny, Marie; Hyakuna, Nobuyuki; Nepesov, Serdar; Oleastro, Matias; Ikinciogullari, Aydan; Dogu, Figen; Asano, Takaki; Ohara, Osamu; Yun, Ling; Della Mina, Erika; Bronnimann, Didier; Itan, Yuval; Gothe, Florian; Bustamante, Jacinta; Boisson-Dupuis, Stéphanie; Tahuil, Natalia; Aytekin, Caner; Salhi, Aicha; Al Muhsen, Saleh; Kobayashi, Masao; Toubiana, Julie; Abel, Laurent; Li, Xiaoxia; Camcioglu, Yildiz; Celmeli, Fatih; Klein, Christoph; AlKhater, Suzan A.; Casanova, Jean-Laurent; Puel, Anne

    2016-01-01

    Chronic mucocutaneous candidiasis (CMC) is defined as recurrent or persistent infection of the skin, nails, and/or mucosae with commensal Candida species. The first genetic etiology of isolated CMC—autosomal recessive (AR) IL-17 receptor A (IL-17RA) deficiency—was reported in 2011, in a single patient. We report here 21 patients with complete AR IL-17RA deficiency, including this first patient. Each patient is homozygous for 1 of 12 different IL-17RA alleles, 8 of which create a premature stop codon upstream from the transmembrane domain and have been predicted and/or shown to prevent expression of the receptor on the surface of circulating leukocytes and dermal fibroblasts. Three other mutant alleles create a premature stop codon downstream from the transmembrane domain, one of which encodes a surface-expressed receptor. Finally, the only known missense allele (p.D387N) also encodes a surface-expressed receptor. All of the alleles tested abolish cellular responses to IL-17A and -17F homodimers and heterodimers in fibroblasts and to IL-17E/IL-25 in leukocytes. The patients are currently aged from 2 to 35 y and originate from 12 unrelated kindreds. All had their first CMC episode by 6 mo of age. Fourteen patients presented various forms of staphylococcal skin disease. Eight were also prone to various bacterial infections of the respiratory tract. Human IL-17RA is, thus, essential for mucocutaneous immunity to Candida and Staphylococcus, but otherwise largely redundant. A diagnosis of AR IL-17RA deficiency should be considered in children or adults with CMC, cutaneous staphylococcal disease, or both, even if IL-17RA is detected on the cell surface. PMID:27930337

  18. Development of an efficient genetic manipulation strategy for sequential gene disruption and expression of different heterologous GFP genes in Candida tropicalis.

    PubMed

    Zhang, Lihua; Chen, Xianzhong; Chen, Zhen; Wang, Zezheng; Jiang, Shan; Li, Li; Pötter, Markus; Shen, Wei; Fan, You

    2016-11-01

    The diploid yeast Candida tropicalis, which can utilize n-alkane as a carbon and energy source, is an attractive strain for both physiological studies and practical applications. However, it presents some characteristics, such as rare codon usage, difficulty in sequential gene disruption, and inefficiency in foreign gene expression, that hamper strain improvement through genetic engineering. In this work, we present a simple and effective method for sequential gene disruption in C. tropicalis based on the use of an auxotrophic mutant host defective in orotidine monophosphate decarboxylase (URA3). The disruption cassette, which consists of a functional yeast URA3 gene flanked by a 0.3 kb gene disruption auxiliary sequence (gda) direct repeat derived from downstream or upstream of the URA3 gene and of homologous arms of the target gene, was constructed and introduced into the yeast genome by integrative transformation. Stable integrants were isolated by selection for Ura + and identified by PCR and sequencing. The important feature of this construct, which makes it very attractive, is that recombination between the flanking direct gda repeats occurs at a high frequency (10 -8 ) during mitosis. After excision of the URA3 marker, only one copy of the gda sequence remains at the recombinant locus. Thus, the resulting ura3 strain can be used again to disrupt a second allelic gene in a similar manner. In addition to this effective sequential gene disruption method, a codon-optimized green fluorescent protein-encoding gene (GFP) was functionally expressed in C. tropicalis. Thus, we propose a simple and reliable method to improve C. tropicalis by genetic manipulation.

  19. JGH Foundation emerging leadership lecture. Significance of hepatitis B virus genotypes and mutations in the development of hepatocellular carcinoma in Asia.

    PubMed

    Chan, Henry Lik-Yuen

    2011-01-01

    Advances in molecular biology technology in the last two decades have allowed detailed study of the viral mutations and genomic heterogeneity of hepatitis B virus (HBV). The first mutant discovered was precore stop codon mutation. It was reported in HBeAg-negative patients and initially thought to associate with fulminant hepatitis. Subsequent studies have suggested that it is merely one of the mechanisms of losing HBeAg by the virus. Another mutation that can downregulate the production of HBeAg is the basal core promoter mutation, which is located in the X gene upstream of the precore region. Based on the configuration of codon 15 and the stability of the epsilon of the precore region, these two mutants will be differentially selected during the course of HBeAg seroconversion. The most common HBV genotypes in South-East Asia are genotype B and C HBV. The higher hepatocellular carcinoma (HCC) risk of genotype C HBV has been confirmed by longitudinal studies in Hong Kong and Taiwan. One possible carcinogenic mechanism is its association with basal core promoter mutation, which has also been found to be a risk factor of HCC. Within genotype C HBV, subgenotype Cs is predominant in South-East Asia and subgenotype Ce is predominant in East Asia. Subgenotype Ce HBV has been found to have the highest risk of HCC as compared with subgenotype Cs or genotype B HBV. The understanding of the carcinogenic mechanisms of these HBV strains may shed light into future therapeutics in the prevention and treatment of HBV-related HCC. © 2010 Journal of Gastroenterology and Hepatology Foundation and Blackwell Publishing Asia Pty Ltd.

  20. Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

    PubMed Central

    Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

    2014-01-01

    Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

  1. Evolutionary characterization of Tembusu virus infection through identification of codon usage patterns.

    PubMed

    Zhou, Hao; Yan, Bing; Chen, Shun; Wang, Mingshu; Jia, Renyong; Cheng, Anchun

    2015-10-01

    Tembusu virus (TMUV) is a single-stranded, positive-sense RNA virus. As reported, TMUV infection has resulted in significant poultry losses, and the virus may also pose a threat to public health. To characterize TMUV evolutionarily and to understand the factors accounting for codon usage properties, we performed, for the first time, a comprehensive analysis of codon usage bias for the genomes of 60 TMUV strains. The most recently published TMUV strains were found to be widely distributed in coastal cities of southeastern China. Codon preference among TMUV genomes exhibits a low bias (effective number of codons (ENC)=53.287) and is maintained at a stable level. ENC-GC3 plots and the high correlation between composition constraints and principal component factor analysis of codon usage demonstrated that mutation pressure dominates over natural selection pressure in shaping the TMUV coding sequence composition. The high correlation between the major components of the codon usage pattern and hydrophobicity (Gravy) or aromaticity (Aromo) was obvious, indicating that properties of viral proteins also account for the observed variation in TMUV codon usage. Principal component analysis (PCA) showed that CQW1 isolated from Chongqing may have evolved from GX2013H or GX2013G isolated from Guangxi, thus indicating that TMUV likely disseminated from southeastern China to the mainland. Moreover, the preferred codons encoding eight amino acids were consistent with the optimal codons for human cells, indicating that TMUV may pose a threat to public health due to possible cross-species transmission (birds to birds or birds to humans). The results of this study not only have theoretical value for uncovering the characteristics of synonymous codon usage patterns in TMUV genomes but also have significant meaning with regard to the molecular evolutionary tendencies of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Preferences of AAA/AAG codon recognition by modified nucleosides, τm5s2U34 and t6A37 present in tRNALys.

    PubMed

    Sonawane, Kailas D; Kamble, Asmita S; Fandilolu, Prayagraj M

    2017-12-27

    Deficiency of 5-taurinomethyl-2-thiouridine, τm 5 s 2 U at the 34th 'wobble' position in tRNA Lys causes MERRF (Myoclonic Epilepsy with Ragged Red Fibers), a neuromuscular disease. This modified nucleoside of mt tRNA Lys , recognizes AAA/AAG codons during protein biosynthesis process. Its preference to identify cognate codons has not been studied at the atomic level. Hence, multiple MD simulations of various molecular models of anticodon stem loop (ASL) of mt tRNA Lys in presence and absence of τm 5 s 2 U 34 and N 6 -threonylcarbamoyl adenosine (t 6 A 37 ) along with AAA and AAG codons have been accomplished. Additional four MD simulations of multiple ASL mt tRNA Lys models in the context of ribosomal A-site residues have also been performed to investigate the role of A-site in recognition of AAA/AAG codons. MD simulation results show that, ASL models in presence of τm 5 s 2 U 34 and t 6 A 37 with codons AAA/AAG are more stable than the ASL lacking these modified bases. MD trajectories suggest that τm 5 s 2 U recognizes the codons initially by 'wobble' hydrogen bonding interactions, and then tRNA Lys might leave the explicit codon by a novel 'single' hydrogen bonding interaction in order to run the protein biosynthesis process smoothly. We propose this model as the 'Foot-Step Model' for codon recognition, in which the single hydrogen bond plays a crucial role. MD simulation results suggest that, tRNA Lys with τm 5 s 2 U and t 6 A recognizes AAA codon more preferably than AAG. Thus, these results reveal the consequences of τm 5 s 2 U and t 6 A in recognition of AAA/AAG codons in mitochondrial disease, MERRF.

  3. Numeral series hidden in the distribution of atomic mass of amino acids to codon domains in the genetic code.

    PubMed

    Wohlin, Åsa

    2015-03-21

    The distribution of codons in the nearly universal genetic code is a long discussed issue. At the atomic level, the numeral series 2x(2) (x=5-0) lies behind electron shells and orbitals. Numeral series appear in formulas for spectral lines of hydrogen. The question here was if some similar scheme could be found in the genetic code. A table of 24 codons was constructed (synonyms counted as one) for 20 amino acids, four of which have two different codons. An atomic mass analysis was performed, built on common isotopes. It was found that a numeral series 5 to 0 with exponent 2/3 times 10(2) revealed detailed congruency with codon-grouped amino acid side-chains, simultaneously with the division on atom kinds, further with main 3rd base groups, backbone chains and with codon-grouped amino acids in relation to their origin from glycolysis or the citrate cycle. Hence, it is proposed that this series in a dynamic way may have guided the selection of amino acids into codon domains. Series with simpler exponents also showed noteworthy correlations with the atomic mass distribution on main codon domains; especially the 2x(2)-series times a factor 16 appeared as a conceivable underlying level, both for the atomic mass and charge distribution. Furthermore, it was found that atomic mass transformations between numeral systems, possibly interpretable as dimension degree steps, connected the atomic mass of codon bases with codon-grouped amino acids and with the exponent 2/3-series in several astonishing ways. Thus, it is suggested that they may be part of a deeper reference system. Copyright © 2015 The Author. Published by Elsevier Ltd.. All rights reserved.

  4. Compositional pressure and translational selection determine codon usage in the extremely GC-poor unicellular eukaryote Entamoeba histolytica.

    PubMed

    Romero, H; Zavala, A; Musto, H

    2000-01-25

    It is widely accepted that the compositional pressure is the only factor shaping codon usage in unicellular species displaying extremely biased genomic compositions. This seems to be the case in the prokaryotes Mycoplasma capricolum, Rickettsia prowasekii and Borrelia burgdorferi (GC-poor), and in Micrococcus luteus (GC-rich). However, in the GC-poor unicellular eukaryotes Dictyostelium discoideum and Plasmodium falciparum, there is evidence that selection, acting at the level of translation, influences codon choices. This is a twofold intriguing finding, since (1) the genomic GC levels of the above mentioned eukaryotes are lower than the GC% of any studied bacteria, and (2) bacteria usually have larger effective population sizes than eukaryotes, and hence natural selection is expected to overcome more efficiently the randomizing effects of genetic drift among prokaryotes than among eukaryotes. In order to gain a new insight about this problem, we analysed the patterns of codon preferences of the nuclear genes of Entamoeba histolytica, a unicellular eukaryote characterised by an extremely AT-rich genome (GC = 25%). The overall codon usage is strongly biased towards A and T in the third codon positions, and among the presumed highly expressed sequences, there is an increased relative usage of a subset of codons, many of which are C-ending. Since an increase in C in third codon positions is 'against' the compositional bias, we conclude that codon usage in E. histolytica, as happens in D. discoideum and P. falciparum, is the result of an equilibrium between compositional pressure and selection. These findings raise the question of why strongly compositionally biased eukaryotic cells may be more sensitive to the (presumed) slight differences among synonymous codons than compositionally biased bacteria.

  5. Bacterial genomes lacking long-range correlations may not be modeled by low-order Markov chains: the role of mixing statistics and frame shift of neighboring genes.

    PubMed

    Cocho, Germinal; Miramontes, Pedro; Mansilla, Ricardo; Li, Wentian

    2014-12-01

    We examine the relationship between exponential correlation functions and Markov models in a bacterial genome in detail. Despite the well known fact that Markov models generate sequences with correlation function that decays exponentially, simply constructed Markov models based on nearest-neighbor dimer (first-order), trimer (second-order), up to hexamer (fifth-order), and treating the DNA sequence as being homogeneous all fail to predict the value of exponential decay rate. Even reading-frame-specific Markov models (both first- and fifth-order) could not explain the fact that the exponential decay is very slow. Starting with the in-phase coding-DNA-sequence (CDS), we investigated correlation within a fixed-codon-position subsequence, and in artificially constructed sequences by packing CDSs with out-of-phase spacers, as well as altering CDS length distribution by imposing an upper limit. From these targeted analyses, we conclude that the correlation in the bacterial genomic sequence is mainly due to a mixing of heterogeneous statistics at different codon positions, and the decay of correlation is due to the possible out-of-phase between neighboring CDSs. There are also small contributions to the correlation from bases at the same codon position, as well as by non-coding sequences. These show that the seemingly simple exponential correlation functions in bacterial genome hide a complexity in correlation structure which is not suitable for a modeling by Markov chain in a homogeneous sequence. Other results include: use of the (absolute value) second largest eigenvalue to represent the 16 correlation functions and the prediction of a 10-11 base periodicity from the hexamer frequencies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Influence of Forced Flow on the Dendritic Growth of Fe-C Alloy: 3D vs 2D Simulation

    NASA Astrophysics Data System (ADS)

    Wang, Weiling; Wang, Zhaohui; Luo, Sen; Ji, Cheng; Zhu, Miaoyong

    2017-12-01

    A 3D parallel cellular automaton-finite volume method (CA-FVM) model was used to simulate the equiaxed dendritic growth of an Fe-0.82 wt pct C alloy with xy- in- out and xyz- in- out type forced flows and the columnar dendritic growth with y- in- out type forced flow. In addition, the similarities and differences between the results of the 3D and 2D models are discussed and summarized in detail. The capabilities of the 3D and 2D CA-FVM models to predict the dendritic growth of the alloy with forced flow are validated through comparison with the boundary layer correction and Oseen-Ivanstov models, respectively. Because the forced flow can pass around perpendicular arms of the dendrites, the secondary arms at the sides upstream from the perpendicular arms are more developed than those on the upstream side of the upstream arms, especially at higher inlet velocities. In addition, compared to the xy- in- out case, the growth of the downstream arms is less inhibited and the secondary arms are more developed in the xyz- in- out case because of the greater lateral flow around their tips. Compared to the 3D case, the 2D equiaxed dendrites are more asymmetrical and lack secondary arms because of the thicker solute envelope. In the 3D case, the columnar dendrites on the upstream side (left one) are promoted, while the middle and downstream dendrites are inhibited in sequence. However, the sequential inhibition starts on the upstream side in the 2D case. This is mainly because the melt can pass around the upstream branch in 3D space. However, it can only climb over the upstream tip in 2D space. Additionally, the secondary arms show upstream development, which is more significant with increasing inlet velocity. The level of development of the secondary arms is also affected by the decay of the forced flow in the flow direction.

