Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

PubMed

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma.

PubMed

Singh, Dinesh K; Kollipara, Rahul K; Vemireddy, Vamsidara; Yang, Xiao-Li; Sun, Yuxiao; Regmi, Nanda; Klingler, Stefan; Hatanpaa, Kimmo J; Raisanen, Jack; Cho, Steve K; Sirasanagandla, Shyam; Nannepaga, Suraj; Piccirillo, Sara; Mashimo, Tomoyuki; Wang, Shan; Humphries, Caroline G; Mickey, Bruce; Maher, Elizabeth A; Zheng, Hongwu; Kim, Ryung S; Kittler, Ralf; Bachoo, Robert M

2017-01-24

Efforts to identify and target glioblastoma (GBM) drivers have primarily focused on receptor tyrosine kinases (RTKs). Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2) transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc-finger E-box binding homeobox 1 (ZEB1), which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Mechanism of Promoter Melting by the Xeroderma Pigmentosum Complementation Group B Helicase of Transcription Factor IIH Revealed by Protein-DNA Photo-Cross-Linking

PubMed Central

Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit

2000-01-01

The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286

What's the FOX Got to Do with the KITten? Regulating the Lineage-Specific Transcriptional Landscape in GIST.

PubMed

Lee, Donna M; Duensing, Anette

2018-02-01

Transcriptional regulation of the KIT receptor tyrosine kinase, a master regulator in gastrointestinal stromal tumors (GIST) and their precursors, the interstitial cells of Cajal (ICC), is part of a positive feedback loop involving the transcription factor ETV1. A new study now shows that the forkhead box (FOX) family transcription factor FOXF1 not only is an upstream regulator of ETV1 and hence ICC/GIST lineage-specific gene transcription, but also functions as lineage-specific pioneer factor with an active role in chromatin rearrangement to facilitate ETV1 binding and transcriptional activity. Cancer Discov; 8(2); 146-9. ©2018 AACR See related article by Ran et al., p. 234 . ©2018 American Association for Cancer Research.

Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

PubMed

Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

1990-03-25

The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

High cancer-specific expression of mesothelin (MSLN) is attributable to an upstream enhancer containing a transcription enhancer factor dependent MCAT motif.

PubMed

Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E

2007-10-01

Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.

Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

PubMed

Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

2018-05-03

Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

Identification of regulatory targets for the bacterial Nus factor complex.

PubMed

Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

2017-12-11

Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Targeting the upstream transcriptional activator of PD-L1 as an alternative strategy in melanoma therapy.

PubMed

Zhu, Bo; Tang, Liming; Chen, Shuyang; Yin, Chengqian; Peng, Shiguang; Li, Xin; Liu, Tongzheng; Liu, Wei; Han, Changpeng; Stawski, Lukasz; Xu, Zhi-Xiang; Zhou, Guangbiao; Chen, Xiang; Gao, Xiumei; Goding, Colin R; Xu, Nan; Cui, Rutao; Cao, Peng

2018-05-22

Programmed cell death ligand 1 (PD-L1) interacts with programmed cell death protein-1 (PD-1) as an immune checkpoint. Reactivating the immune response by inhibiting PD-L1 using therapeutic antibodies provides substantial clinical benefits in many, though not all, melanoma patients. However, transcriptional suppression of PD-L1 expression as an alternative therapeutic anti-melanoma strategy has not been exploited. Here we provide biochemical evidence demonstrating that ultraviolet radiation (UVR) induction of PD-L1 in skin is directly controlled by nuclear factor E2-related transcription factor 2 (NRF2). Depletion of NRF2 significantly induces tumor infiltration by both CD8 + and CD4 + T cells to suppress melanoma progression, and combining NRF2 inhibition with anti-PD-1 treatment enhanced its anti-tumor function. Our studies identify a critical and targetable PD-L1 upstream regulator and provide an alternative strategy to inhibit the PD-1/PD-L1 signaling in melanoma treatment.

Bmal1 is a direct transcriptional target of the orphan nuclear receptor, NR2F1

USDA-ARS?s Scientific Manuscript database

Orphan nuclear receptor NR2F1 (also known as COUP-TFI, Chicken Ovalbumin Upstream Promoter Transcription Factor I) is a highly conserved member of the nuclear receptor superfamily. NR2F1 plays a critical role during embryonic development, particularly in the central and peripheral nervous systems a...

Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

The membrane-tethered transcription factor ANAC089 serves as redox-dependent suppressor of stromal ascorbate peroxidase gene expression

PubMed Central

Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef

2012-01-01

The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559

Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

PubMed Central

Gilmartin, G M; Fleming, E S; Oetjen, J

1992-01-01

The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

Genomic organization and chromosomal localization of the gene TCF15 encoding the early mesodermal basic helix-loop-helix factor bHLH-EC2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hidai, H.; Quertermous, E.E.; Quertermous, T.

1995-12-10

bHLH-EC2 is a recently characterized member of a growing family of basic helix-loop-helix transcription factors. This family includes bHLH factors such as twist, which appear to be primarily involved in early mesodermal differentiation, and bHLH factors such as TAL-1, which have been characterized through their association with chromosomal breakpoints associated with T-cell leukemias. To provide for studies aimed at understanding the genetic regulation of bHLH-EC2, we have characterized the organization of this gene and conducted preliminary studies of the transcriptional activity of the upstream promoter region. The mouse bHLH-EC2 gene was found to consist of two exons separated by amore » 5-kb intron, an organization pattern similar to the mouse twist gene. The transcription initiation site was identified by RNase protection assay and primer extension analysis. Linked promoter-reporter gene transfection experiments in cultured cells indicated that while the identified upstream sequence can function to promote transcription, it does not function in a cell-specific fashion. To investigate the possible association of bHLH-EC2 with hematological malignancy, the chromosomal location of this gene in the human was mapped by fluorescence in situ hybridization and assigned to chromosome band 20p13. 16 refs., 3 figs.« less

Auxin-dependent compositional change in Mediator in ARF7- and ARF19-mediated transcription.

PubMed

Ito, Jun; Fukaki, Hidehiro; Onoda, Makoto; Li, Lin; Li, Chuanyou; Tasaka, Masao; Furutani, Masahiko

2016-06-07

Mediator is a multiprotein complex that integrates the signals from transcription factors binding to the promoter and transmits them to achieve gene transcription. The subunits of Mediator complex reside in four modules: the head, middle, tail, and dissociable CDK8 kinase module (CKM). The head, middle, and tail modules form the core Mediator complex, and the association of CKM can modify the function of Mediator in transcription. Here, we show genetic and biochemical evidence that CKM-associated Mediator transmits auxin-dependent transcriptional repression in lateral root (LR) formation. The AUXIN/INDOLE 3-ACETIC ACID 14 (Aux/IAA14) transcriptional repressor inhibits the transcriptional activity of its binding partners AUXIN RESPONSE FACTOR 7 (ARF7) and ARF19 by making a complex with the CKM-associated Mediator. In addition, TOPLESS (TPL), a transcriptional corepressor, forms a bridge between IAA14 and the CKM component MED13 through the physical interaction. ChIP assays show that auxin induces the dissociation of MED13 but not the tail module component MED25 from the ARF7 binding region upstream of its target gene. These findings indicate that auxin-induced degradation of IAA14 changes the module composition of Mediator interacting with ARF7 and ARF19 in the upstream region of their target genes involved in LR formation. We suggest that this regulation leads to a quick switch of signal transmission from ARFs to target gene expression in response to auxin.

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

PubMed

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland

2013-03-29

Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less

Tbx6-mediated Notch signaling controls somite-specific Mesp2 expression.

PubMed

Yasuhiko, Yukuto; Haraguchi, Seiki; Kitajima, Satoshi; Takahashi, Yu; Kanno, Jun; Saga, Yumiko

2006-03-07

Mesp2 is a transcription factor that plays fundamental roles in somitogenesis, and its expression is strictly restricted to the anterior presomitic mesoderm just before segment border formation. The transcriptional on-off cycle is linked to the segmentation clock. In our current study, we show that a T-box transcription factor, Tbx6, is essential for Mesp2 expression. Tbx6 directly binds to the Mesp2 gene upstream region and mediates Notch signaling, and subsequent Mesp2 transcription, in the anterior presomitic mesoderm. Our data therefore reveal that a mechanism, via Tbx6-dependent Notch signaling, acts on the transcriptional regulation of Mesp2. This finding uncovers an additional component of the interacting network of various signaling pathways that are involved in somitogenesis.

Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

PubMed

Kim, Yea Woon; Kim, AeRi

2017-07-20

Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

PubMed

Kel, AlexanderE

2017-02-01

Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

PubMed

Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

1989-12-01

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

Upstream regulators and downstream effectors of NF-κB in Alzheimer's disease.

PubMed

Shi, Zhe-Min; Han, Ya-Wei; Han, Xiao-Hui; Zhang, Kun; Chang, Ya-Nan; Hu, Zhi-Mei; Qi, Hai-Xia; Ting, Chen; Zhen, Zhang; Hong, Wei

2016-07-15

Since Alzheimer's disease (AD) is becoming the prevalent dementia in the whole world, more underlying mechanisms are emerging. Long time has the transcription factor NF-κB been identified to participate in AD pathogenesis, various studies have focused on the causes and effects of AD that are linked to NF-κB. In this review we discuss diverse environmental stimuli including oxidative stress, neuroinflammation and metabolism, involved signaling pathways such as PI3K/AKT, MAPK and AGE/RAGE/GSK-3 and newly found ncRNAs that mediate neuron toxicity or neuron protection through NF-κB activation and the following response associated with the same factors in AD. These may provide future orientation of investigation at transcription level and support efficient treatment to AD by a better understanding of the upstream regulators and downstream effectors of NF-κB. Copyright © 2016 Elsevier B.V. All rights reserved.

Control of transcription of the Bacillus subtilis spoIIIG gene, which codes for the forespore-specific transcription factor sigma G.

PubMed

Sun, D X; Cabrera-Martinez, R M; Setlow, P

1991-05-01

The Bacillus subtilis spoIIIG gene codes for a sigma factor termed sigma G which directs transcription of genes expressed only in the forespore compartment of the sporulating cell. Use of spoIIIG-lacZ transcriptional fusions showed that spoIIIG is cotranscribed with the spoIIG operon beginning at t0.5-1 of sporulation. However, this large mRNA produced little if any sigma G, and transferring the spoIIIG gene without the spoIIG promoter into the amyE locus resulted in a Spo+ phenotype. Significant translation of spoIIIG began at t2.5-3 with use of an mRNA whose 5' end is just upstream of the spoIIIG coding sequence. Synthesis of this spoIIIG-specific mRNA was not abolished by a deletion in spoIIIG itself. Similar results were obtained when a spoIIIG-lacZ translational fusion lacking the spoIIG promoter was integrated at the amyE locus. These data suggest that synthesis of sigma G is dependent neither on transcription from the spoIIG promoter nor on sigma G itself but can be due to another transcription factor. This transcription factor may be sigma F, the product of the spoIIAC locus, since a spoIIAC mutation blocked spoIIIG expression, and sequences upstream of the 5' end of the spoIIIG-specific mRNA agree well with the recognition sequence for sigma F. RNA polymerase containing sigma F (E sigma F) initiated transcription in vitro on a spoIIIG template at the 5' end found in vivo, as did E sigma G. However, E sigma F showed a greater than 20-fold preference for spoIIIG over a known sigma G-dependent gene compared with the activity of E sigma G.

NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

PubMed

Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

2016-07-19

The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

PubMed Central

Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

2010-01-01

The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

Promoter-proximal rDNA terminator augments initiation by preventing disruption of the stable transcription complex caused by polymerase read-in

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henderson, S.L.; Ryan, K.; Sollner-Webb, B.

1989-02-01

We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less

TAK1 regulates NF-{Kappa}B and AP-1 activation in airway epithelial cells following RSV infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dey, Nilay; Liu Tianshuang; Garofalo, Roberto P.

2011-09-30

Respiratory syncytial virus (RSV) is the most common cause of epidemic respiratory diseases in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B) and AP-1. In this study, we have investigated the signaling pathway leading to activation of these two transcription factors in response to RSV infection. Our results show that IKK{beta} plays a key role in viral-induced NF-{kappa}B activation, while JNK regulates AP-1-dependent gene transcription, as demonstrated by using kinase inactive proteins and chemical inhibitors of the two kinases.more » Inhibition of TAK1 activation, by overexpression of kinase inactive TAK1 or using cells lacking TAK1 expression, significantly reduced RSV-induced NF-{kappa}B and AP-1 nuclear translocation and DNA-binding activity, as well as NF-{kappa}B-dependent gene expression, identifying TAK1 as an important upstream signaling molecule regulating RSV-induced NF-{kappa}B and AP-1 activation. - Highlights: > IKK{beta} is a major kinase involved in RSV-induced NF-{kappa}B activation. > JNK regulates AP-1-dependent gene transcription in RSV infection. > TAK1 is a critical upstream signaling molecule for both pathways in infected cells.« less

Tbx6-mediated Notch signaling controls somite-specific Mesp2 expression

PubMed Central

Yasuhiko, Yukuto; Haraguchi, Seiki; Kitajima, Satoshi; Takahashi, Yu; Kanno, Jun; Saga, Yumiko

2006-01-01

Mesp2 is a transcription factor that plays fundamental roles in somitogenesis, and its expression is strictly restricted to the anterior presomitic mesoderm just before segment border formation. The transcriptional on–off cycle is linked to the segmentation clock. In our current study, we show that a T-box transcription factor, Tbx6, is essential for Mesp2 expression. Tbx6 directly binds to the Mesp2 gene upstream region and mediates Notch signaling, and subsequent Mesp2 transcription, in the anterior presomitic mesoderm. Our data therefore reveal that a mechanism, via Tbx6-dependent Notch signaling, acts on the transcriptional regulation of Mesp2. This finding uncovers an additional component of the interacting network of various signaling pathways that are involved in somitogenesis. PMID:16505380

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

Jasmonate Regulates the INDUCER OF CBF EXPRESSION–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 Cascade and Freezing Tolerance in Arabidopsis[W

PubMed Central

Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu

2013-01-01

The INDUCER OF CBF EXPRESSION (ICE)–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several JASMONATE ZIM-DOMAIN (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance. PMID:23933884

Jasmonate regulates the inducer of cbf expression-C-repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis.

PubMed

Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu

2013-08-01

The inducer of cbf expression (ICE)-C-repeat binding factor/DRE binding factor1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several jasmonate ZIM-domain (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance.

Quantifying the Effect of DNA Packaging on Gene Expression Level

NASA Astrophysics Data System (ADS)

Kim, Harold

2010-10-01

Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

PubMed

Kageyama, R; Merlino, G T; Pastan, I

1989-09-15

Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

PubMed

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genetic variation in the MITF promoter affects skin colour and transcriptional activity in black-boned chickens.

PubMed

Wang, G; Liao, J; Tang, M; Yu, S

2018-02-01

1. Microphthalmia-associated transcription factor (MITF) plays a pivotal role in melanocyte development by regulating the transcription of major pigmentation enzymes (e.g. TYR, TYRP1 and DCT). A single-nucleotide polymorphism (SNP), c.-638T>C, was identified in the MITF promoter, and genotyping of a population (n = 426) revealed that SNP c.-638T>C was associated with skin colour in black-boned chickens. 2. Individuals with genotypes CC and TC exhibited greater MTIF expression than those with genotype TT. Luciferase assays also revealed that genotype CC and TC promoters had higher activity levels than genotype TT. Expression of melanogenesis-related gene (TYR) was higher in the skin of chickens with the CC and CT genotype compared to TT chickens (P < 0.05). 3. Transcription factor-binding site analyses showed that the c.-638C allele contains a putative binding site for transcription factor sterol regulatory element-binding transcription factor 2, aryl hydrocarbon receptor nuclear translocator, transcription factor binding to IGHM enhancer 3 and upstream transcription factor 2. In contrast, the c.-638T allele contains binding sites for Sp3 transcription factor and Krüppel-like factor 1. 4. It was concluded that MITF promoter polymorphisms affected chicken skin colour. SNP c.-638T>C could be used for the marker-assisted selection of skin colour in black-boned chicken breeding.

Transcriptional regulation of hepatic lipogenesis.

PubMed

Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

2015-11-01

Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.

Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

PubMed

Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

1999-01-01

In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

PubMed

Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

2016-01-15

Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Probing the structure of Nun transcription arrest factor bound to RNA polymerase

PubMed Central

Mustaev, Arkady; Vitiello, Christal L.; Gottesman, Max E.

2016-01-01

The coliphage HK022 protein Nun transcription elongation arrest factor inhibits RNA polymerase translocation. In vivo, Nun acts specifically to block transcription of the coliphage λ chromosome. Using in vitro assays, we demonstrate that Nun cross-links RNA in an RNA:DNA hybrid within a ternary elongation complex (TEC). Both the 5′ and the 3′ ends of the RNA cross-link Nun, implying that Nun contacts RNA polymerase both at the upstream edge of the RNA:DNA hybrid and in the vicinity of the catalytic center. This finding suggests that Nun may inhibit translocation by more than one mechanism. Transcription elongation factor GreA efficiently blocked Nun cross-linking to the 3′ end of the transcript, whereas the highly homologous GreB factor did not. Surprisingly, both factors strongly suppressed Nun cross-linking to the 5′ end of the RNA, suggesting that GreA and GreB can enter the RNA exit channel as well as the secondary channel, where they are known to bind. These findings extend the known action mechanism for these ubiquitous cellular factors. PMID:27436904

The external amino acid signaling pathway promotes activation of Stp1 and Uga35/Dal81 transcription factors for induction of the AGP1 gene in Saccharomyces cerevisiae.

PubMed Central

Abdel-Sater, Fadi; Iraqui, Ismaïl; Urrestarazu, Antonio; André, Bruno

2004-01-01

Yeast cells respond to the presence of amino acids in their environment by inducing transcription of several amino acid permease genes including AGP1, BAP2, and BAP3. The signaling pathway responsible for this induction involves Ssy1, a permease-like sensor of external amino acids, and culminates with proteolytic cleavage and translocation to the nucleus of the zinc-finger proteins Stp1 and Stp2, the lack of which abolishes induction of BAP2 and BAP3. Here we show that Stp1-but not Stp2-plays an important role in AGP1 induction, although significant induction of AGP1 by amino acids persists in stp1 and stp1 stp2 mutants. This residual induction depends on the Uga35/Dal81 transcription factor, indicating that the external amino acid signaling pathway activates not only Stp1 and Stp2, but also another Uga35/Dal81-dependent transcriptional circuit. Analysis of the AGP1 gene's upstream region revealed that Stp1 and Uga35/Dal81 act synergistically through a 21-bp cis-acting sequence similar to the UAS(AA) element previously found in the BAP2 and BAP3 upstream regions. Although cells growing under poor nitrogen-supply conditions display much higher induction of AGP1 expression than cells growing under good nitrogen-supply conditions, the UAS(AA) itself is totally insensitive to nitrogen availability. Nitrogen-source control of AGP1 induction is mediated by the GATA factor Gln3, likely acting through adjacent 5'-GATA-3' sequences, to amplify the positive effect of UAS(AA). Our data indicate that Stp1 may act in combination with distinct sets of transcription factors, according to the gene context, to promote induction of transcription in response to external amino acids. The data also suggest that Uga35/Dal81 is yet another transcription factor under the control of the external amino acid sensing pathway. Finally, the data show that the TOR pathway mediating global nitrogen control of transcription does not interfere with the external amino acid signaling pathway. PMID:15126393

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana.

PubMed

Qin, Yuxiang; Tian, Yanchen; Han, Lu; Yang, Xinchao

2013-10-25

The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway. Copyright © 2013. Published by Elsevier Inc.

Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

PubMed

Calonge, María Julia; Seoane, Joan; Massagué, Joan

2004-05-28

A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

Activation of YUCCA5 by the Transcription Factor TCP4 Integrates Developmental and Environmental Signals to Promote Hypocotyl Elongation in Arabidopsis.

PubMed

Challa, Krishna Reddy; Aggarwal, Pooja; Nath, Utpal

2016-09-05

Cell expansion is an essential process in plant morphogenesis and is regulated by the coordinated action of environmental stimuli and endogenous factors, such as the phytohormones auxin and brassinosteroid. Although the biosynthetic pathways that generate these hormones and their downstream signaling mechanisms have been extensively studied, the upstream transcriptional network that modulates their levels and connects their action to cell morphogenesis is less clear. Here we show that the miR319-regulated TCP (TEOSINTE BRANCHED 1, CYCLODEA, PROLIFERATING CELL FACTORS) transcription factors, notably TCP4, directly activate YUCCA5 transcription and integrate the auxin response to a brassinosteroid-dependent molecular circuit that promotes cell elongation in Arabidopsis hypocotyls. Further, TCP4 modulates the common transcriptional network downstream to auxin-BR signaling, which is also triggered by environmental cues, such as light, to promote cell expansion. Our study links TCP function with the hormone response during cell morphogenesis and shows that developmental and environmental signals converge on a common transcriptional network to promote cell elongation. {copyright, serif} 2016 American Society of Plant Biologists. All rights reserved.

Interplay between cardiac transcription factors and non-coding RNAs in predisposing to atrial fibrillation.

PubMed

Mikhailov, Alexander T; Torrado, Mario

2018-05-12

There is growing evidence that putative gene regulatory networks including cardio-enriched transcription factors, such as PITX2, TBX5, ZFHX3, and SHOX2, and their effector/target genes along with downstream non-coding RNAs can play a potentially important role in the process of adaptive and maladaptive atrial rhythm remodeling. In turn, expression of atrial fibrillation-associated transcription factors is under the control of upstream regulatory non-coding RNAs. This review broadly explores gene regulatory mechanisms associated with susceptibility to atrial fibrillation-with key examples from both animal models and patients-within the context of both cardiac transcription factors and non-coding RNAs. These two systems appear to have multiple levels of cross-regulation and act coordinately to achieve effective control of atrial rhythm effector gene expression. Perturbations of a dynamic expression balance between transcription factors and corresponding non-coding RNAs can provoke the development or promote the progression of atrial fibrillation. We also outline deficiencies in current models and discuss ongoing studies to clarify remaining mechanistic questions. An understanding of the function of transcription factors and non-coding RNAs in gene regulatory networks associated with atrial fibrillation risk will enable the development of innovative therapeutic strategies.

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

PubMed

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Constitutive Expression of a Transcription Termination Factor by a Repressed Prophage: Promoters for Transcribing the Phage HK022 nun Gene

PubMed Central

King, Rodney A.; Madsen, Peter L.; Weisberg, Robert A.

2000-01-01

Lysogens of phage HK022 are resistant to infection by phage λ. Lambda resistance is caused by the action of the HK022 Nun protein, which prematurely terminates early λ transcripts. We report here that transcription of the nun gene initiates at a constitutive prophage promoter, PNun, located just upstream of the protein coding sequence. The 5′ end of the transcript was determined by primer extension analysis of RNA isolated from HK022 lysogens or RNA made in vitro by transcribing a template containing the promoter with purified Escherichia coli RNA polymerase. Inactivation of PNun by mutation greatly reduced Nun activity and Nun antigen in an HK022 lysogen. However, a low level of residual activity was detected, suggesting that a secondary promoter also contributes to nun expression. We found one possible secondary promoter, PNun′, just upstream of PNun. Neither promoter is likely to increase the expression of other phage genes in a lysogen because their transcripts should be terminated downstream of nun. We estimate that HK022 lysogens in stationary phase contain several hundred molecules of Nun per cell and that cells in exponential phase probably contain fewer. PMID:10629193

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.

PubMed

Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C

2010-05-01

Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

PubMed Central

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-01-01

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

PubMed

Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

2018-05-09

Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

A Serratia marcescens PigP Homolog Controls Prodigiosin Biosynthesis, Swarming Motility and Hemolysis and Is Regulated by cAMP-CRP and HexS

PubMed Central

Shanks, Robert M. Q.; Lahr, Roni M.; Stella, Nicholas A.; Arena, Kristin E.; Brothers, Kimberly M.; Kwak, Daniel H.; Liu, Xinyu; Kalivoda, Eric J.

2013-01-01

Swarming motility and hemolysis are virulence-associated determinants for a wide array of pathogenic bacteria. The broad host-range opportunistic pathogen Serratia marcescens produces serratamolide, a small cyclic amino-lipid, that promotes swarming motility and hemolysis. Serratamolide is negatively regulated by the transcription factors HexS and CRP. Positive regulators of serratamolide production are unknown. Similar to serratamolide, the antibiotic pigment, prodigiosin, is regulated by temperature, growth phase, HexS, and CRP. Because of this co-regulation, we tested the hypothesis that a homolog of the PigP transcription factor of the atypical Serratia species ATCC 39006, which positively regulates prodigiosin biosynthesis, is also a positive regulator of serratamolide production in S. marcescens. Mutation of pigP in clinical, environmental, and laboratory strains of S. marcescens conferred pleiotropic phenotypes including the loss of swarming motility, hemolysis, and severely reduced prodigiosin and serratamolide synthesis. Transcriptional analysis and electrophoretic mobility shift assays place PigP in a regulatory pathway with upstream regulators CRP and HexS. The data from this study identifies a positive regulator of serratamolide production, describes novel roles for the PigP transcription factor, shows for the first time that PigP directly regulates the pigment biosynthetic operon, and identifies upstream regulators of pigP. This study suggests that PigP is important for the ability of S. marcescens to compete in the environment. PMID:23469212

PAX3-FOXO1: Zooming in on an "undruggable" target.