  7. Species Based Synonymous Codon Usage in Fusion Protein Gene of Newcastle Disease Virus

    PubMed Central

    Kumar, Chandra Shekhar; Kumar, Sachin

    2014-01-01

    Newcastle disease is highly pathogenic to poultry and many other avian species. However, the Newcastle disease virus (NDV) has also been reported from many non-avian species. The NDV fusion protein (F) is a major determinant of its pathogenicity and virulence. The functionalities of F gene have been explored for the development of vaccine and diagnostics against NDV. Although the F protein is well studied but the codon usage and its nucleotide composition from NDV isolated from different species have not yet been explored. In present study, we have analyzed the factors responsible for the determination of codon usage in NDV isolated from four major avian host species. The F gene of NDV is analyzed for its base composition and its correlation with the bias in codon usage. Our result showed that random mutational pressure is responsible for codon usage bias in F protein of NDV isolates. Aromaticity, GC3s, and aliphatic index were not found responsible for species based synonymous codon usage bias in F gene of NDV. Moreover, the low amount of codon usage bias and expression level was further confirmed by a low CAI value. The phylogenetic analysis of isolates was found in corroboration with the relatedness of species based on codon usage bias. The relationship between the host species and the NDV isolates from the host does not represent a significant correlation in our study. The present study provides a basic understanding of the mechanism involved in codon usage among species. PMID:25479071

  8. An integrated, structure- and energy-based view of the genetic code.

    PubMed

    Grosjean, Henri; Westhof, Eric

    2016-09-30

    The principles of mRNA decoding are conserved among all extant life forms. We present an integrative view of all the interaction networks between mRNA, tRNA and rRNA: the intrinsic stability of codon-anticodon duplex, the conformation of the anticodon hairpin, the presence of modified nucleotides, the occurrence of non-Watson-Crick pairs in the codon-anticodon helix and the interactions with bases of rRNA at the A-site decoding site. We derive a more information-rich, alternative representation of the genetic code, that is circular with an unsymmetrical distribution of codons leading to a clear segregation between GC-rich 4-codon boxes and AU-rich 2:2-codon and 3:1-codon boxes. All tRNA sequence variations can be visualized, within an internal structural and energy framework, for each organism, and each anticodon of the sense codons. The multiplicity and complexity of nucleotide modifications at positions 34 and 37 of the anticodon loop segregate meaningfully, and correlate well with the necessity to stabilize AU-rich codon-anticodon pairs and to avoid miscoding in split codon boxes. The evolution and expansion of the genetic code is viewed as being originally based on GC content with progressive introduction of A/U together with tRNA modifications. The representation we present should help the engineering of the genetic code to include non-natural amino acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Organization of tcp, acf, and toxT genes within a ToxT-dependent operon.

    PubMed

    Brown, R C; Taylor, R K

    1995-05-01

    The toxin coregulated pilus (TCP) is required for Vibrio cholerae to colonize the human intestine. The expression of the pilin gene, tcpA, is dependent upon ToxR and upon ToxT. The toxT gene was recently mapped within the TCP biogenesis gene cluster and shown to be capable of activating a tcpA::TnphoA fusion when cloned in Escherichia coli. In this study, we determined that ToxR/ToxT activation occurs at the level of tcpA transcription. ToxT expressed in E. coli could activate a tcp operon fusion, while ToxR, ToxR with ToxS, or a ToxR-PhoA fusion failed to activate the tcp operon fusion and we could not demonstrate binding of a ToxR extract to the tcpA promoter region in DNA mobility-shift assays. The start site for the regulated promoter was shown by primer extension to lie 75 bp upstream of the first codon of tcpA. An 800-base tcpA message was identified, by Northern analysis, that correlates by size to the distance between the transcriptional start and a hairpin-loop sequence between tcpA and tcpB. The more-sensitive assay of RNase protection analysis demonstrated that a regulated transcript probably extends through the rest of the downstream tcp genes, including toxT and the adjacent accessory colonization factor (acf) genes. An in-frame tcpA deletion, but not a polar tcpA::TnphoA fusion, could be complemented for pilus surface expression by providing tcpA in trans. This evidence suggests that the tcp genes, including toxT, are organized in an operon directly activated by ToxT in a ToxR-dependent manner. Most of the toxT expression under induced conditions requires transcription of the tcpA promoter. Further investigation of how tcp::TnphoA insertions that are polar on toxT expression retain regulation showed that a low basal level of toxT expression is present in toxR and tcp::TnphoA strains. Overall, these observations support the ToxR/ToxT cascade of regulation for tcp. Once induced, toxT expression becomes autoregulatory via the tcp promoter, linking tcp expression to that of additional colonization factors, exotoxin production, and genes of unknown function in cholera pathogenesis.

  10. Codon usage bias and tRNA over-expression in Buchnera aphidicola after aromatic amino acid nutritional stress on its host Acyrthosiphon pisum

    PubMed Central

    Charles, Hubert; Calevro, Federica; Vinuelas, José; Fayard, Jean-Michel; Rahbe, Yvan

    2006-01-01

    Codon usage bias and relative abundances of tRNA isoacceptors were analysed in the obligate intracellular symbiotic bacterium, Buchnera aphidicola from the aphid Acyrthosiphon pisum, using a dedicated 35mer oligonucleotide microarray. Buchnera is archetypal of organisms living with minimal metabolic requirements and presents a reduced genome with high-evolutionary rate. Codonusage in Buchnera has been overcome by the high mutational bias towards AT bases. However, several lines of evidence for codon usage selection are given here. A significant correlation was found between tRNA relative abundances and codon composition of Buchnera genes. A significant codon usage bias was found for the choice of rare codons in Buchnera: C-ending codons are preferred in highly expressed genes, whereas G-ending codons are avoided. This bias is not explained by GC skew in the bacteria and might correspond to a selection for perfect matching between codon–anticodon pairs for some essential amino acids in Buchnera proteins. Nutritional stress applied to the aphid host induced a significant overexpression of most of the tRNA isoacceptors in bacteria. Although, molecular regulation of the tRNA operons in Buchnera was not investigated, a correlation between relative expression levels and organization in transcription unit was found in the genome of Buchnera. PMID:16963497

  11. Three stages during the evolution of the genetic code. [Abstract only

    NASA Technical Reports Server (NTRS)

    Baumann, U.; Oro, J.

    1994-01-01

    A diversification of the genetic code based on the number of codons available for the proteinous amino acids is established. Three groups of amino acids during evolution of the code are distinguished. On the basis of their chemical complexity and a small codon number those amino acids emerging later in a translation process are derived. Both criteria indicate that His, Phe, Tyr, Cys and either Lys or Asn were introduced in the second stage, whereas the number of codons alone gives evidence that Trp and Met were introduced in the third stage. The amino acids of stage one use purines rich codons, thus purines have been retained in their third codon position. All the amino acids introduced in the second stage, in contrast, use pyrimidines in this codon position. A low abundance of pyrimidines during early translation is derived. This assumption is supported by experiments on non enzymatic replication and interactions of DNA hairpin loops with a complementary strand. A back extrapolation concludes a high purine content of the first nucleic acids which gradually decreased during their evolution. Amino acids independently available form prebiotic synthesis were thus correlated to purine rich codons. Conclusions on prebiotic replication are discussed also in the light of recent codon usage data.

  12. Relative codon adaptation: a generic codon bias index for prediction of gene expression.

    PubMed

    Fox, Jesse M; Erill, Ivan

    2010-06-01

    The development of codon bias indices (CBIs) remains an active field of research due to their myriad applications in computational biology. Recently, the relative codon usage bias (RCBS) was introduced as a novel CBI able to estimate codon bias without using a reference set. The results of this new index when applied to Escherichia coli and Saccharomyces cerevisiae led the authors of the original publications to conclude that natural selection favours higher expression and enhanced codon usage optimization in short genes. Here, we show that this conclusion was flawed and based on the systematic oversight of an intrinsic bias for short sequences in the RCBS index and of biases in the small data sets used for validation in E. coli. Furthermore, we reveal that how the RCBS can be corrected to produce useful results and how its underlying principle, which we here term relative codon adaptation (RCA), can be made into a powerful reference-set-based index that directly takes into account the genomic base composition. Finally, we show that RCA outperforms the codon adaptation index (CAI) as a predictor of gene expression when operating on the CAI reference set and that this improvement is significantly larger when analysing genomes with high mutational bias.

  13. Traveling waves in a continuum model of 1D schools

    NASA Astrophysics Data System (ADS)

    Oza, Anand; Kanso, Eva; Shelley, Michael

    2017-11-01

    We construct and analyze a continuum model of a 1D school of flapping swimmers. Our starting point is a delay differential equation that models the interaction between a swimmer and its upstream neighbors' wakes, which is motivated by recent experiments in the Applied Math Lab at NYU. We coarse-grain the evolution equations and derive PDEs for the swimmer density and variables describing the upstream wake. We study the equations both analytically and numerically, and find that a uniform density of swimmers destabilizes into a traveling wave. Our model makes a number of predictions about the properties of such traveling waves, and sheds light on the role of hydrodynamics in mediating the structure of swimming schools.

  14. Mapping the subgenomic RNA promoter of the Citrus leaf blotch virus coat protein gene by Agrobacterium-mediated inoculation.

    PubMed

    Renovell, Agueda; Gago, Selma; Ruiz-Ruiz, Susana; Velázquez, Karelia; Navarro, Luis; Moreno, Pedro; Vives, Mari Carmen; Guerri, José

    2010-10-25

    Citrus leaf blotch virus has a single-stranded positive-sense genomic RNA (gRNA) of 8747 nt organized in three open reading frames (ORFs). The ORF1, encoding a polyprotein involved in replication, is translated directly from the gRNA, whereas ORFs encoding the movement (MP) and coat (CP) proteins are expressed via 3' coterminal subgenomic RNAs (sgRNAs). We characterized the minimal promoter region critical for the CP-sgRNA expression in infected cells by deletion analyses using Agrobacterium-mediated infection of Nicotiana benthamiana plants. The minimal CP-sgRNA promoter was mapped between nucleotides -67 and +50 nt around the transcription start site. Surprisingly, larger deletions in the region between the CP-sgRNA transcription start site and the CP translation initiation codon resulted in increased CP-sgRNA accumulation, suggesting that this sequence could modulate the CP-sgRNA transcription. Site-specific mutational analysis of the transcription start site revealed that the +1 guanylate and the +2 adenylate are important for CP-sgRNA synthesis. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. 78 FR 34258 - Safety Zone; Salvage Operations at Marseilles Dam; Illinois River

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-07

    ...-AA00 Safety Zone; Salvage Operations at Marseilles Dam; Illinois River AGENCY: Coast Guard, DHS. ACTION... Illinois River starting at Mile Marker 246.9 and extending 600 yards upstream of the Marseilles Dam to Mile... repair efforts at the Marseilles Dam. This safety zone is necessary to protect the general public...

  16. [Genetic diversity and genetic structure of endangered wild Sinopodophyllum emodi by start codon targeted polymorphism].

    PubMed

    Chen, Da-Xia; Zhao, Ji-Feng; Liu, Xiang; Wang, Chang-Hua; Zhang, Zhi-Wei; Qin, Song-Yun; Zhong, Guo-Yue

    2013-01-01

    Revealed the genetic diversity level and genetic structure characteristics in Sinopodophyllum emodi, a rare and endangered species in China. We detected the genetic polymorphism within and among six wild populations (45 individuals) by the approach of Start Codon Targeted (SCoT) Polymorphism. The associated genetic parameters were calculated by POP-GENE1.31 and the relationship was constructed based on UPGMA method. A total of 350 bands were scored by 27 primers and 284 bands of them were polymorphic. The average polymorphic bands of each primer were 10.52. At species level, there was a high level of genetic diversity among six populations (PPB = 79.27%, N(e) = 1.332 7, H = 0.210 9 and H(sp) = 0.328 6). At population level, the genetic diversity level was low (PPB = 10.48% (4.00% -23.71%), N(e) = 1.048 7 (1.020 7-1.103 7), H = 0.029 7 (0.012 9-0.063 1), H(pop) = 0.046 2 (0.019 9-0.098 6). The Nei's coefficient of genetic differentiation was 0.841 1, which was consistent with the Shannon's coefficient of genetic differentiation (0.849 4). Two calculated methods all showed that most of the genetic variation existed among populations. The gene flow (N(m) = 0.094 4) was less among populations, indicating that the degree of genetic differentiation was higher. Genetic similarity coefficient were changed from 0.570 8 to 0.978 7. By clustering analysis, the tested populations were divided into two classes and had a tendency that the same geographical origin or material of similar habitats clustered into one group. The genetic diversity of samples of S. emodi is high,which laid a certain foundation for effective protection and improvement of germplasm resources.

  17. Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

    PubMed

    Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

    2018-01-26

    Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

  18. A common class of transcripts with 5'-intron depletion, distinct early coding sequence features, and N1-methyladenosine modification.

    PubMed

    Cenik, Can; Chua, Hon Nian; Singh, Guramrit; Akef, Abdalla; Snyder, Michael P; Palazzo, Alexander F; Moore, Melissa J; Roth, Frederick P

    2017-03-01

    Introns are found in 5' untranslated regions (5'UTRs) for 35% of all human transcripts. These 5'UTR introns are not randomly distributed: Genes that encode secreted, membrane-bound and mitochondrial proteins are less likely to have them. Curiously, transcripts lacking 5'UTR introns tend to harbor specific RNA sequence elements in their early coding regions. To model and understand the connection between coding-region sequence and 5'UTR intron status, we developed a classifier that can predict 5'UTR intron status with >80% accuracy using only sequence features in the early coding region. Thus, the classifier identifies transcripts with 5 ' proximal- i ntron- m inus-like-coding regions ("5IM" transcripts). Unexpectedly, we found that the early coding sequence features defining 5IM transcripts are widespread, appearing in 21% of all human RefSeq transcripts. The 5IM class of transcripts is enriched for non-AUG start codons, more extensive secondary structure both preceding the start codon and near the 5' cap, greater dependence on eIF4E for translation, and association with ER-proximal ribosomes. 5IM transcripts are bound by the exon junction complex (EJC) at noncanonical 5' proximal positions. Finally, N 1 -methyladenosines are specifically enriched in the early coding regions of 5IM transcripts. Taken together, our analyses point to the existence of a distinct 5IM class comprising ∼20% of human transcripts. This class is defined by depletion of 5' proximal introns, presence of specific RNA sequence features associated with low translation efficiency, N 1 -methyladenosines in the early coding region, and enrichment for noncanonical binding by the EJC. © 2017 Cenik et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. Association between mismatch repair gene MSH3 codons 1036 and 222 polymorphisms and sporadic prostate cancer in the Iranian population.

    PubMed

    Jafary, Fariba; Salehi, Mansoor; Sedghi, Maryam; Nouri, Nayereh; Jafary, Farzaneh; Sadeghi, Farzaneh; Motamedi, Shima; Talebi, Maede

    2012-01-01

    The mismatch repair system (MMR) is a post-replicative DNA repair mechanism whose defects can lead to cancer. The MSH3 protein is an essential component of the system. We postulated that MSH3 gene polymorphisms might therefore be associated with prostate cancer (PC). We studied MSH3 codon 222 and MSH3 codon 1036 polymorphisms in a group of Iranian sporadic PC patients. A total of 60 controls and 18 patients were assessed using the polymerase chain reaction and single strand conformational polymorphism. For comparing the genotype frequencies of patients and controls the chi-square test was applied. The obtained result indicated that there was significantly association between G/A genotype of MSH3 codon 222 and G/G genotype of MSH3 codon 1036 with an increased PC risk (P=0.012 and P=0.02 respectively). Our results demonstrated that MSH3 codon 222 and MSH3 codon 1036 polymorphisms may be risk factors for sporadic prostate cancer in the Iranian population.

  20. Molecular and biochemical characterization of two tungsten- and selenium-containing formate dehydrogenases from Eubacterium acidaminophilum that are associated with components of an iron-only hydrogenase.

    PubMed

    Graentzdoerffer, Andrea; Rauh, David; Pich, Andreas; Andreesen, Jan R

    2003-01-01

    Two gene clusters encoding similar formate dehydrogenases (FDH) were identified in Eubacterium acidaminophilum. Each cluster is composed of one gene coding for a catalytic subunit ( fdhA-I, fdhA-II) and one for an electron-transferring subunit ( fdhB-I, fdhB-II). Both fdhA genes contain a TGA codon for selenocysteine incorporation and the encoded proteins harbor five putative iron-sulfur clusters in their N-terminal region. Both FdhB subunits resemble the N-terminal region of FdhA on the amino acid level and contain five putative iron-sulfur clusters. Four genes thought to encode the subunits of an iron-only hydrogenase are located upstream of the FDH gene cluster I. By sequence comparison, HymA and HymB are predicted to contain one and four iron-sulfur clusters, respectively, the latter protein also binding sites for FMN and NAD(P). Thus, HymA and HymB seem to represent electron-transferring subunits, and HymC the putative catalytic subunit containing motifs for four iron-sulfur clusters and one H-cluster specific for Fe-only hydrogenases. HymD has six predicted transmembrane helices and might be an integral membrane protein. Viologen-dependent FDH activity was purified from serine-grown cells of E. acidaminophilum and the purified protein complex contained four subunits, FdhA and FdhB, encoded by FDH gene cluster II, and HymA and HymB, identified after determination of their N-terminal sequences. Thus, this complex might represent the most simple type of a formate hydrogen lyase. The purified formate dehydrogenase fraction contained iron, tungsten, a pterin cofactor, and zinc, but no molybdenum. FDH-II had a two-fold higher K(m) for formate (0.37 mM) than FDH-I and also catalyzed CO(2) reduction to formate. Reverse transcription (RT)-PCR pointed to increased expression of FDH-II in serine-grown cells, supporting the isolation of this FDH isoform. The fdhA-I gene was expressed as inactive protein in Escherichia coli. The in-frame UGA codon for selenocysteine incorporation was read in the heterologous system only as stop codon, although its potential SECIS element exhibited a quite high similarity to that of E. coli FDH.

  1. Reducing codon redundancy and screening effort of combinatorial protein libraries created by saturation mutagenesis.

    PubMed

    Kille, Sabrina; Acevedo-Rocha, Carlos G; Parra, Loreto P; Zhang, Zhi-Gang; Opperman, Diederik J; Reetz, Manfred T; Acevedo, Juan Pablo

    2013-02-15

    Saturation mutagenesis probes define sections of the vast protein sequence space. However, even if randomization is limited this way, the combinatorial numbers problem is severe. Because diversity is created at the codon level, codon redundancy is a crucial factor determining the necessary effort for library screening. Additionally, due to the probabilistic nature of the sampling process, oversampling is required to ensure library completeness as well as a high probability to encounter all unique variants. Our trick employs a special mixture of three primers, creating a degeneracy of 22 unique codons coding for the 20 canonical amino acids. Therefore, codon redundancy and subsequent screening effort is significantly reduced, and a balanced distribution of codon per amino acid is achieved, as demonstrated exemplarily for a library of cyclohexanone monooxygenase. We show that this strategy is suitable for any saturation mutagenesis methodology to generate less-redundant libraries.

  2. Diverse expression levels of two codon-optimized genes that encode human papilloma virus type 16 major protein L1 in Hansenula polymorpha.

    PubMed

    Liu, Cunbao; Yang, Xu; Yao, Yufeng; Huang, Weiwei; Sun, Wenjia; Ma, Yanbing

    2014-05-01

    Two versions of an optimized gene that encodes human papilloma virus type 16 major protein L1 were designed according to the codon usage frequency of Pichia pastoris. Y16 was highly expressed in both P. pastoris and Hansenula polymorpha. M16 expression was as efficient as that of Y16 in P. pastoris, but merely detectable in H. polymorpha even though transcription levels of M16 and Y16 were similar. H. polymorpha had a unique codon usage frequency that contains many more rare codons than Saccharomyces cerevisiae or P. pastoris. These findings indicate that even codon-optimized genes that are expressed well in S. cerevisiae and P. pastoris may be inefficiently expressed in H. polymorpha; thus rare codons must be avoided when universal optimized gene versions are designed to facilitate expression in a variety of yeast expression systems, especially H. polymorpha is involved.

  3. Evolutionary conservation of codon optimality reveals hidden signatures of cotranslational folding.

    PubMed

    Pechmann, Sebastian; Frydman, Judith

    2013-02-01

    The choice of codons can influence local translation kinetics during protein synthesis. Whether codon preference is linked to cotranslational regulation of polypeptide folding remains unclear. Here, we derive a revised translational efficiency scale that incorporates the competition between tRNA supply and demand. Applying this scale to ten closely related yeast species, we uncover the evolutionary conservation of codon optimality in eukaryotes. This analysis reveals universal patterns of conserved optimal and nonoptimal codons, often in clusters, which associate with the secondary structure of the translated polypeptides independent of the levels of expression. Our analysis suggests an evolved function for codon optimality in regulating the rhythm of elongation to facilitate cotranslational polypeptide folding, beyond its previously proposed role of adapting to the cost of expression. These findings establish how mRNA sequences are generally under selection to optimize the cotranslational folding of corresponding polypeptides.

  4. Mean velocities and Reynolds stresses upstream of a simulated wing-fuselage juncture

    NASA Technical Reports Server (NTRS)

    Mcmahon, H.; Hubbartt, J.; Kubendran, L. R.

    1983-01-01

    Values of three mean velocity components and six turbulence stresses measured in a turbulent shear layer upstream of a simulated wing-fuselage juncture and immediately downstream of the start of the juncture are presented nd discussed. Two single-sensor hot-wire probes were used in the measurements. The separated region just upstream of the wing contains an area of reversed flow near the fuselage surface where the turbulence level is high. Outside of this area the flow skews as it passes around the body, and in this skewed region the magnitude and distribution of the turbulent normal and shear stresses within the shear layer are modified slightly by the skewing and deceleration of the flow. A short distance downstream of the wing leading edge the secondary flow vortext is tightly rolled up and redistributes both mean flow and turbulence in the juncture. The data acquisition technique employed here allows a hot wire to be used in a reversed flow region to indicate flow direction.

  5. Codon usage bias and phylogenetic analysis of mitochondrial ND1 gene in pisces, aves, and mammals.

    PubMed

    Uddin, Arif; Choudhury, Monisha Nath; Chakraborty, Supriyo

    2018-01-01

    The mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 1 (MT-ND1) gene is a subunit of the respiratory chain complex I and involved in the first step of the electron transport chain of oxidative phosphorylation (OXPHOS). To understand the pattern of compositional properties, codon usage and expression level of mitochondrial ND1 genes in pisces, aves, and mammals, we used bioinformatic approaches as no work was reported earlier. In this study, a perl script was used for calculating nucleotide contents and different codon usage bias parameters. The codon usage bias of MT-ND1 was low but the expression level was high as revealed from high ENC and CAI value. Correspondence analysis (COA) suggests that the pattern of codon usage for MT-ND1 gene is not same across species and that compositional constraint played an important role in codon usage pattern of this gene among pisces, aves, and mammals. From the regression equation of GC12 on GC3, it can be inferred that the natural selection might have played a dominant role while mutation pressure played a minor role in influencing the codon usage patterns. Further, ND1 gene has a discrepancy with cytochrome B (CYB) gene in preference of codons as evident from COA. The codon usage bias was low. It is influenced by nucleotide composition, natural selection, mutation pressure, length (number) of amino acids, and relative dinucleotide composition. This study helps in understanding the molecular biology, genetics, evolution of MT-ND1 gene, and also for designing a synthetic gene.

  6. Codon usage and expression level of human mitochondrial 13 protein coding genes across six continents.

    PubMed

    Chakraborty, Supriyo; Uddin, Arif; Mazumder, Tarikul Huda; Choudhury, Monisha Nath; Malakar, Arup Kumar; Paul, Prosenjit; Halder, Binata; Deka, Himangshu; Mazumder, Gulshana Akthar; Barbhuiya, Riazul Ahmed; Barbhuiya, Masuk Ahmed; Devi, Warepam Jesmi

    2017-12-02

    The study of codon usage coupled with phylogenetic analysis is an important tool to understand the genetic and evolutionary relationship of a gene. The 13 protein coding genes of human mitochondria are involved in electron transport chain for the generation of energy currency (ATP). However, no work has yet been reported on the codon usage of the mitochondrial protein coding genes across six continents. To understand the patterns of codon usage in mitochondrial genes across six different continents, we used bioinformatic analyses to analyze the protein coding genes. The codon usage bias was low as revealed from high ENC value. Correlation between codon usage and GC3 suggested that all the codons ending with G/C were positively correlated with GC3 but vice versa for A/T ending codons with the exception of ND4L and ND5 genes. Neutrality plot revealed that for the genes ATP6, COI, COIII, CYB, ND4 and ND4L, natural selection might have played a major role while mutation pressure might have played a dominant role in the codon usage bias of ATP8, COII, ND1, ND2, ND3, ND5 and ND6 genes. Phylogenetic analysis indicated that evolutionary relationships in each of 13 protein coding genes of human mitochondria were different across six continents and further suggested that geographical distance was an important factor for the origin and evolution of 13 protein coding genes of human mitochondria. Copyright © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  7. Overcoming codon bias: a method for high-level overexpression of Plasmodium and other AT-rich parasite genes in Escherichia coli.

    PubMed

    Baca, A M; Hol, W G

    2000-02-01

    Parasite genes often use codons which are rarely used in the highly expressed genes of Escherichia coli, possibly resulting in translational stalling and lower yields of recombinant protein. We have constructed the "RIG" plasmid to overcome the potential codon-bias problem seen in Plasmodium genes. RIG contains the genes that encode three tRNAs (Arg, Ile, Gly), which recognise rare codons found in parasite genes. When co-transformed into E. coli along with expression plasmids containing parasite genes, RIG can greatly increase levels of overexpressed protein. Codon frequency analysis suggests that RIG may be applied to a variety of protozoan and helminth genes.

  8. Cloning and Expression of the Erwinia carotovora subsp. carotovora Gene Encoding the Low-Molecular-Weight Bacteriocin Carocin S1▿

    PubMed Central

    Chuang, Duen-yau; Chien, Yung-chei; Wu, Huang-Pin

    2007-01-01

    The purpose of this study was to clone the carocin S1 gene and express it in a non-carocin-producing strain of Erwinia carotovora. A mutant, TH22-10, which produced a high-molecular-weight bacteriocin but not a low-molecular-weight bacteriocin, was obtained by Tn5 insertional mutagenesis using H-rif-8-2 (a spontaneous rifampin-resistant mutant of Erwinia carotovora subsp. carotovora 89-H-4). Using thermal asymmetric interlaced PCR, the DNA sequence from the Tn5 insertion site and the DNA sequence of the contiguous 2,280-bp region were determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequence fragment. ORF2 and ORF3 were identified with the carocin S1 genes, caroS1K (ORF2) and caroS1I (ORF3), which, respectively, encode a killing protein (CaroS1K) and an immunity protein (CaroS1I). These genes were homologous to the pyocin S3 gene and the pyocin AP41 gene. Carocin S1 was expressed in E. carotovora subsp. carotovora Ea1068 and replicated in TH22-10 but could not be expressed in Escherichia coli (JM101) because a consensus sequence resembling an SOS box was absent. A putative sequence similar to the consensus sequence for the E. coli cyclic AMP receptor protein binding site (−312 bp) was found upstream of the start codon. Production of this bacteriocin was also induced by glucose and lactose. The homology search results indicated that the carocin S1 gene (between bp 1078 and bp 1704) was homologous to the pyocin S3 and pyocin AP41 genes in Pseudomonas aeruginosa. These genes encode proteins with nuclease activity (domain 4). This study found that carocin S1 also has nuclease activity. PMID:17071754

  9. Spontaneous mutations of the UDP-glucose:flavonoid 3-O-glucosyltransferase gene confers pale- and dull-colored flowers in the Japanese and common morning glories.

    PubMed

    Morita, Yasumasa; Ishiguro, Kanako; Tanaka, Yoshikazu; Iida, Shigeru; Hoshino, Atsushi

    2015-09-01

    UDP-glucose:flavonoid 3- O -glucosyltransferase is essential for maintaining proper production quantity, acylation, and glucosylation of anthocyanin, and defects cause pale and dull flower pigmentation in morning glories. The Japanese (Ipomoea nil) and the common (I. purpurea) morning glory display bright blue and dark purple flowers, respectively. These flowers contain acylated and glucosylated anthocyanin pigments, and a number of flower color mutants have been isolated in I. nil. Of these, the duskish mutants of I. nil produce pale- and dull-colored flowers. We found that the Duskish gene encodes UDP-glucose:flavonoid 3-O-glucosyltransferase (3GT). The duskish-1 mutation is a frameshift mutation caused by a 4-bp insertion, and duskish-2 is an insertion of a DNA transposon, Tpn10, at 1.3 kb upstream of the 3GT start codon. In the duskish-2 mutant, excision of Tpn10 is responsible for restoration of the expression of the 3GT gene. The recombinant 3GT protein displays expected 3GT enzymatic activities to catalyze 3-O-glucosylation of anthocyanidins in vitro. Anthocyanin analysis of a duskish-2 mutant and its germinal revertant showing pale and normal pigmented flowers, respectively, revealed that the mutation caused around 80 % reduction of anthocyanin accumulation. We further characterized two I. purpurea mutants showing pale brownish-red flowers, and found that they carry the same frameshift mutation in the 3GT gene. Most of the flower anthocyanins in the mutants were previously found to be anthocyanidin 3-O-glucosides lacking several caffeic acid and glucose moieties that are attached to the anthocyanins in the wild-type plants. These results indicated that 3GT is essential not only for production, but also for proper acylation and glucosylation, of anthocyanin in the morning glories.