PubMed

Wachtel, Marco; Schäfer, Beat W

2018-06-01

Driver oncogenes are prime targets for therapy in tumors many of which, including leukemias and sarcomas, express recurrent fusion transcription factors. One specific example for such a cancer type is alveolar rhabdomyosarcoma, which is associated in the majority of cases with the fusion protein PAX3-FOXO1. Since fusion transcription factors are challenging targets for development of small molecule inhibitors, indirect inhibitory strategies for this type of oncogenes represent a more promising approach. One can envision strategies at different molecular levels including upstream modifiers and activators, epigenetic and transcriptional co-regulators, and downstream effector targets. In this review, we will discuss the current knowledge regarding potential therapeutic targets that might contribute to indirect interference with PAX3-FOXO1 activity in alveolar rhabdomyosarcoma at the different molecular levels and extrapolate these findings to fusion transcription factors in general. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

PubMed

Lee, S H; Minowa, M T; Mouradian, M M

1996-10-11

The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has two functional TATA-less promoters, both in D1A expressing cultured neuroblastoma cells and in the human striatum.

TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease

PubMed Central

Coin, Frédéric; Frit, Philippe; Viollet, Benoit; Salles, Bernard; Egly, Jean-Marc

1998-01-01

DNA damage recognition by basal transcription factors follows different mechanisms. Using transcription-competition, nitrocellulose filter binding, and DNase I footprinting assays, we show that, although the general transcription factor TFIIH is able to target any kind of lesion which can be repaired by the nucleotide excision repair pathway, TATA binding protein (TBP)-TFIID is more selective in damage recognition. Only genotoxic agents which are able to induce kinked DNA structures similar to the one for the TATA box in its TBP complex are recognized. Indeed, DNase I footprinting patterns reveal that TBP protects equally 4 nucleotides upstream and 6 nucleotides downstream from the A-T (at position −29 of the noncoding strand) of the adenovirus major late promoter and from the G-G of a cisplatin-induced 1,2-d(GpG) cross-link. Together, our results may partially explain differences in transcription inhibition rates following DNA damage. PMID:9632775

COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

PubMed Central

Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

2002-01-01

Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

Genomic identification of direct target genes of LEAFY

PubMed Central

William, Dilusha A.; Su, Yanhui; Smith, Michael R.; Lu, Meina; Baldwin, Don A.; Wagner, Doris

2004-01-01

The switch from vegetative to reproductive development in plants necessitates a switch in the developmental program of the descendents of the stem cells in the shoot apical meristem. Genetic and molecular investigations have demonstrated that the plant-specific transcription factor and meristem identity regulator LEAFY (LFY) controls this developmental transition by inducing expression of a second transcription factor, APETALA1, and by regulating the expression of additional, as yet unknown, genes. Here we show that the additional LFY targets include the APETALA1-related factor, CAULI-FLOWER, as well as three transcription factors and two putative signal transduction pathway components. These genes are up-regulated by LFY even when protein synthesis is inhibited and, hence, appear to be direct targets of LFY. Supporting this conclusion, cis-regulatory regions upstream of these genes are bound by LFY in vivo. The newly identified LFY targets likely initiate the transcriptional changes that are required for the switch from vegetative to reproductive development in Arabidopsis. PMID:14736918

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed Central

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-01-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-03-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

Activation of the Cph1-Dependent MAP Kinase Signaling Pathway Induces White-Opaque Switching in Candida albicans

PubMed Central

Ramírez-Zavala, Bernardo; Weyler, Michael; Gildor, Tsvia; Schmauch, Christian; Kornitzer, Daniel; Arkowitz, Robert; Morschhäuser, Joachim

2013-01-01

Depending on the environmental conditions, the pathogenic yeast Candida albicans can undergo different developmental programs, which are controlled by dedicated transcription factors and upstream signaling pathways. C. albicans strains that are homozygous at the mating type locus can switch from the normal yeast form (white) to an elongated cell type (opaque), which is the mating-competent form of this fungus. Both white and opaque cells use the Ste11-Hst7-Cek1/Cek2 MAP kinase signaling pathway to react to the presence of mating pheromone. However, while opaque cells employ the transcription factor Cph1 to induce the mating response, white cells recruit a different downstream transcription factor, Tec1, to promote the formation of a biofilm that facilitates mating of opaque cells in the population. The switch from the white to the opaque cell form is itself induced by environmental signals that result in the upregulation of the transcription factor Wor1, the master regulator of white-opaque switching. To get insight into the upstream signaling pathways controlling the switch, we expressed all C. albicans protein kinases from a tetracycline-inducible promoter in a switching-competent strain. Screening of this library of strains showed that a hyperactive form of Ste11 lacking its N-terminal domain (Ste11ΔN467) efficiently stimulated white cells to switch to the opaque phase, a behavior that did not occur in response to pheromone. Ste11ΔN467-induced switching specifically required the downstream MAP kinase Cek1 and its target transcription factor Cph1, but not Cek2 and Tec1, and forced expression of Cph1 also promoted white-opaque switching in a Wor1-dependent manner. Therefore, depending on the activation mechanism, components of the pheromone-responsive MAP kinase pathway can be reconnected to stimulate an alternative developmental program, switching of white cells to the mating-competent opaque phase. PMID:24130492

Osteoblast-specific transcription factor Osterix (Osx) is an upstream regulator of Satb2 during bone formation.

PubMed

Tang, Wanjin; Li, Yang; Osimiri, Lindsey; Zhang, Chi

2011-09-23

Osterix (Osx) is an osteoblast-specific transcription factor essential for osteoblast differentiation and bone formation. Osx knock-out mice lack bone completely. Satb2 is critical for osteoblast differentiation as a special AT-rich binding transcription factor. It is not known how Satb2 is transcriptionally regulated during bone formation. In this study, quantitative real-time RT-PCR results demonstrated that Satb2 was down-regulated in Osx-null calvaria. In stable C2C12 mesenchymal cells using the tetracycline (Tet)-Off system, overexpression of Osx stimulated Satb2 expression. Moreover, inhibition of Osx by siRNA led to repression of Satb2 expression in osteoblasts. These results suggest that Osx controls Satb2 expression. Transient transfection assay showed that Osx activated 1kb Satb2 promoter reporter activity in a dose-dependent manner. To define the region of Satb2 promoter responsive to Osx activation, a series of deletion mutants of Satb2 constructs were made, and the minimal region was narrowed down to the proximal 130 bp of the Satb2 promoter. Further point mutation studies found that two GC-rich region mutations disrupted the Satb2 130bp promoter activation by Osx, suggesting that these GC-rich binding sites were responsible for Satb2 activation by Osx. Gel shift assay showed that Osx bound to the Satb2 promoter sequence directly. ChIP assays indicated that endogenous Osx associated with the native Satb2 promoter in osteoblasts. Importantly, Satb2 siRNA significantly inhibited Osx-induced osteoblast marker gene expressions. Taken together, our findings indicate that Osx is an upstream regulator of Satb2 during bone formation. This reveals a new additional link of the transcriptional regulation mechanism that Osx controls bone formation.

Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

PubMed Central

Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

2003-01-01

The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

The fundamental ribosomal RNA transcription initiation factor-IB (TIF-IB, SL1, factor D) binds to the rRNA core promoter primarily by minor groove contacts.

PubMed

Geiss, G K; Radebaugh, C A; Paule, M R

1997-11-14

Acanthamoeba castellanii transcription initiation factor-IB (TIF-IB) is the TATA-binding protein-containing transcription factor that binds the rRNA promoter to form the committed complex. Minor groove-specific drugs inhibit TIF-IB binding, with higher concentrations needed to disrupt preformed complexes because of drug exclusion by bound TIF-IB. TIF-IB/DNA interactions were mapped by hydroxyl radical and uranyl nitrate footprinting. TIF-IB contacts four minor grooves in its binding site. TIF-IB and DNA wrap around each other in a right-handed superhelix of high pitch, so the upstream and downstream contacts are on opposite faces of the helix. Dimethyl sulfate protection assays revealed limited contact with a few guanines in the major groove. This detailed analysis suggests significant DNA conformation dependence of the interaction.

eXpression2Kinases (X2K) Web: linking expression signatures to upstream cell signaling networks.

PubMed

Clarke, Daniel J B; Kuleshov, Maxim V; Schilder, Brian M; Torre, Denis; Duffy, Mary E; Keenan, Alexandra B; Lachmann, Alexander; Feldmann, Axel S; Gundersen, Gregory W; Silverstein, Moshe C; Wang, Zichen; Ma'ayan, Avi

2018-05-25

While gene expression data at the mRNA level can be globally and accurately measured, profiling the activity of cell signaling pathways is currently much more difficult. eXpression2Kinases (X2K) computationally predicts involvement of upstream cell signaling pathways, given a signature of differentially expressed genes. X2K first computes enrichment for transcription factors likely to regulate the expression of the differentially expressed genes. The next step of X2K connects these enriched transcription factors through known protein-protein interactions (PPIs) to construct a subnetwork. The final step performs kinase enrichment analysis on the members of the subnetwork. X2K Web is a new implementation of the original eXpression2Kinases algorithm with important enhancements. X2K Web includes many new transcription factor and kinase libraries, and PPI networks. For demonstration, thousands of gene expression signatures induced by kinase inhibitors, applied to six breast cancer cell lines, are provided for fetching directly into X2K Web. The results are displayed as interactive downloadable vector graphic network images and bar graphs. Benchmarking various settings via random permutations enabled the identification of an optimal set of parameters to be used as the default settings in X2K Web. X2K Web is freely available from http://X2K.cloud.

Transcriptional requirements of the distal heavy-strand promoter of mtDNA

PubMed Central

Zollo, Ornella; Tiranti, Valeria; Sondheimer, Neal

2012-01-01

The heavy strand of mtDNA contains two promoters with nonoverlapping functions. The role of the minor heavy-strand promoter (HSP2) is controversial, because the promoter has been difficult to activate in an in vitro system. We have isolated HSP2 by excluding its interaction with the more powerful HSP1 promoter, and we find that it is transcribed efficiently by recombinant mtRNA polymerase and mitochondrial transcription factor B2. The mitochondrial transcription factor A is not required for initiation, but it has the ability to alternatively activate and repress the HSP2 transcriptional unit depending on the ratio between mitochondrial transcription factor A and other transcription factors. The positioning of transcriptional initiation agrees with our current understanding of HSP2 activity in vivo. Serial deletion of HSP2 shows that only proximal sequences are required. Several mutations, including the disruption of a polycytosine track upstream of the HSP2 initiation site, influence transcriptional activity. Transcription from HSP2 is also observed when HeLa cell mitochondrial extract is used as the source of mitochondrial polymerase, and this transcription is maintained when HSP2 is provided in proper spacing and context to the HSP1 promoter. Studies of the linked heavy-strand promoters show that they are differentially regulated by ATP dosage. We conclude that HSP2 is transcribed and has features that allow it to regulate mitochondrial mRNA synthesis. PMID:22454497

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com

Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Yuxiang, E-mail: yuxiangqin@126.com; Tian, Yanchen; Han, Lu

Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusionmore » between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway.« less

An MSC2 Promoter-lacZ Fusion Gene Reveals Zinc-Responsive Changes in Sites of Transcription Initiation That Occur across the Yeast Genome

PubMed Central

Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.

2016-01-01

The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924

Growth and stress response mechanisms underlying post-feeding regenerative organ growth in the Burmese python.

PubMed

Andrew, Audra L; Perry, Blair W; Card, Daren C; Schield, Drew R; Ruggiero, Robert P; McGaugh, Suzanne E; Choudhary, Amit; Secor, Stephen M; Castoe, Todd A

2017-05-02

Previous studies examining post-feeding organ regeneration in the Burmese python (Python molurus bivittatus) have identified thousands of genes that are significantly differentially regulated during this process. However, substantial gaps remain in our understanding of coherent mechanisms and specific growth pathways that underlie these rapid and extensive shifts in organ form and function. Here we addressed these gaps by comparing gene expression in the Burmese python heart, liver, kidney, and small intestine across pre- and post-feeding time points (fasted, one day post-feeding, and four days post-feeding), and by conducting detailed analyses of molecular pathways and predictions of upstream regulatory molecules across these organ systems. Identified enriched canonical pathways and upstream regulators indicate that while downstream transcriptional responses are fairly tissue specific, a suite of core pathways and upstream regulator molecules are shared among responsive tissues. Pathways such as mTOR signaling, PPAR/LXR/RXR signaling, and NRF2-mediated oxidative stress response are significantly differentially regulated in multiple tissues, indicative of cell growth and proliferation along with coordinated cell-protective stress responses. Upstream regulatory molecule analyses identify multiple growth factors, kinase receptors, and transmembrane receptors, both within individual organs and across separate tissues. Downstream transcription factors MYC and SREBF are induced in all tissues. These results suggest that largely divergent patterns of post-feeding gene regulation across tissues are mediated by a core set of higher-level signaling molecules. Consistent enrichment of the NRF2-mediated oxidative stress response indicates this pathway may be particularly important in mediating cellular stress during such extreme regenerative growth.

The TCP4 transcription factor regulates trichome cell differentiation by directly activating GLABROUS INFLORESCENCE STEMS in Arabidopsis thaliana.

PubMed

Vadde, Batthula Vijaya Lakshmi; Challa, Krishna Reddy; Nath, Utpal

2018-01-01

Trichomes are the first cell type to be differentiated during the morphogenesis of leaf epidermis and serve as an ideal model to study cellular differentiation. Many genes involved in the patterning and differentiation of trichome cells have been studied over the past decades, and the majority of these genes encode transcription factors that specifically regulate epidermal cell development. However, the upstream regulators of these genes that link early leaf morphogenesis with cell type differentiation are less studied. The TCP proteins are the plant-specific transcription factors involved in regulating diverse aspects of plant development including lateral organ morphogenesis by modulating cell proliferation and differentiation. Here, we show that the miR319-regulated class II TCP proteins, notably TCP4, suppress trichome branching in Arabidopsis leaves and inflorescence stem by direct transcriptional activation of GLABROUS INFLORESCENCE STEMS (GIS), a known negative regulator of trichome branching. The trichome branch number is increased in plants with reduced TCP activity and decreased in the gain-of-function lines of TCP4. Biochemical analyses show that TCP4 binds to the upstream regulatory region of GIS and activates its expression. Detailed genetic analyses show that GIS and TCP4 work in same pathway and GIS function is required for TCP4-mediated regulation of trichome differentiation. Taken together, these results identify a role for the class II TCP genes in trichome differentiation, thus providing a connection between organ morphogenesis and cellular differentiation. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

REGULATION OF INFLAMMATORY TRANSCRIPTION FACTORS BY HEAT SHOCK PROTEIN 70 IN PRIMARY CULTURED ASTROCYTES EXPOSED TO OXYGEN–GLUCOSE DEPRIVATION

PubMed Central

KIM, J. Y.; YENARI, M. A.; LEE, J. E.

2018-01-01

Inflammation is an important event in ischemic injury. These immune responses begin with the expression of pro-inflammatory genes modulating transcription factors, such as nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and signal transducers and activator of transcription-1 (STAT-1). The 70-kDa heat shock protein (Hsp70) can both induce and arrest inflammatory reactions and lead to improved neurological outcome in experimental brain injury and ischemia. Since Hsp70 are induced under heat stress, we investigated the link between Hsp70 neuroprotection and phosphorylation of inhibitor of κB (IκB), c-Jun N-terminal kinases (JNK) and p38 through co-immunoprecipitation and enzyme-linked immunosorbent assay (ELISA) assay. Transcription factors and pro-inflammatory genes were quantified by immunoblotting, electrophoretic-mobility shift assay and reverse transcription-polymerase chain reaction assays. The results showed that heat stress led to Hsp70 overexpression which rendered neuroprotection after ischemia-like injury. Overexpression Hsp70 also interrupts the phosphorylation of IκB, JNK and p38 and bluntsDNA binding of their transcription factors (NF-κB, AP-1 and STAT-1), effectively downregulating the expression of pro-inflammatory genes inheat-pretreatedastrocytes. Takentogether, these results suggest that overexpression of Hsp70 may protect against brain ischemia via an anti-inflammatory mechanism by interrupting the phosphorylation of upstream of transcription factors. PMID:25485480

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

PubMed

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-07-27

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Characterization of a spliced variant of human IRF-3 promoter and its regulation by the transcription factor Sp1.

PubMed

Ren, Wei; Zhu, Liang-Hua; Xu, Hua-Guo; Jin, Rui; Zhou, Guo-Ping

2012-06-01

Interferon regulatory factor 3 (IRF-3), an essential transcriptional regulator of the interferon genes, plays an important role in host defense against viral and microbial infection as well as in cell growth regulation. Promoter plays a crucial role in gene transcription. We have reported the characterization of the wide type of human IRF-3 promoter, but the characterization of the spliced variant of human IRF-3 Int2V1 promoter has not been systematically analyzed. To observe the spliced variant of human IRF-3 promoter, we have cloned the human IRF-3 gene promoter region containing 300 nucleotides upstream the transcription start site (TSS). Transient transfection of 5' deleted promoter-reporter constructs and luciferase assay illustrated the region -159/-100 relative to the TSS is sufficient for full promoter activity. This region contains GATA1 and specific protein-1 (Sp1) transcription factor binding sites. Interestingly, mutation of this Sp1 site reduced the promoter activity by 50%. However, overexpression of Sp1 increased the transcription activity by 2.4-fold. These results indicated that the spliced variant of human IRF-3 gene core promoter was located within the region -159/-100 relative to the TSS. Sp1 transcription factor upregulates the spliced variant of human IRF-3 gene promoter.

Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

PubMed Central

Lloyd, G S; Busby, S J; Savery, N J

1998-01-01

During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

Two transcriptional activators of N-acetylserotonin O-methyltransferase 2 and melatonin biosynthesis in cassava.

PubMed

Wei, Yunxie; Liu, Guoyin; Bai, Yujing; Xia, Feiyu; He, Chaozu; Shi, Haitao; Foyer, Christine

2017-10-13

Similar to the situation in animals, melatonin biosynthesis is regulated by four sequential enzymatic steps in plants. Although the melatonin synthesis genes have been identified in various plants, the upstream transcription factors of them remain unknown. In this study on cassava (Manihot esculenta), we found that MeWRKY79 and heat-shock transcription factor 20 (MeHsf20) targeted the W-box and the heat-stress elements (HSEs) in the promoter of N-acetylserotonin O-methyltransferase 2 (MeASMT2), respectively. The interaction between MeWRKY79, MeHsf20, and the MeASMT2 promoter was evidenced by the activation of promoter activity and chromatin immunoprecipitation (ChIP) in cassava protoplasts, and by an in vitro electrophoretic mobility shift assay (EMSA). The transcripts of MeWRKY79, MeHsf20, and MeASMT2 were all regulated by a 22-amino acid flagellin peptide (flg22) and by Xanthomonas axonopodis pv manihotis (Xam). In common with the phenotype of MeASMT2, transient expression of MeWRKY79 and MeHsf20 in Nicotiana benthamiana leaves conferred improved disease resistance. Through virus-induced gene silencing (VIGS) in cassava, we found that MeWRKY79- and MeHsf20-silenced plants showed lower transcripts of MeASMT2 and less accumulation of melatonin, which resulted in disease sensitivity that could be reversed by exogenous melatonin. Taken together, these results indicate that MeASMT2 is a target of MeWRKY79 and MeHsf20 in plant disease resistance. This study identifies novel upstream transcription factors of melatonin synthesis genes in cassava, thus extending our knowledge of the complex modulation of melatonin synthesis in plant defense. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Rapid detection of biothreat agents based on cellular machinery.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lane, Todd W.; Gantt, Richard W.

This research addresses rapid and sensitive identification of biological agents in a complex background. We attempted to devise a method by which the specificity of the cellular transcriptional machinery could be used to detect and identify bacterial bio-terror agents in a background of other organisms. Bacterial cells contain RNA polymerases and transcription factors that transcribe genes into mRNA for translation into proteins. RNA polymerases in conjunction with transcription factors recognize regulatory elements (promoters) upstream of the gene. These promoters are, in many cases, recognized by the polymerase and transcription factor combinations of one species only. We have engineered a plasmid,more » for Escherichia coli, containing the virA promoter from the target species Shigella flexneri. This promoter was fused to a reporter gene Green Fluorescent Protein (GFP). In theory the indicator strain (carrying the plasmid) is mixed with the target strain and the two are lysed. The cellular machinery from both cells mixes and the GFP is produced. This report details the results of testing this system.« less

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-11-11

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed Central

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-01-01

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

FOXD3 inhibits SCN2A gene transcription in intractable epilepsy cell models.

PubMed

Xiang, Jun; Wen, Fang; Zhang, Lingyun; Zhou, Yu

2018-04-01

The expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) is closely related to the development of epilepsy. This study investigated regulatory element of the SCN2A gene involved in epilepsy. An intractable epilepsy cell model was constructed using hippocampal primary neurons and the SH-SY5Y cell line. SCN2A protein and gene expression in cells as well as the level of lactic acid dehydrogenase (LDH) in the cell culture supernatants was detected. Potential regulatory factors of SCN2A and its upstream regulatory elements were identified using the dual-luciferase reporter assay. Finally, the role of the hypothetical transcription factor in epilepsy was examined by using its small interfering RNA (siRNA). Results found that levels of LDH and expression of the hypothetical transcription factor, Forkhead box D3 (FOXD3), was both increased in the model cells, whereas that of SCN2A was decreased. The results of dual-luciferase reporter assays revealed that an upstream region of SCN2A gene spanning from nucleotides -1617 to -1470 was a transcription factor binding region and a trans-acting factor role of FOXD3 was identified in the core region (GGCAAAATTAT). Then the FOXD3 binding site was further verified by the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA). After SH-SY5Y cells were transfected with FOXD3 siRNA, the release of LDH into culture supernatants and the LDH expression levels in cells were significantly decreased. SCN2A expression in model cells was increased by knockdown of FOXD3. Therefore, this study demonstrated that FOXD3 is a trans-acting factor of SCN2A, and this mechanism may play a role in cell injury after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Translation of the mRNA of the maize transcriptional activator Opaque-2 is inhibited by upstream open reading frames present in the leader sequence.

PubMed Central

Lohmer, S; Maddaloni, M; Motto, M; Salamini, F; Thompson, R D

1993-01-01

The protein encoded by the Opaque-2 (O2) gene is a transcription factor, translated from an mRNA that possesses an unusually long 5' leader sequence containing three upstream open reading frames (uORFs). The efficiency of translation of O2 mRNA has been tested in vivo by a transient assay in which the level of activation of the b32 promoter, a natural target of O2 protein, is measured. We show that uORF-less O2 alleles possess a higher transactivation value than the wild-type allele and that the reduction in transactivation due to the uORFs is a cis-dominant effect. The data presented indicate that both uORF1 and uORF2 are involved in the reducing effect and suggest that both are likely to be translated. PMID:8439744

Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells

PubMed Central

Leddin, Mathias; Perrod, Chiara; Hoogenkamp, Maarten; Ghani, Saeed; Assi, Salam; Heinz, Sven; Wilson, Nicola K.; Follows, George; Schönheit, Jörg; Vockentanz, Lena; Mosammam, Ali M.; Chen, Wei; Tenen, Daniel G.; Westhead, David R.; Göttgens, Berthold

2011-01-01

The transcription factor PU.1 occupies a central role in controlling myeloid and early B-cell development, and its correct lineage-specific expression is critical for the differentiation choice of hematopoietic progenitors. However, little is known of how this tissue-specific pattern is established. We previously identified an upstream regulatory cis element whose targeted deletion in mice decreases PU.1 expression and causes leukemia. We show here that the upstream regulatory cis element alone is insufficient to confer physiologic PU.1 expression in mice but requires the cooperation with other, previously unidentified elements. Using a combination of transgenic studies, global chromatin assays, and detailed molecular analyses we present evidence that PU.1 is regulated by a novel mechanism involving cross talk between different cis elements together with lineage-restricted autoregulation. In this model, PU.1 regulates its expression in B cells and macrophages by differentially associating with cell type–specific transcription factors at one of its cis-regulatory elements to establish differential activity patterns at other elements. PMID:21239694

Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

PubMed Central

Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

2005-01-01

Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

miR-141-3p functions as a tumor suppressor modulating activating transcription factor 5 in glioma.

PubMed

Wang, Mengyuan; Hu, Ming; Li, Zhaohua; Qian, Dongmeng; Wang, Bin; Liu, David X

2017-09-02

Glioma is the most common malignant primary brain tumor which arises from the central nervous system. Our studies reported that an anti-apoptotic factor, activating transcription factor 5 (ATF5), is highly expressed in malignant glioma specimens and cell lines. Downregulation by dominant-negetive ATF5 could repress glioma cell proliferation and accelerate apoptosis. Here, we further investigate the upstream factor which regulates ATF5 expression. Bioinformatic analysis showed that ATF5 was a potential target of miR-141-3p. Luciferase reporter assay verified that miR-141-3p specifically targeted the ATF5 3'-UTR in glioma cells. Functional studied suggested that miR-141-3p overexpression inhibited proliferation and promoted apoptosis of glioma cells (U87MG and U251). Xenograft experiments proved the inhibition of miR-141-3p on glioma growth in vivo. Moreover, exogenous ATF5 without 3'-UTR restored the cell proliferation inhibition triggered by miR-141-3p. Taken together, we put forward that miR-141-3p is a new upstream target towards ATF5. It can serve as a crucial tumor suppressor in regulating the ATF5-regulated growth of malignant glioma. Copyright © 2017 Elsevier Inc. All rights reserved.