  10. Characteristic mutations found in the ML0411 gene of Mycobacterium leprae isolated in Northeast Asian countries.

    PubMed

    Kai, M; Nakata, N; Matsuoka, M; Sekizuka, T; Kuroda, M; Makino, M

    2013-10-01

    Genome analysis of Mycobacterium leprae strain Kyoto-2 in this study revealed characteristic nucleotide substitutions in gene ML0411, compared to the reference genome M. leprae strain TN. The ML0411 gene of Kyoto-2 had six SNPs compared to that of TN. All SNPs in ML0411 were non-synonymous mutations that result in amino acid replacements. In addition, a seventh SNP was found 41 bp upstream of the start codon in the regulatory region. The seven SNP sites in the ML0411 region were investigated by sequencing in 36 M. leprae isolates from the Leprosy Research Center in Japan. The SNP pattern in 14 of the 36 isolates showed similarity to that of Kyoto-2. Determination of the standard SNP types within the 36 stocked isolates revealed that almost all of the Japanese strains belonged to SNP type III, with nucleotide substitutions at position 14676, 164275, and 2935685 of the M. leprae TN genome. The geographical distribution pattern of east Asian M. leprae isolates by discrimination of ML0411 SNPs was investigated and interestingly turned out to be similar to that of tandem repeat numbers of GACATC in the rpoT gene (3 copies or 4 copies), which has been established as a tool for M. leprae genotyping. All seven Korean M. leprae isolates examined in this study, as well as those derived from Honshu Island of Japan, showed 4 copies of the 6-base tandem repeat plus the ML0411 SNPs observed in M. leprae Kyoto-2. They are termed Northeast Asian (NA) strain of M. leprae. On the other hand, many of isolates derived from the Okinawa Islands of Japan and from the Philippines showed 3 copies of the 6-base tandem repeat in addition to the M. leprae TN ML0411 type of SNPs. These results demonstrate the existence of M. leprae strains in Northeast Asian region having characteristic SNP patterns. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing ofmore » an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.« less

  12. Molecular characterization of phosphorylcholine expression on the lipooligosaccharide of Histophilus somni.

    PubMed

    Elswaifi, Shaadi F; St Michael, Frank; Sreenivas, Avula; Cox, Andrew; Carman, George M; Inzana, Thomas J

    2009-10-01

    Histophilus somni (Haemophilus somnus) is an important pathogen of cattle that is responsible for respiratory disease, septicemia, and systemic diseases such as thrombotic meningoencephalitis, myocarditis, and abortion. A variety of virulence factors have been identified in H. somni, including compositional and antigenic variation of the lipooligosaccharide (LOS). Phosphorylcholine (ChoP) has been identified as one of the components of H. somni LOS that undergoes antigenic variation. In this study, five genes (lic1ABCD(Hs) and glpQ) with homology to genes responsible for ChoP expression in Haemophilus influenzae LOS were identified in the H. somni genome. An H. somni open reading frame (ORF) with homology to H. influenzae lic1A (lic1A(Hi)) contained a variable number of tandem repeats (VNTR). However, whereas the tetranucleotide repeat 5'-CAAT-3' is present in lic1A(Hi), the VNTR in H. somni lic1A (lic1A(Hs)) consisted of 5'-AACC-3'. Due to the propensity of VNTR to vary during replication and cause the ORF to shift in and out of frame with the upstream start codon, the VNTR were deleted from lic1A(Hs) to maintain the gene constitutively on. This construct was cloned into Escherichia coli, and functional enzyme assays confirmed that lic1A(Hs) encoded a choline kinase, and that the VNTR were not required for expression of a functional gene product. Variation in the number of VNTR in lic1A(Hs) correlated with antigenic variation of ChoP expression in H. somni strain 124P. However, antigenic variation of ChoP expression in strain 738 predominately occurred through variable extension/truncation of the LOS outer core. These results indicated that the lic1(Hs) genes controlled expression of ChoP on the LOS, but that in H. somni there are two potential mechanisms that account for antigenic variation of ChoP.

  13. Molecular characterization of phosphorylcholine expression on the lipooligosaccharide of Histophilus somni

    PubMed Central

    Elswaifi, Shaadi F.; St. Michael, Frank; Sreenivas, Avula; Cox, Andrew; Carman, George M.; Inzana, Thomas J.

    2013-01-01

    Histophilus somni (Haemophilus somnus) is an important pathogen of cattle that is responsible for respiratory disease, septicemia, and systemic diseases such as thrombotic meningoencephalitis, myocarditis, and abortion. A variety of virulence factors have been identified in H. somni, including compositional and antigenic variation of the lipooligosaccharide (LOS). Phosphorylcholine (ChoP) has been identified as one of the components of H. somni LOS that undergoes antigenic variation. In this study, five genes (lic1ABCDHs and glpQ) with homology to genes responsible for ChoP expression in Haemophilus influenzae LOS were identified in the H. somni genome. An H. somni open reading frame (ORF) with homology to H. influenzae lic1A (lic1AHi) contained a variable number of tandem repeats (VNTR). However, whereas the tetranucleotide repeat 5′-CAAT-3′ is present in lic1AHi, the VNTR in H. somni lic1A (lic1AHs) consisted of 5′-AACC-3′. Due to the propensity of VNTR to vary during replication and cause the ORF to shift in and out of frame with the upstream start codon, the VNTR were deleted from lic1AHs to maintain the gene constitutively on. This construct was cloned into Escherichia coli, and functional enzyme assays confirmed that lic1AHs encoded a choline kinase, and that the VNTR were not required for expression of a functional gene product. Variation in the number of VNTR in lic1AHs correlated with antigenic variation of ChoP expression in H. somni strain 124P. However, antigenic variation of ChoP expression in strain 738 predominately occurred through variable extension/truncation of the LOS outer core. These results indicated that the lic1Hs genes controlled expression of ChoP on the LOS, but that in H. somni there are two potential mechanisms that account for antigenic variation of ChoP. PMID:19682567

  14. Soybean Salt Tolerance 1 (GmST1) Reduces ROS Production, Enhances ABA Sensitivity, and Abiotic Stress Tolerance in Arabidopsis thaliana.

    PubMed

    Ren, Shuxin; Lyle, Chimera; Jiang, Guo-Liang; Penumala, Abhishek

    2016-01-01

    Abiotic stresses, including high soil salinity, significantly reduce crop production worldwide. Salt tolerance in plants is a complex trait and is regulated by multiple mechanisms. Understanding the mechanisms and dissecting the components on their regulatory pathways will provide new insights, leading to novel strategies for the improvement of salt tolerance in agricultural and economic crops of importance. Here we report that soybean salt tolerance 1, named GmST1, exhibited strong tolerance to salt stress in the Arabidopsis transgenic lines. The GmST1-overexpressed Arabidopsis also increased sensitivity to ABA and decreased production of reactive oxygen species under salt stress. In addition, GmST1 significantly improved drought tolerance in Arabidopsis transgenic lines. GmST1 belongs to a 3-prime part of Glyma.03g171600 gene in the current version of soybean genome sequence annotation. However, comparative reverse transcription-polymerase chain reaction analysis around Glyma.03g171600 genomic region confirmed that GmST1 might serve as an intact gene in soybean leaf tissues. Unlike Glyma.03g171600 which was not expressed in leaves, GmST1 was strongly induced by salt treatment in the leaf tissues. By promoter analysis, a TATA box was detected to be positioned close to GmST1 start codon and a putative ABRE and a DRE cis-acting elements were identified at about 1 kb upstream of GmST1 gene. The data also indicated that GmST1-transgenic lines survived under drought stress and showed a significantly lower water loss than non-transgenic lines. In summary, our results suggest that overexpression of GmST1 significantly improves Arabidopsis tolerance to both salt and drought stresses and the gene may be a potential candidate for genetic engineering of salt- and drought-tolerant crops.

  15. Molecular Characterization and Regulation of the aguBA Operon, Responsible for Agmatine Utilization in Pseudomonas aeruginosa PAO1

    PubMed Central

    Nakada, Yuji; Jiang, Ying; Nishijyo, Takayuki; Itoh, Yoshifumi; Lu, Chung-Dar

    2001-01-01

    Pseudomonas aeruginosa PAO1 utilizes agmatine as the sole carbon and nitrogen source via two reactions catalyzed successively by agmatine deiminase (encoded by aguA; also called agmatine iminohydrolase) and N-carbamoylputrescine amidohydrolase (encoded by aguB). The aguBA and adjacent aguR genes were cloned and characterized. The predicted AguB protein (Mr 32,759; 292 amino acids) displayed sequence similarity (≤60% identity) to enzymes of the β-alanine synthase/nitrilase family. While the deduced AguA protein (Mr 41,190; 368 amino acids) showed no significant similarity to any protein of known function, assignment of agmatine deiminase to AguA in this report discovered a new family of carbon-nitrogen hydrolases widely distributed in organisms ranging from bacteria to Arabidopsis. The aguR gene encoded a putative regulatory protein (Mr 24,424; 221 amino acids) of the TetR protein family. Measurements of agmatine deiminase and N-carbamoylputrescine amidohydrolase activities indicated the induction effect of agmatine and N-carbamoylputrescine on expression of the aguBA operon. The presence of an inducible promoter for the aguBA operon in the aguR-aguB intergenic region was demonstrated by lacZ fusion experiments, and the transcription start of this promoter was localized 99 bp upstream from the initiation codon of aguB by S1 nuclease mapping. Experiments with knockout mutants of aguR established that expression of the aguBA operon became constitutive in the aguR background. Interaction of AguR overproduced in Escherichia coli with the aguBA regulatory region was demonstrated by gel retardation assays, supporting the hypothesis that AguR serves as the negative regulator of the aguBA operon, and binding of agmatine and N-carbamoylputrescine to AguR would antagonize its repressor function. PMID:11673419

  16. Cloning and pharmacological characterization of the rabbit bradykinin B2 receptor.

    PubMed

    Bachvarov, D R; Saint-Jacques, E; Larrivée, J F; Levesque, L; Rioux, F; Drapeau, G; Marceau, F

    1995-12-01

    Degenerate primers, corresponding to consensus sequences of third and sixth transmembrane domains of G protein-coupled receptor superfamily, were used for the polymerase chain reaction amplification and consecutive characterization of G protein-coupled receptors present in cultured rabbit aortic smooth muscle cells. One of the isolated resulting fragments was highly homologous to the corresponding region of the bradykinin (BK) B2 receptor cloned in other species. The polymerase chain reaction fragment was used to screen a rabbit genomic library, which allowed the identification of an intronless 1101-nucleotide open reading frame which codes for a 367-amino acid receptor protein. The rabbit B2 receptor sequence is more than 80% identical to the ones determined in three other species and retain putative glycosylation, palmitoylation and phosphorylation sites. In the rabbit genomic sequence, an acceptor splice sequence was found 8 base pairs upstream of the start codon. Northern blot analysis showed a high expression of a major transcript (4.2 kilobases) in the rabbit kidney and duodenum, and a less abundant expression in other tissues. Southern blot experiments suggest that a single copy of this gene exists in the rabbit genome. The cloned rabbit B2 receptor expressed in COS-1 cells binds [3H]BK in a saturable manner (KD 2.1 nM) and this ligand competes with a series of kinin agonists and antagonist with a rank order consistent with the B2 receptor identity. The insurmountable character of the antagonism exerted by Hoe 140 against BK on the rabbit B2 receptor, previously shown in pharmacological experiments, was confirmed in binding experiments with the cloned receptor expressed in a controlled manner. By contrast, Hoe 140 competed with [3H]BK in a surmountable manner for the human B2 receptor expressed in COS-1 cells. The cloning of the rabbit B2 receptor will be useful notably for the study of the structural basis of antagonist binding and for studies on receptor regulation in a relatively large animal.

  17. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

  18. A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia.

    PubMed

    Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi

    2017-01-01

    We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.

  19. Interaction of the Transcription Start Site Core Region and Transcription Factor YY1 Determine Ascorbate Transporter SVCT2 Exon 1a Promoter Activity

    PubMed Central

    Qiao, Huan; May, James M.

    2012-01-01

    Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872

  20. Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

    PubMed

    O'Sullivan, D J; O'Gara, F

    1991-08-01

    An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

  1. Codon Optimization of the Human Papillomavirus E7 Oncogene Induces a CD8+ T Cell Response to a Cryptic Epitope Not Harbored by Wild-Type E7

    PubMed Central

    Lorenz, Felix K. M.; Wilde, Susanne; Voigt, Katrin; Kieback, Elisa; Mosetter, Barbara; Schendel, Dolores J.; Uckert, Wolfgang

    2015-01-01

    Codon optimization of nucleotide sequences is a widely used method to achieve high levels of transgene expression for basic and clinical research. Until now, immunological side effects have not been described. To trigger T cell responses against human papillomavirus, we incubated T cells with dendritic cells that were pulsed with RNA encoding the codon-optimized E7 oncogene. All T cell receptors isolated from responding T cell clones recognized target cells expressing the codon-optimized E7 gene but not the wild type E7 sequence. Epitope mapping revealed recognition of a cryptic epitope from the +3 alternative reading frame of codon-optimized E7, which is not encoded by the wild type E7 sequence. The introduction of a stop codon into the +3 alternative reading frame protected the transgene product from recognition by T cell receptor gene-modified T cells. This is the first experimental study demonstrating that codon optimization can render a transgene artificially immunogenic through generation of a dominant cryptic epitope. This finding may be of great importance for the clinical field of gene therapy to avoid rejection of gene-corrected cells and for the design of DNA- and RNA-based vaccines, where codon optimization may artificially add a strong immunogenic component to the vaccine. PMID:25799237

  2. Influence of certain forces on evolution of synonymous codon usage bias in certain species of three basal orders of aquatic insects.

    PubMed

    Selva Kumar, C; Nair, Rahul R; Sivaramakrishnan, K G; Ganesh, D; Janarthanan, S; Arunachalam, M; Sivaruban, T

    2012-12-01

    Forces that influence the evolution of synonymous codon usage bias are analyzed in six species of three basal orders of aquatic insects. The rationale behind choosing six species of aquatic insects (three from Ephemeroptera, one from Plecoptera, and two from Odonata) for the present analysis is based on phylogenetic position at the basal clades of the Order Insecta facilitating the understanding of the evolution of codon bias and of factors shaping codon usage patterns in primitive clades of insect lineages and their subtle differences in some of their ecological and environmental requirements in terms of habitat-microhabitat requirements, altitudinal preferences, temperature tolerance ranges, and consequent responses to climate change impacts. The present analysis focuses on open reading frames of the 13 protein-coding genes in the mitochondrial genome of six carefully chosen insect species to get a comprehensive picture of the evolutionary intricacies of codon bias. In all the six species, A and T contents are observed to be significantly higher than G and C, and are used roughly equally. Since transcription hypothesis on codon usage demands A richness and T poorness, it is quite likely that mutation pressure may be the key factor associated with synonymous codon usage (SCU) variations in these species because the mutation hypothesis predicts AT richness and GC poorness in the mitochondrial DNA. Thus, AT-biased mutation pressure seems to be an important factor in framing the SCU variation in all the selected species of aquatic insects, which in turn explains the predominance of A and T ending codons in these species. This study does not find any association between microhabitats and codon usage variations in the mitochondria of selected aquatic insects. However, this study has identified major forces, such as compositional constraints and mutation pressure, which shape patterns of codon usage in mitochondrial genes in the primitive clades of insect lineages.

  3. Expression of caveolin in trabecular meshwork cells and its possible implication in pathogenesis of primary open angle glaucoma

    PubMed Central

    Surgucheva, Irina

    2011-01-01

    Purpose Primary open-angle glaucoma (POAG), which is the most common form of glaucoma, has been associated with a heterogeneous genetic component. A genome-wide association study has identified a common sequence variant at 7q31 (rs4236601 [A]) near the caveolin genes in patients with POAG. Caveolins are a family of integral membrane proteins which participate in many cellular processes, including vesicular transport, cholesterol homeostasis, signal transduction, cell adhesion and migration. The goal of this study was to investigate the expression and regulation of caveolin 1 (CAV-1) and caveolin 2 (CAV-2) in normal and glaucoma trabecular meshwork (TM) cells. Methods CAV-1 and CAV-2 protein expression was quantified by immunoblot analysis using lysates isolated from primary and immortalized TM cells or TM tissue dissected from normal and POAG eyes. The localization of caveolins in TM cells was assessed by immunofluorescent microscopy. CAV-1 and CAV-2 protein expression was also investigated in TM cells at various time points after subjecting the cells to known glaucomatous insults like dexamethasone (DEX) and tumor growth factor beta2 (TGF-β2) treatment. Phosphorylation of CAV-1 at tyrosine 14 in normal and glaucoma TM cell lines was evaluated using a specific monoclonal antibody (Ab). The 5′ upstream region of the CAV-1 gene was amplified and the sequence variant rs4236601 (A/G polymorphic site) and several putative transcription factor-binding sites were modified by in vitro mutagenesis. The effect of nucleotide sequence modifications in the CAV-1 upstream region on gene expression was assayed in a luciferase-based system in TM and non-TM cells. Results CAV-1 and CAV-2 are expressed in TM cells, with localization to the cytoplasm and perinuclear region. DEX increased CAV-1 expression in immortalized glaucoma TM cells by 2.8±0.1 (n=3) fold at 24 h and 2.5±0.1 (n=3) fold at 48 h, compared to 1.3±0.06 (n=3) fold at 24 and 48 h in immortalized normal TM cells. Phosphorylation of CAV-1 at Tyr14 was reduced by 3.2±0.15 (n=3) fold in glaucomatous TM cells when compared to normal TM cells. In POAG and normal TM tissue, CAV-1 expression was found to be uniform. CAV-2, on the other hand, was variable in independent normal and glaucoma TM tissue. Substitution of a G for an A at base pair −2,388 upstream of the start codon of CAV-1, corresponding to the minor allele rs4236601 [A], increased transcriptional activity in TM and non-TM cells when compared to the native sequence. Deletion analysis of putative transcription factor binding sites in the CAV-1 promoter region caused cell-specific effects on gene expression. Conclusions CAV-1 and CAV-2 are expressed in normal and glaucoma tissue and TM cell lines. Phosphorylation of Tyr14 in CAV-1 and transcriptional regulation of CAV-1 expression may have a role in glaucomatous alterations in TM cells. PMID:22128235

  4. Two novel heat shock genes encoding proteins produced in response to heterologous protein expression in Escherichia coli.

    PubMed Central

    Allen, S P; Polazzi, J O; Gierse, J K; Easton, A M

    1992-01-01

    In Escherichia coli high-level production of some heterologous proteins (specifically, human prorenin, renin, and bovine insulin-like growth factor 2) resulted in the induction of two new E. coli heat shock proteins, both of which have molecular masses of 16 kDa and are tightly associated with inclusion bodies formed during heterologous protein production. We named these inclusion body-associated proteins IbpA and IbpB. The coding sequences for IbpA and IbpB were identified and isolated from the Kohara E. coli gene bank. The genes for these proteins (ibpA and ibpB) are located at 82.5 min on the chromosome. Nucleotide sequencing of the two genes revealed that they are transcribed in the same direction and are separated by 110 bp. Putative Shine-Dalgarno sequences are located upstream from the initiation codons of both genes. A putative heat shock promoter is located upstream from ibpA, and a putative transcription terminator is located downstream from ibpB. A temperature upshift experiment in which we used a wild-type E. coli strain and an isogenic rpoH mutant strain indicated that a sigma 32-containing RNA polymerase is involved in the regulation of expression of these genes. There is 57.5% identity between the genes at the nucleotide level and 52.2% identity at the amino acid level. A search of the protein data bases showed that both of these 16-kDa proteins exhibit low levels of homology to low-molecular-weight heat shock proteins from eukaryotic species. Images PMID:1356969

  5. Three stages in the evolution of the genetic code

    NASA Technical Reports Server (NTRS)

    Baumann, U.; Oro, J.

    1993-01-01

    A diversification of the genetic code based on the number of codons available for the proteinous amino acids is established. Three groups of amino acids during evolution of the code are distinguished. On the basis of their chemical complexity those amino acids emerging later in a translation process are derived. Codon number and chemical complexity indicate that His, Phe, Tyr, Cys and either Lys or Asn were introduced in the second stage, whereas the number of codons alone gives evidence that Trp and Met were introduced in the third stage. The amino acids of stage 1 use purine-rich codons, while all the amino acids introduced in the second stage, in contrast, use pyrimidines in the third position of their codons. A low abundance of pyrimidines during early translation is derived. This assumption is supported by experiments on non-enzymatic replication and interactions of hairpin loops with a complementary strand. A back extrapolation concludes a high purine content of the first nucleic acids, which gradually decreased during their evolution. Amino acids independently available from prebiotic synthesis were thus correlated to purine-rich codons. Implications on the prebiotic replication are discussed also in the light of recent codon usage data.

  6. Cardiomyopathy in epidermolysis bullosa simplex patients with mutations in the KLHL24 gene.

    PubMed

    Yenamandra, V K; van den Akker, P C; Lemmink, H H; Jan, S Z; Diercks, G F H; Vermeer, M; van den Berg, M P; van der Meer, P; Pasmooij, A M G; Sinke, R J; Jonkman, M F; Bolling, M C

    2018-05-19

    Dominant mutations in the KLHL24 gene, encoding for kelch-like protein 24, have been implicated in the pathogenesis of epidermolysis bullosa simplex (EBS). So far, 26 patients from different ethnicities have been reported and all of them harboured a heterozygous KLHL24 start-codon mutation, with c.1A>G;p.Met1? being the most prevalent. 1-3 Through this report, we aimed to expand the phenotypic spectrum by incorporating additional findings, in particular, dilated cardiomyopathy, seen in a Dutch family. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  7. EUGÈNE'HOM: a generic similarity-based gene finder using multiple homologous sequences

    PubMed Central

    Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

    2003-01-01

    EUGÈNE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGÈNE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGÈNE'HOM to handle sequences from a variety of organisms. The current target of EUGÈNE'HOM is plant sequences. The EUGÈNE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl. PMID:12824408

  8. Emergent Rules for Codon Choice Elucidated by Editing Rare Arginine Codons in Escherichia coli

    DTIC Science & Technology

    2016-09-20

    alternative codons are more likely to be viable. To evaluate synonymous and nonsynonymous alternatives to essential AGRs further, we imple- mented a CRISPR ... Crispr -assisted MAGE). First, we designed oligos that changed not only the target AGR codon to NNN but also made several synonymous changes at least 50...nt downstream that would disrupt a 20-bp CRISPR target lo- cus. MAGE was used to replace each AGR with NNN in parallel, and CRISPR /cas9 was used to

  9. Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs

    PubMed Central

    Mandal, Debabrata; Köhrer, Caroline; Su, Dan; Babu, I. Ramesh; Chan, Clement T.Y.; Liu, Yuchen; Söll, Dieter; Blum, Paul; Kuwahara, Masayasu; Dedon, Peter C.; RajBhandary, Uttam L.

    2014-01-01

    Most archaea and bacteria use a modified C in the anticodon wobble position of isoleucine tRNA to base pair with A but not with G of the mRNA. This allows the tRNA to read the isoleucine codon AUA without also reading the methionine codon AUG. To understand why a modified C, and not U or modified U, is used to base pair with A, we mutated the C34 in the anticodon of Haloarcula marismortui isoleucine tRNA (tRNA2Ile) to U, expressed the mutant tRNA in Haloferax volcanii, and purified and analyzed the tRNA. Ribosome binding experiments show that although the wild-type tRNA2Ile binds exclusively to the isoleucine codon AUA, the mutant tRNA binds not only to AUA but also to AUU, another isoleucine codon, and to AUG, a methionine codon. The G34 to U mutant in the anticodon of another H. marismortui isoleucine tRNA species showed similar codon binding properties. Binding of the mutant tRNA to AUG could lead to misreading of the AUG codon and insertion of isoleucine in place of methionine. This result would explain why most archaea and bacteria do not normally use U or a modified U in the anticodon wobble position of isoleucine tRNA for reading the codon AUA. Biochemical and mass spectrometric analyses of the mutant tRNAs have led to the discovery of a new modified nucleoside, 5-cyanomethyl U in the anticodon wobble position of the mutant tRNAs. 5-Cyanomethyl U is present in total tRNAs from euryarchaea but not in crenarchaea, eubacteria, or eukaryotes. PMID:24344322

  10. Demonstration of GTG as an endogenous initiation codon for a human mRNA transcript revealed by molecular cloning of the serpin endopin 2B.

    PubMed

    Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill; Hook, Vivian Y H

    2004-08-16

    This study demonstrates utilization of the novel GTG initiation codon for translation of a human mRNA transcript that encodes the serpin endopin 2B, a protease inhibitor. Molecular cloning revealed the nucleotide sequence of the human endopin 2B cDNA. Its deduced primary sequence shows high homology to bovine endopin 2A that possesses cross-class protease inhibition of elastase and papain. Notably, the human endopin 2B cDNA sequence revealed GTG as the predicted translation initiation codon; the predicted translation product of 46 kDa endopin 2B was produced by in vitro translation of 35S-endopin 2B with mammalian (rabbit) protein translation components. Importantly, bioinformatic studies demonstrated the presence of the entire human endopin 2B cDNA sequence with GTG as initiation codon within the human genome on chromosome 14. Further evidence for GTG as a functional initiation codon was illustrated by GTG-mediated in vitro translation of the heterologous protein EGFP, and by GTG-mediated expression of EGFP in mammalian PC12 cells. Mutagenesis of GTG to GTC resulted in the absence of EGFP expression in PC12 cells, indicating the function of GTG as an initiation codon. In addition, it was apparent that the GTG initiation codon produces lower levels of translated protein compared to ATG as initiation codon. Significantly, GTG-mediated translation of endopin 2B demonstrates a functional human gene product not previously predicted from initial analyses of the human genome. Further analyses based on GTG as an alternative initiation codon may predict new candidate genes of the human genome.

  11. Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion

    PubMed Central

    O’Donoghue, Patrick; Prat, Laure; Heinemann, Ilka U.; Ling, Jiqiang; Odoi, Keturah; Liu, Wenshe R.; Söll, Dieter

    2012-01-01

    Over 300 amino acids are found in proteins in nature, yet typically only 20 are genetically encoded. Reassigning stop codons and use of quadruplet codons emerged as the main avenues for genetically encoding non-canonical amino acids (NCAAs). Canonical aminoacyl-tRNAs with near-cognate anticodons also read these codons to some extent. This background suppression leads to ‘statistical protein’ that contains some natural amino acid(s) at a site intended for NCAA. We characterize near-cognate suppression of amber, opal and a quadruplet codon in common Escherichia coli laboratory strains and find that the PylRS/tRNAPyl orthogonal pair cannot completely outcompete contamination by natural amino acids. PMID:23036644

  12. Importance of codon usage for the temporal regulation of viral gene expression

    PubMed Central

    Shin, Young C.; Bischof, Georg F.; Lauer, William A.; Desrosiers, Ronald C.

    2015-01-01

    The glycoproteins of herpesviruses and of HIV/SIV are made late in the replication cycle and are derived from transcripts that use an unusual codon usage that is quite different from that of the host cell. Here we show that the actions of natural transinducers from these two different families of persistent viruses (Rev of SIV and ORF57 of the rhesus monkey rhadinovirus) are dependent on the nature of the skewed codon usage. In fact, the transinducibility of expression of these glycoproteins by Rev and by ORF57 can be flipped simply by changing the nature of the codon usage. Even expression of a luciferase reporter could be made Rev dependent or ORF57 dependent by distinctive changes to its codon usage. Our findings point to a new general principle in which different families of persisting viruses use a poor codon usage that is skewed in a distinctive way to temporally regulate late expression of structural gene products. PMID:26504241

  13. Comparison of codon usage bias across Leishmania and Trypanosomatids to understand mRNA secondary structure, relative protein abundance and pathway functions.

    PubMed

    Subramanian, Abhishek; Sarkar, Ram Rup

    2015-10-01

    Understanding the variations in gene organization and its effect on the phenotype across different Leishmania species, and to study differential clinical manifestations of parasite within the host, we performed large scale analysis of codon usage patterns between Leishmania and other known Trypanosomatid species. We present the causes and consequences of codon usage bias in Leishmania genomes with respect to mutational pressure, translational selection and amino acid composition bias. We establish GC bias at wobble position that governs codon usage bias across Leishmania species, rather than amino acid composition bias. We found that, within Leishmania, homogenous codon context coding for less frequent amino acid pairs and codons avoiding formation of folding structures in mRNA are essentially chosen. We predicted putative differences in global expression between genes belonging to specific pathways across Leishmania. This explains the role of evolution in shaping the otherwise conserved genome to demonstrate species-specific function-level differences for efficient survival. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Theoretical foundations for quantitative paleogenetics. III - The molecular divergence of nucleic acids and proteins for the case of genetic events of unequal probability

    NASA Technical Reports Server (NTRS)

    Holmquist, R.; Pearl, D.

    1980-01-01

    Theoretical equations are derived for molecular divergence with respect to gene and protein structure in the presence of genetic events with unequal probabilities: amino acid and base compositions, the frequencies of nucleotide replacements, the usage of degenerate codons, the distribution of fixed base replacements within codons and the distribution of fixed base replacements among codons. Results are presented in the form of tables relating the probabilities of given numbers of codon base changes with respect to the original codon for the alpha hemoglobin, beta hemoglobin, myoglobin, cytochrome c and parvalbumin group gene families. Application of the calculations to the rabbit alpha and beta hemoglobin mRNAs and proteins indicates that the genes are separated by about 425 fixed based replacements distributed over 114 codon sites, which is a factor of two greater than previous estimates. The theoretical results also suggest that many more base replacements are required to effect a given gene or protein structural change than previously believed.

  15. Expression of codon-optmized phosphoenolpyruvate carboxylase gene from Glaciecola sp. HTCC2999 in Escherichia coli and its application for C4 chemical production.

    PubMed

    Park, Soohyun; Pack, Seung Pil; Lee, Jinwon

    2012-08-01

    We examined the expression of the phosphoenolpyruvate carboxylase (PEPC) gene from marine bacteria in Escherichia coli using codon optimization. The codon-optimized PEPC gene was expressed in the E. coli K-12 strain W3110. SDS-PAGE analysis revealed that the codon-optimized PEPC gene was only expressed in E. coli, and measurement of enzyme activity indicated the highest PEPC activity in the E. coli SGJS112 strain that contained the codon-optimized PEPC gene. In fermentation assays, the E. coli SGJS112 produced the highest yield of oxaloacetate using glucose as the source and produced a 20-times increase in the yield of malate compared to the control. We concluded that the codon optimization enabled E. coli to express the PEPC gene derived from the Glaciecola sp. HTCC2999. Also, the expressed protein exhibited an enzymatic activity similar to that of E. coli PEPC and increased the yield of oxaloacetate and malate in an E. coli system.

  16. Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

    PubMed

    Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

    2002-04-24

    The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

  17. Stop codon readthrough generates a C-terminally extended variant of the human vitamin D receptor with reduced calcitriol response

    PubMed Central

    Loughran, Gary; Jungreis, Irwin; Tzani, Ioanna; Power, Michael; Dmitriev, Ruslan I.; Ivanov, Ivaylo P.; Kellis, Manolis; Atkins, John F.