A Network of HMG-box Transcription Factors Regulates Sexual Cycle in the Fungus Podospora anserina

PubMed Central

Ait Benkhali, Jinane; Coppin, Evelyne; Brun, Sylvain; Peraza-Reyes, Leonardo; Martin, Tom; Dixelius, Christina; Lazar, Noureddine; van Tilbeurgh, Herman; Debuchy, Robert

2013-01-01

High-mobility group (HMG) B proteins are eukaryotic DNA-binding proteins characterized by the HMG-box functional motif. These transcription factors play a pivotal role in global genomic functions and in the control of genes involved in specific developmental or metabolic pathways. The filamentous ascomycete Podospora anserina contains 12 HMG-box genes. Of these, four have been previously characterized; three are mating-type genes that control fertilization and development of the fruit-body, whereas the last one encodes a factor involved in mitochondrial DNA stability. Systematic deletion analysis of the eight remaining uncharacterized HMG-box genes indicated that none were essential for viability, but that seven were involved in the sexual cycle. Two HMG-box genes display striking features. PaHMG5, an ortholog of SpSte11 from Schizosaccharomyces pombe, is a pivotal activator of mating-type genes in P. anserina, whereas PaHMG9 is a repressor of several phenomena specific to the stationary phase, most notably hyphal anastomoses. Transcriptional analyses of HMG-box genes in HMG-box deletion strains indicated that PaHMG5 is at the hub of a network of several HMG-box factors that regulate mating-type genes and mating-type target genes. Genetic analyses revealed that this network also controls fertility genes that are not regulated by mating-type transcription factors. This study points to the critical role of HMG-box members in sexual reproduction in fungi, as 11 out of 12 members were involved in the sexual cycle in P. anserina. PaHMG5 and SpSte11 are conserved transcriptional regulators of mating-type genes, although P. anserina and S. pombe diverged 550 million years ago. Two HMG-box genes, SOX9 and its upstream regulator SRY, also play an important role in sex determination in mammals. The P. anserina and S. pombe mating-type genes and their upstream regulatory factor form a module of HMG-box genes analogous to the SRY/SOX9 module, revealing a commonality of sex regulation in animals and fungi. PMID:23935511

The Drosophila Extradenticle and Homothorax selector proteins control branchless/FGF expression in mesodermal bridge-cells.

PubMed

Merabet, Samir; Ebner, Andreas; Affolter, Markus

2005-08-01

The stereotyped outgrowth of tubular branches of the Drosophila tracheal system is orchestrated by the local and highly dynamic expression profile of branchless (bnl), which encodes a secreted fibroblast growth factor (FGF)-like molecule. Despite the importance of the spatial and temporal bnl regulation, little is known about the upstream mechanisms that establish its complex expression pattern. Here, we show that the Extradenticle and Homothorax selector proteins control bnl transcription in a single cell per segment, the mesodermal bridge-cell. In addition, we observed that a key determinant of bridge-cell specification, the transcription factor Hunchback, is also required for bnl expression. Therefore, we propose that one of the functions of the bridge-cell is to synthesize and secrete the chemoattractant Bnl. These findings provide a hitherto unknown and interesting link between combinatorial inputs of transcription factors, cell-specific ligand expression and organ morphogenesis.

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

Dynamic regulation of VEGF-inducible genes by an ERK/ERG/p300 transcriptional network.

PubMed

Fish, Jason E; Cantu Gutierrez, Manuel; Dang, Lan T; Khyzha, Nadiya; Chen, Zhiqi; Veitch, Shawn; Cheng, Henry S; Khor, Melvin; Antounians, Lina; Njock, Makon-Sébastien; Boudreau, Emilie; Herman, Alexander M; Rhyner, Alexander M; Ruiz, Oscar E; Eisenhoffer, George T; Medina-Rivera, Alejandra; Wilson, Michael D; Wythe, Joshua D

2017-07-01

The transcriptional pathways activated downstream of vascular endothelial growth factor (VEGF) signaling during angiogenesis remain incompletely characterized. By assessing the signals responsible for induction of the Notch ligand delta-like 4 (DLL4) in endothelial cells, we find that activation of the MAPK/ERK pathway mirrors the rapid and dynamic induction of DLL4 transcription and that this pathway is required for DLL4 expression. Furthermore, VEGF/ERK signaling induces phosphorylation and activation of the ETS transcription factor ERG, a prerequisite for DLL4 induction. Transcription of DLL4 coincides with dynamic ERG-dependent recruitment of the transcriptional co-activator p300. Genome-wide gene expression profiling identified a network of VEGF-responsive and ERG-dependent genes, and ERG chromatin immunoprecipitation (ChIP)-seq revealed the presence of conserved ERG-bound putative enhancer elements near these target genes. Functional experiments performed in vitro and in vivo confirm that this network of genes requires ERK, ERG and p300 activity. Finally, genome-editing and transgenic approaches demonstrate that a highly conserved ERG-bound enhancer located upstream of HLX (which encodes a transcription factor implicated in sprouting angiogenesis) is required for its VEGF-mediated induction. Collectively, these findings elucidate a novel transcriptional pathway contributing to VEGF-dependent angiogenesis. © 2017. Published by The Company of Biologists Ltd.

Functional Architecture of T7 RNA Polymerase Transcription Complexes

PubMed Central

Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

2007-01-01

Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

PubMed

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

PubMed Central

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

Rhodobase, a meta-analytical tool for reconstructing gene regulatory networks in a model photosynthetic bacterium.

PubMed

Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark

2011-02-01

We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

PubMed Central

Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

2014-01-01

The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

PubMed

Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

2008-06-01

The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

Transcription factor AP-2γ induces early Cdx2 expression and represses HIPPO signaling to specify the trophectoderm lineage

PubMed Central

Cao, Zubing; Carey, Timothy S.; Ganguly, Avishek; Wilson, Catherine A.; Paul, Soumen; Knott, Jason G.

2015-01-01

Cell fate decisions are fundamental to the development of multicellular organisms. In mammals the first cell fate decision involves segregation of the pluripotent inner cell mass and the trophectoderm, a process regulated by cell polarity proteins, HIPPO signaling and lineage-specific transcription factors such as CDX2. However, the regulatory mechanisms that operate upstream to specify the trophectoderm lineage have not been established. Here we report that transcription factor AP-2γ (TFAP2C) functions as a novel upstream regulator of Cdx2 expression and position-dependent HIPPO signaling in mice. Loss- and gain-of-function studies and promoter analysis revealed that TFAP2C binding to an intronic enhancer is required for activation of Cdx2 expression during early development. During the 8-cell to morula transition TFAP2C potentiates cell polarity to suppress HIPPO signaling in the outside blastomeres. TFAP2C depletion triggered downregulation of PARD6B, loss of apical cell polarity, disorganization of F-actin, and activation of HIPPO signaling in the outside blastomeres. Rescue experiments using Pard6b mRNA restored cell polarity but only partially corrected position-dependent HIPPO signaling, suggesting that TFAP2C negatively regulates HIPPO signaling via multiple pathways. Several genes involved in regulation of the actin cytoskeleton (including Rock1, Rock2) were downregulated in TFAP2C-depleted embryos. Inhibition of ROCK1 and ROCK2 activity during the 8-cell to morula transition phenocopied TFAP2C knockdown, triggering a loss of position-dependent HIPPO signaling and decrease in Cdx2 expression. Altogether, these results demonstrate that TFAP2C facilitates trophectoderm lineage specification by functioning as a key regulator of Cdx2 transcription, cell polarity and position-dependent HIPPO signaling. PMID:25858457

Xylem specific activation of 5' upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.

Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

PubMed Central

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

Integrated Module and Gene-Specific Regulatory Inference Implicates Upstream Signaling Networks

PubMed Central

Roy, Sushmita; Lagree, Stephen; Hou, Zhonggang; Thomson, James A.; Stewart, Ron; Gasch, Audrey P.

2013-01-01

Regulatory networks that control gene expression are important in diverse biological contexts including stress response and development. Each gene's regulatory program is determined by module-level regulation (e.g. co-regulation via the same signaling system), as well as gene-specific determinants that can fine-tune expression. We present a novel approach, Modular regulatory network learning with per gene information (MERLIN), that infers regulatory programs for individual genes while probabilistically constraining these programs to reveal module-level organization of regulatory networks. Using edge-, regulator- and module-based comparisons of simulated networks of known ground truth, we find MERLIN reconstructs regulatory programs of individual genes as well or better than existing approaches of network reconstruction, while additionally identifying modular organization of the regulatory networks. We use MERLIN to dissect global transcriptional behavior in two biological contexts: yeast stress response and human embryonic stem cell differentiation. Regulatory modules inferred by MERLIN capture co-regulatory relationships between signaling proteins and downstream transcription factors thereby revealing the upstream signaling systems controlling transcriptional responses. The inferred networks are enriched for regulators with genetic or physical interactions, supporting the inference, and identify modules of functionally related genes bound by the same transcriptional regulators. Our method combines the strengths of per-gene and per-module methods to reveal new insights into transcriptional regulation in stress and development. PMID:24146602

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Growth hormone and Pit-1 expression in bovine fetal lymphoid cells.

PubMed

Chen, H T; Schuler, L A; Schultz, R D

1997-11-01

Bovine fetal lymphoid cells were examined for growth hormone (GH) and the transcription factor Pit-1/GHF-1 mRNA. GH and Pit-1/GHF-1 transcripts were detected in thymocytes and splenocytes from fetuses at 60, 90, 120, and 270 d of gestation using reverse transcription-polymerase chain reaction (RT-PCR). Northern analysis indicated that the lymphoid GH mRNA was approximately 350 nucleotides larger than in the pituitary. RT-PCR analysis demonstrated that the coding regions as well as 3' untranslated region of the lymphocyte GH and pituitary transcripts were the same. Analysis of the 5'-untranslated region of the lymphocyte GH mRNA showed that transcription began upstream from the start site in the pituitary gland, suggesting differences in regulation in these tissues. Fetal thymocytes and splenocytes expressed Pit-1/GHF-1 mRNA; however, they contained only the 2.5-kb transcript. The GH and Pit-1/GHF-1 mRNA in fetal lymphoid cells supports the hypothesis that lymphocyte-derived GH may function as an autocrine and/or paracrine factor during the development and maturation of the bovine fetal immune system.

Sense transcription through the S region is essential for immunoglobulin class switch recombination

PubMed Central

Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

2011-01-01

Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

Purification and characterization of human mitochondrial transcription factor 1.

PubMed Central

Fisher, R P; Clayton, D A

1988-01-01

We purified to near homogeneity a transcription factor from human KB cell mitochondria. This factor, designated mitochondrial transcription factor 1 (mtTF1), is required for the in vitro recognition of both major promoters of human mitochondrial DNA by the homologous mitochondrial RNA polymerase. Furthermore, it has been shown to bind upstream regulatory elements of the two major promoters. After separation from RNA polymerase by phosphocellulose chromatography, mtTF1 was chromatographed on a MonoQ anion-exchange fast-performance liquid chromatography column. Analysis of mtTF1-containing fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single major polypeptide with an Mr of approximately 25,000. Centrifugation in analytical glycerol gradients indicated a sedimentation coefficient of approximately 2.5 S, consistent with a monomeric 25-kilodalton protein. Finally, when the 25-kilodalton polypeptide was excised from a stained sodium dodecyl sulfate-polyacrylamide gel and allowed to renature, it regained DNA-binding and transcriptional stimulatory activities at both promoters. Although mtTF1 is the only mitochondrial DNA-binding transcription factor to be purified and characterized, its properties, such as a high affinity for random DNA and a weak specificity for one of its target sequences, may typify this class of regulatory proteins. Images PMID:3211148

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

The Treacher Collins syndrome (TCOF1) gene product is involved in ribosomal DNA gene transcription by interacting with upstream binding factor.

PubMed

Valdez, Benigno C; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J

2004-07-20

Treacher Collins syndrome (TCS) is an autosomal dominant disorder characterized by an abnormality of craniofacial development that arises during early embryogenesis. TCS is caused by mutations in the gene TCOF1, which encodes the nucleolar phosphoprotein treacle. Even though the genetic alterations causing TCS have been uncovered, the mechanism underlying its pathogenesis and the function of treacle remain unknown. Here, we show that treacle is involved in ribosomal DNA gene transcription by interacting with upstream binding factor (UBF). Immunofluorescence labeling shows treacle and UBF colocalize to specific nucleolar organizer regions and cosegregate within nucleolar caps of actinomycin d-treated HeLa cells. Biochemical analysis shows the association of treacle and UBF with chromatin. Immunoprecipitation and the yeast two-hybrid system both suggest physical interaction of the two nucleolar phosphoproteins. Down-regulation of treacle expression using specific short interfering RNA results in inhibition of ribosomal DNA transcription and cell growth. A similar correlation is observed in Tcof(+/-) mouse embryos that exhibit craniofacial defects and growth retardation. Thus, treacle haploinsufficiency in TCS patients might result in abnormal development caused by inadequate ribosomal RNA production in the prefusion neural folds during the early stages of embryogenesis. The elucidation of a physiological function of treacle provides important information of relevance to the molecular dissection of the biochemical pathology of TCS.

The Treacher Collins syndrome (TCOF1) gene product is involved in ribosomal DNA gene transcription by interacting with upstream binding factor

PubMed Central

Valdez, Benigno C.; Henning, Dale; So, Rolando B.; Dixon, Jill; Dixon, Michael J.

2004-01-01

Treacher Collins syndrome (TCS) is an autosomal dominant disorder characterized by an abnormality of craniofacial development that arises during early embryogenesis. TCS is caused by mutations in the gene TCOF1, which encodes the nucleolar phosphoprotein treacle. Even though the genetic alterations causing TCS have been uncovered, the mechanism underlying its pathogenesis and the function of treacle remain unknown. Here, we show that treacle is involved in ribosomal DNA gene transcription by interacting with upstream binding factor (UBF). Immunofluorescence labeling shows treacle and UBF colocalize to specific nucleolar organizer regions and cosegregate within nucleolar caps of actinomycin d-treated HeLa cells. Biochemical analysis shows the association of treacle and UBF with chromatin. Immunoprecipitation and the yeast two-hybrid system both suggest physical interaction of the two nucleolar phosphoproteins. Down-regulation of treacle expression using specific short interfering RNA results in inhibition of ribosomal DNA transcription and cell growth. A similar correlation is observed in Tcof+/- mouse embryos that exhibit craniofacial defects and growth retardation. Thus, treacle haploinsufficiency in TCS patients might result in abnormal development caused by inadequate ribosomal RNA production in the prefusion neural folds during the early stages of embryogenesis. The elucidation of a physiological function of treacle provides important information of relevance to the molecular dissection of the biochemical pathology of TCS. PMID:15249688

Pod-1/Capsulin shows a sex- and stage-dependent expression pattern in the mouse gonad development and represses expression of Ad4BP/SF-1.

PubMed

Tamura, M; Kanno, Y; Chuma, S; Saito, T; Nakatsuji, N

2001-04-01

Mammalian sex-determination and differentiation are controlled by several genes, such as Sry, Sox-9, Dax-1 and Mullerian inhibiting substance (MIS), but their upstream and downstream genes are largely unknown. Ad4BP/SF-1, encoding a zinc finger transcription factor, plays important roles in gonadogenesis. Disruption of this gene caused disappearance of the urogenital system including the gonad. Ad4BP/SF-1, however, is also involved in the sex differentiation of the gonad at later stages, such as the regulation of steroid hormones and MIS. Pod-1/Capsulin, a member of basic helix-loop-helix transcription factors, is expressed in a pattern closely related but mostly complimentary to that of the Ad4BP/SF-1 expression in the developing gonad. In the co-transfection experiment using cultured cells, overexpression of Pod-1/Capsulin repressed expression of a reporter gene that carried the upstream regulatory region of the Ad4BP/SF-1 gene. Furthermore, forced expression of Pod-1/Capsulin repressed expression of Ad4BP/SF-1 in the Leydig cell-derived I-10 cells. These results suggest that Pod-1/Capsulin may play important roles in the development and sex differentiation of the mammalian gonad via transcriptional regulation of Ad4BP/SF-1.

Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny

PubMed Central

Orengo, Dorcas J.; Aguadé, Montserrat

2017-01-01

The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426

Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait.

PubMed

Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi

2014-08-01

Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.

Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.

PubMed

Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N

1999-01-01

The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Redundant CArG Box Cis-motif Activity Mediates SHATTERPROOF2 Transcriptional Regulation during Arabidopsis thaliana Gynoecium Development

PubMed Central

Sehra, Bhupinder; Franks, Robert G.

2017-01-01

In the Arabidopsis thaliana seed pod, pod shatter and seed dispersal properties are in part determined by the development of a longitudinally orientated dehiscence zone (DZ) that derives from cells of the gynoecial valve margin (VM). Transcriptional regulation of the MADS protein encoding transcription factors genes SHATTERPROOF1 (SHP1) and SHATTERPROOF2 (SHP2) are critical for proper VM identity specification and later on for DZ development. Current models of SHP1 and SHP2 regulation indicate that the transcription factors FRUITFULL (FUL) and REPLUMLESS (RPL) repress these SHP genes in the developing valve and replum domains, respectively. Thus the expression of the SHP genes is restricted to the VM. FUL encodes a MADS-box containing transcription factor that is predicted to act through CArG-box containing cis-regulatory motifs. Here we delimit functional modules within the SHP2 cis-regulatory region and examine the functional importance of CArG box motifs within these regulatory regions. We have characterized a 2.2kb region upstream of the SHP2 translation start site that drives early and late medial domain expression in the gynoecium, as well as expression within the VM and DZ. We identified two separable, independent cis-regulatory modules, a 1kb promoter region and a 700bp enhancer region, that are capable of giving VM and DZ expression. Our results argue for multiple independent cis-regulatory modules that support SHP2 expression during VM development and may contribute to the robustness of SHP2 expression in this tissue. Additionally, three closely positioned CArG box motifs located in the SHP2 upstream regulatory region were mutated in the context of the 2.2kb reporter construct. Mutating simultaneously all three CArG boxes caused a moderate de-repression of the SHP2 reporter that was detected within the valve domain, suggesting that these CArG boxes are involved in SHP2 repression in the valve. PMID:29085379

Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks

PubMed Central

Merk, Karin; Breinig, Marco; Böttcher, Romy; Krebs, Stefan; Blum, Helmut; Boutros, Michael

2017-01-01

DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene’s first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks. PMID:28628606

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

Internal Associations of the Acidic Region of Upstream Binding Factor Control Its Nucleolar Localization.

PubMed

Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru

2017-11-15

Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.

Etsrp/etv2 is directly regulated by foxc1a/b in the zebrafish angioblast

PubMed Central

Veldman, Matthew B.; Lin, Shuo

2012-01-01

Rationale Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. Objective We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. Methods and Results To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all three regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative RT-PCR and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed while pronephric gene pax2a was relatively normal in expression level and pattern. Conclusions These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast. PMID:22135404

Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.

PubMed

Veldman, Matthew B; Lin, Shuo

2012-01-20

Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.

Integration host factor is necessary for lysogenization of Escherichia coli by bacteriophage P2.

PubMed

Saha, S; Haggård-Ljungquist, E; Nordström, K

1990-01-01

Whether infection by bacteriophage P2 results in lysogenization of the host or vegetative growth of the phage depends upon a race between transcription from the repressor promoter Pc and the early promoter Pe; transcription from these promoters is mutually exclusive, since the Pc repressor Cox is formed from the Pe transcript and the Pe repressor C from the Pc transcript. The involvement of integration host factor (IHF) in the lysogenization of Escherichia coli K12 by P2 was tested by comparing wild-type and IHF-deficient (himA and himD) mutants. No lysogenic clones were formed following infection of the mutant bacteria. A switch plasmid that contains Pc-C-cat and Pe-cox-kan was used to test the choice for expression of Pc versus Pe. In the wild-type K12 bacteria, 20% of the clones expressed Pe transcription and 80% Pc transcription, whereas all transformed IHF-defective clones expressed transcription from Pe only. The effects of IHF on the in vivo expression of the Pe and Pc promoters were only marginal. The IHF protein was found to bind upstream of the Pe promoter, where a potential ihf sequence is located.

Expression of different functional isoforms in haematopoiesis.

PubMed

Grech, Godfrey; Pollacco, Joel; Portelli, Mark; Sacco, Keith; Baldacchino, Shawn; Grixti, Justine; Saliba, Christian

2014-01-01

Haematopoiesis is a complex process regulated at various levels facilitating rapid responses to external factors including stress, modulation of lineage commitment and terminal differentiation of progenitors. Although the transcription program determines the RNA pool of a cell, various mRNA strands can be obtained from the same template, giving rise to multiple protein isoforms. The majority of variants and isoforms co-occur in normal haematopoietic cells or are differentially expressed at various maturity stages of progenitor maturation and cellular differentiation within the same lineage or across lineages. Genetic aberrations or specific cellular states result in the predominant expression of abnormal isoforms leading to deregulation and disease. The presence of upstream open reading frames (uORF) in 5' untranslated regions (UTRs) of a transcript, couples the utilization of start codons with the cellular status and availability of translation initiation factors (eIFs). In addition, tissue-specific and cell lineage-specific alternative promoter use, regulates several transcription factors producing transcript variants with variable 5' exons. In this review, we propose to give a detailed account of the differential isoform formation, causing haematological malignancies.

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

PubMed

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

Human Promoters Are Intrinsically Directional

PubMed Central

Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe

2015-01-01

Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469

Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

PubMed

Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

2018-04-06

The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

The ygaVP Genes of Escherichia coli Form a Tributyltin-Inducible Operon▿ †

PubMed Central

Gueuné, Hervé; Durand, Marie-José; Thouand, Gérald; DuBow, Michael S.

2008-01-01

A tributyltin (TBT) luxAB transcriptional fusion in Escherichia coli revealed that a TBT-activated promoter is located upstream of two cotranscribed orphan genes, ygaV and ygaP. We demonstrate that transcription from the promoter upstream of ygaVP is constitutive in a ygaVP mutant, suggesting that YgaV is an autoregulated, TBT-inducible repressor. PMID:18245262

CsSPL functions as an adaptor between HD-ZIP III and CsWUS transcription factors regulating anther and ovule development in cucumber

USDA-ARS?s Scientific Manuscript database

Anthers and ovules are the sex organs that produce male and female spores, respectively. The SPOROCYTELESS (SPL)/NOZZLE (NZZ) encodes a nuclear protein controlling the sporogenesis in sex organs. However, the function of SPL in unisexual plants has never been explored, and the upstream regulators of...

Transcriptional activation of Mina by Sp1/3 factors.

PubMed

Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

Transcriptional Activation of Mina by Sp1/3 Factors

PubMed Central

Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

2013-01-01

Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617

Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

PubMed Central

Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

2015-01-01

Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

PubMed Central

Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

2010-01-01

The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

The zinc finger gene Krox20 regulates HoxB2 (Hox2.8) during hindbrain segmentation.

PubMed

Sham, M H; Vesque, C; Nonchev, S; Marshall, H; Frain, M; Gupta, R D; Whiting, J; Wilkinson, D; Charnay, P; Krumlauf, R

1993-01-29

The zinc finger gene Krox20 and many Hox homeobox genes are expressed in segment-restricted domains in the hindbrain. The restricted expression patterns appear before morphological segmentation, suggesting that these transcription factors may play an early role in the establishment and identity of rhombomeric segments. In this paper, we show that the HoxB2 (Hox2.8) gene is normally upregulated in rhombomeres (r) 3, 4, and 5, and we identify an enhancer region upstream of the gene that imposes r3/r5 expression in transgenic mice. This enhancer contains three Krox20-binding sites required in vitro for complex formation with Krox20 protein and in vivo for rhombomere-restricted expression. In transgenic mice, Krox20 expressed in ectopic domains can transactivate a reporter construct containing the HoxB2 r3/r5 enhancer. These data demonstrate that Krox20 is a part of the upstream transcriptional cascade that directly regulates HoxB2 expression during hindbrain segmentation.

Crystal structure of a transcribing RNA Polymerase II complex reveals a complete transcription bubble

PubMed Central

Barnes, Christopher O.; Calero, Monica; Malik, Indranil; Graham, Brian W.; Spahr, Henrik; Lin, Guowu; Cohen, Aina; Brown, Ian S.; Zhang, Qiangmin; Pullara, Filippo; Trakselis, Michael A.; Kaplan, Craig D.; Calero, Guillermo

2015-01-01

Summary Notwithstanding numerous published structures of RNA Polymerase II (Pol II), structural details of Pol II engaging a complete nucleic acid scaffold have been lacking. Here, we report the structures of TFIIF stabilized transcribing Pol II complexes, revealing the upstream duplex and full transcription bubble. The upstream duplex lies over a wedge-shaped loop from Rpb2 that engages its minor groove, providing part of the structural framework for DNA tracking during elongation. At the upstream transcription bubble fork, rudder and fork loop-1 residues spatially coordinate strand annealing and the nascent RNA transcript. At the downstream fork, a network of Pol II interactions with the non-template strand forms a rigid domain with the Trigger Loop (TL), allowing visualization of its open state. Overall, our observations suggest that “open/closed” conformational transitions of the TL may be linked to interactions with the non-template strand, possibly in a synchronized ratcheting manner conducive to polymerase translocation. PMID:26186291

Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian

The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less

Expression of AtWRKY33 encoding a pathogen- or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements.

PubMed

Lippok, Bernadette; Birkenbihl, Rainer P; Rivory, Gaelle; Brümmer, Janna; Schmelzer, Elmon; Logemann, Elke; Somssich, Imre E

2007-04-01

WRKY transcription factors regulate distinct parts of the plant defense transcriptome. Expression of many WRKY genes themselves is induced by pathogens or pathogen-mimicking molecules. Here, we demonstrate that Arabidopsis WRKY33 responds to various stimuli associated with plant defense as well as to different kinds of phytopathogens. Although rapid pathogen-induced AtWRKY33 expression does not require salicylic acid (SA) signaling, it is dependent on PAD4, a key regulator upstream of SA. Activation of AtWRKY33 is independent of de novo protein synthesis, suggesting that it is at least partly under negative regulatory control. We show that a set of three WRKY-specific cis-acting DNA elements (W boxes) within the AtWRKY33 promoter is required for efficient pathogen- or PAMP-triggered gene activation. This strongly indicates that WRKY transcription factors are major components of the regulatory machinery modulating immediate to early expression of this gene in response to pathogen attack.

Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

Common and divergent features in transcriptional control of the homologous small RNAs GlmY and GlmZ in Enterobacteriaceae

PubMed Central

Göpel, Yvonne; Lüttmann, Denise; Heroven, Ann Kathrin; Reichenbach, Birte; Dersch, Petra; Görke, Boris

2011-01-01

Small RNAs GlmY and GlmZ compose a cascade that feedback-regulates synthesis of enzyme GlmS in Enterobacteriaceae. Here, we analyzed the transcriptional regulation of glmY/glmZ from Yersinia pseudotuberculosis, Salmonella typhimurium and Escherichia coli, as representatives for other enterobacterial species, which exhibit similar promoter architectures. The GlmY and GlmZ sRNAs of Y. pseudotuberculosis are transcribed from σ54-promoters that require activation by the response regulator GlrR through binding to three conserved sites located upstream of the promoters. This also applies to glmY/glmZ of S. typhimurium and glmY of E. coli, but as a difference additional σ70-promoters overlap the σ54-promoters and initiate transcription at the same site. In contrast, E. coli glmZ is transcribed from a single σ70-promoter. Thus, transcription of glmY and glmZ is controlled by σ54 and the two-component system GlrR/GlrK (QseF/QseE) in Y. pseudotuberculosis and presumably in many other Enterobacteria. However, in a subset of species such as E. coli this relationship is partially lost in favor of σ70-dependent transcription. In addition, we show that activity of the σ54-promoter of E. coli glmY requires binding of the integration host factor to sites upstream of the promoter. Finally, evidence is provided that phosphorylation of GlrR increases its activity and thereby sRNA expression. PMID:20965974

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

ABA signaling is necessary but not sufficient for RD29B transcriptional memory during successive dehydration stresses in Arabidopsis thaliana.

PubMed

Virlouvet, Laetitia; Ding, Yong; Fujii, Hiroaki; Avramova, Zoya; Fromm, Michael

2014-07-01

Plants subjected to a prior dehydration stress were seen to have altered transcriptional responses during a subsequent dehydration stress for up to 5 days after the initial stress. The abscisic acid (ABA) inducible RD29B gene of Arabidopsis thaliana was strongly induced after the first stress and displayed transcriptional memory with transcript levels nine-fold higher during the second dehydration stress. These increased transcript levels were due to an increased rate of transcription and are associated with an altered chromatin template during the recovery interval between the dehydration stresses. Here we use a combination of promoter deletion/substitutions, mutants in the trans-acting transcription factors and their upstream protein kinases, and treatments with exogenous ABA or dehydration stress to advance our understanding of the features required for transcriptional memory of RD29B. ABA Response Elements (ABREs) are sufficient to confer transcriptional memory on a minimal promoter, although there is a context effect from flanking sequences. Different mutations in Snf1 Related Protein Kinase 2 (SnRK2) genes positively and negatively affected the response, suggesting that this effect is important for transcriptional memory. Although exogenous ABA treatments could prime transcriptional memory, a second ABA treatment was not sufficient to activate transcriptional memory. Therefore, we concluded that transcriptional memory requires ABA and an ABA-independent factor that is induced or activated by a subsequent dehydration stress and directly or indirectly results in a more active RD29B chromatin template. These results advance our knowledge of the cis- and trans-acting factors that are required for transcriptional memory of RD29B. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

An ABA-responsive DRE-binding protein gene from Setaria italica, SiARDP, the target gene of SiAREB, plays a critical role under drought stress.

PubMed

Li, Cong; Yue, Jing; Wu, Xiaowei; Xu, Cong; Yu, Jingjuan

2014-10-01

The DREB (dehydration-responsive element binding)-type transcription factors regulate the expression of stress-inducible genes by binding the DRE/CRT cis-elements in promoter regions. The upstream transcription factors that regulate the transcription of DREB transcription factors have not been clearly defined, although the function of DREB transcription factors in abiotic stress is known. In this study, an abscisic acid (ABA)-responsive DREB-binding protein gene (SiARDP) was cloned from foxtail millet (Setaria italica). The transcript level of SiARDP increased not only after drought, high salt, and low temperature stresses, but also after an ABA treatment in foxtail millet seedlings. Two ABA-responsive elements (ABRE1: ACGTGTC; ABRE2: ACGTGGC) exist in the promoter of SiARDP. Further analyses showed that two ABA-responsive element binding (AREB)-type transcription factors, SiAREB1 and SiAREB2, could physically bind to the ABRE core element in vitro and in vivo. The constitutive expression of SiARDP in Arabidopsis thaliana enhanced drought and salt tolerance during seed germination and seedling development, and overexpression of SiARDP in foxtail millet improved drought tolerance. The expression levels of target genes of SiARDP were upregulated in transgenic Arabidopsis and foxtail millet. These results reveal that SiARDP, one of the target genes of SiAREB, is involved in ABA-dependent signal pathways and plays a critical role in the abiotic stress response in plants. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

A Notch-dependent transcriptional hierarchy promotes mesenchymal transdifferentiation in the cardiac cushion.

PubMed

Chang, Alex C Y; Garside, Victoria C; Fournier, Michele; Smrz, Justin; Vrljicak, Pavle; Umlandt, Patricia; Fuller, Megan; Robertson, Gordon; Zhao, Yongjun; Tam, Angela; Jones, Steven J M; Marra, Marco A; Hoodless, Pamela A; Karsan, Aly

2014-07-01

Valvuloseptal defects are the most common congenital heart defects. Notch signaling-induced endothelial-to-mesenchymal transition (EMT) in the atrioventricular canal (AVC) cushions at murine embryonic day (E)9.5 is a required step during early valve development. Insights to the transcriptional network that is activated in endocardial cells (EC) during EMT and how these pathways direct valve maturation are lacking. We show that at E11.5, AVC-EC retain the ability to undergo Notch-dependent EMT when explanted on collagen. EC-Notch inhibition at E10.5 blocks expression of known mesenchymal genes in E11.5 AVC-EC. To understand the genetic network and AVC development downstream of Notch signaling beyond E9.5, we constructed Tag-Seq libraries corresponding to different cell types of the E11.5 AVC and atrium in wild-type mice and in EC-Notch inhibited mice. We identified 1,400 potential Notch targets in the AVC-EC, of which 124 are transcription factors (TF). From the 124 TFs, we constructed a transcriptional hierarchy and identify 10 upstream TFs within the network. We validated 4 of the upstream TFs as Notch targets that are enriched in AVC-EC. Functionally, we show these 4 TFs regulate EMT in AVC explant assays. These novel signaling pathways downstream of Notch are potentially relevant to valve development. © 2014 Wiley Periodicals, Inc.

Enhancer elements upstream of the SHOX gene are active in the developing limb.

PubMed

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-05-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

Enhancer elements upstream of the SHOX gene are active in the developing limb

PubMed Central

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-01-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128

Epigenetic Regulation of Myeloid Cells

PubMed Central

IVASHKIV, LIONEL B.; PARK, SUNG HO

2017-01-01

Epigenetic regulation in myeloid cells is crucial for cell differentiation and activation in response to developmental and environmental cues. Epigenetic control involves posttranslational modification of DNA or chromatin, and is also coupled to upstream signaling pathways and transcription factors. In this review, we summarize key epigenetic events and how dynamics in the epigenetic landscape of myeloid cells shape the development, immune activation, and innate immune memory. PMID:27337441

Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

PubMed Central

KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

2017-01-01

Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

PubMed

Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

2017-11-01

We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

PubMed Central

Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

2014-01-01

The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

NASA Technical Reports Server (NTRS)

Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid

2003-01-01

Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

Investigating the Control of Chlorophyll Degradation by Genomic Correlation Mining.

PubMed

Ghandchi, Frederick P; Caetano-Anolles, Gustavo; Clough, Steven J; Ort, Donald R

2016-01-01

Chlorophyll degradation is an intricate process that is critical in a variety of plant tissues at different times during the plant life cycle. Many of the photoactive chlorophyll degradation intermediates are exceptionally cytotoxic necessitating that the pathway be carefully coordinated and regulated. The primary regulatory step in the chlorophyll degradation pathway involves the enzyme pheophorbide a oxygenase (PAO), which oxidizes the chlorophyll intermediate pheophorbide a, that is eventually converted to non-fluorescent chlorophyll catabolites. There is evidence that PAO is differentially regulated across different environmental and developmental conditions with both transcriptional and post-transcriptional components, but the involved regulatory elements are uncertain or unknown. We hypothesized that transcription factors modulate PAO expression across different environmental conditions, such as cold and drought, as well as during developmental transitions to leaf senescence and maturation of green seeds. To test these hypotheses, several sets of Arabidopsis genomic and bioinformatic experiments were investigated and re-analyzed using computational approaches. PAO expression was compared across varied environmental conditions in the three separate datasets using regression modeling and correlation mining to identify gene elements co-expressed with PAO. Their functions were investigated as candidate upstream transcription factors or other regulatory elements that may regulate PAO expression. PAO transcript expression was found to be significantly up-regulated in warm conditions, during leaf senescence, and in drought conditions, and in all three conditions significantly positively correlated with expression of transcription factor Arabidopsis thaliana activating factor 1 (ATAF1), suggesting that ATAF1 is triggered in the plant response to these processes or abiotic stresses and in result up-regulates PAO expression. The proposed regulatory network includes the freezing, senescence, and drought stresses modulating factor ATAF1 and various other transcription factors and pathways, which in turn act to regulate chlorophyll degradation by up-regulating PAO expression.

Methylation of an intragenic alternative promoter regulates transcription of GARP.

PubMed

Haupt, Sonja; Söntgerath, Viktoria Sophie Apollonia; Leipe, Jan; Schulze-Koops, Hendrik; Skapenko, Alla

2016-02-01

Alternative promoter usage has been proposed as a mechanism regulating transcriptional and translational diversity in highly elaborated systems like the immune system in humans. Here, we report that transcription of human glycoprotein A repetitions predominant (GARP) in regulatory CD4 T cells (Tregs) is tightly regulated by two alternative promoters. An intragenic promoter contains several CpGs and acts as a weak promoter that is demethylated and initiates transcription Treg-specifically. The strong up-stream promoter containing a CpG-island is, in contrast, fully demethylated throughout tissues. Transcriptional activity of the strong promoter was surprisingly down-regulated upon demethylation of the weak promoter. This demethylation-induced transcriptional attenuation regulated the magnitude of GARP expression and correlated with disease activity in rheumatoid arthritis. Treg-specific GARP transcription was initiated by synergistic interaction of forkhead box protein 3 (Foxp3) with nuclear factor of activated T cells (NFAT) and was underpinned by permissive chromatin remodeling caused by release of the H3K4 demethylase, PLU-1. Our findings describe a novel function of alternative promoters in regulating the extent of transcription. Moreover, since GARP functions as a transporter of transforming growth factor β (TGFβ), a cytokine with broad pleiotropic traits, GARP transcriptional attenuation by alternative promoters might provide a mechanism regulating peripheral TGFβ to avoid unwanted harmful effects. Copyright © 2015 Elsevier B.V. All rights reserved.

Upstream paths for Hippo signaling in Drosophila organ development.

PubMed

Choi, Kwang-Wook

2018-03-01

Organ growth is fundamental to animal development. One of major mechanisms for growth control is mediated by the conserved Hippo signaling pathway initially identified in Drosophila. The core of this pathway in Drosophila consists of a cascade of protein kinases Hippo and Warts that negatively regulate transcriptional coactivator Yorkie (Yki). Activation of Yki promotes cell survival and proliferation to induce organ growth. A key issue in Hippo signaling is to understand how core kinase cascade is activated. Activation of Hippo kinase cascade is regulated in the upstream by at least two transmembrane proteins Crumbs and Fat that act in parallel. These membrane proteins interact with additional factors such as FERM-domain proteins Expanded and Merlin to modulate subcellular localization and function of the Hippo kinase cascade. Hippo signaling is also influenced by cytoskeletal networks and cell tension in epithelia of developing organs. These upstream events in the regulation of Hippo signaling are only partially understood. This review focuses on our current understanding of some upstream processes involved in Hippo signaling in developing Drosophila organs. [BMB Reports 2018; 51(3): 134-142].

Transcription factor AP-2γ induces early Cdx2 expression and represses HIPPO signaling to specify the trophectoderm lineage.

PubMed

Cao, Zubing; Carey, Timothy S; Ganguly, Avishek; Wilson, Catherine A; Paul, Soumen; Knott, Jason G

2015-05-01

Cell fate decisions are fundamental to the development of multicellular organisms. In mammals the first cell fate decision involves segregation of the pluripotent inner cell mass and the trophectoderm, a process regulated by cell polarity proteins, HIPPO signaling and lineage-specific transcription factors such as CDX2. However, the regulatory mechanisms that operate upstream to specify the trophectoderm lineage have not been established. Here we report that transcription factor AP-2γ (TFAP2C) functions as a novel upstream regulator of Cdx2 expression and position-dependent HIPPO signaling in mice. Loss- and gain-of-function studies and promoter analysis revealed that TFAP2C binding to an intronic enhancer is required for activation of Cdx2 expression during early development. During the 8-cell to morula transition TFAP2C potentiates cell polarity to suppress HIPPO signaling in the outside blastomeres. TFAP2C depletion triggered downregulation of PARD6B, loss of apical cell polarity, disorganization of F-actin, and activation of HIPPO signaling in the outside blastomeres. Rescue experiments using Pard6b mRNA restored cell polarity but only partially corrected position-dependent HIPPO signaling, suggesting that TFAP2C negatively regulates HIPPO signaling via multiple pathways. Several genes involved in regulation of the actin cytoskeleton (including Rock1, Rock2) were downregulated in TFAP2C-depleted embryos. Inhibition of ROCK1 and ROCK2 activity during the 8-cell to morula transition phenocopied TFAP2C knockdown, triggering a loss of position-dependent HIPPO signaling and decrease in Cdx2 expression. Altogether, these results demonstrate that TFAP2C facilitates trophectoderm lineage specification by functioning as a key regulator of Cdx2 transcription, cell polarity and position-dependent HIPPO signaling. © 2015. Published by The Company of Biologists Ltd.

The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

PubMed Central

2010-01-01

Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Damiani, R.D. Jr.; Wessler, S.R.

1993-09-01

The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open readingmore » frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.« less

Transgenic analysis of the medaka mesp-b enhancer in somitogenesis.

PubMed

Terasaki, Harumi; Murakami, Ryohei; Yasuhiko, Yukuto; Shin-I, Tadasu; Kohara, Yuji; Saga, Yumiko; Takeda, Hiroyuki

2006-04-01

Somitogenesis is a critical step during the formation of metameric structures in vertebrates. Recent studies in mouse, chick, zebrafish and Xenopus have revealed that several factors, such as T-box genes, Notch/Delta, Wnt, retinoic acid and FGF signaling, are involved in the specification of nascent somites. By interacting with these pathways, the Mesp2-like bHLH transcription factors are transiently expressed in the anterior presomitic mesoderm and play a crucial role in somite formation. The regulatory mechanisms of Mesp2 and its related genes during somitogenesis have been studied in mouse and Xenopus. However, the precise mechanism that regulates the transcriptional activity of Mesp2 has yet to be determined. In our current report, we identify the essential enhancer element of medaka mesp-b, an orthologue of mouse Mesp2, using transgenic techniques and embryo manipulation. Our results demonstrate that a region of approximately 2.8 kb, upstream of the mesp-b gene, is responsible for both the initiation and anterior localization of mesp-b transcription within a somite primordium. Furthermore, putative motifs for both T-box transcription factors and Notch/Delta signaling are present in this enhancer region and are essential for activity.

Myh7b/miR-499 gene expression is transcriptionally regulated by MRFs and Eos

PubMed Central

Yeung, Fan; Chung, Eunhee; Guess, Martin G.; Bell, Matthew L.; Leinwand, Leslie A.

2012-01-01

The sarcomeric myosin gene, Myh7b, encodes an intronic microRNA, miR-499, which regulates cardiac and skeletal muscle biology, yet little is known about its transcriptional regulation. To identify the transcription factors involved in regulating Myh7b/miR-499 gene expression, we have mapped the transcriptional start sites and identified an upstream 6.2 kb region of the mouse Myh7b gene whose activity mimics the expression pattern of the endogenous Myh7b gene both in vitro and in vivo. Through promoter deletion analysis, we have mapped a distal E-box element and a proximal Ikaros site that are essential for Myh7b promoter activity in muscle cells. We show that the myogenic regulatory factors, MyoD, Myf5 and Myogenin, bind to the E-box, while a lymphoid transcription factor, Ikaros 4 (Eos), binds to the Ikaros motif. Further, we show that through physical interaction, MyoD and Eos form an active transcriptional complex on the chromatin to regulate the expression of the endogenous Myh7b/miR-499 gene in muscle cells. We also provide the first evidence that Eos can regulate expression of additional myosin genes (Myosin 1 and β-Myosin) via the miR-499/Sox6 pathway. Therefore, our results indicate a novel role for Eos in the regulation of the myofiber gene program. PMID:22638570

Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

PubMed

Vieille-Grosjean, I; Huber, P

1995-03-03

The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

Coliphage HK022 Nun protein inhibits RNA polymerase translocation

PubMed Central

Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max

2014-01-01

The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

PubMed Central

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites.

PubMed

Irizarry, Kristopher J L; Bryden, Randall L

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus . Our results provide insight into pigment phenotypes in pythons.

Sexy splicing: regulatory interplays governing sex determination from Drosophila to mammals.

PubMed

Lalli, Enzo; Ohe, Kenji; Latorre, Elisa; Bianchi, Marco E; Sassone-Corsi, Paolo

2003-02-01

A remarkable array of strategies is used to produce sexual differentiation in different species. Complex gene hierarchies govern sex determination pathways, as exemplified by the classic D. melanogaster paradigm, where an interplay of transcriptional, splicing and translational mechanisms operate. Molecular studies support the hypothesis that genetic sex determination pathways evolved in reverse order, from downstream to upstream genes, in the cascade. The recent identification of a role for the key regulatory factors SRY and WT1(+KTS) in pre-mRNA splicing indicates that important steps in the mammalian sex determination process are likely to operate at the post-transcriptional level.

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

Intronic L1 Retrotransposons and Nested Genes Cause Transcriptional Interference by Inducing Intron Retention, Exonization and Cryptic Polyadenylation

PubMed Central

Kaer, Kristel; Branovets, Jelena; Hallikma, Anni; Nigumann, Pilvi; Speek, Mart

2011-01-01

Background Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown. Methodology/Principal Findings Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3′ ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs) and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals. Conclusions/Significance Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression. PMID:22022525

A Core Regulatory Pathway Controlling Rice Tiller Angle Mediated by the LAZY1-dependent Asymmetric Distribution of Auxin.

PubMed

Zhang, Ning; Yu, Hong; Yu, Hao; Cai, Yueyue; Huang, Linzhou; Xu, Cao; Xiong, Guosheng; Meng, Xiangbing; Wang, Jiyao; Chen, Haofeng; Liu, Guifu; Jing, Yanhui; Yuan, Yundong; Liang, Yan; Li, Shujia; Smith, Steven M; Li, Jiayang; Wang, Yonghong

2018-06-18

Tiller angle in cereals is a key shoot architecture trait that strongly influences grain yield. Studies in rice (Oryza sativa L.) have implicated shoot gravitropism in the regulation of tiller angle. However, the functional link between shoot gravitropism and tiller angle is unknown. Here, we conducted a large-scale transcriptome analysis of rice shoots in response to gravistimulation and identified two new nodes of a shoot gravitropism regulatory gene network that also controls rice tiller angle. We demonstrate that HEAT STRESS TRANSCRIPTION FACTOR 2D (HSFA2D) is an upstream positive regulator of the LAZY1-mediated asymmetric auxin distribution pathway. We also show that two functionally redundant transcription factor genes, WUSCHEL RELATED HOMEOBOX6 (WOX6) and WOX11, are expressed asymmetrically in response to auxin to connect gravitropism responses with the control of rice tiller angle. These findings define upstream and downstream genetic components that link shoot gravitropism, asymmetric auxin distribution, and rice tiller angle. The results highlight the power of the high-temporal-resolution RNA-seq dataset, and its use to explore further genetic components controlling tiller angle. Collectively these approaches will identify genes to improve grain yields by facilitating the optimization of plant architecture. © 2018 American Society of Plant Biologists. All rights reserved.

STAT3 Target Genes Relevant to Human Cancers

PubMed Central

Carpenter, Richard L.; Lo, Hui-Wen

2014-01-01

Since its discovery, the STAT3 transcription factor has been extensively studied for its function as a transcriptional regulator and its role as a mediator of development, normal physiology, and pathology of many diseases, including cancers. These efforts have uncovered an array of genes that can be positively and negatively regulated by STAT3, alone and in cooperation with other transcription factors. Through regulating gene expression, STAT3 has been demonstrated to play a pivotal role in many cellular processes including oncogenesis, tumor growth and progression, and stemness. Interestingly, recent studies suggest that STAT3 may behave as a tumor suppressor by activating expression of genes known to inhibit tumorigenesis. Additional evidence suggested that STAT3 may elicit opposing effects depending on cellular context and tumor types. These mixed results signify the need for a deeper understanding of STAT3, including its upstream regulators, parallel transcription co-regulators, and downstream target genes. To help facilitate fulfilling this unmet need, this review will be primarily focused on STAT3 downstream target genes that have been validated to associate with tumorigenesis and/or malignant biology of human cancers. PMID:24743777

Genome-wide Determinants of Proviral Targeting, Clonal Abundance and Expression in Natural HTLV-1 Infection

PubMed Central

Melamed, Anat; Laydon, Daniel J.; Gillet, Nicolas A.; Tanaka, Yuetsu; Taylor, Graham P.; Bangham, Charles R. M.

2013-01-01

The regulation of proviral latency is a central problem in retrovirology. We postulate that the genomic integration site of human T lymphotropic virus type 1 (HTLV-1) determines the pattern of expression of the provirus, which in turn determines the abundance and pathogenic potential of infected T cell clones in vivo. We recently developed a high-throughput method for the genome-wide amplification, identification and quantification of proviral integration sites. Here, we used this protocol to test two hypotheses. First, that binding sites for transcription factors and chromatin remodelling factors in the genome flanking the proviral integration site of HTLV-1 are associated with integration targeting, spontaneous proviral expression, and in vivo clonal abundance. Second, that the transcriptional orientation of the HTLV-1 provirus relative to that of the nearest host gene determines spontaneous proviral expression and in vivo clonal abundance. Integration targeting was strongly associated with the presence of a binding site for specific host transcription factors, especially STAT1 and p53. The presence of the chromatin remodelling factors BRG1 and INI1 and certain host transcription factors either upstream or downstream of the provirus was associated respectively with silencing or spontaneous expression of the provirus. Cells expressing HTLV-1 Tax protein were significantly more frequent in clones of low abundance in vivo. We conclude that transcriptional interference and chromatin remodelling are critical determinants of proviral latency in natural HTLV-1 infection. PMID:23555266

SRY-box-containing Gene 2 Regulation of Nuclear Receptor Tailless (Tlx) Transcription in Adult Neural Stem Cells*

PubMed Central

Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M.; Evans, Ronald M.; Gage, Fred H.

2012-01-01

Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs. PMID:22194602

SRY-box-containing gene 2 regulation of nuclear receptor tailless (Tlx) transcription in adult neural stem cells.

PubMed

Shimozaki, Koji; Zhang, Chun-Li; Suh, Hoonkyo; Denli, Ahmet M; Evans, Ronald M; Gage, Fred H

2012-02-17

Adult neurogenesis is maintained by self-renewable neural stem cells (NSCs). Their activity is regulated by multiple signaling pathways and key transcription factors. However, it has been unclear whether these factors interplay with each other at the molecular level. Here we show that SRY-box-containing gene 2 (Sox2) and nuclear receptor tailless (TLX) form a molecular network in adult NSCs. We observed that both Sox2 and TLX proteins bind to the upstream region of Tlx gene. Sox2 positively regulates Tlx expression, whereas the binding of TLX to its own promoter suppresses its transcriptional activity in luciferase reporter assays. Such TLX-mediated suppression can be antagonized by overexpressing wild-type Sox2 but not a mutant lacking the transcriptional activation domain. Furthermore, through regions involved in DNA-binding activity, Sox2 and TLX physically interact to form a complex on DNAs that contain a consensus binding site for TLX. Finally, depletion of Sox2 revealed the potential negative feedback loop of TLX expression that is antagonized by Sox2 in adult NSCs. These data suggest that Sox2 plays an important role in Tlx transcription in cultured adult NSCs.

Chromatin Accessibility Mapping Identifies Mediators of Basal Transcription and Retinoid-Induced Repression of OTX2 in Medulloblastoma

PubMed Central

Zhang, Monica; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Furey, Terrence S.; Crawford, Gregory E.; Yan, Hai; He, Yiping

2014-01-01

Despite an emerging understanding of the genetic alterations giving rise to various tumors, the mechanisms whereby most oncogenes are overexpressed remain unclear. Here we have utilized an integrated approach of genomewide regulatory element mapping via DNase-seq followed by conventional reporter assays and transcription factor binding site discovery to characterize the transcriptional regulation of the medulloblastoma oncogene Orthodenticle Homeobox 2 (OTX2). Through these studies we have revealed that OTX2 is differentially regulated in medulloblastoma at the level of chromatin accessibility, which is in part mediated by DNA methylation. In cell lines exhibiting chromatin accessibility of OTX2 regulatory regions, we found that autoregulation maintains OTX2 expression. Comparison of medulloblastoma regulatory elements with those of the developing brain reveals that these tumors engage a developmental regulatory program to drive OTX2 transcription. Finally, we have identified a transcriptional regulatory element mediating retinoid-induced OTX2 repression in these tumors. This work characterizes for the first time the mechanisms of OTX2 overexpression in medulloblastoma. Furthermore, this study establishes proof of principle for applying ENCODE datasets towards the characterization of upstream trans-acting factors mediating expression of individual genes. PMID:25198066

Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

PubMed

Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

2017-03-01

To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Long-term memory deficits in Pavlovian fear conditioning in Ca2+/calmodulin kinase kinase alpha-deficient mice.