    2018-01-01

    Although stop codon readthrough is used extensively by viruses to expand their gene expression, verified instances of mammalian readthrough have only recently been uncovered by systems biology and comparative genomics approaches. Previously, our analysis of conserved protein coding signatures that extend beyond annotated stop codons predicted stop codon readthrough of several mammalian genes, all of which have been validated experimentally. Four mRNAs display highly efficient stop codon readthrough, and these mRNAs have a UGA stop codon immediately followed by CUAG (UGA_CUAG) that is conserved throughout vertebrates. Extending on the identification of this readthrough motif, we here investigated stop codon readthrough, using tissue culture reporter assays, for all previously untested human genes containing UGA_CUAG. The readthrough efficiency of the annotated stop codon for the sequence encoding vitamin D receptor (VDR) was 6.7%. It was the highest of those tested but all showed notable levels of readthrough. The VDR is a member of the nuclear receptor superfamily of ligand-inducible transcription factors, and it binds its major ligand, calcitriol, via its C-terminal ligand-binding domain. Readthrough of the annotated VDR mRNA results in a 67 amino acid–long C-terminal extension that generates a VDR proteoform named VDRx. VDRx may form homodimers and heterodimers with VDR but, compared with VDR, VDRx displayed a reduced transcriptional response to calcitriol even in the presence of its partner retinoid X receptor. PMID:29386352

  18. Stop codons in the hepatitis B surface proteins are enriched during antiviral therapy and are associated with host cell apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Colledge, Danielle; Soppe, Sally; Yuen, Lilly

    Premature stop codons in the hepatitis B virus (HBV) surface protein can be associated with nucleos(t)ide analogue resistance due to overlap of the HBV surface and polymerase genes. The aim of this study was to determine the effect of the replication of three common surface stop codon variants on the hepatocyte. Cell lines were transfected with infectious HBV clones encoding surface stop codons rtM204I/sW196*, rtA181T/sW172*, rtV191I/sW182*, and a panel of substitutions in the surface proteins. HBsAg was measured by Western blotting. Proliferation and apoptosis were measured using flow cytometry. All three surface stop codon variants were defective in HBsAg secretion.more » Cells transfected with these variants were less proliferative and had higher levels of apoptosis than those transfected with variants that did not encode surface stop codons. The most cytopathic variant was rtM204I/sW196*. Replication of HBV encoding surface stop codons was toxic to the cell and promoted apoptosis, exacerbating disease progression. - Highlights: •Under normal circumstances, HBV replication is not cytopathic. •Premature stop codons in the HBV surface protein can be selected and enriched during nucleos(t)ide analogue therapy. •Replication of these variants can be cytopathic to the cell and promote apoptosis. •Inadequate antiviral therapy may actually promote disease progression.« less

  19. Comparative Genomic Analysis MERS CoV Isolated from Humans and Camels with Special Reference to Virus Encoded Helicase.

    PubMed

    Alnazawi, Mohamed; Altaher, Abdallah; Kandeel, Mahmoud

    2017-01-01

    Middle East Respiratory Syndrome Coronavirus (MERS CoV) is a new emerging viral disease characterized by high fatality rate. Understanding MERS CoV genetic aspects and codon usage pattern is important to understand MERS CoV survival, adaptation, evolution, resistance to innate immunity, and help in finding the unique aspects of the virus for future drug discovery experiments. In this work, we provide comprehensive analysis of 238 MERS CoV full genomes comprised of human (hMERS) and camel (cMERS) isolates of the virus. MERS CoV genome shaping seems to be under compositional and mutational bias, as revealed by preference of A/T over G/C nucleotides, preferred codons, nucleotides at the third position of codons (NT3s), relative synonymous codon usage, hydropathicity (Gravy), and aromaticity (Aromo) indices. Effective number of codons (ENc) analysis reveals a general slight codon usage bias. Codon adaptation index reveals incomplete adaptation to host environment. MERS CoV showed high ability to resist the innate immune response by showing lower CpG frequencies. Neutrality evolution analysis revealed a more significant role of mutation pressure in cMERS over hMERS. Correspondence analysis revealed that MERS CoV genomes have three genetic clusters, which were distinct in their codon usage, host, and geographic distribution. Additionally, virtual screening and binding experiments were able to identify three new virus-encoded helicase binding compounds. These compounds can be used for further optimization of inhibitors.

  20. GC-Content of Synonymous Codons Profoundly Influences Amino Acid Usage

    PubMed Central

    Li, Jing; Zhou, Jun; Wu, Ying; Yang, Sihai; Tian, Dacheng

    2015-01-01

    Amino acids typically are encoded by multiple synonymous codons that are not used with the same frequency. Codon usage bias has drawn considerable attention, and several explanations have been offered, including variation in GC-content between species. Focusing on a simple parameter—combined GC proportion of all the synonymous codons for a particular amino acid, termed GCsyn—we try to deepen our understanding of the relationship between GC-content and amino acid/codon usage in more details. We analyzed 65 widely distributed representative species and found a close association between GCsyn, GC-content, and amino acids usage. The overall usages of the four amino acids with the greatest GCsyn and the five amino acids with the lowest GCsyn both vary with the regional GC-content, whereas the usage of the remaining 11 amino acids with intermediate GCsyn is less variable. More interesting, we discovered that codon usage frequencies are nearly constant in regions with similar GC-content. We further quantified the effects of regional GC-content variation (low to high) on amino acid usage and found that GC-content determines the usage variation of amino acids, especially those with extremely high GCsyn, which accounts for 76.7% of the changed GC-content for those regions. Our results suggest that GCsyn correlates with GC-content and has impact on codon/amino acid usage. These findings suggest a novel approach to understanding the role of codon and amino acid usage in shaping genomic architecture and evolutionary patterns of organisms. PMID:26248983

  1. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

    PubMed Central

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

  2. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

    PubMed

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

  3. Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

    PubMed Central

    Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

    2011-01-01

    Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

  4. Genome-wide analysis reveals class and gene specific codon usage adaptation in avian paramyxoviruses 1

    USDA-ARS?s Scientific Manuscript database

    In order to characterize the evolutionary adaptations of avian paramyxovirus 1 (APMV-1) genomes, we have compared codon usage and codon adaptation indexes among groups of Newcastle disease viruses that differ in biological, ecological, and genetic characteristics. We have used available GenBank com...

  5. Enhanced expression of codon optimized Mycobacterium avium subsp. paratuberculosis antigens in Lactobacillus salivarius

    USDA-ARS?s Scientific Manuscript database

    We have previously identified the mycobacterial high G+C codon usage bias as a limiting factor in heterologous expression of MAP proteins from Lb.salivarius, and demonstrated that codon optimisation of a synthetic coding gene greatly enhances MAP protein production. Here, we effectively demonstrate ...

  6. Codon Usage Bias and Determining Forces in Taenia solium Genome.

    PubMed

    Yang, Xing; Ma, Xusheng; Luo, Xuenong; Ling, Houjun; Zhang, Xichen; Cai, Xuepeng

    2015-12-01

    The tapeworm Taenia solium is an important human zoonotic parasite that causes great economic loss and also endangers public health. At present, an effective vaccine that will prevent infection and chemotherapy without any side effect remains to be developed. In this study, codon usage patterns in the T. solium genome were examined through 8,484 protein-coding genes. Neutrality analysis showed that T. solium had a narrow GC distribution, and a significant correlation was observed between GC12 and GC3. Examination of an NC (ENC vs GC3s)-plot showed a few genes on or close to the expected curve, but the majority of points with low-ENC (the effective number of codons) values were detected below the expected curve, suggesting that mutational bias plays a major role in shaping codon usage. The Parity Rule 2 plot (PR2) analysis showed that GC and AT were not used proportionally. We also identified 26 optimal codons in the T. solium genome, all of which ended with either a G or C residue. These optimal codons in the T. solium genome are likely consistent with tRNAs that are highly expressed in the cell, suggesting that mutational and translational selection forces are probably driving factors of codon usage bias in the T. solium genome.

  7. Analyzing gene expression from relative codon usage bias in Yeast genome: a statistical significance and biological relevance.

    PubMed

    Das, Shibsankar; Roymondal, Uttam; Sahoo, Satyabrata

    2009-08-15

    Based on the hypothesis that highly expressed genes are often characterized by strong compositional bias in terms of codon usage, there are a number of measures currently in use that quantify codon usage bias in genes, and hence provide numerical indices to predict the expression levels of genes. With the recent advent of expression measure from the score of the relative codon usage bias (RCBS), we have explicitly tested the performance of this numerical measure to predict the gene expression level and illustrate this with an analysis of Yeast genomes. In contradiction with previous other studies, we observe a weak correlations between GC content and RCBS, but a selective pressure on the codon preferences in highly expressed genes. The assertion that the expression of a given gene depends on the score of relative codon usage bias (RCBS) is supported by the data. We further observe a strong correlation between RCBS and protein length indicating natural selection in favour of shorter genes to be expressed at higher level. We also attempt a statistical analysis to assess the strength of relative codon bias in genes as a guide to their likely expression level, suggesting a decrease of the informational entropy in the highly expressed genes.

  8. Lost in Translation: Bioinformatic Analysis of Variations Affecting the Translation Initiation Codon in the Human Genome.

    PubMed

    Abad, Francisco; de la Morena-Barrio, María Eugenia; Fernández-Breis, Jesualdo Tomás; Corral, Javier

    2018-06-01

    Translation is a key biological process controlled in eukaryotes by the initiation AUG codon. Variations affecting this codon may have pathological consequences by disturbing the correct initiation of translation. Unfortunately, there is no systematic study describing these variations in the human genome. Moreover, we aimed to develop new tools for in silico prediction of the pathogenicity of gene variations affecting AUG codons, because to date, these gene defects have been wrongly classified as missense. Whole-exome analysis revealed the mean of 12 gene variations per person affecting initiation codons, mostly with high (> 0:01) minor allele frequency (MAF). Moreover, analysis of Ensembl data (December 2017) revealed 11,261 genetic variations affecting the initiation AUG codon of 7,205 genes. Most of these variations (99.5%) have low or unknown MAF, probably reflecting deleterious consequences. Only 62 variations had high MAF. Genetic variations with high MAF had closer alternative AUG downstream codons than did those with low MAF. Besides, the high-MAF group better maintained both the signal peptide and reading frame. These differentiating elements could help to determine the pathogenicity of this kind of variation. Data and scripts in Perl and R are freely available at https://github.com/fanavarro/hemodonacion. jfernand@um.es. Supplementary data are available at Bioinformatics online.

  9. Influence of codon usage bias on FGLamide-allatostatin mRNA secondary structure.

    PubMed

    Martínez-Pérez, Francisco; Bendena, William G; Chang, Belinda S W; Tobe, Stephen S

    2011-03-01

    The FGLamide allatostatins (ASTs) are invertebrate neuropeptides which inhibit juvenile hormone biosynthesis in Dictyoptera and related orders. They also show myomodulatory activity. FGLamide AST nucleotide frequencies and codon bias were investigated with respect to possible effects on mRNA secondary structure. 367 putative FGLamide ASTs and their potential endoproteolytic cleavage sites were identified from 40 species of crustaceans, chelicerates and insects. Among these, 55% comprised only 11 amino acids. An FGLamide AST consensus was identified to be (X)(1→16)Y(S/A/N/G)FGLGKR, with a strong bias for the codons UUU encoding for Phe and AAA for Lys, which can form strong Watson-Crick pairing in all peptides analyzed. The physical distance between these codons favor a loop structure from Ser/Ala-Phe to Lys-Arg. Other loop and hairpin loops were also inferred from the codon frequencies in the N-terminal motif, and the first amino acids from the C-terminal motif, or the dibasic potential endoproteolytic cleavage site. Our results indicate that nucleotide frequencies and codon usage bias in FGLamide ASTs tend to favor mRNA folds in the codon sequence in the C-terminal active peptide core and at the dibasic potential endoproteolytic cleavage site. Copyright © 2010 Elsevier Inc. All rights reserved.

  10. The complete mitochondrial genome of the mudsnail Cipangopaludina cathayensis (Gastropoda: Viviparidae).

    PubMed

    Yang, Huirong; Zhang, Jia-En; Luo, Hao; Luo, Mingzhu; Guo, Jing; Deng, Zhixin; Zhao, Benliang

    2016-05-01

    We present the complete mitochondrial genome of Cipangopaludina cathayensis in this study. The mitochondrial genome is 17,157 bp in length, containing 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes. All of them are encoded on the heavy strand except 7 tRNA genes on the light strand. Overall nucleotide compositions of the light strand are 44.51% of A, 26.74% of T, 20.48% of C and 8.28% of G. All the protein-coding genes start with ATG initiation codon except ATP6 with ATA and ND4 with TTG, and 2 types of termination codons are TAA (ATP6, ND2, COX1, COX2, ATP8, ND1, ND6, Cytb, COX3, ND4) and TAG (ND4L, ND5, ND3). There are 29 intergenic spacers and 5 gene overlaps. The tandem repeat sequences are observed in COX2, tRNA(Asp), ATP6, tRNA(Cys), S-rRNA, ND1, Cytb, ND4 and COX3 genes. Gene arrangement and distribution are different from the typical vertebrates. The absence of D-loop is consistent with the Gastropoda, but at least one lengthy non-coding region is essential regulatory element for the initiation of transcription and replication.

  11. Complete mitochondrial genome of Bactrocera arecae (Insecta: Tephritidae) by next-generation sequencing and molecular phylogeny of Dacini tribe

    PubMed Central

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Chan, Kok-Gan; Chow, Wan-Loo; Eamsobhana, Praphathip

    2015-01-01

    The whole mitochondrial genome of the pest fruit fly Bactrocera arecae was obtained from next-generation sequencing of genomic DNA. It had a total length of 15,900 bp, consisting of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a non-coding region (A + T-rich control region). The control region (952 bp) was flanked by rrnS and trnI genes. The start codons included 6 ATG, 3 ATT and 1 each of ATA, ATC, GTG and TCG. Eight TAA, two TAG, one incomplete TA and two incomplete T stop codons were represented in the protein-coding genes. The cloverleaf structure for trnS1 lacked the D-loop, and that of trnN and trnF lacked the TΨC-loop. Molecular phylogeny based on 13 protein-coding genes was concordant with 37 mitochondrial genes, with B. arecae having closest genetic affinity to B. tryoni. The subgenus Bactrocera of Dacini tribe and the Dacinae subfamily (Dacini and Ceratitidini tribes) were monophyletic. The whole mitogenome of B. arecae will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general. PMID:26472633

  12. The complete mitochondrial genome of the butterfly Apatura metis (Lepidoptera: Nymphalidae).

    PubMed

    Zhang, Min; Nie, Xinping; Cao, Tianwen; Wang, Juping; Li, Tao; Zhang, Xiaonan; Guo, Yaping; Ma, Enbo; Zhong, Yang

    2012-06-01

    As an important pest in the Slender Leaved Willow (Salix alba), Apatura metis is called Freyer's purple emperor, and its mitochondrial genome is 15,236 bp long. The encoded genes for 22 tRNA genes, two ribosomal RNA (rrnL and rrnS) genes, and 13 protein-coding genes (PCGs), and a control region in the A. metis mitochondria are highly homologous to other lepidopteran species. The mitochondrial genome of A. metis is biased toward a high A + T content (A + T = 80.5%). All protein-coding genes, except for COI begins with the CGA codon as observed in other lepidopterans, start with a typical ATN initiation codon. All tRNAs show the classic clover-leaf structure, except that the dihydrouridine (DHU) arm of tRNA(Ser(AGN)) forms a simple loop. The A. metis A + T-rich region contains some conserved structures including a structure combining the motif 'ATAGA' and 19 bp poly (T) stretch, which is similar to those found in other lepidopteran mitogenomes. The phylogenetic analyses of lepidopterans based on mitogenomes sequences demonstrate that each of the six superfamilies is monophyletic, and the relationship among them is (((Noctuoidea + (Geometroidea + Bombycoidea)) + Pyraloidea) + Papilionoidea) + Tortricoidea. In Papilionoidea group, our conclusion argues that ((Lycaenidae + Pieridae) + Nymphalidae) + Papilionidae.

  13. The first two mitochondrial genomes from Taeniopterygidae (Insecta: Plecoptera): Structural features and phylogenetic implications.

    PubMed

    Chen, Zhi-Teng; Du, Yu-Zhou

    2018-05-01

    The complete mitochondrial genomes (mitogenomes) of Taeniopteryx ugola and Doddsia occidentalis (Plecoptera: Taeniopterygidae) were firstly sequenced from the family Taeniopterygidae. The 15,353-bp long mitogenome of T. ugola and the 16,020-bp long mitogenome of D. occidentalis each contained 37 genes including 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), two ribosomal RNA genes (rRNAs) and a control region (CR). The mitochondrial gene arrangement of the two taeniopterygids and other stoneflies was identical with the putative ancestral mitogenome of Drosophila yakuba. Most PCGs used standard ATN start codons and TAN termination codons. Twenty-one of the 22 tRNAs in each mitogenome could fold into the cloverleaf secondary structures, while the dihydrouridine (DHU) arm of trnSer (AGN) was reduced or absent. Stem-loop (SL) structures, poly-T stretch, poly-[AT] n stretch and tandem repeats were found in the CRs of the two mitogenomes. The phylogenetic analyses using Bayesian inference (BI) and maximum likelihood methods (ML) generated identical results, both supporting the monophyly of all stonefly families and the two infraorders, Systellognatha and Euholognatha. Taeniopterygidae was grouped with another two families from Euholognatha. The relationships within Plecoptera were recovered as (((Perlidae+Peltoperlidae)+((Pteronarcyidae+Chloroperlidae)+Styloperlidae))+((Capniidae+Taeniopterygidae)+Nemouridae))+Gripopterygidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    PubMed

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  15. Genome-wide transcription start site profiling in biofilm-grown Burkholderia cenocepacia J2315.

    PubMed

    Sass, Andrea M; Van Acker, Heleen; Förstner, Konrad U; Van Nieuwerburgh, Filip; Deforce, Dieter; Vogel, Jörg; Coenye, Tom

    2015-10-13

    Burkholderia cenocepacia is a soil-dwelling Gram-negative Betaproteobacterium with an important role as opportunistic pathogen in humans. Infections with B. cenocepacia are very difficult to treat due to their high intrinsic resistance to most antibiotics. Biofilm formation further adds to their antibiotic resistance. B. cenocepacia harbours a large, multi-replicon genome with a high GC-content, the reference genome of strain J2315 includes 7374 annotated genes. This study aims to annotate transcription start sites and identify novel transcripts on a whole genome scale. RNA extracted from B. cenocepacia J2315 biofilms was analysed by differential RNA-sequencing and the resulting dataset compared to data derived from conventional, global RNA-sequencing. Transcription start sites were annotated and further analysed according to their position relative to annotated genes. Four thousand ten transcription start sites were mapped over the whole B. cenocepacia genome and the primary transcription start site of 2089 genes expressed in B. cenocepacia biofilms were defined. For 64 genes a start codon alternative to the annotated one was proposed. Substantial antisense transcription for 105 genes and two novel protein coding sequences were identified. The distribution of internal transcription start sites can be used to identify genomic islands in B. cenocepacia. A potassium pump strongly induced only under biofilm conditions was found and 15 non-coding small RNAs highly expressed in biofilms were discovered. Mapping transcription start sites across the B. cenocepacia genome added relevant information to the J2315 annotation. Genes and novel regulatory RNAs putatively involved in B. cenocepacia biofilm formation were identified. These findings will help in understanding regulation of B. cenocepacia biofilm formation.

  16. Determinants of translation speed are randomly distributed across transcripts resulting in a universal scaling of protein synthesis times

    NASA Astrophysics Data System (ADS)

    Sharma, Ajeet K.; Ahmed, Nabeel; O'Brien, Edward P.

    2018-02-01

    Ribosome profiling experiments have found greater than 100-fold variation in ribosome density along mRNA transcripts, indicating that individual codon elongation rates can vary to a similar degree. This wide range of elongation times, coupled with differences in codon usage between transcripts, suggests that the average codon translation-rate per gene can vary widely. Yet, ribosome run-off experiments have found that the average codon translation rate for different groups of transcripts in mouse stem cells is constant at 5.6 AA/s. How these seemingly contradictory results can be reconciled is the focus of this study. Here, we combine knowledge of the molecular factors shown to influence translation speed with genomic information from Escherichia coli, Saccharomyces cerevisiae and Homo sapiens to simulate the synthesis of cytosolic proteins in these organisms. The model recapitulates a near constant average translation rate, which we demonstrate arises because the molecular determinants of translation speed are distributed nearly randomly amongst most of the transcripts. Consequently, codon translation rates are also randomly distributed and fast-translating segments of a transcript are likely to be offset by equally probable slow-translating segments, resulting in similar average elongation rates for most transcripts. We also show that the codon usage bias does not significantly affect the near random distribution of codon translation rates because only about 10 % of the total transcripts in an organism have high codon usage bias while the rest have little to no bias. Analysis of Ribo-Seq data and an in vivo fluorescent assay supports these conclusions.

  17. Idiosyncratic recognition of UUG/UUA codons by modified nucleoside 5-taurinomethyluridine, τm5U present at 'wobble' position in anticodon loop of tRNALeu: A molecular modeling approach.

    PubMed

    Kamble, Asmita S; Fandilolu, Prayagraj M; Sambhare, Susmit B; Sonawane, Kailas D

    2017-01-01

    Lack of naturally occurring modified nucleoside 5-taurinomethyluridine (τm5U) at the 'wobble' 34th position in tRNALeu causes mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS). The τm5U34 specifically recognizes UUG and UUA codons. Structural consequences of τm5U34 to read cognate codons have not been studied so far in detail at the atomic level. Hence, 50ns multiple molecular dynamics (MD) simulations of various anticodon stem loop (ASL) models of tRNALeu in presence and absence of τm5U34 along with UUG and UUA codons were performed to explore the dynamic behaviour of τm5U34 during codon recognition process. The MD simulation results revealed that τm5U34 recognizes G/A ending codons by 'wobble' as well as a novel 'single' hydrogen bonding interactions. RMSD and RMSF values indicate the comparative stability of the ASL models containing τm5U34 modification over the other models, lacking τm5U34. Another MD simulation study of 55S mammalian mitochondrial rRNA with tRNALeu showed crucial interactions between the A-site residues, A918, A919, G256 and codon-anticodon bases. Thus, these results could improve our understanding about the decoding efficiency of human mt tRNALeu with τm5U34 to recognize UUG and UUA codons.

  18. Idiosyncratic recognition of UUG/UUA codons by modified nucleoside 5-taurinomethyluridine, τm5U present at ‘wobble’ position in anticodon loop of tRNALeu: A molecular modeling approach

    PubMed Central

    Kamble, Asmita S.; Fandilolu, Prayagraj M.; Sambhare, Susmit B.; Sonawane, Kailas D.

    2017-01-01

    Lack of naturally occurring modified nucleoside 5-taurinomethyluridine (τm5U) at the ‘wobble’ 34th position in tRNALeu causes mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS). The τm5U34 specifically recognizes UUG and UUA codons. Structural consequences of τm5U34 to read cognate codons have not been studied so far in detail at the atomic level. Hence, 50ns multiple molecular dynamics (MD) simulations of various anticodon stem loop (ASL) models of tRNALeu in presence and absence of τm5U34 along with UUG and UUA codons were performed to explore the dynamic behaviour of τm5U34 during codon recognition process. The MD simulation results revealed that τm5U34 recognizes G/A ending codons by ‘wobble’ as well as a novel ‘single’ hydrogen bonding interactions. RMSD and RMSF values indicate the comparative stability of the ASL models containing τm5U34 modification over the other models, lacking τm5U34. Another MD simulation study of 55S mammalian mitochondrial rRNA with tRNALeu showed crucial interactions between the A-site residues, A918, A919, G256 and codon-anticodon bases. Thus, these results could improve our understanding about the decoding efficiency of human mt tRNALeu with τm5U34 to recognize UUG and UUA codons. PMID:28453549

  19. Insight into pattern of codon biasness and nucleotide base usage in serotonin receptor gene family from different mammalian species.

    PubMed

    Dass, J Febin Prabhu; Sudandiradoss, C

    2012-07-15

    5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Recent evidence for evolution of the genetic code

    NASA Technical Reports Server (NTRS)

    Osawa, S.; Jukes, T. H.; Watanabe, K.; Muto, A.

    1992-01-01

    The genetic code, formerly thought to be frozen, is now known to be in a state of evolution. This was first shown in 1979 by Barrell et al. (G. Barrell, A. T. Bankier, and J. Drouin, Nature [London] 282:189-194, 1979), who found that the universal codons AUA (isoleucine) and UGA (stop) coded for methionine and tryptophan, respectively, in human mitochondria. Subsequent studies have shown that UGA codes for tryptophan in Mycoplasma spp. and in all nonplant mitochondria that have been examined. Universal stop codons UAA and UAG code for glutamine in ciliated protozoa (except Euplotes octacarinatus) and in a green alga, Acetabularia. E. octacarinatus uses UAA for stop and UGA for cysteine. Candida species, which are yeasts, use CUG (leucine) for serine. Other departures from the universal code, all in nonplant mitochondria, are CUN (leucine) for threonine (in yeasts), AAA (lysine) for asparagine (in platyhelminths and echinoderms), UAA (stop) for tyrosine (in planaria), and AGR (arginine) for serine (in several animal orders) and for stop (in vertebrates). We propose that the changes are typically preceded by loss of a codon from all coding sequences in an organism or organelle, often as a result of directional mutation pressure, accompanied by loss of the tRNA that translates the codon. The codon reappears later by conversion of another codon and emergence of a tRNA that translates the reappeared codon with a different assignment. Changes in release factors also contribute to these revised assignments. We also discuss the use of UGA (stop) as a selenocysteine codon and the early history of the code.

  1. A condition-specific codon optimization approach for improved heterologous gene expression in Saccharomyces cerevisiae

    PubMed Central

    2014-01-01

    Background Heterologous gene expression is an important tool for synthetic biology that enables metabolic engineering and the production of non-natural biologics in a variety of host organisms. The translational efficiency of heterologous genes can often be improved by optimizing synonymous codon usage to better match the host organism. However, traditional approaches for optimization neglect to take into account many factors known to influence synonymous codon distributions. Results Here we define an alternative approach for codon optimization that utilizes systems level information and codon context for the condition under which heterologous genes are being expressed. Furthermore, we utilize a probabilistic algorithm to generate multiple variants of a given gene. We demonstrate improved translational efficiency using this condition-specific codon optimization approach with two heterologous genes, the fluorescent protein-encoding eGFP and the catechol 1,2-dioxygenase gene CatA, expressed in S. cerevisiae. For the latter case, optimization for stationary phase production resulted in nearly 2.9-fold improvements over commercial gene optimization algorithms. Conclusions Codon optimization is now often a standard tool for protein expression, and while a variety of tools and approaches have been developed, they do not guarantee improved performance for all hosts of applications. Here, we suggest an alternative method for condition-specific codon optimization and demonstrate its utility in Saccharomyces cerevisiae as a proof of concept. However, this technique should be applicable to any organism for which gene expression data can be generated and is thus of potential interest for a variety of applications in metabolic and cellular engineering. PMID:24636000

  2. Alterations of the three short open reading frames in the Rous sarcoma virus leader RNA modulate viral replication and gene expression.

    PubMed Central

    Moustakas, A; Sonstegard, T S; Hackett, P B

    1993-01-01

    The Rous sarcoma virus (RSV) leader RNA has three short open reading frames (ORF1 to ORF3) which are conserved in all avian sarcoma-leukosis retroviruses. Effects on virus propagation were determined following three types of alterations in the ORFs: (i) replacement of AUG initiation codons in order to prohibit ORF translation, (ii) alterations of the codon context around the AUG initiation codon to enhance translation of the normally silent ORF3, and (iii) elongation of the ORF coding sequences. Mutagenesis of the AUG codons for ORF1 and ORF2 (AUG1 and AUG2) singly or together delayed the onset of viral replication and cell transformation. In contrast, mutagenesis of AUG3 almost completely suppressed these viral activities. Mutagenesis of ORF3 to enhance its translation inhibited viral propagation. When the mutant ORF3 included an additional frameshift mutation which extended the ORF beyond the initiation site for the gag, gag-pol, and env proteins, host cells were initially transformed but died soon thereafter. Elongation of ORF1 from 7 to 62 codons led to the accumulation of transformation-defective virus with a delayed onset of replication. In contrast, viruses with elongation of ORF1 from 7 to 30 codons, ORF2 from 16 to 48 codons, or ORF3 from 9 to 64 codons, without any alterations in the AUG context, exhibited wild-type phenotypes. These results are consistent with a model that translation of the ORFs is necessary to facilitate virus production. Images PMID:7685415

  3. Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.

    PubMed

    Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng

    2012-08-01

    A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.

  4. Codon usage bias reveals genomic adaptations to environmental conditions in an acidophilic consortium.

    PubMed

    Hart, Andrew; Cortés, María Paz; Latorre, Mauricio; Martinez, Servet

    2018-01-01

    The analysis of codon usage bias has been widely used to characterize different communities of microorganisms. In this context, the aim of this work was to study the codon usage bias in a natural consortium of five acidophilic bacteria used for biomining. The codon usage bias of the consortium was contrasted with genes from an alternative collection of acidophilic reference strains and metagenome samples. Results indicate that acidophilic bacteria preferentially have low codon usage bias, consistent with both their capacity to live in a wide range of habitats and their slow growth rate, a characteristic probably acquired independently from their phylogenetic relationships. In addition, the analysis showed significant differences in the unique sets of genes from the autotrophic species of the consortium in relation to other acidophilic organisms, principally in genes which code for proteins involved in metal and oxidative stress resistance. The lower values of codon usage bias obtained in this unique set of genes suggest higher transcriptional adaptation to living in extreme conditions, which was probably acquired as a measure for resisting the elevated metal conditions present in the mine.

  5. RNA editing makes mistakes in plant mitochondria: editing loses sense in transcripts of a rps19 pseudogene and in creating stop codons in coxI and rps3 mRNAs of Oenothera.

    PubMed Central

    Schuster, W; Brennicke, A

    1991-01-01

    An intact gene for the ribosomal protein S19 (rps19) is absent from Oenothera mitochondria. The conserved rps19 reading frame found in the mitochondrial genome is interrupted by a termination codon. This rps19 pseudogene is cotranscribed with the downstream rps3 gene and is edited on both sides of the translational stop. Editing, however, changes the amino acid sequence at positions that were well conserved before editing. Other strange editings create translational stops in open reading frames coding for functional proteins. In coxI and rps3 mRNAs CGA codons are edited to UGA stop codons only five and three codons, respectively, downstream to the initiation codon. These aberrant editings in essential open reading frames and in the rps19 pseudogene appear to have been shifted to these positions from other editing sites. These observations suggest a requirement for a continuous evolutionary constraint on the editing specificities in plant mitochondria. Images PMID:1762921

  6. Identification of four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, from an East African population by high-resolution sequence-based typing.

    PubMed

    Luo, M; Mao, X; Plummer, F A

    2005-02-01

    We report here four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, identified from an East African population during sequence-based HLA-B typing. The novel alleles were confirmed by sequencing two separate polymerase chain reaction products, and by molecular cloning and sequencing multiple clones. B*1590 is identical to B*1510 at exon 2 and exon 3, except for a difference (GCCGTC) at codon 158. Sequence differences at codon 152 (GAGGTG) and codon 167 (TGGTCG) differentiate B*1591 from B*1503 at exon 3. B*2726 is identical to B*2708 at exon 2 and exon 3, except for a difference (AAGCAG) at codon 70. B*4705 was identified in three Kenyan women. The allele is identical to B*47010101/02 at exon 2 and exon 3, except for differences at codon 97 (AGGAAT) and codon 99 (TTTTAT). These new alleles have been named by the WHO Nomenclature Committee. Identification of these novel HLA-B alleles reflects the genetic diversity of this East African population.