PubMed

Blaeser, Frank; Sanders, Matthew J; Truong, Nga; Ko, Shanelle; Wu, Long Jun; Wozniak, David F; Fanselow, Michael S; Zhuo, Min; Chatila, Talal A

2006-12-01

Signaling by the Ca(2+)/calmodulin kinase (CaMK) cascade has been implicated in neuronal gene transcription, synaptic plasticity, and long-term memory consolidation. The CaM kinase kinase alpha (CaMKKalpha) isoform is an upstream component of the CaMK cascade whose function in different behavioral and learning and memory paradigms was analyzed by targeted gene disruption in mice. CaMKKalpha mutants exhibited normal long-term spatial memory formation and cued fear conditioning but showed deficits in context fear during both conditioning and long-term follow-up testing. They also exhibited impaired activation of the downstream kinase CaMKIV/Gr and its substrate, the transcription factor cyclic AMP-responsive element binding protein (CREB) upon fear conditioning. Unlike CaMKIV/Gr-deficient mice, the CaMKKalpha mutants exhibited normal long-term potentiation and normal levels of anxiety-like behavior. These results demonstrate a selective role for CaMKKalpha in contextual fear memory and suggest that different combinations of upstream and downstream components of the CaMK cascade may serve distinct physiological functions.

A critical role for the transcription factor Scl in platelet production during stress thrombopoiesis.

PubMed

McCormack, Matthew P; Hall, Mark A; Schoenwaelder, Simone M; Zhao, Quan; Ellis, Sarah; Prentice, Julia A; Clarke, Ashleigh J; Slater, Nicholas J; Salmon, Jessica M; Jackson, Shaun P; Jane, Stephen M; Curtis, David J

2006-10-01

The generation of platelets from megakaryocytes in the steady state is regulated by a variety of cytokines and transcription factors, including thrombopoietin (TPO), GATA-1, and NF-E2. Less is known about platelet production in the setting of stress thrombopoiesis, a pivotal event in the context of cytotoxic chemotherapy. Here we show in mice that the transcription factor Scl is critical for platelet production after chemotherapy and in thrombopoiesis induced by administration of TPO. Megakaryocytes from these mice showed appropriate increases in number and ploidy but failed to shed platelets. Ultrastructural examination of Scl-null megakaryocytes revealed a disorganized demarcation membrane and reduction in platelet granules. Quantitative real-time polymerase chain reaction showed that Scl-null platelets lacked NF-E2, and chromatin immunoprecipitation analysis demonstrated Scl binding to the NF-E2 promoter in the human megakaryoblastic-cell line Meg-01, along with its binding partners E47, Lmo2, and the cofactors Ldb1 and GATA-2. These findings suggest that Scl acts up-stream of NF-E2 expression to control megakaryocyte development and platelet release in settings of thrombopoietic stress.

Cation-induced transcriptional regulation of the dlt operon of Staphylococcus aureus.

PubMed

Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P

2006-05-01

Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with D-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. D-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating D-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na(+) and moderate concentrations of Mg(2+) and Ca(2+) but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg(2+)-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg(2+)-induced repression of the dlt operon in S. aureus.

Cation-Induced Transcriptional Regulation of the dlt Operon of Staphylococcus aureus

PubMed Central

Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P.

2006-01-01

Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with d-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. d-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating d-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na+ and moderate concentrations of Mg2+ and Ca2+ but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg2+-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg2+-induced repression of the dlt operon in S. aureus. PMID:16672616

The C2H2-type transcription factor, FlbC, is involved in the transcriptional regulation of Aspergillus oryzae glucoamylase and protease genes specifically expressed in solid-state culture.

PubMed

Tanaka, Mizuki; Yoshimura, Midori; Ogawa, Masahiro; Koyama, Yasuji; Shintani, Takahiro; Gomi, Katsuya

2016-07-01

Aspergillus oryzae produces a large amount of secreted proteins in solid-state culture, and some proteins such as glucoamylase (GlaB) and acid protease (PepA) are specifically produced in solid-state culture, but rarely in submerged culture. From the disruption mutant library of A. oryzae transcriptional regulators, we successfully identified a disruption mutant showing an extremely low production level of GlaB but a normal level of α-amylase production. This strain was a disruption mutant of the C2H2-type transcription factor, FlbC, which is reported to be involved in the regulation of conidiospore development. Disruption mutants of other upstream regulators comprising a conidiation regulatory network had no apparent effect on GlaB production in solid-state culture. In addition to GlaB, the production of acid protease in solid-state culture was also markedly decreased by flbC disruption. Northern blot analyses revealed that transcripts of glaB and pepA were significantly decreased in the flbC disruption strain. These results suggested that FlbC is involved in the transcriptional regulation of genes specifically expressed under solid-state cultivation conditions, possibly independent of the conidiation regulatory network.

The SAGA/TREX-2 subunit Sus1 binds widely to transcribed genes and affects mRNA turnover globally.

PubMed

García-Molinero, Varinia; García-Martínez, José; Reja, Rohit; Furió-Tarí, Pedro; Antúnez, Oreto; Vinayachandran, Vinesh; Conesa, Ana; Pugh, B Franklin; Pérez-Ortín, José E; Rodríguez-Navarro, Susana

2018-03-29

Eukaryotic transcription is regulated through two complexes, the general transcription factor IID (TFIID) and the coactivator Spt-Ada-Gcn5 acetyltransferase (SAGA). Recent findings confirm that both TFIID and SAGA contribute to the synthesis of nearly all transcripts and are recruited genome-wide in yeast. However, how this broad recruitment confers selectivity under specific conditions remains an open question. Here we find that the SAGA/TREX-2 subunit Sus1 associates with upstream regulatory regions of many yeast genes and that heat shock drastically changes Sus1 binding. While Sus1 binding to TFIID-dominated genes is not affected by temperature, its recruitment to SAGA-dominated genes and RP genes is significantly disturbed under heat shock, with Sus1 relocated to environmental stress-responsive genes in these conditions. Moreover, in contrast to recent results showing that SAGA deubiquitinating enzyme Ubp8 is dispensable for RNA synthesis, genomic run-on experiments demonstrate that Sus1 contributes to synthesis and stability of a wide range of transcripts. Our study provides support for a model in which SAGA/TREX-2 factor Sus1 acts as a global transcriptional regulator in yeast but has differential activity at yeast genes as a function of their transcription rate or during stress conditions.

Up-Regulation of HSFA2c and HSPs by ABA Contributing to Improved Heat Tolerance in Tall Fescue and Arabidopsis

PubMed Central

Wang, Xiuyun; Zhuang, Lili; Huang, Bingru

2017-01-01

Abscisic acid (ABA) is known to play roles in regulating plant tolerance to various abiotic stresses, but whether ABA’s effects on heat tolerance are associated with its regulation of heat stress transcription factors (HSFs) and heat shock proteins (HSPs) is not well documented. The objective of this study was to determine whether improved heat tolerance of tall fescue (Festuca arundinacea Schreb.) by ABA was through the regulation of HSFs and HSPs. ABA-responsive transcriptional factors, ABA-responsive element binding protein 3 (FaAREB3) and dehydration-responsive element binding protein 2A (FaDREB2A) of tall fescue, were able to bind to the cis-elements in the promoter of tall fescue heat stress transcription factor A2c (FaHSFA2c). Exogenous ABA (5 μM) application enhanced heat tolerance of tall fescue, as manifested by increased leaf photochemical efficiency and membrane stability under heat stress (37/32 °C, day/night). The expression levels of FaHSFA2c, several tall fescue HSPs (FaHSPs), and ABA-responsive transcriptional factors were up-regulated in plants treated with ABA. Deficiency of Arabidopsis heat stress transcription factor A2 (AtHSFA2) suppressed ABA-induction of AtHSPs expression and ABA-improved heat tolerance in Arabidopsis. These results suggested that HSFA2 plays an important role in ABA-mediated plant heat tolerance, and FaAREB3 and FaDREB2A may function as upstream trans-acting factors and regulate transcriptional activity of FaHSFA2c and the downstream FaHSPs, leading to improved heat tolerance. PMID:28914758

Conditional Inactivation of Upstream Binding Factor Reveals Its Epigenetic Functions and the Existence of a Somatic Nucleolar Precursor Body

PubMed Central

Hamdane, Nourdine; Stefanovsky, Victor Y.; Tremblay, Michel G.; Németh, Attila; Paquet, Eric; Lessard, Frédéric; Sanij, Elaine; Hannan, Ross; Moss, Tom

2014-01-01

Upstream Binding Factor (UBF) is a unique multi-HMGB-box protein first identified as a co-factor in RNA polymerase I (RPI/PolI) transcription. However, its poor DNA sequence selectivity and its ability to generate nucleosome-like nucleoprotein complexes suggest a more generalized role in chromatin structure. We previously showed that extensive depletion of UBF reduced the number of actively transcribed ribosomal RNA (rRNA) genes, but had little effect on rRNA synthesis rates or cell proliferation, leaving open the question of its requirement for RPI transcription. Using gene deletion in mouse, we now show that UBF is essential for embryo development beyond morula. Conditional deletion in cell cultures reveals that UBF is also essential for transcription of the rRNA genes and that it defines the active chromatin conformation of both gene and enhancer sequences. Loss of UBF prevents formation of the SL1/TIF1B pre-initiation complex and recruitment of the RPI-Rrn3/TIF1A complex. It is also accompanied by recruitment of H3K9me3, canonical histone H1 and HP1α, but not by de novo DNA methylation. Further, genes retain penta-acetyl H4 and H2A.Z, suggesting that even in the absence of UBF the rRNA genes can maintain a potentially active state. In contrast to canonical histone H1, binding of H1.4 is dependent on UBF, strongly suggesting that it plays a positive role in gene activity. Unexpectedly, arrest of rRNA synthesis does not suppress transcription of the 5S, tRNA or snRNA genes, nor expression of the several hundred mRNA genes implicated in ribosome biogenesis. Thus, rRNA gene activity does not coordinate global gene expression for ribosome biogenesis. Loss of UBF also unexpectedly induced the formation in cells of a large sub-nuclear structure resembling the nucleolar precursor body (NPB) of oocytes and early embryos. These somatic NPBs contain rRNA synthesis and processing factors but do not associate with the rRNA gene loci (NORs). PMID:25121932

Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

NASA Technical Reports Server (NTRS)

Morrow, Maureen A.

2003-01-01

Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

Direct activation of Shroom3 transcription by Pitx proteins drives epithelial morphogenesis in the developing gut

PubMed Central

Chung, Mei-I; Nascone-Yoder, Nanette M.; Grover, Stephanie A.; Drysdale, Thomas A.; Wallingford, John B.

2010-01-01

Individual cell shape changes are essential for epithelial morphogenesis. A transcriptional network for epithelial cell shape change is emerging in Drosophila, but this area remains largely unexplored in vertebrates. The distinction is important as so far, key downstream effectors of cell shape change in Drosophila appear not to be conserved. Rather, Shroom3 has emerged as a central effector of epithelial morphogenesis in vertebrates, driving both actin- and microtubule-based cell shape changes. To date, the morphogenetic role of Shroom3 has been explored only in the neural epithelium, so the broad expression of this gene raises two important questions: what are the requirements for Shroom3 in non-neural tissues and what factors control Shroom3 transcription? Here, we show in Xenopus that Shroom3 is essential for cell shape changes and morphogenesis in the developing vertebrate gut and that Shroom3 transcription in the gut requires the Pitx1 transcription factor. Moreover, we show that Pitx proteins directly activate Shroom3 transcription, and we identify Pitx-responsive regulatory elements in the genomic DNA upstream of Shroom3. Finally, we show that ectopic expression of Pitx proteins is sufficient to induce Shroom3-dependent cytoskeletal reorganization and epithelial cell shape change. These data demonstrate new breadth to the requirements for Shroom3 in morphogenesis, and they also provide a cell-biological basis for the role of Pitx transcription factors in morphogenesis. More generally, these results provide a foundation for deciphering the transcriptional network that underlies epithelial cell shape change in developing vertebrates. PMID:20332151

Transcriptional response to muscarinic acetylcholine receptor stimulation: regulation of Egr-1 biosynthesis by ERK, Elk-1, MKP-1, and calcineurin in carbachol-stimulated human neuroblastoma cells.

PubMed

Rössler, Oliver G; Henss, Isabell; Thiel, Gerald

2008-02-01

Carbachol-mediated activation of type M(3) muscarinic acetylcholine receptors induces the biosynthesis of the transcription factor Egr-1 in human SH-SY5Y neuroblastoma cells involving an activation of extracellular signal-regulated protein kinase. Carbachol triggered the phosphorylation of the ternary complex factor Elk-1, a key transcriptional regulator of serum response element-driven gene transcription, and strikingly enhanced the transcriptional activation potential of Elk-1. Chromatin immunoprecipitation experiments revealed that Elk-1 binds in vivo to the 5'-upstream region of the Egr-1 gene in carbachol-stimulated neuroblastoma cells. Together, these data indicate that Elk-1 connects the intracellular signaling cascade elicited by activation of M(3) muscarinic acetylcholine receptors with the transcription of the Egr-1 gene. Lentiviral-mediated expression of either MAP kinase phosphatase-1 (MKP-1) or a constitutively active mutant of calcineurin A inhibited Egr-1 biosynthesis following carbachol stimulation, indicating that these phosphatases function as shut-off devices of muscarinic acetylcholine receptor signaling. Additionally, carbachol stimulation increased transcription of a chromatin-embedded collagenase promoter/reporter gene, showing that AP-1 activity is enhanced in carbachol-stimulated neuroblastoma. Expression experiments revealed that both MKP-1 and a constitutively active mutant of calcineurin A impaired carbachol-induced upregulation of AP-1 activity. The fact that carbachol stimulation of neuroblastoma cells activates the transcription factors Egr-1 and AP-1 suggests that changes in the gene expression pattern are an integral part of muscarinic acetylcholine receptor signaling.

Identification of pathogenic genes and upstream regulators in age-related macular degeneration.

PubMed

Zhao, Bin; Wang, Mengya; Xu, Jing; Li, Min; Yu, Yuhui

2017-06-26

Age-related macular degeneration (AMD) is the leading cause of irreversible blindness in older individuals. Our study aims to identify the key genes and upstream regulators in AMD. To screen pathogenic genes of AMD, an integrated analysis was performed by using the microarray datasets in AMD derived from the Gene Expression Omnibus (GEO) database. The functional annotation and potential pathways of differentially expressed genes (DEGs) were further discovered by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. We constructed the AMD-specific transcriptional regulatory network to find the crucial transcriptional factors (TFs) which target the DEGs in AMD. Quantitative real time polymerase chain reaction (qRT-PCR) was performed to verify the DEGs and TFs obtained by integrated analysis. From two GEO datasets obtained, we identified 1280 DEGs (730 up-regulated and 550 down-regulated genes) between AMD and normal control (NC). After KEGG analysis, steroid biosynthesis is a significantly enriched pathway for DEGs. The expression of 8 genes (TNC, GRP, TRAF6, ADAMTS5, GPX3, FAP, DHCR7 and FDFT1) was detected. Except for TNC and GPX3, the other 6 genes in qRT-PCR played the same pattern with that in our integrated analysis. The dysregulation of these eight genes may involve with the process of AMD. Two crucial transcription factors (c-rel and myogenin) were concluded to play a role in AMD. Especially, myogenin was associated with AMD by regulating TNC, GRP and FAP. Our finding can contribute to developing new potential biomarkers, revealing the underlying pathogenesis, and further raising new therapeutic targets for AMD.

Astaxanthin inhibits NF-κB and Wnt/β-catenin signaling pathways via inactivation of Erk/MAPK and PI3K/Akt to induce intrinsic apoptosis in a hamster model of oral cancer.

PubMed

Kavitha, K; Kowshik, J; Kishore, T Kranthi Kiran; Baba, Abdul Basit; Nagini, S

2013-10-01

The oncogenic transcription factors NF-κB and β-catenin, constitutively activated by upstream serine/threonine kinases control several cellular processes implicated in malignant transformation including apoptosis evasion. The aim of this study was to investigate the chemopreventive effects of astaxanthin, an antioxidant carotenoid, in the hamster buccal pouch (HBP) carcinogenesis model based on its ability to modulate NF-κB and Wnt signaling pathways and induce apoptosis. We determined the effect of dietary supplementation of astaxanthin on the oncogenic signaling pathways - NF-κB and Wnt/β-catenin, their upstream activator kinases - Erk/MAPK and PI-3K/Akt, and the downstream event - apoptosis evasion by real-time quantitative RT-PCR, western blot, and immunohistochemical analyses. We found that astaxanthin inhibits NF-κB and Wnt signaling by downregulating the key regulatory enzymes IKKβ and GSK-3β. Analysis of gene expression and docking interactions revealed that inhibition of these pathways may be mediated via inactivation of the upstream signaling kinases Erk/Akt by astaxanthin. Astaxanthin also induced caspase-mediated mitochondrial apoptosis by downregulating the expression of antiapoptotic Bcl-2, p-Bad, and survivin and upregulating proapoptotic Bax and Bad, accompanied by efflux of Smac/Diablo and cytochrome-c into the cytosol, and induced cleavage of poly (ADP-ribose) polymerase (PARP). The results provide compelling evidence that astaxanthin exerts chemopreventive effects by concurrently inhibiting phosphorylation of transcription factors and signaling kinases and inducing intrinsic apoptosis. Astaxanthin targets key molecules in oncogenic signaling pathways and induces apoptosis and is a promising candidate agent for cancer prevention and therapy. Copyright © 2013 Elsevier B.V. All rights reserved.

The pineapple AcMADS1 promoter confers high level expression in tomato and arabidopsis flowering and fruiting tissues, but AcMADS1 does not complement the tomato LeMADS-RIN (rin) mutant

USDA-ARS?s Scientific Manuscript database

A previous EST study identified a MADS box transcription factor coding sequence, AcMADS1, that is strongly induced during non-climacteric pineapple fruit ripening. Phylogenetic analyses place the AcMADS1 protein in the same superclade as LeMADS-RIN, a master regulator of fruit ripening upstream of e...

A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

PubMed

Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

2012-09-01

The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

TALE transcription factors during early development of the vertebrate brain and eye.

PubMed

Schulte, Dorothea; Frank, Dale

2014-01-01

Our brain's cognitive performance arises from the coordinated activities of billions of nerve cells. Despite a high degree of morphological and functional differences, all neurons of the vertebrate central nervous system (CNS) arise from a common field of multipotent progenitors. Cell fate specification and differentiation are directed by multistep processes that include inductive/external cues, such as the extracellular matrix or growth factors, and cell-intrinsic determinants, such as transcription factors and epigenetic modulators of proteins and DNA. Here we review recent findings implicating TALE-homeodomain proteins in these processes. Although originally identified as HOX-cofactors, TALE proteins also contribute to many physiological processes that do not require HOX-activity. Particular focus is, therefore, given to HOX-dependent and -independent functions of TALE proteins during early vertebrate brain development. Additionally, we provide an overview about known upstream and downstream factors of TALE proteins in the developing vertebrate brain and discuss general concepts of how TALE proteins function to modulate neuronal cell fate specification. Copyright © 2013 Wiley Periodicals, Inc.

Opposing Control by Transcription Factors MYB61 and MYB3 Increases Freezing Tolerance by Relieving C-Repeat Binding Factor Suppression1[OPEN

PubMed Central

Zhang, Yunqin; Miao, Zhenyan; Xie, Can; Meng, Xiangzhao; Deng, Jie; Mysore, Kirankumar S.; Frugier, Florian; Wang, Tao

2016-01-01

Cold acclimation is an important process by which plants respond to low temperature and enhance their winter hardiness. C-REPEAT BINDING FACTOR1 (CBF1), CBF2, and CBF3 genes were shown previously to participate in cold acclimation in Medicago truncatula. In addition, MtCBF4 is transcriptionally induced by salt, drought, and cold stresses. We show here that MtCBF4, shown previously to enhance drought and salt tolerance, also positively regulates cold acclimation and freezing tolerance. To identify molecular factors acting upstream and downstream of the MtCBF4 transcription factor (TF) in cold responses, we first identified genes that are differentially regulated upon MtCBF4 overexpression using RNAseq Digital Gene Expression Profiling. Among these, we showed that MtCBF4 directly activates the transcription of the COLD ACCLIMATION SPECIFIC15 (MtCAS15) gene. To gain insights into how MtCBF4 is transcriptionally regulated in response to cold, an R2R3-MYB TF, MtMYB3, was identified based on a yeast one-hybrid screen as binding directly to MYB cis-elements in the MtCBF4 promoter, leading to the inhibition of MtCBF4 expression. In addition, another MYB TF, MtMYB61, identified as an interactor of MtMYB3, can relieve the inhibitory effect of MtMYB3 on MtCBF4 transcription. This study, therefore, supports a model describing how MtCBF4 is regulated by antagonistic MtMYB3/MtMYB61 TFs, leading to the up-regulation of downstream targets such as MtCAS15 acting in cold acclimation in M. truncatula. PMID:27578551

Rapid transient isoform-specific neuregulin1 transcription in motor neurons is regulated by neurotrophic factors and axon-target interactions.

PubMed

Wang, Jiajing; Hmadcha, Abdelkrim; Zakarian, Vaagn; Song, Fei; Loeb, Jeffrey A

2015-09-01

The neuregulins (NRGs) are a family of alternatively spliced factors that play important roles in nervous system development and disease. In motor neurons, NRG1 expression is regulated by activity and neurotrophic factors, however, little is known about what controls isoform-specific transcription. Here we show that NRG1 expression in the chick embryo increases in motor neurons that have extended their axons and that limb bud ablation before motor axon outgrowth prevents this induction, suggesting a trophic role from the developing limb. Consistently, NRG1 induction after limb bud ablation can be rescued by adding back the neurotrophic factors BDNF and GDNF. Mechanistically, BDNF induces a rapid and transient increase in type I and type III NRG1 mRNAs that peak at 4h in rat embryonic ventral spinal cord cultures. Blocking MAPK or PI3K signaling or blocking transcription with Actinomycin D blocks BDNF induced NRG1 gene induction. BDNF had no effect on mRNA degradation, suggesting that transcriptional activation rather than message stability is important. Furthermore, BDNF activates a reporter construct that includes 700bp upstream of the type I NRG1 start site. Protein synthesis is also required for type I NRG1 mRNA transcription as cycloheximide produced a super-induction of type I, but not type III NRG1 mRNA, possibly through a mechanism involving sustained activation of MAPK and PI3K. These results reveal the existence of highly responsive, transient transcriptional regulatory mechanisms that differentially modulate NRG1 isoform expression as a function of extracellular and intracellular signaling cascades and mediated by neurotrophic factors and axon-target interactions. Copyright © 2015 Elsevier Inc. All rights reserved.

Translational Upregulation of an Individual p21Cip1 Transcript Variant by GCN2 Regulates Cell Proliferation and Survival under Nutrient Stress

PubMed Central

Lehman, Stacey L.; Cerniglia, George J.; Johannes, Gregg J.; Ye, Jiangbin; Ryeom, Sandra; Koumenis, Constantinos

2015-01-01

Multiple transcripts encode for the cell cycle inhibitor p21Cip1. These transcripts produce identical proteins but differ in their 5’ untranslated regions (UTRs). Although several stresses that induce p21 have been characterized, the mechanisms regulating the individual transcript variants and their functional significance are unknown. Here we demonstrate through 35S labeling, luciferase reporter assays, and polysome transcript profiling that activation of the Integrated Stress Response (ISR) kinase GCN2 selectively upregulates the translation of a p21 transcript variant containing 5’ upstream open reading frames (uORFs) through phosphorylation of the eukaryotic translation initiation factor eIF2α. Mutational analysis reveals that the uORFs suppress translation under basal conditions, but promote translation under stress. Functionally, ablation of p21 ameliorates G1/S arrest and reduces cell survival in response to GCN2 activation. These findings uncover a novel mechanism of p21 post-transcriptional regulation, offer functional significance for the existence of multiple p21 transcripts, and support a key role for GCN2 in regulating the cell cycle under stress. PMID:26102367

Neuregulin 1 transcripts are differentially expressed in schizophrenia and regulated by 5′ SNPs associated with the disease

PubMed Central

Law, Amanda J.; Lipska, Barbara K.; Weickert, Cynthia Shannon; Hyde, Thomas M.; Straub, Richard E.; Hashimoto, Ryota; Harrison, Paul J.; Kleinman, Joel E.; Weinberger, Daniel R.

2006-01-01

Genetic variation in neuregulin 1 (NRG1) is associated with schizophrenia. The disease-associated SNPs are noncoding, and their functional implications remain unknown. We hypothesized that differential expression of the NRG1 gene explains its association to the disease. We examined four of the disease-associated SNPs that make up the original risk haplotype in the 5′ upstream region of the gene for their effects on mRNA abundance of NRG1 types I–IV in human postmortem hippocampus. Diagnostic comparisons revealed a 34% increase in type I mRNA in schizophrenia and an interaction of diagnosis and genotype (SNP8NRG221132) on this transcript. Of potentially greater interest, a single SNP within the risk haplotype (SNP8NRG243177) and a 22-kb block of this core haplotype are associated with mRNA expression for the novel type IV isoform in patients and controls. Bioinformatic promoter analyses indicate that both SNPs lead to a gain/loss of putative binding sites for three transcription factors, serum response factor, myelin transcription factor-1, and High Mobility Group Box Protein-1. These data implicate variation in isoform expression as a molecular mechanism for the genetic association of NRG1 with schizophrenia. PMID:16618933

Murine T-box transcription factor Tbx20 acts as a repressor during heart development, and is essential for adult heart integrity, function and adaptation.

PubMed

Stennard, Fiona A; Costa, Mauro W; Lai, Donna; Biben, Christine; Furtado, Milena B; Solloway, Mark J; McCulley, David J; Leimena, Christiana; Preis, Jost I; Dunwoodie, Sally L; Elliott, David E; Prall, Owen W J; Black, Brian L; Fatkin, Diane; Harvey, Richard P

2005-05-01

The genetic hierarchies guiding lineage specification and morphogenesis of the mammalian embryonic heart are poorly understood. We now show by gene targeting that murine T-box transcription factor Tbx20 plays a central role in these pathways, and has important activities in both cardiac development and adult function. Loss of Tbx20 results in death of embryos at mid-gestation with grossly abnormal heart morphogenesis. Underlying these disturbances was a severely compromised cardiac transcriptional program, defects in the molecular pre-pattern, reduced expansion of cardiac progenitors and a block to chamber differentiation. Notably, Tbx20-null embryos showed ectopic activation of Tbx2 across the whole heart myogenic field. Tbx2 encodes a transcriptional repressor normally expressed in non-chamber myocardium, and in the atrioventricular canal it has been proposed to inhibit chamber-specific gene expression through competition with positive factor Tbx5. Our data demonstrate a repressive activity for Tbx20 and place it upstream of Tbx2 in the cardiac genetic program. Thus, hierarchical, repressive interactions between Tbx20 and other T-box genes and factors underlie the primary lineage split into chamber and non-chamber myocardium in the forming heart, an early event upon which all subsequent morphogenesis depends. Additional roles for Tbx20 in adult heart integrity and contractile function were revealed by in-vivo cardiac functional analysis of Tbx20 heterozygous mutant mice. These data suggest that mutations in human cardiac transcription factor genes, possibly including TBX20, underlie both congenital heart disease and adult cardiomyopathies.

Integrated Transcriptomic and Epigenomic Analysis of Primary Human Lung Epithelial Cell Differentiation

PubMed Central

Marconett, Crystal N.; Zhou, Beiyun; Rieger, Megan E.; Selamat, Suhaida A.; Dubourd, Mickael; Fang, Xiaohui; Lynch, Sean K.; Stueve, Theresa Ryan; Siegmund, Kimberly D.; Berman, Benjamin P.

2013-01-01

Elucidation of the epigenetic basis for cell-type specific gene regulation is key to gaining a full understanding of how the distinct phenotypes of differentiated cells are achieved and maintained. Here we examined how epigenetic changes are integrated with transcriptional activation to determine cell phenotype during differentiation. We performed epigenomic profiling in conjunction with transcriptomic profiling using in vitro differentiation of human primary alveolar epithelial cells (AEC). This model recapitulates an in vivo process in which AEC transition from one differentiated cell type to another during regeneration following lung injury. Interrogation of histone marks over time revealed enrichment of specific transcription factor binding motifs within regions of changing chromatin structure. Cross-referencing of these motifs with pathways showing transcriptional changes revealed known regulatory pathways of distal alveolar differentiation, such as the WNT and transforming growth factor beta (TGFB) pathways, and putative novel regulators of adult AEC differentiation including hepatocyte nuclear factor 4 alpha (HNF4A), and the retinoid X receptor (RXR) signaling pathways. Inhibition of the RXR pathway confirmed its functional relevance for alveolar differentiation. Our incorporation of epigenetic data allowed specific identification of transcription factors that are potential direct upstream regulators of the differentiation process, demonstrating the power of this approach. Integration of epigenomic data with transcriptomic profiling has broad application for the identification of regulatory pathways in other models of differentiation. PMID:23818859

Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

PubMed Central

Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

1992-01-01

Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.

PubMed

Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K

1989-01-01

The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.

The minimal promoter region of the dense-core vesicle protein IA-2: transcriptional regulation by CREB.

PubMed

Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L

2015-06-01

IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.

Characterization of human mitochondrial ferritin promoter: identification of transcription factors and evidences of epigenetic control

NASA Astrophysics Data System (ADS)

Guaraldo, Michela; Santambrogio, Paolo; Rovelli, Elisabetta; di Savino, Augusta; Saglio, Giuseppe; Cittaro, Davide; Roetto, Antonella; Levi, Sonia

2016-09-01

Mitochondrial ferritin (FtMt) is an iron storage protein belonging to the ferritin family but, unlike the cytosolic ferritin, it has an iron-unrelated restricted tissue expression. FtMt appears to be preferentially expressed in cell types characterized by high metabolic activity and oxygen consumption, suggesting a role in protecting mitochondria from iron-dependent oxidative damage. The human gene (FTMT) is intronless and its promoter region has not been described yet. To analyze the regulatory mechanisms controlling FTMT expression, we characterized the 5‧ flanking region upstream the transcriptional starting site of FTMT by in silico enquiry of sequences conservation, DNA deletion analysis, and ChIP assay. The data revealed a minimal promoter region and identified the presence of SP1, CREB and YY1 as positive regulators, and GATA2, FoxA1 and C/EBPβ as inhibitors of the transcriptional regulation. Furthermore, the FTMT transcription is increased by acetylating and de-methylating agent treatments in K562 and HeLa cells. These treatments up-regulate FtMt expression even in fibroblasts derived from a Friedreich ataxia patient, where it might exert a beneficial effect against mitochondrial oxidative damage. The expression of FTMT appears regulated by a complex mechanism involving epigenetic events and interplay between transcription factors.

Tissue expression analysis, cloning and characterization of the 5'-regulatory region of the bovine FABP3 gene.

PubMed

Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen

2016-09-01

Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.

Transcriptional Profiling Identifies Functional Interactions of TGFβ and PPARβ/δ Signaling

PubMed Central

Kaddatz, Kerstin; Adhikary, Till; Finkernagel, Florian; Meissner, Wolfgang; Müller-Brüsselbach, Sabine; Müller, Rolf

2010-01-01

Peroxisome proliferator-activated receptors (PPARs) not only play a key role in regulating metabolic pathways but also modulate inflammatory processes, pointing to a functional interaction between PPAR and cytokine signaling pathways. In this study, we show by genome-wide transcriptional profiling that PPARβ/δ and transforming growth factor-β (TGFβ) pathways functionally interact in human myofibroblasts and that a subset of these genes is cooperatively activated by TGFβ and PPARβ/δ. Using the angiopoietin-like 4 (ANGPTL4) gene as a model, we demonstrate that two enhancer regions cooperate to mediate the observed synergistic response. A TGFβ-responsive enhancer located ∼8 kb upstream of the transcriptional start site is regulated by a mechanism involving SMAD3, ETS1, RUNX, and AP-1 transcription factors that interact with multiple contiguous binding sites. A second enhancer (PPAR-E) consisting of three juxtaposed PPAR response elements is located in the third intron ∼3.5 kb downstream of the transcriptional start site. The PPAR-E is strongly activated by all three PPAR subtypes, with a novel type of PPAR response element motif playing a central role. Although the PPAR-E is not regulated by TGFβ, it interacts with SMAD3, ETS1, RUNX2, and AP-1 in vivo, providing a possible mechanistic explanation for the observed synergism. PMID:20595396

Simian Virus 40 Large T Antigen Interacts with Human TFIIB-Related Factor and Small Nuclear RNA-Activating Protein Complex for Transcriptional Activation of TATA-Containing Polymerase III Promoters

PubMed Central

Damania, Blossom; Mital, Renu; Alwine, James C.

1998-01-01

The TATA-binding protein (TBP) is common to the basal transcription factors of all three RNA polymerases, being associated with polymerase-specific TBP-associated factors (TAFs). Simian virus 40 large T antigen has previously been shown to interact with the TBP-TAFII complexes, TFIID (B. Damania and J. C. Alwine, Genes Dev. 10:1369–1381, 1996), and the TBP-TAFI complex, SL1 (W. Zhai, J. Tuan, and L. Comai, Genes Dev. 11:1605–1617, 1997), and in both cases these interactions are critical for transcriptional activation. We show a similar mechanism for activation of the class 3 polymerase III (pol III) promoter for the U6 RNA gene. Large T antigen can activate this promoter, which contains a TATA box and an upstream proximal sequence element but cannot activate the TATA-less, intragenic VAI promoter (a class 2, pol III promoter). Mutants of large T antigen that cannot activate pol II promoters also fail to activate the U6 promoter. We provide evidence that large T antigen can interact with the TBP-containing pol III transcription factor human TFIIB-related factor (hBRF), as well as with at least two of the three TAFs in the pol III-specific small nuclear RNA-activating protein complex (SNAPc). In addition, we demonstrate that large T antigen can cofractionate and coimmunoprecipitate with the hBRF-containing complex TFIIIB derived from HeLa cells infected with a recombinant adenovirus which expresses large T antigen. Hence, similar to its function with pol I and pol II promoters, large T antigen interacts with TBP-containing, basal pol III transcription factors and appears to perform a TAF-like function. PMID:9488448

Expanding the Substantial Interactome of NEMO Using Protein Microarrays

PubMed Central

Fenner, Beau J.; Scannell, Michael; Prehn, Jochen H. M.

2010-01-01

Signal transduction by the NF-kappaB pathway is a key regulator of a host of cellular responses to extracellular and intracellular messages. The NEMO adaptor protein lies at the top of this pathway and serves as a molecular conduit, connecting signals transmitted from upstream sensors to the downstream NF-kappaB transcription factor and subsequent gene activation. The position of NEMO within this pathway makes it an attractive target from which to search for new proteins that link NF-kappaB signaling to additional pathways and upstream effectors. In this work, we have used protein microarrays to identify novel NEMO interactors. A total of 112 protein interactors were identified, with the most statistically significant hit being the canonical NEMO interactor IKKbeta, with IKKalpha also being identified. Of the novel interactors, more than 30% were kinases, while at least 25% were involved in signal transduction. Binding of NEMO to several interactors, including CALB1, CDK2, SAG, SENP2 and SYT1, was confirmed using GST pulldown assays and coimmunoprecipitation, validating the initial screening approach. Overexpression of CALB1, CDK2 and SAG was found to stimulate transcriptional activation by NF-kappaB, while SYT1 overexpression repressed TNFalpha-dependent NF-kappaB transcriptional activation in human embryonic kidney cells. Corresponding with this finding, RNA silencing of CDK2, SAG and SENP2 reduced NF-kappaB transcriptional activation, supporting a positive role for these proteins in the NF-kappaB pathway. The identification of a host of new NEMO interactors opens up new research opportunities to improve understanding of this essential cell signaling pathway. PMID:20098747

Origins of extrinsic variability in eukaryotic gene expression

NASA Astrophysics Data System (ADS)

Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff

2006-02-01

Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes simultaneously, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modelling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous lower limit for expression variability. A second source, which is modelled as originating from a common upstream transcription factor, exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.

Origins of extrinsic variability in eukaryotic gene expression

NASA Astrophysics Data System (ADS)

Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff

2006-03-01

Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes in concert, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modeling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous noise floor in expression variability. A second source which is modeled as originating from a common upstream transcription factor exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.

The R2R3-MYB–Like Regulatory Factor EOBI, Acting Downstream of EOBII, Regulates Scent Production by Activating ODO1 and Structural Scent-Related Genes in Petunia[C][W

PubMed Central

Spitzer-Rimon, Ben; Farhi, Moran; Albo, Boaz; Cna’ani, Alon; Ben Zvi, Michal Moyal; Masci, Tania; Edelbaum, Orit; Yu, Yixun; Shklarman, Elena; Ovadis, Marianna; Vainstein, Alexander

2012-01-01

Flower scent is a highly dynamic trait, under developmental, spatial, and diurnal regulation. The mechanism governing scent production is only beginning to be unraveled. In petunia (Petunia hybrida), EMISSION OF BENZENOIDS II (EOBII) controls transcription of both the shikimate pathway-regulating MYB factor ODORANT1 (ODO1) and phenylpropanoid scent-related structural genes. A promoter-activation screen identified an R2R3-MYB–like regulatory factor of phenylpropanoid volatile biosynthesis acting downstream of EOBII, designated EOBI. EOBI silencing led to downregulation of ODO1 and numerous structural scent-related genes from both the shikimate and phenylpropanoid pathways. The ability of EOBI to directly activate ODO1, as revealed by electrophoretic mobility shift assay and yeast one-hybrid analysis, place EOBI upstream of ODO1 in regulating substrate availability for volatile biosynthesis. Interestingly, ODO1-silenced transgenic petunia flowers accumulated higher EOBI transcript levels than controls, suggesting a complex feedback loop between these regulatory factors. The accumulation pattern of EOBI transcript relative to EOBII and ODO1, and the effect of up/downregulation of EOBII on transcript levels of EOBI and ODO1, further support these factors' hierarchical relationships. The dependence of scent production on EOBI expression and its direct interaction with both regulatory and structural genes provide evidence for EOBI’s wide-ranging involvement in the production of floral volatiles. PMID:23275577

The R2R3-MYB-like regulatory factor EOBI, acting downstream of EOBII, regulates scent production by activating ODO1 and structural scent-related genes in petunia.

PubMed

Spitzer-Rimon, Ben; Farhi, Moran; Albo, Boaz; Cna'ani, Alon; Ben Zvi, Michal Moyal; Masci, Tania; Edelbaum, Orit; Yu, Yixun; Shklarman, Elena; Ovadis, Marianna; Vainstein, Alexander

2012-12-01

Flower scent is a highly dynamic trait, under developmental, spatial, and diurnal regulation. The mechanism governing scent production is only beginning to be unraveled. In petunia (Petunia hybrida), EMISSION OF BENZENOIDS II (EOBII) controls transcription of both the shikimate pathway-regulating MYB factor ODORANT1 (ODO1) and phenylpropanoid scent-related structural genes. A promoter-activation screen identified an R2R3-MYB-like regulatory factor of phenylpropanoid volatile biosynthesis acting downstream of EOBII, designated EOBI. EOBI silencing led to downregulation of ODO1 and numerous structural scent-related genes from both the shikimate and phenylpropanoid pathways. The ability of EOBI to directly activate ODO1, as revealed by electrophoretic mobility shift assay and yeast one-hybrid analysis, place EOBI upstream of ODO1 in regulating substrate availability for volatile biosynthesis. Interestingly, ODO1-silenced transgenic petunia flowers accumulated higher EOBI transcript levels than controls, suggesting a complex feedback loop between these regulatory factors. The accumulation pattern of EOBI transcript relative to EOBII and ODO1, and the effect of up/downregulation of EOBII on transcript levels of EOBI and ODO1, further support these factors' hierarchical relationships. The dependence of scent production on EOBI expression and its direct interaction with both regulatory and structural genes provide evidence for EOBI's wide-ranging involvement in the production of floral volatiles.

Factors of transforming growth factor beta signalling are co-regulated in human hepatocellular carcinoma.

PubMed

Longerich, Thomas; Breuhahn, Kai; Odenthal, Margarete; Petmecky, Katharina; Schirmacher, Peter

2004-12-01

Transforming growth factor beta (TGFbeta) is a central mitoinhibitory factor for epithelial cells, and alterations of TGFbeta signalling have been demonstrated in many different human cancers. We have analysed human hepatocellular carcinomas (HCCs) for potential pro-tumourigenic alterations in regard to expression of Smad4 and mutations and expression changes of the pro-oncogenic transcriptional co-repressors Ski and SnoN, as well as mRNA levels of matrix metalloproteinase-2 (MMP2), which is transcriptionally regulated by TGFbeta. Smad4 mRNA was detected in all HCCs; while, using immunohistology, loss of Smad4 expression was found in 10% of HCCs. Neither mutations in the transformation-relevant sequences nor significant pro-tumourigenic expression changes of the Ski and SnoN genes were detected. In HCC cell lines, expression of both genes was regulated, potentially involving phosphorylation. Ski showed a distinct nuclear speckled pattern, indicating recruitment to active transcription complexes. MMP2 mRNA levels were increased in 19% of HCCs, whereas MMP2 mRNA was not detectable in HCC cell lines, suggesting that MMP2 was derived only from tumour stroma cells. Transcript levels of Smad4, Ski, SnoN and MMP2 correlated well. These data argue against a significant role of Ski and SnoN in human hepatocarcinogenesis and suggest that, in the majority of HCCs, the analysed factors are co-regulated by an upstream mechanism, potentially by TGFbeta itself.

A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H2O2 content.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-03-01

MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.

HSI2/VAL1 Silences AGL15 to Regulate the Developmental Transition from Seed Maturation to Vegetative Growth in Arabidopsis[OPEN

PubMed Central

Abdelmageed, Haggag; Kang, Miyoung

2018-01-01

Gene expression during seed development in Arabidopsis thaliana is controlled by transcription factors including LEAFY COTYLEDON1 (LEC1) and LEC2, ABA INSENSITIVE3 (ABI3), FUSCA3 (FUS3), known as LAFL proteins, and AGAMOUS-LIKE15 (AGL15). The transition from seed maturation to germination and seedling growth requires the transcriptional silencing of these seed maturation-specific factors leading to downregulation of structural genes including those that encode seed storage proteins, oleosins, and dehydrins. During seed germination and vegetative growth, B3-domain protein HSI2/VAL1 is required for the transcriptional silencing of LAFL genes. Here, we report chromatin immunoprecipitation analysis indicating that HSI2/VAL1 binds to the upstream sequences of the AGL15 gene but not at LEC1, ABI3, FUS3, or LEC2 loci. Functional analysis indicates that the HSI2/VAL1 B3 domain interacts with two RY elements upstream of the AGL15 coding region and at least one of them is required for HSI2/VAL1-dependent AGL15 repression. Expression analysis of the major seed maturation regulatory genes LEC1, ABI3, FUS3, and LEC2 in different genetic backgrounds demonstrates that HSI2/VAL1 is epistatic to AGL15 and represses the seed maturation regulatory program through downregulation of AGL15 by deposition of H3K27me3 at this locus. This hypothesis is further supported by results that show that HSI2/VAL1 physically interacts with the Polycomb Repressive Complex 2 component protein MSI1, which is also enriched at the AGL15 locus. PMID:29475938

Signaling coupled epigenomic regulation of gene expression.

PubMed

Kumar, R; Deivendran, S; Santhoshkumar, T R; Pillai, M R

2017-10-26

Inheritance of genomic information independent of the DNA sequence, the epigenetics, as well as gene transcription are profoundly shaped by serine/threonine and tyrosine signaling kinases and components of the chromatin remodeling complexes. To precisely respond to a changing external milieu, human cells efficiently translate upstream signals into post-translational modifications (PTMs) on histones and coregulators such as corepressors, coactivators, DNA-binding factors and PTM modifying enzymes. Because a protein with multiple residues for putative PTMs is expected to undergo more than one PTM in cells stimulated with growth factors, the outcome of combinational PTM codes on histones and coregulators is profoundly shaped by regulatory interplays between PTMs. The genomic functions of signaling kinases in cancer cells are manifested by the downstream effectors of cytoplasmic signaling cascades as well as translocation of the cytoplasmic signaling kinases to the nucleus. Signaling-mediated phosphorylation of histones serves as a regulatory switch for other PTMs, and connects chromatin remodeling complexes into gene transcription and gene activity. Here, we will discuss the recent advances in signaling-dependent epigenomic regulation of gene transcription using a few representative cancer-relevant serine/threonine and tyrosine kinases and their interplay with chromatin remodeling factors in cancer cells.

HAND2 Targets Define a Network of Transcriptional Regulators that Compartmentalize the Early Limb Bud Mesenchyme

DOE PAGES

Osterwalder, Marco; Speziale, Dario; Shoukry, Malak; ...

2014-11-10

The genetic networks that govern vertebrate development are well studied, but how the interactions of trans-acting factors with cis-regulatory modules (CRMs) are integrated into spatiotemporal regulation of gene expression is not clear. The transcriptional regulator HAND2 is required during limb, heart, and branchial arch development. Here, we identify the genomic regions enriched in HAND2 chromatin complexes from mouse embryos and limb buds. Then we analyze the HAND2 target CRMs in the genomic landscapes encoding transcriptional regulators required in early limb buds. HAND2 controls the expression of genes functioning in the proximal limb bud and orchestrates the establishment of anterior andmore » posterior polarity of the nascent limb bud mesenchyme by impacting Gli3 and Tbx3 expression. TBX3 is required downstream of HAND2 to refine the posterior Gli3 expression boundary. In conclusion, our analysis uncovers the transcriptional circuits that function in establishing distinct mesenchymal compartments downstream of HAND2 and upstream of SHH signaling.« less

Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

PubMed

Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

2004-09-01

Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

PubMed Central

Lo, W Y; Ting, L P

1994-01-01

Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

Sequoia regulates cell fate decisions in the external sensory organs of adult Drosophila.

PubMed

Andrews, Hillary K; Giagtzoglou, Nikolaos; Yamamoto, Shinya; Schulze, Karen L; Bellen, Hugo J

2009-06-01

The adult Drosophila external sensory organ (ESO), comprising the hair, socket, neuron, sheath and glia cells, arises through the asymmetric division of sensory organ precursor cells (SOPs). In a mosaic screen designed to identify new components in ESO development, we isolated mutations in sequoia, which encodes a putative zinc-finger transcription factor that has previously been shown to have a role in dendritogenesis. Here, we show that adult clones mutant for seq exhibit a loss of hair cells and a gain of socket cells. We propose that the seq mutant phenotype arises, in part, owing to the loss of several crucial transcription factors known to be important in peripheral nervous system development such as D-Pax2, Prospero and Hamlet. Thus, Sequoia is a new upstream regulator of genes that orchestrates cell fate specification during development of the adult ESO lineage.

Sequoia regulates cell fate decisions in the external sensory organs of adult Drosophila

PubMed Central

Andrews, Hillary K; Giagtzoglou, Nikolaos; Yamamoto, Shinya; Schulze, Karen L; Bellen, Hugo J

2009-01-01

The adult Drosophila external sensory organ (ESO), comprising the hair, socket, neuron, sheath and glia cells, arises through the asymmetric division of sensory organ precursor cells (SOPs). In a mosaic screen designed to identify new components in ESO development, we isolated mutations in sequoia, which encodes a putative zinc-finger transcription factor that has previously been shown to have a role in dendritogenesis. Here, we show that adult clones mutant for seq exhibit a loss of hair cells and a gain of socket cells. We propose that the seq mutant phenotype arises, in part, owing to the loss of several crucial transcription factors known to be important in peripheral nervous system development such as D-Pax2, Prospero and Hamlet. Thus, Sequoia is a new upstream regulator of genes that orchestrates cell fate specification during development of the adult ESO lineage. PMID:19444309

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

Low concentrations of copper in drinking water increase AP-1 binding in the brain.

PubMed

Lung, Shyang; Li, Huihui; Bondy, Stephen C; Campbell, Arezoo

2015-12-01

Copper (Cu) in trace amounts is essential for biological organisms. However, dysregulation of the redox-active metal has been implicated in different neurological disorders such as Wilson's, Menkes', Alzheimer's, and Parkinson's diseases. Since many households use Cu tubing in the plumbing system, and corrosion causes the metal to leach into the drinking water, there may be adverse effects on the central nervous system connected with low-level chronic exposure. The present study demonstrates that treatment with a biologically relevant concentration of Cu for 3 months significantly increases activation of the redox-modulated transcription factor AP-1 in mouse brains. This was independent of an upstream kinase indicated in AP-1 activation. Another redox-active transcription factor, NF-κB, was not significantly modified by the Cu exposure. These results indicate that the effect of Cu on AP-1 is unique and may involve direct modulation of DNA binding. © The Author(s) 2012.

Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

PubMed

Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

2012-07-01

The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

Differential epigenetic and transcriptional response of the skeletal muscle carnitine palmitoyltransferase 1B (CPT1B) gene to lipid exposure with obesity

PubMed Central

Maples, Jill M.; Brault, Jeffrey J.; Witczak, Carol A.; Park, Sanghee; Hubal, Monica J.; Weber, Todd M.; Houmard, Joseph A.

2015-01-01

The ability to increase fatty acid oxidation (FAO) in response to dietary lipid is impaired in the skeletal muscle of obese individuals, which is associated with a failure to coordinately upregulate genes involved with FAO. While the molecular mechanisms contributing to this metabolic inflexibility are not evident, a possible candidate is carnitine palmitoyltransferase-1B (CPT1B), which is a rate-limiting step in FAO. The present study was undertaken to determine if the differential response of skeletal muscle CPT1B gene transcription to lipid between lean and severely obese subjects is linked to epigenetic modifications (DNA methylation and histone acetylation) that impact transcriptional activation. In primary human skeletal muscle cultures the expression of CPT1B was blunted in severely obese women compared with their lean counterparts in response to lipid, which was accompanied by changes in CpG methylation, H3/H4 histone acetylation, and peroxisome proliferator-activated receptor-δ and hepatocyte nuclear factor 4α transcription factor occupancy at the CPT1B promoter. Methylation of specific CpG sites in the CPT1B promoter that correlated with CPT1B transcript level blocked the binding of the transcription factor upstream stimulatory factor, suggesting a potential causal mechanism. These findings indicate that epigenetic modifications may play important roles in the regulation of CPT1B in response to a physiologically relevant lipid mixture in human skeletal muscle, a major site of fatty acid catabolism, and that differential DNA methylation may underlie the depressed expression of CPT1B in response to lipid, contributing to the metabolic inflexibility associated with severe obesity. PMID:26058865

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

New Face for Chromatin-Related Mesenchymal Modulator: n-CHD9 Localizes to Nucleoli and Interacts With Ribosomal Genes.

PubMed

Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L

2015-09-01

Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.

Transcriptional master regulator analysis in breast cancer genetic networks.