  7. Energetics of codon-anticodon recognition on the small ribosomal subunit.

    PubMed

    Almlöf, Martin; Andér, Martin; Aqvist, Johan

    2007-01-09

    Recent crystal structures of the small ribosomal subunit have made it possible to examine the detailed energetics of codon recognition on the ribosome by computational methods. The binding of cognate and near-cognate anticodon stem loops to the ribosome decoding center, with mRNA containing the Phe UUU and UUC codons, are analyzed here using explicit solvent molecular dynamics simulations together with the linear interaction energy (LIE) method. The calculated binding free energies are in excellent agreement with experimental binding constants and reproduce the relative effects of mismatches in the first and second codon position versus a mismatch at the wobble position. The simulations further predict that the Leu2 anticodon stem loop is about 10 times more stable than the Ser stem loop in complex with the Phe UUU codon. It is also found that the ribosome significantly enhances the intrinsic stability differences of codon-anticodon complexes in aqueous solution. Structural analysis of the simulations confirms the previously suggested importance of the universally conserved nucleotides A1492, A1493, and G530 in the decoding process.

  8. Simple-MSSM: a simple and efficient method for simultaneous multi-site saturation mutagenesis.

    PubMed

    Cheng, Feng; Xu, Jian-Miao; Xiang, Chao; Liu, Zhi-Qiang; Zhao, Li-Qing; Zheng, Yu-Guo

    2017-04-01

    To develop a practically simple and robust multi-site saturation mutagenesis (MSSM) method that enables simultaneously recombination of amino acid positions for focused mutant library generation. A general restriction enzyme-free and ligase-free MSSM method (Simple-MSSM) based on prolonged overlap extension PCR (POE-PCR) and Simple Cloning techniques. As a proof of principle of Simple-MSSM, the gene of eGFP (enhanced green fluorescent protein) was used as a template gene for simultaneous mutagenesis of five codons. Forty-eight randomly selected clones were sequenced. Sequencing revealed that all the 48 clones showed at least one mutant codon (mutation efficiency = 100%), and 46 out of the 48 clones had mutations at all the five codons. The obtained diversities at these five codons are 27, 24, 26, 26 and 22, respectively, which correspond to 84, 75, 81, 81, 69% of the theoretical diversity offered by NNK-degeneration (32 codons; NNK, K = T or G). The enzyme-free Simple-MSSM method can simultaneously and efficiently saturate five codons within one day, and therefore avoid missing interactions between residues in interacting amino acid networks.

  9. Lack of correlation between p53 codon 72 polymorphism and anal cancer risk

    PubMed Central

    Contu, Simone S; Agnes, Grasiela; Damin, Andrea P; Contu, Paulo C; Rosito, Mário A; Alexandre, Claudio O; Damin, Daniel C

    2009-01-01

    AIM: To investigate the potential role of p53 codon 72 polymorphism as a risk factor for development of anal cancer. METHODS: Thirty-two patients with invasive anal carcinoma and 103 healthy blood donors were included in the study. p53 codon 72 polymorphism was analyzed in blood samples through polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing. RESULTS: The relative frequency of each allele was 0.60 for Arg and 0.40 for Pro in patients with anal cancer, and 0.61 for Arg and 0.39 for Pro in normal controls. No significant differences in distribution of the codon 72 genotypes between patients and controls were found. CONCLUSION: These results do not support a role for the p53 codon 72 polymorphism in anal carcinogenesis. PMID:19777616

  10. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.

    PubMed

    Rujito, Lantip; Basalamah, Muhammad; Mulatsih, Sri; Sofro, Abdul Salam M

    2015-08-03

    Thalassemia is the most prevalent genetic blood disorder worldwide, and particularly prevalent in Indonesia. The purpose of this study was to determine the spectrum of β-thalassemia (β-thal) mutations found in the southern region of Central Java, Indonesia. The subjects of the study included 209 β-thal Javanese patients from Banyumas Residency, a southwest region of Central Java Province. DNA analysis was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), amplification refractory mutation system (ARMS), and the direct sequencing method. The results showed that 14 alleles were found in the following order: IVS-I-5 (G > C) (HBB: c.92 + 5G > C) 43.5%, codon 26 (Hb E; HBB: c.79G > A) 28.2%, IVS-I-1 (G > A) (HBB: c.92 + 1G > A) 5.0%, codon 15 (TGG > TAG) (HBB: c.47G > A) 3.8%, IVS-I-1 (G > T) (HBB: c.92 + 1G > T) 3.1%, codon 35 (-C) (HBB: c.110delC) 2.4%. The rest, including codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), codons 8/9 (+G) (HBB: c.27_28insG), codon 19 (AAC > AGC) (HBB: c.59A > G), codon 17 (AAG > TAG) (HBB: c.52A > T), IVS-I-2 (T > C) (HBB: c.92 + 2T > C), codons 123/124/125 (-ACCCCACC) (HBB: c.370_378delACCCCACCA), codon 40 (-G) (HBB: c.123delG) and Cap +1 (A > C) (HBB: c.-50A > C), accounted for up to 1.0% each. The most prevalent alleles would be recommended to be used as part of β-thal screening for the Javanese, one of the major ethnic groups in the country.

  11. Random codon re-encoding induces stable reduction of replicative fitness of Chikungunya virus in primate and mosquito cells.

    PubMed

    Nougairede, Antoine; De Fabritus, Lauriane; Aubry, Fabien; Gould, Ernest A; Holmes, Edward C; de Lamballerie, Xavier

    2013-02-01

    Large-scale codon re-encoding represents a powerful method of attenuating viruses to generate safe and cost-effective vaccines. In contrast to specific approaches of codon re-encoding which modify genome-scale properties, we evaluated the effects of random codon re-encoding on the re-emerging human pathogen Chikungunya virus (CHIKV), and assessed the stability of the resultant viruses during serial in cellulo passage. Using different combinations of three 1.4 kb randomly re-encoded regions located throughout the CHIKV genome six codon re-encoded viruses were obtained. Introducing a large number of slightly deleterious synonymous mutations reduced the replicative fitness of CHIKV in both primate and arthropod cells, demonstrating the impact of synonymous mutations on fitness. Decrease of replicative fitness correlated with the extent of re-encoding, an observation that may assist in the modulation of viral attenuation. The wild-type and two re-encoded viruses were passaged 50 times either in primate or insect cells, or in each cell line alternately. These viruses were analyzed using detailed fitness assays, complete genome sequences and the analysis of intra-population genetic diversity. The response to codon re-encoding and adaptation to culture conditions occurred simultaneously, resulting in significant replicative fitness increases for both re-encoded and wild type viruses. Importantly, however, the most re-encoded virus failed to recover its replicative fitness. Evolution of these viruses in response to codon re-encoding was largely characterized by the emergence of both synonymous and non-synonymous mutations, sometimes located in genomic regions other than those involving re-encoding, and multiple convergent and compensatory mutations. However, there was a striking absence of codon reversion (<0.4%). Finally, multiple mutations were rapidly fixed in primate cells, whereas mosquito cells acted as a brake on evolution. In conclusion, random codon re-encoding provides important information on the evolution and genetic stability of CHIKV viruses and could be exploited to develop a safe, live attenuated CHIKV vaccine.

  12. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.

    PubMed

    Rujito, Lantip; Basalamah, Muhammad; Mulatsih, Sri; Sofro, Abdul Salam M

    2015-01-01

    Thalassemia is the most prevalent genetic blood disorder worldwide, and particularly prevalent in Indonesia. The purpose of this study was to determine the spectrum of β-thalassemia (β-thal) mutations found in the southern region of Central Java, Indonesia. The subjects of the study included 209 β-thal Javanese patients from Banyumas Residency, a southwest region of Central Java Province. DNA analysis was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), amplification refractory mutation system (ARMS), and the direct sequencing method. The results showed that 14 alleles were found in the following order: IVS-I-5 (G > C) (HBB: c.92 + 5G > C) 43.5%, codon 26 (Hb E; HBB: c.79G > A) 28.2%, IVS-I-1 (G > A) (HBB: c.92 + 1G > A) 5.0%, codon 15 (TGG > TAG) (HBB: c.47G > A) 3.8%, IVS-I-1 (G > T) (HBB: c.92 + 1G > T) 3.1%, codon 35 (-C) (HBB: c.110delC) 2.4%. The rest, including codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), codons 8/9 (+G) (HBB: c.27_28insG), codon 19 (AAC > AGC) (HBB: c.59A > G), codon 17 (AAG > TAG) (HBB: c.52A > T), IVS-I-2 (T > C) (HBB: c.92 + 2T > C), codons 123/124/125 (-ACCCCACC) (HBB: c.370_378delACCCCACCA), codon 40 (-G) (HBB: c.123delG) and Cap +1 (A > C) (HBB: c.-50A > C), accounted for up to 1.0% each. The most prevalent alleles would be recommended to be used as part of β-thal screening for the Javanese, one of the major ethnic groups in the country.

  13. Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burkhardt E.; Adham, I.M.; Brosig, B.

    1994-03-01

    Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

  14. The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

    PubMed Central

    Grichnik, J M; French, B A; Schwartz, R J

    1988-01-01

    The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

  15. PTENα, a PTEN isoform translated through alternative initiation, regulates mitochondrial function and energy metabolism.

    PubMed

    Liang, Hui; He, Shiming; Yang, Jingyi; Jia, Xinying; Wang, Pan; Chen, Xi; Zhang, Zhong; Zou, Xiajuan; McNutt, Michael A; Shen, Wen Hong; Yin, Yuxin

    2014-05-06

    PTEN is one of the most frequently mutated genes in human cancer. It is known that PTEN has a wide range of biological functions beyond tumor suppression. Here, we report that PTENα, an N-terminally extended form of PTEN, functions in mitochondrial metabolism. Translation of PTENα is initiated from a CUG codon upstream of and in-frame with the coding region of canonical PTEN. Eukaryotic translation initiation factor 2A (eIF2A) controls PTENα translation, which requires a CUG-centered palindromic motif. We show that PTENα induces cytochrome c oxidase activity and ATP production in mitochondria. TALEN-mediated somatic deletion of PTENα impairs mitochondrial respiratory chain function. PTENα interacts with canonical PTEN to increase PINK1 protein levels and promote energy production. Our studies demonstrate the importance of eIF2A-mediated alternative translation for generation of protein diversity in eukaryotic systems and provide insights into the mechanism by which the PTEN family is involved in multiple cellular processes. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Physical map location of the multicopy genes coding for ammonia monooxygenase and hydroxylamine oxidoreductase in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11.

    PubMed

    Hirota, R; Yamagata, A; Kato, J; Kuroda, A; Ikeda, T; Takiguchi, N; Ohtake, H

    2000-02-01

    Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB(1) and amoCAB(2)), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)). In this DNA fragment, amoCAB(1) and amoCAB(2) were about 390 kb apart, while hao(1), hao(2), and hao(3) were separated by at least about 100 kb from each other. Interestingly, hao(1) and hao(2) were located relatively close to amoCAB(1) and amoCAB(2), respectively. DNA sequence analysis revealed that hao(1) and hao(2) shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao(3) showed only 30% nucleotide identity in the 160-bp corresponding region.

  17. Physical Map Location of the Multicopy Genes Coding for Ammonia Monooxygenase and Hydroxylamine Oxidoreductase in the Ammonia-Oxidizing Bacterium Nitrosomonas sp. Strain ENI-11

    PubMed Central

    Hirota, Ryuichi; Yamagata, Akira; Kato, Junichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

    2000-01-01

    Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB1 and amoCAB2), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao1, hao2, and hao3). In this DNA fragment, amoCAB1 and amoCAB2 were about 390 kb apart, while hao1, hao2, and hao3 were separated by at least about 100 kb from each other. Interestingly, hao1 and hao2 were located relatively close to amoCAB1 and amoCAB2, respectively. DNA sequence analysis revealed that hao1 and hao2 shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao3 showed only 30% nucleotide identity in the 160-bp corresponding region. PMID:10633121

  18. Large-scale analyses of synonymous substitution rates can be sensitive to assumptions about the process of mutation.

    PubMed

    Aris-Brosou, Stéphane; Bielawski, Joseph P

    2006-08-15

    A popular approach to examine the roles of mutation and selection in the evolution of genomes has been to consider the relationship between codon bias and synonymous rates of molecular evolution. A significant relationship between these two quantities is taken to indicate the action of weak selection on substitutions among synonymous codons. The neutral theory predicts that the rate of evolution is inversely related to the level of functional constraint. Therefore, selection against the use of non-preferred codons among those coding for the same amino acid should result in lower rates of synonymous substitution as compared with sites not subject to such selection pressures. However, reliably measuring the extent of such a relationship is problematic, as estimates of synonymous rates are sensitive to our assumptions about the process of molecular evolution. Previous studies showed the importance of accounting for unequal codon frequencies, in particular when synonymous codon usage is highly biased. Yet, unequal codon frequencies can be modeled in different ways, making different assumptions about the mutation process. Here we conduct a simulation study to evaluate two different ways of modeling uneven codon frequencies and show that both model parameterizations can have a dramatic impact on rate estimates and affect biological conclusions about genome evolution. We reanalyze three large data sets to demonstrate the relevance of our results to empirical data analysis.

  19. Canine parvovirus type 2 (CPV-2) and Feline panleukopenia virus (FPV) codon bias analysis reveals a progressive adaptation to the new niche after the host jump.

    PubMed

    Franzo, Giovanni; Tucciarone, Claudia Maria; Cecchinato, Mattia; Drigo, Michele

    2017-09-01

    Based on virus dependence from host cell machinery, their codon usage is expected to show a strong relation with the host one. Even if this association has been stated, especially for bacteria viruses, the linkage is considered to be less consistent for more complex organisms and a codon bias adaptation after host jump has never been proven. Canine parvovirus type 2 (CPV-2) was selected as a model because it represents a well characterized case of host jump, originating from Feline panleukopenia virus (FPV). The current study demonstrates that the adaptation to specific tissue and host codon bias affected CPV-2 evolution. Remarkably, FPV and CPV-2 showed a higher closeness toward the codon bias of the tissues they display the higher tropism for. Moreover, after the host jump, a clear and significant trend was evidenced toward a reduction in the distance between CPV-2 and the dog codon bias over time. This evidence was not confirmed for FPV, suggesting that an equilibrium has been reached during the prolonged virus-host co-evolution. Additionally, the presence of an intermediate pattern displayed by some strains infecting wild species suggests that these could have facilitated the host switch also by acting on codon bias. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. A mutated hygromycin resistance gene is functional in the n-alkane-assimilating yeast Candida tropicalis.

    PubMed

    Hara, A; Ueda, M; Misawa, S; Matsui, T; Furuhashi, K; Tanaka, A

    2000-03-01

    Development of a transformation system in the n-alkane-assimilating diploid yeast Candida tropicalis requires an antibiotic resistance gene in order to establish a selectable marker. The resistance gene for hygromycin B has often been used as a selectable marker in yeast transformation. However, C. tropicalis harboring the hygromycin resistance gene (HYG) was as sensitive to hygromycin B as the wild-type strain. Nine CTG codons were found in the ORF of the HYG gene. This codon has been reported to be translated as serine rather than leucine in Candida species. Analysis of the tRNA gene in C. tropicalis with the anticodon CAG [tRNA(CAG) gene], which is complementary to the codon CTG, showed that the sequence was highly similar to that of the C. maltosa tRNA(CAG) gene. In C. maltosa, the codon CTG is read as serine and not leucine. These results suggested that the HYG gene was not functional due to the nonuniversal usage of the CTG codon. Each of the nine CTG codons in the ORF of the HYG gene was changed to a CTC codon, which is read as leucine, by site-directed mutagenesis. When a plasmid containing the mutated HYG gene (HYG#) was constructed and introduced into C. tropicalis, hygromycin-resistant transformants were successfully obtained. This mutated hygromycin resistance gene may be useful for direct selection of C. tropicalis transformants.

Top