PubMed

Tovar, Hugo; García-Herrera, Rodrigo; Espinal-Enríquez, Jesús; Hernández-Lemus, Enrique

2015-12-01

Gene regulatory networks account for the delicate mechanisms that control gene expression. Under certain circumstances, gene regulatory programs may give rise to amplification cascades. Such transcriptional cascades are events in which activation of key-responsive transcription factors called master regulators trigger a series of gene expression events. The action of transcriptional master regulators is then important for the establishment of certain programs like cell development and differentiation. However, such cascades have also been related with the onset and maintenance of cancer phenotypes. Here we present a systematic implementation of a series of algorithms aimed at the inference of a gene regulatory network and analysis of transcriptional master regulators in the context of primary breast cancer cells. Such studies were performed in a highly curated database of 880 microarray gene expression experiments on biopsy-captured tissue corresponding to primary breast cancer and healthy controls. Biological function and biochemical pathway enrichment analyses were also performed to study the role that the processes controlled - at the transcriptional level - by such master regulators may have in relation to primary breast cancer. We found that transcription factors such as AGTR2, ZNF132, TFDP3 and others are master regulators in this gene regulatory network. Sets of genes controlled by these regulators are involved in processes that are well-known hallmarks of cancer. This kind of analyses may help to understand the most upstream events in the development of phenotypes, in particular, those regarding cancer biology. Copyright © 2015 Elsevier Ltd. All rights reserved.

Transcription factor Sp1 regulates T-type Ca(2+) channel CaV 3.1 gene expression.

PubMed

González-Ramírez, Ricardo; Martínez-Hernández, Elizabeth; Sandoval, Alejandro; Felix, Ricardo

2014-05-01

Voltage-gated T-type Ca(2+) (CaV 3) channels mediate a number of physiological events in developing and mature cells, and are implicated in neurological and cardiovascular diseases. In mammals, there are three distinct T-channel genes (CACNA1G, CACNA1H, and CACNA1I) encoding proteins (CaV 3.1-CaV 3.3) that differ in their localization as well as in molecular, biophysical, and pharmacological properties. The CACNA1G is a large gene that contains 38 exons and is localized in chromosome 17q22. Only basic characteristics of the CACNA1G gene promoter region have been investigated classifying it as a TATA-less sequence containing several potential transcription factor-binding motifs. Here, we cloned and characterized a proximal promoter region and initiated the analysis of transcription factors that control CaV 3.1 channel expression using the murine Cacna1g gene as a model. We isolated a ∼1.5 kb 5'-upstream region of Cacna1g and verified its transcriptional activity in the mouse neuroblastoma N1E-115 cell line. In silico analysis revealed that this region possesses a TATA-less minimal promoter that includes two potential transcription start sites and four binding sites for the transcription factor Sp1. The ability of one of these sites to interact with the transcription factor was confirmed by electrophoretic mobility shift assays. Consistent with this, Sp1 over-expression enhanced promoter activity while siRNA-mediated Sp1 silencing significantly decreased the level of CaV 3.1 protein and reduced the amplitude of whole-cell T-type Ca(2+) currents expressed in the N1E-115 cells. These results provide new insights into the molecular mechanisms that control CaV 3.1 channel expression. © 2013 Wiley Periodicals, Inc.

C/EBPβ (CCAAT/enhancer-binding protein β) mediates progesterone production through transcriptional regulation in co-operation with SF-1 (steroidogenic factor-1).

PubMed

Mizutani, Tetsuya; Ju, Yunfeng; Imamichi, Yoshitaka; Osaki, Tsukasa; Yazawa, Takashi; Kawabe, Shinya; Ishikane, Shin; Matsumura, Takehiro; Kanno, Masafumi; Kamiki, Yasue; Kimura, Kohei; Minamino, Naoto; Miyamoto, Kaoru

2014-06-15

The transcription factor SF-1 (steroidogenic factor-1) is a master regulator of steroidogenesis. Previously, we have found that SF-1 induces the differentiation of mesenchymal stem cells into steroidogenic cells. To elucidate the molecular mechanisms of SF-1-mediated functions, we attempted to identify protein components of the SF-1 nuclear protein complex in differentiated cells. SF-1 immunoaffinity chromatography followed by MS/MS analysis was performed, and 24 proteins were identified. Among these proteins, we focused on C/EBPβ (CCAAT/enhancer-binding protein β), which is an essential transcription factor for ovulation and luteinization, as the transcriptional mechanisms of C/EBPβ working together with SF-1 are poorly understood. C/EBPβ knockdown attenuated cAMP-induced progesterone production in granulosa tumour-derived KGN cells by altering STAR (steroidogenic acute regulatory protein), CYP11A1 (cytochrome P450, family 11, subfamily A, polypeptide 1) and HSD3B2 (hydroxy-δ-5-steroid dehydrogenase, 3β- and steroid δ-isomerase 2) expression. EMSA and ChIP assays revealed novel C/EBPβ-binding sites in the upstream regions of the HSD3B2 and CYP11A1 genes. These interactions were enhanced by cAMP stimulation. Luciferase assays showed that C/EBPβ-responsive regions were found in each promoter and C/EBPβ is involved in the cAMP-induced transcriptional activity of these genes together with SF-1. These results indicate that C/EBPβ is an important mediator of progesterone production by working together with SF-1, especially under tropic hormone-stimulated conditions.

STAT3 inhibition as a therapeutic strategy for leukemia.

PubMed

Kanna, Rubashruti; Choudhary, Gaurav; Ramachandra, Nandini; Steidl, Ulrich; Verma, Amit; Shastri, Aditi

2017-11-22

Leukemia is characterized by selective overgrowth of malignant hematopoietic stem cells (HSC's) that interfere with HSC differentiation. Cytoreductive chemotherapy can kill rapidly dividing cancerous cells but cannot eradicate the malignant HSC pool leading to relapses. Leukemic stem cells have several dysregulated pathways and the Janus kinases (JAKs) and signal transducer and activator of transcription (STAT) pathway are prominent among them. STAT3 is an important transcription factor that regulates cell growth, proliferation, and inhibits apoptosis. High STAT3 expression in leukemia has been associated with an increased risk for relapse and decreased overall survival. Multiple strategies for interfering with STAT3 activity in leukemic cells include inhibition of STAT3 phosphorylation, interfering with STAT3 interactions, preventing nuclear transfer, inhibiting transcription and causing interference in STAT: DNA binding. A better understanding of key interactions and upstream mediators of STAT3 activity will help facilitate the development of effective cancer therapies and may result in durable remissions.

Early life stress confers lifelong stress susceptibility in mice via ventral tegmental area OTX2.

PubMed

Peña, Catherine J; Kronman, Hope G; Walker, Deena M; Cates, Hannah M; Bagot, Rosemary C; Purushothaman, Immanuel; Issler, Orna; Loh, Yong-Hwee Eddie; Leong, Tin; Kiraly, Drew D; Goodman, Emma; Neve, Rachael L; Shen, Li; Nestler, Eric J

2017-06-16

Early life stress increases risk for depression. Here we establish a "two-hit" stress model in mice wherein stress at a specific postnatal period increases susceptibility to adult social defeat stress and causes long-lasting transcriptional alterations that prime the ventral tegmental area (VTA)-a brain reward region-to be in a depression-like state. We identify a role for the developmental transcription factor orthodenticle homeobox 2 ( Otx2 ) as an upstream mediator of these enduring effects. Transient juvenile-but not adult-knockdown of Otx2 in VTA mimics early life stress by increasing stress susceptibility, whereas its overexpression reverses the effects of early life stress. This work establishes a mechanism by which early life stress encodes lifelong susceptibility to stress via long-lasting transcriptional programming in VTA mediated by Otx2 . Copyright © 2017, American Association for the Advancement of Science.

Identification of Akt Interaction Protein PHF20/TZP That Transcriptionally Regulates p53*

PubMed Central

Park, Sungman; Kim, Donghwa; Dan, Han C.; Chen, Huihua; Testa, Joseph R.; Cheng, Jin Q.

2012-01-01

Akt regulates a diverse array of cellular functions, including cell survival, proliferation, differentiation, and metabolism. Although a number of molecules have been identified as upstream regulators and downstream targets of Akt, the mechanisms by which Akt regulates these cellular processes remain elusive. Here, we demonstrate that a novel transcription factor, PHF20/TZP (referring to Tudor and zinc finger domain containing protein), binds to Akt and induces p53 expression at the transcription level. Knockdown of PHF20 significantly reduces p53. PHF20 inhibits cell growth, DNA synthesis, and cell survival. Akt phosphorylates PHF20 at Ser291 in vitro and in vivo, which results in its translocation from the nucleus to the cytoplasm and attenuation of PHF20 function. These data indicate that PHF20 is a substrate of Akt and plays a role in Akt cell survival/growth signaling. PMID:22334668

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamaji, Takashi; Lopez, David; Pellegrini, Matteo

Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

Two Genetic Determinants Acquired Late in Mus Evolution Regulate the Inclusion of Exon 5, which Alters Mouse APOBEC3 Translation Efficiency

PubMed Central

Li, Jun; Hakata, Yoshiyuki; Takeda, Eri; Liu, Qingping; Iwatani, Yasumasa; Kozak, Christine A.; Miyazawa, Masaaki

2012-01-01

Mouse apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like editing complex 3 (mA3), an intracellular antiviral factor, has 2 allelic variations that are linked with different susceptibilities to beta- and gammaretrovirus infections among various mouse strains. In virus-resistant C57BL/6 (B6) mice, mA3 transcripts are more abundant than those in susceptible BALB/c mice both in the spleen and bone marrow. These strains of mice also express mA3 transcripts with different splicing patterns: B6 mice preferentially express exon 5-deficient (Δ5) mA3 mRNA, while BALB/c mice produce exon 5-containing full-length mA3 mRNA as the major transcript. Although the protein product of the Δ5 mRNA exerts stronger antiretroviral activities than the full-length protein, how exon 5 affects mA3 antiviral activity, as well as the genetic mechanisms regulating exon 5 inclusion into the mA3 transcripts, remains largely uncharacterized. Here we show that mA3 exon 5 is indeed a functional element that influences protein synthesis at a post-transcriptional level. We further employed in vitro splicing assays using genomic DNA clones to identify two critical polymorphisms affecting the inclusion of exon 5 into mA3 transcripts: the number of TCCT repeats upstream of exon 5 and the single nucleotide polymorphism within exon 5 located 12 bases upstream of the exon 5/intron 5 boundary. Distribution of the above polymorphisms among different Mus species indicates that the inclusion of exon 5 into mA3 mRNA is a relatively recent event in the evolution of mice. The widespread geographic distribution of this exon 5-including genetic variant suggests that in some Mus populations the cost of maintaining an effective but mutagenic enzyme may outweigh its antiviral function. PMID:22275865

Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.

PubMed Central

Qureshi, S A; Khoo, B; Baumann, P; Jackson, S P

1995-01-01

The Archaea (archaebacteria) constitute a group of prokaryotes that are phylogenetically distinct from Eucarya (eukaryotes) and Bacteria (eubacteria). Although Archaea possess only one RNA polymerase, evidence suggests that their transcriptional apparatus is similar to that of Eucarya. For example, Archaea contain a homolog of the TATA-binding protein which interacts with the TATA-box like A-box sequence upstream of many archaeal genes. Here, we report the cloning of a Sulfolobus shibatae gene that encodes a protein (transcription factor TFB) with striking homology to the eukaryotic basal transcription factor TFIIB. We show by primer extension analysis that transcription of the S. shibatae TFB gene initiates 27 bp downstream from a consensus A-box element. Significantly, S. shibatae TFB contains an N-terminal putative metal-binding region and two imperfect direct repeats--structural features that are well conserved in eukaryotic TFIIBs. This suggests that TFB may perform analogous functions in Archaea and Eucarya. Consistent with this, we demonstrate that S. shibatae TFB promotes the binding of S. shibatae TBP to the A-box element of the Sulfolobus 16S/23S rRNA gene. Finally, we show that S. shibatae TFB is significantly more related to TFB of the archaeon Pyrococcus woesei than it is to eukaryotic TFIIBs. These data suggest that TFB arose in the common archaeal/eukaryotic ancestor and that the lineages leading to P. woesei and S. shibatae separated after the divergence of the archaeal and eukaryotic lines of descent. Images Fig. 2 Fig. 3 PMID:7597084

Antagonistic Basic Helix-Loop-Helix/bZIP Transcription Factors Form Transcriptional Modules That Integrate Light and Reactive Oxygen Species Signaling in Arabidopsis[W

PubMed Central

Chen, Dongqin; Xu, Gang; Tang, Weijiang; Jing, Yanjun; Ji, Qiang; Fei, Zhangjun; Lin, Rongcheng

2013-01-01

The critical developmental switch from heterotrophic to autotrophic growth of plants involves light signaling transduction and the production of reactive oxygen species (ROS). ROS function as signaling molecules that regulate multiple developmental processes, including cell death. However, the relationship between light and ROS signaling remains unclear. Here, we identify transcriptional modules composed of the basic helix-loop-helix and bZIP transcription factors PHYTOCHROME-INTERACTING FACTOR1 (PIF1), PIF3, ELONGATED HYPOCOTYL5 (HY5), and HY5 HOMOLOGY (HYH) that bridge light and ROS signaling to regulate cell death and photooxidative response. We show that pif mutants release more singlet oxygen and exhibit more extensive cell death than the wild type during Arabidopsis thaliana deetiolation. Genome-wide expression profiling indicates that PIF1 represses numerous ROS and stress-related genes. Molecular and biochemical analyses reveal that PIF1/PIF3 and HY5/HYH physically interact and coordinately regulate the expression of five ROS-responsive genes by directly binding to their promoters. Furthermore, PIF1/PIF3 and HY5/HYH function antagonistically during the seedling greening process. In addition, phytochromes, cryptochromes, and CONSTITUTIVE PHOTOMORPHOGENIC1 act upstream to regulate ROS signaling. Together, this study reveals that the PIF1/PIF3-HY5/HYH transcriptional modules mediate crosstalk between light and ROS signaling and sheds light on a new mechanism by which plants adapt to the light environments. PMID:23645630

Essential and Unexpected Role of YY1 to Promote Mesodermal Cardiac Differentiation

PubMed Central

Gregoire, Serge; Karra, Ravi; Passer, Derek; Deutsch, Marcus-Andre; Krane, Markus; Feistritzer, Rebecca; Sturzu, Anthony; Domian, Ibrahim; Saga, Yumiko; Wu, Sean M.

2013-01-01

Rational Cardiogenesis is regulated by a complex interplay between transcription factors. However, little is known about how these interactions regulate the transition from mesodermal precursors to cardiac progenitor cells (CPCs). Objective To identify novel regulators of mesodermal cardiac lineage commitment. Methods and Results We performed a bioinformatic-based transcription factor binding site analysis on upstream promoter regions of genes that are enriched in embryonic stem cell (ESC)-derived CPCs. From 32 candidate transcription factors screened, we found that YY1, a repressor of sarcomeric gene expression, is present in CPCs in vivo. Interestingly, we uncovered the ability of YY1 to transcriptionally activate Nkx2.5, a key marker of early cardiogenic commitment. YY1 regulates Nkx2.5 expression via a 2.1 kb cardiac-specific enhancer as demonstrated by in vitro luciferase-based assays and in vivo chromatin immunoprecipitation (ChIP) and genome-wide sequencing analysis. Furthermore, the ability of YY1 to activate Nkx2.5 expression depends on its cooperative interaction with Gata4 at a nearby chromatin. Cardiac mesoderm-specific loss-of-function of YY1 resulted in early embryonic lethality. This was corroborated in vitro by ESC-based assays where we show that the overexpression of YY1 enhanced the cardiogenic differentiation of ESCs into CPCs. Conclusion These results demonstrate an essential and unexpected role for YY1 to promote cardiogenesis as a transcriptional activator of Nkx2.5 and other CPC-enriched genes. PMID:23307821

Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the -111 kb-Myf5 enhancer.

PubMed

Daubas, Philippe; Buckingham, Margaret E

2013-04-15

The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.

Characterization of New Otic Enhancers of the Pou3f4 Gene Reveal Distinct Signaling Pathway Regulation and Spatio-Temporal Patterns

PubMed Central

Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta

2010-01-01

POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840

Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis

NASA Astrophysics Data System (ADS)

Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

2015-09-01

An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.

Transcriptome Analysis of Polyhydroxybutyrate Cycle Mutants Reveals Discrete Loci Connecting Nitrogen Utilization and Carbon Storage in Sinorhizobium meliloti.

PubMed

D'Alessio, Maya; Nordeste, Ricardo; Doxey, Andrew C; Charles, Trevor C

2017-01-01

Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti , we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis ( phbA , phbB , phbAB , and phbC ), PHB degradation ( bdhA , phaZ , and acsA2 ), and glycogen synthesis ( glgA1 ). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to the cell. The impact of carbon storage on cellular metabolism would be reflected in global transcription patterns. By investigating the transcriptomic effects of genetically disrupting genes involved in the PHB carbon storage cycle, we revealed a relationship between intracellular carbon storage and nitrogen metabolism. This work demonstrates the utility of combining transcriptome sequencing with metabolic pathway mutations for identifying underlying gene regulatory mechanisms.

Immunoglobulin class switch DNA recombination: induction, targeting and beyond

PubMed Central

Xu, Zhenming; Zan, Hong; Pone, Egest J.; Mai, Thach; Casali, Paolo

2012-01-01

Class switch DNA recombination (CSR) of the immunoglobulin heavy chain (IgH) locus is central to the maturation of the antibody response and critically requires the AID cytidine deaminase. CSR entails changes of the chromatin state and transcriptional activation of the IgH locus upstream and downstream switch (S) regions that are to undergo S-S DNA recombination, induction of AID, and targeting of CSR factors to S regions by 14-3-3 adaptors and as enabled by the transcription machinery and histone modifications. In this Review, we focus on recent advances in CSR induction and targeting. We also outline an integrated model of the assembly of macromolecular complexes that transduce critical epigenetic information to enzymatic effectors of the CSR machinery. PMID:22728528

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

A novel polymorphism in the PAI-1 gene promoter enhances gene expression. A novel pro-thrombotic risk factor?

PubMed

Liguori, Renato; Quaranta, Sandro; Di Fiore, Rosanna; Elce, Ausilia; Castaldo, Giuseppe; Amato, Felice

2014-12-01

Plasminogen activator inhibitor-1 (PAI-1) is the major physiological inhibitor of tissue-type plasminogen activator in plasma and the most important regulator of the fibrinolytic pathway. The 4G/5G polymorphism (rs1799889) in the PAI-1 promoter is associated with altered PAI-1 transcription. We have identified a new 4G/5G allele, in which a T is inserted near the 4G tract or replaces a G in the 5G tract, forming a T plus 4G (T4G) region. This new variant was first identified in two women, one had experienced juvenile myocardial infarction, the other repeated miscarriage; both had increased PAI-1 plasma activity. In view of the important influence of this promoter region on PAI-1 protein plasma level, we performed in vitro evaluation of the effects of the T4G variant on the transcription activity of the PAI-1 gene promoter. In silico prediction analysis showed that presence of the T4G allele disrupts the E-Box region upstream of the T4G variant, altering the affinity of the target sequence for E-Box binding factors like upstream stimulatory factor-1 (USF-1). Basal T4G promoter activity was 50% higher compared to 4G and 5G variants, but it was less stimulated by USF-1 overexpression. We also analyzed the effects of IL-1β and IL-6 on the PAI-1 promoter activity of our three constructs and showed that the T4G variant was less affected by IL-1β than the other variants. These findings indicate that the T4G variant may be a novel risk factor for thrombotic events. Copyright © 2014 Elsevier Ltd. All rights reserved.

Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development.

PubMed

Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G

2010-12-01

The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. © 2010 Blackwell Publishing Ltd.

Nucleoside Triphosphate Phosphohydrolase I (NPH I) Functions as a 5′ to 3′ Translocase in Transcription Termination of Vaccinia Early Genes*

PubMed Central

Hindman, Ryan; Gollnick, Paul

2016-01-01

Vaccinia virus early genes are transcribed immediately upon infection. Nucleoside triphosphate phosphohydrolase I (NPH I) is an essential component of the early gene transcription complex. NPH I hydrolyzes ATP to release transcripts during transcription termination. The ATPase activity of NPH I requires single-stranded (ss) DNA as a cofactor; however, the source of this cofactor within the transcription complex is not known. Based on available structures of transcription complexes it has been hypothesized that the ssDNA cofactor is obtained from the unpaired non-template strand within the transcription bubble. In vitro transcription on templates that lack portions of the non-template strand within the transcription bubble showed that the upstream portion of the transcription bubble is required for efficient NPH I-mediated transcript release. Complementarity between the template and non-template strands in this region is also required for NPH I-mediated transcript release. This observation complicates locating the source of the ssDNA cofactor within the transcription complex because removal of the non-template strand also disrupts transcription bubble reannealing. Prior studies have shown that ssRNA binds to NPH I, but it does not activate ATPase activity. Chimeric transcription templates with RNA in the non-template strand confirm that the source of the ssDNA cofactor for NPH I is the upstream portion of the non-template strand in the transcription bubble. Consistent with this conclusion we also show that isolated NPH I acts as a 5′ to 3′ translocase on single-stranded DNA. PMID:27189950

c-kit expression profile and regulatory factors during spermatogonial stem cell differentiation

PubMed Central

2013-01-01

Background It has been proven that c-kit is crucial for proliferation, migration, survival and maturation of spermatogenic cells. A periodic expression of c-kit is observed from primordial germ cells (PGCs) to spermatogenetic stem cells (SSCs), However, the expression profile of c-kit during the entire spermatogenesis process is still unclear. This study aims to reveal and compare c-kit expression profiles in the SSCs before and after the anticipated differentiation, as well as to examine its relationship with retinoic acid (RA) stimulation. Results We have found that there are more than 4 transcripts of c-kit expressed in the cell lines and in the testes. The transcripts can be divided into short and long categories. The long transcripts include the full-length canonical c-kit transcript and the 3′ end short transcript. Short transcripts include the 3.4 kb short transcript and several truncated transcripts (1.9-3.2 kb). In addition, the 3.4 kb transcript (starting from intron 9 and covering exons 10 ~ 21) is discovered to be specifically expressed in the spermatogonia. The extracellular domain of Kit is obtained in the spermatogonia stage, but the intracellular domain (50 kDa) is constantly expressed in both SSCs and spermatogonia. The c-kit expression profiles in the testis and the spermatogonial stem cell lines vary after RA stimulation. The wave-like changes of the quantitative expression pattern of c-kit (increase initially and decrease afterwards) during the induction process are similar to that of the in vivo male germ cell development process. Conclusions There are dynamic transcription and translation changes of c-kit before and after SSCs’ anticipated differentiation and most importantly, RA is a significant upstream regulatory factor for c-kit expression. PMID:24161026

Transcriptional role of androgen receptor in the expression of long non-coding RNA Sox2OT in neurogenesis

PubMed Central

Tosetti, Valentina; Sassone, Jenny; Ferri, Anna L. M.; Taiana, Michela; Bedini, Gloria; Nava, Sara; Brenna, Greta; Di Resta, Chiara; Pareyson, Davide; Di Giulio, Anna Maria; Carelli, Stephana

2017-01-01

The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR) is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA) Sox2 overlapping transcript (Sox2OT) plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE), and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT. PMID:28704421

Transcriptional role of androgen receptor in the expression of long non-coding RNA Sox2OT in neurogenesis.

PubMed

Tosetti, Valentina; Sassone, Jenny; Ferri, Anna L M; Taiana, Michela; Bedini, Gloria; Nava, Sara; Brenna, Greta; Di Resta, Chiara; Pareyson, Davide; Di Giulio, Anna Maria; Carelli, Stephana; Parati, Eugenio A; Gorio, Alfredo

2017-01-01

The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR) is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA) Sox2 overlapping transcript (Sox2OT) plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE), and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT.

Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors

PubMed Central

Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

2014-01-01

The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around −120 to −80 bp, while highly effective sgRNAs targeted from −147 to −89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells. PMID:24500196

Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.

PubMed

Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

2014-04-01

The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells.

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

The Membrane-Bound NAC Transcription Factor ANAC013 Functions in Mitochondrial Retrograde Regulation of the Oxidative Stress Response in Arabidopsis[C][W

PubMed Central

De Clercq, Inge; Vermeirssen, Vanessa; Van Aken, Olivier; Vandepoele, Klaas; Murcha, Monika W.; Law, Simon R.; Inzé, Annelies; Ng, Sophia; Ivanova, Aneta; Rombaut, Debbie; van de Cotte, Brigitte; Jaspers, Pinja; Van de Peer, Yves; Kangasjärvi, Jaakko; Whelan, James; Van Breusegem, Frank

2013-01-01

Upon disturbance of their function by stress, mitochondria can signal to the nucleus to steer the expression of responsive genes. This mitochondria-to-nucleus communication is often referred to as mitochondrial retrograde regulation (MRR). Although reactive oxygen species and calcium are likely candidate signaling molecules for MRR, the protein signaling components in plants remain largely unknown. Through meta-analysis of transcriptome data, we detected a set of genes that are common and robust targets of MRR and used them as a bait to identify its transcriptional regulators. In the upstream regions of these mitochondrial dysfunction stimulon (MDS) genes, we found a cis-regulatory element, the mitochondrial dysfunction motif (MDM), which is necessary and sufficient for gene expression under various mitochondrial perturbation conditions. Yeast one-hybrid analysis and electrophoretic mobility shift assays revealed that the transmembrane domain–containing NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON transcription factors (ANAC013, ANAC016, ANAC017, ANAC053, and ANAC078) bound to the MDM cis-regulatory element. We demonstrate that ANAC013 mediates MRR-induced expression of the MDS genes by direct interaction with the MDM cis-regulatory element and triggers increased oxidative stress tolerance. In conclusion, we characterized ANAC013 as a regulator of MRR upon stress in Arabidopsis thaliana. PMID:24045019

The BABY BOOM Transcription Factor Activates the LEC1-ABI3-FUS3-LEC2 Network to Induce Somatic Embryogenesis1[OPEN

PubMed Central

Weemen, Mieke

2017-01-01

Somatic embryogenesis is an example of induced cellular totipotency, where embryos develop from vegetative cells rather than from gamete fusion. Somatic embryogenesis can be induced in vitro by exposing explants to growth regulators and/or stress treatments. The BABY BOOM (BBM) and LEAFY COTYLEDON1 (LEC1) and LEC2 transcription factors are key regulators of plant cell totipotency, as ectopic overexpression of either transcription factor induces somatic embryo formation from Arabidopsis (Arabidopsis thaliana) seedlings without exogenous growth regulators or stress treatments. Although LEC and BBM proteins regulate the same developmental process, it is not known whether they function in the same molecular pathway. We show that BBM transcriptionally regulates LEC1 and LEC2, as well as the two other LAFL genes, FUSCA3 (FUS3) and ABSCISIC ACID INSENSITIVE3 (ABI3). LEC2 and ABI3 quantitatively regulate BBM-mediated somatic embryogenesis, while FUS3 and LEC1 are essential for this process. BBM-mediated somatic embryogenesis is dose and context dependent, and the context-dependent phenotypes are associated with differential LAFL expression. We also uncover functional redundancy for somatic embryogenesis among other Arabidopsis BBM-like proteins and show that one of these proteins, PLETHORA2, also regulates LAFL gene expression. Our data place BBM upstream of other major regulators of plant embryo identity and totipotency. PMID:28830937

Signaling through protein kinases and transcriptional regulators in Candida albicans.

PubMed

Dhillon, Navneet K; Sharma, Sadhna; Khuller, G K

2003-01-01

The human fungal pathogen Candida albicans switches from a budding yeast form to a polarized hyphal form in response to various external signals. This morphogenetic switching has been implicated in the development of pathogenicity. Several signaling pathways that regulate morphogenesis have been identified, including various transcription factors that either activate or repress hypha-specific genes. Two well-characterized pathways include the MAP kinase cascade and cAMP-dependent protein kinase pathway that regulate the transcription factors Cph1p and Efg1p, respectively. cAMP also appears to interplay with other second messengers: Ca2+, inositol tri-phosphates in regulating yeast-hyphal transition. Other, less-characterized pathways include two component histidine kinases, cyclin-dependent kinase pathway, and condition specific pathways such as pH and embedded growth conditions. Nrg1 and Rfg1 function as transcriptional repressors of hyphal genes via recruitment of Tup1 co-repressor complex. Different upstream signals converge into a common downstream output during hyphal switch. The levels of expression of several genes have been shown to be associated with hyphal morphogenesis rather than with a specific hypha-inducing condition. Hyphal development is also linked to the expression of a range of other virulence factors. This review explains the relative contribution of multiple pathways that could be used by Candida albican cells to sense subtle differences in the growth conditions of its native host environment.

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

The DEK oncogene activates VEGF expression and promotes tumor angiogenesis and growth in HIF-1α-dependent and -independent manners

PubMed Central

Li, Yang; Lv, Zhaohui; Zhu, Jie; Lin, Jing; Ding, Lihua; Ye, Qinong

2016-01-01

The DEK oncogene is overexpressed in various cancers and overexpression of DEK correlates with poor clinical outcome. Vascular endothelial growth factor (VEGF) is the most important regulator of tumor angiogenesis, a process essential for tumor growth and metastasis. However, whether DEK enhances tumor angiogenesis remains unclear. Here, we show that DEK is a key regulator of VEGF expression and tumor angiogenesis. Using chromatin immunoprecipitation assay, we found that DEK promoted VEGF transcription in breast cancer cells (MCF7, ZR75-1 and MDA-MB-231) by directly binding to putative DEK-responsive element (DRE) of the VEGF promoter and indirectly binding to hypoxia response element (HRE) upstream of the DRE through its interaction with the transcription factor hypoxia-inducible factor 1α (HIF-1α), a master regulator of tumor angiogenesis and growth. DEK is responsible for recruitment of HIF-1α and the histone acetyltransferase p300 to the VEGF promoter. DEK-enhanced VEGF increases vascular endothelial cell proliferation, migration and tube formation as well as angiogenesis in the chick chorioallantoic membrane. DEK promotes tumor angiogenesis and growth in nude mice in HIF-1α-dependent and -independent manners. Immunohistochemical staining showed that DEK expression positively correlates with the expression of VEGF and microvessel number in 58 breast cancer patients. Our data establish DEK as a sequence-specific binding transcription factor, a novel coactivator for HIF-1α in regulation of VEGF transcription and a novel promoter of angiogenesis. PMID:26988756

Deregulation of polycomb repressor complex 1 modifier AUTS2 in T-cell leukemia.

PubMed

Nagel, Stefan; Pommerenke, Claudia; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G; MacLeod, Roderick A F

2016-07-19

Recently, we identified deregulated expression of the B-cell specific transcription factor MEF2C in T-cell acute lymphoid leukemia (T-ALL). Here, we performed sequence analysis of a regulatory upstream section of MEF2C in T-ALL cell lines which, however, proved devoid of mutations. Unexpectedly, we found strong conservation between the regulatory upstream region of MEF2C (located at chromosomal band 5q14) and an intergenic stretch at 7q11 located between STAG3L4 and AUTS2, covering nearly 20 kb. While the non-coding gene STAG3L4 was inconspicuously expressed, AUTS2 was aberrantly upregulated in 6% of T-ALL patients (public dataset GSE42038) and in 3/24 T-ALL cell lines, two of which represented very immature differentiation stages. AUTS2 expression was higher in normal B-cells than in T-cells, indicating lineage-specific activity in lymphopoiesis. While excluding chromosomal aberrations, examinations of AUTS2 transcriptional regulation in T-ALL cells revealed activation by IL7-IL7R-STAT5-signalling and MEF2C. AUTS2 protein has been shown to interact with polycomb repressor complex 1 subtype 5 (PRC1.5), transforming this particular complex into an activator. Accordingly, expression profiling and functional analyses demonstrated that AUTS2 activated while PCGF5 repressed transcription of NKL homeobox gene MSX1 in T-ALL cells. Forced expression and pharmacological inhibition of EZH2 in addition to H3K27me3 analysis indicated that PRC2 repressed MSX1 as well. Taken together, we found that AUTS2 and MEF2C, despite lying on different chromosomes, share strikingly similar regulatory upstream regions and aberrant expression in T-ALL subsets. Our data implicate chromatin complexes PRC1/AUTS2 and PRC2 in a gene network in T-ALL regulating early lymphoid differentiation.

Carotenoid biosynthesis in bacteria: In vitro studies of a crt/bch transcription factor from Rhodobacter capsulatus and carotenoid enzymes from Erwinia herbicola

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Brien, D.A.

1992-11-01

A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis ofmore » two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.« less

Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

PubMed Central

Datta, Kausiki; von Hippel, Peter H.

2008-01-01

Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

Regulatory Nexus of Synthesis and Degradation Deciphers Cellular Nrf2 Expression Levels

PubMed Central

Suzuki, Takafumi; Shibata, Tatsuhiro; Takaya, Kai; Shiraishi, Kouya; Kohno, Takashi; Kunitoh, Hideo; Tsuta, Koji; Furuta, Koh; Goto, Koichi; Hosoda, Fumie; Sakamoto, Hiromi; Motohashi, Hozumi

2013-01-01

Transcription factor Nrf2 (NF-E2-related factor 2) is essential for oxidative and electrophilic stress responses. While it has been well characterized that Nrf2 activity is tightly regulated at the protein level through proteasomal degradation via Keap1 (Kelch-like ECH-associated protein 1)-mediated ubiquitination, not much attention has been paid to the supply side of Nrf2, especially regulation of Nrf2 gene transcription. Here we report that manipulation of Nrf2 transcription is effective in changing the final Nrf2 protein level and activity of cellular defense against oxidative stress even in the presence of Keap1 and under efficient Nrf2 degradation, determined using genetically engineered mouse models. In excellent agreement with this finding, we found that minor A/A homozygotes of a single nucleotide polymorphism (SNP) in the human NRF2 upstream promoter region (rs6721961) exhibited significantly diminished NRF2 gene expression and, consequently, an increased risk of lung cancer, especially those who had ever smoked. Our results support the notion that in addition to control over proteasomal degradation and derepression from degradation/repression, the transcriptional level of the Nrf2 gene acts as another important regulatory point to define cellular Nrf2 levels. These results thus verify the critical importance of human SNPs that influence the levels of transcription of the NRF2 gene for future personalized medicine. PMID:23572560

Transcriptional regulation of human papillomavirus type 18 P105 promoter by the co-activator CBP.

PubMed

Valencia-Hernández, Armando; Cuevas-Bennett, Christian; Garrido, Efraín

2007-01-01

Human papillomaviruses (HPVs) are the etiological agents of cervical cancer, with HPV-16 and 18 being the representative types of the higher risk group. The expression of the viral genes with transforming activity (E6 and E7) is controlled by the upstream regulatory region (URR), a segment of the viral genome that contains elements recognized by several transcription factors. We have analyzed the participation of the cellular co-activator CBP on the transcriptional regulation of the HPV-18 URR. We generated mutants and 5' end deletion constructs derived from the HPV-18 URR and evaluated their transcriptional activity performing transient co-transfection assays on C-33A cells with a plasmid that over-expresses the co-activator CBP. We also performed quantitative chromatin immunoprecipitation assays to analyze the participation of the co-activator CBP on the HPV-18 P105 promoter. Our results demonstrate that in C-33A cells CBP acts as a strong activator of the HPV-18 P105 promoter by a mechanism that depends on the integrity of the SP1-binding site, directly correlating with the acetylation of the histone H3 that is involved in nucleosomal stability. We propose a mechanism of regulation of the HPV-18 P105 promoter by the cellular co-activator CBP, recruited by the transcription factor SP1. (c) 2008 S. Karger AG, Basel

Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

DOE PAGES

Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina; ...

2015-11-10

Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina

Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum

PubMed Central

2012-01-01

Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. Conclusions The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have overcome the stress condition. Here we propose a model of the regulation of oxidative and heat stress response including redox homeostasis by SigH, RshA and the thioredoxin system. PMID:22943411

Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum.

PubMed

Busche, Tobias; Silar, Radoslav; Pičmanová, Martina; Pátek, Miroslav; Kalinowski, Jörn

2012-09-03

The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have overcome the stress condition. Here we propose a model of the regulation of oxidative and heat stress response including redox homeostasis by SigH, RshA and the thioredoxin system.

Identification of upstream transcription factors (TFs) for expression signature genes in breast cancer.

PubMed

Zang, Hongyan; Li, Ning; Pan, Yuling; Hao, Jingguang

2017-03-01

Breast cancer is a common malignancy among women with a rising incidence. Our intention was to detect transcription factors (TFs) for deeper understanding of the underlying mechanisms of breast cancer. Integrated analysis of gene expression datasets of breast cancer was performed. Then, functional annotation of differentially expressed genes (DEGs) was conducted, including Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment. Furthermore, TFs were identified and a global transcriptional regulatory network was constructed. Seven publically available GEO datasets were obtained, and a set of 1196 DEGs were identified (460 up-regulated and 736 down-regulated). Functional annotation results showed that cell cycle was the most significantly enriched pathway, which was consistent with the fact that cell cycle is closely related to various tumors. Fifty-three differentially expressed TFs were identified, and the regulatory networks consisted of 817 TF-target interactions between 46 TFs and 602 DEGs in the context of breast cancer. Top 10 TFs covering the most downstream DEGs were SOX10, NFATC2, ZNF354C, ARID3A, BRCA1, FOXO3, GATA3, ZEB1, HOXA5 and EGR1. The transcriptional regulatory networks could enable a better understanding of regulatory mechanisms of breast cancer pathology and provide an opportunity for the development of potential therapy.

The COUP-TFs compose a family of functionally related transcription factors

PubMed Central

Wang, Lee-Ho; Ing, Nancy H.; Tsai, Sophia Y.; O’Malley, Bert W.; Tsai, Ming-Jer

1991-01-01

The chicken ovalbumin upstream promoter transcription factors (COUP-TFs) are members of the steroid/thyroid hormone receptor superfamily and function in transcriptional regulation of a wide variety of genes. The COUP-TFs purified from HeLa nuclear extract by COUP-affinity chromatography are composed of multiple Mr forms. The Low Mr COUP-TFs (43,000, 44,000, 46,000, and 47,000 Mr) produce a relatively fast migrating complex (Cl) with DNA in electrophoresis mobility shift assays, while the high Mr forms (66,000, 68,000, 72,000, and 74,000 Mr) produce a slower migrating (C2) complex. The high Mr COUP-TFs were purified by gel filtration chromatography and independently formed the C2 DNA complex, probably acting as dimers. The high Mr forms are indistinguishable from the low Mr COUP-TFs in DNA binding and in enhancement of in vitro transcription from the ovalbumin promoter. The finding of multiple COUP-TF forms led us to clone a second low Mr COUP-TF, “COUP-TF2.” The COUP-TF2 sequence has very strong homology with COUP-TF1. The N-termini of COUP-TF1 and COUP-TF2 are least similar, but both contain glutamine-rich and proline-rich motifs, putative activation domains. PMID:1820218

NF-κB p65 Subunit Mediates Lipopolysaccharide-Induced Na+/I− Symporter Gene Expression by Involving Functional Interaction with the Paired Domain Transcription Factor Pax8

PubMed Central

Nicola, Juan Pablo; Nazar, Magalí; Mascanfroni, Iván Darío; Pellizas, Claudia Gabriela; Masini-Repiso, Ana María

2010-01-01

The Gram-negative bacterial endotoxin lipopolysaccharide (LPS) elicits a variety of biological responses. Na+/I− symporter (NIS)-mediated iodide uptake is the main rate-limiting step in thyroid hormonogenesis. We have recently reported that LPS stimulates TSH-induced iodide uptake. Here, we further analyzed the molecular mechanism involved in the LPS-induced NIS expression in Fisher rat thyroid cell line 5 (FRTL-5) thyroid cells. We observed an increase in TSH-induced NIS mRNA expression in a dose-dependent manner upon LPS treatment. LPS enhanced the TSH-stimulated NIS promoter activity denoting the NIS-upstream enhancer region (NUE) as responsible for the stimulatory effects. We characterized a novel putative conserved κB site for the transcription factor nuclear factor-κB (NF-κB) within the NUE region. NUE contains two binding sites for the transcription factor paired box 8 (Pax8), main regulator of NIS transcription. A physical interaction was observed between the NF-κB p65 subunit and paired box 8 (Pax8), which appears to be responsible for the synergic effect displayed by these transcription factors on NIS gene transcription. Moreover, functional blockage of NF-κB signaling and site-directed mutagenesis of the κB cis-acting element abrogated LPS stimulation. Silencing expression of p65 confirmed its participation as an effector of LPS-induced NIS stimulation. Furthermore, chromatin immunoprecipitation corroborated that NIS is a novel target gene for p65 transactivation in response to LPS. Moreover, we were able to corroborate the LPS-stimulatory effect on thyroid cells in vivo in LPS-treated rats, supporting that thyrocytes are capable of responding to systemic infections. In conclusion, our results reveal a new mechanism involving p65 in the LPS-induced NIS expression, denoting a novel aspect in thyroid cell differentiation. PMID:20667985

Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

2010-10-15

Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

Role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of Dr+ Escherichia coli receptor protein Decay Accelerating Factor (DAF or CD55) by Nitric oxide

PubMed Central

Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra

2012-01-01

We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr+). The epithelial invasion of Dr+ E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by down-regulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the down-regulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5′-untranslated region and mapped NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5′-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3′-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. The NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. PMID:23176121

Role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of Dr+ Escherichia coli receptor protein decay accelerating factor (DAF or CD55) by nitric oxide.

PubMed

Banadakoppa, Manu; Liebenthal, Daniel; Nowak, David E; Urvil, Petri; Yallampalli, Uma; Wilson, Gerald M; Kishor, Aparna; Yallampalli, Chandra

2013-02-01

We previously reported that nitric oxide (NO) reduces the rate of bacteremia and maternal mortality in pregnant rats with uterine infection by Escherichia coli expressing the Dr Fimbria (Dr(+) ). The epithelial invasion of Dr(+) E. coli is dependent on the expression level of its cellular receptor decay accelerating factor (DAF). NO reduces the rate of bacteremia by downregulating the expression of DAF. In this study, we elucidated the role of transcription factor Sp1 and RNA binding protein HuR in the downregulation of human DAF by NO. We generated a series of deletion mutant constructs of DAF gene 5'-untranslated region and mapped the NO-response region upstream to the core promoter region of the DAF gene. One of the several Sp1 binding sites in the DAF 5'-untranslated region was located within the NO-response region. The binding of Sp1 to this site was inhibited by NO. Furthermore, NO also promoted the degradation of DAF mRNA. The 3'-untranslated region of DAF harbors an AU-rich element and this element destabilized the mRNA transcript. NO promoted the rapid degradation of DAF mRNA by inhibiting the binding of mRNA stabilizing protein HuR to this AU-rich region. The inhibition of binding of HuR to the AU-rich region was due to the S-nitrosylation of one or more cysteine residues by NO. Thus, these data reveal the molecular mediators of transcriptional and post-transcriptional regulation of DAF by NO with implications in pathophysiology related to DAF. © 2012 The Authors Journal compilation © 2012 FEBS.

Hepatitis B virus X protein suppresses virus-triggered IRF3 activation and IFN-beta induction by disrupting the VISA-associated complex.

PubMed

Wang, Xianmiao; Li, Ying; Mao, Aiping; Li, Chao; Li, Yongkui; Tien, Po

2010-09-01

Viral RNAs produced during viral infection are recognized by the cytoplasmic RNA helicases retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5). A central adapter protein downstream of RIG-I and MDA5 is the mitochondrial membrane protein virus-induced signaling adaptor (VISA), which mediates the induction of type I interferons (IFNs) through the activation of transcription factors such as nuclear factor-kappaB (NF-kappaB) and IFN-regulatory factor-3 (IRF3). Here we found that hepatitis B virus (HBV)-encoded X protein (HBx) acts as an inhibitor of virus-triggered IRF3 activation and IFN-beta induction. Reporter and plaque assays indicate that HBx inhibits signaling by components upstream but not downstream of VISA. Immunoprecipitation experiments indicate that HBx interacts with VISA and disrupts the association of VISA with its upstream and downstream components. These findings suggest that HBx acts as a suppressor of virus-triggered induction of type I IFNs, which explains the observation that HBV causes transient and chronic infection in hepatocytes but fails to activate the pattern recognition receptor-mediated IFN induction pathways.

Hepatocyte Nuclear Factor 4α (HNF4α) Is a Transcription Factor of Vertebrate Fatty Acyl Desaturase Gene as Identified in Marine Teleost Siganus canaliculatus

PubMed Central

Dong, Yewei; Wang, Shuqi; Chen, Junliang; Zhang, Qinghao; Liu, Yang; You, Cuihong; Monroig, Óscar; Tocher, Douglas R.; Li, Yuanyou

2016-01-01

Rabbitfish Siganus canaliculatus was the first marine teleost demonstrated to have the capability of biosynthesizing long-chain polyunsaturated fatty acids (LC-PUFA) from C18 precursors, and to possess a Δ4 fatty acyl desaturase (Δ4 Fad) which was the first report in vertebrates, and is a good model for studying the regulatory mechanisms of LC-PUFA biosynthesis in teleosts. In order to understand regulatory mechanisms of transcription of Δ4 Fad, the gene promoter was cloned and characterized in the present study. An upstream sequence of 1859 bp from the initiation codon ATG was cloned as the promoter candidate. On the basis of bioinformatic analysis, several binding sites of transcription factors (TF) including GATA binding protein 2 (GATA-2), CCAAT enhancer binding protein (C/EBP), nuclear factor 1 (NF-1), nuclear factor Y (NF-Y), hepatocyte nuclear factor 4α (HNF4α) and sterol regulatory element (SRE), were identified in the promoter by site-directed mutation and functional assays. HNF4α and NF-1 were confirmed to interact with the core promoter of Δ4 Fad by gel shift assay and mass spectrometry. Moreover, over-expression of HNF4α increased promoter activity in HEK 293T cells and mRNA level of Δ4 Fad in rabbitfish primary hepatocytes, respectively. The results indicated that HNF4α is a TF of rabbitfish Δ4 Fad. To our knowledge, this is the first report on promoter structure of a Δ4 Fad, and also the first demonstration of HNF4α as a TF of vertebrate Fad gene involved in transcription regulation of LC-PUFA biosynthesis. PMID:27472219

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

PubMed Central

Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

2008-01-01

Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of the enzyme. PMID:18442387

The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

PubMed

Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

1999-09-24

To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

Theory on the mechanism of distal action of transcription factors: looping of DNA versus tracking along DNA

NASA Astrophysics Data System (ADS)

Murugan, R.

2010-10-01

In this paper, we develop a theory on the mechanism of distal action of the transcription factors, which are bound at their respective cis-regulatory enhancer modules on the promoter-RNA polymerase II (PR) complexes to initiate the transcription event in eukaryotes. We consider both the looping and tracking modes of their distal communication and calculate the mean first passage time that is required for the distal interactions of the complex of enhancer and transcription factor with the PR via both these modes. We further investigate how this mean first passage time is dependent on the length of the DNA segment (L, base-pairs) that connects the cis-regulatory binding site and the respective promoter. When the radius of curvature of this connecting segment of DNA is R that was induced upon binding of the transcription factor at the cis-acting element and RNAPII at the promoter in cis-positions, our calculations indicate that the looping mode of distal action will dominate when L is such that L > 2πR and the tracking mode of distal action will be favored when L < 2πR. The time required for the distal action will be minimum when L = 2πR where the typical value of R for the binding of histones will be R ~ 16 bps and L ~ 102 bps. It seems that the free energy associated with the binding of the transcription factor with its cis-acting element and the distance of this cis-acting element from the corresponding promoter of the gene of interest is negatively correlated. Our results suggest that the looping and tracking modes of distal action are concurrently operating on the transcription activation and the physics that determines the timescales associated with the looping/tracking in the mechanism of action of these transcription factors on the initiation of the transcription event must put a selection pressure on the distribution of the distances of cis-regulatory modules from their respective promoters of the genes. The computational analysis of the upstream sequences of promoters of various genes in the human and mouse genomes for the presence of putative cis-regulatory elements for a set of known transcription factors using the position weight matrices available with the JASPAR database indicates the presence of cis-acting elements with maximum probability at a distance of ~102 bps from the promoters which substantiates our theoretical predictions.

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

Constraints on the evolution of a doublesex target gene arising from doublesex’s pleiotropic deployment

PubMed Central

Luo, Shengzhan D.; Baker, Bruce S.

2015-01-01

“Regulatory evolution,” that is, changes in a gene’s expression pattern through changes at its regulatory sequence, rather than changes at the coding sequence of the gene or changes of the upstream transcription factors, has been increasingly recognized as a pervasive evolution mechanism. Many somatic sexually dimorphic features of Drosophila melanogaster are the results of gene expression regulated by the doublesex (dsx) gene, which encodes sex-specific transcription factors (DSXF in females and DSXM in males). Rapid changes in such sexually dimorphic features are likely a result of changes at the regulatory sequence of the target genes. We focused on the Flavin-containing monooxygenase-2 (Fmo-2) gene, a likely direct dsx target, to elucidate how sexually dimorphic expression and its evolution are brought about. We found that dsx is deployed to regulate the Fmo-2 transcription both in the midgut and in fat body cells of the spermatheca (a female-specific tissue), through a canonical DSX-binding site in the Fmo-2 regulatory sequence. In the melanogaster group, Fmo-2 transcription in the midgut has evolved rapidly, in contrast to the conserved spermathecal transcription. We identified two cis-regulatory modules (CRM-p and CRM-d) that direct sexually monomorphic or dimorphic Fmo-2 transcription, respectively, in the midguts of these species. Changes of Fmo-2 transcription in the midgut from sexually dimorphic to sexually monomorphic in some species are caused by the loss of CRM-d function, but not the loss of the canonical DSX-binding site. Thus, conferring transcriptional regulation on a CRM level allows the regulation to evolve rapidly in one tissue while evading evolutionary constraints posed by other tissues. PMID:25675536

Mitochondrial Dynamics Impacts Stem Cell Identity and Fate Decisions by Regulating a Nuclear Transcriptional Program.

PubMed

Khacho, Mireille; Clark, Alysen; Svoboda, Devon S; Azzi, Joelle; MacLaurin, Jason G; Meghaizel, Cynthia; Sesaki, Hiromi; Lagace, Diane C; Germain, Marc; Harper, Mary-Ellen; Park, David S; Slack, Ruth S

2016-08-04

Regulated mechanisms of stem cell maintenance are key to preventing stem cell depletion and aging. While mitochondrial morphology plays a fundamental role in tissue development and homeostasis, its role in stem cells remains unknown. Here, we uncover that mitochondrial dynamics regulates stem cell identity, self-renewal, and fate decisions by orchestrating a transcriptional program. Manipulation of mitochondrial structure, through OPA1 or MFN1/2 deletion, impaired neural stem cell (NSC) self-renewal, with consequent age-dependent depletion, neurogenesis defects, and cognitive impairments. Gene expression profiling revealed ectopic expression of the Notch self-renewal inhibitor Botch and premature induction of transcription factors that promote differentiation. Changes in mitochondrial dynamics regulate stem cell fate decisions by driving a physiological reactive oxygen species (ROS)-mediated process, which triggers a dual program to suppress self-renewal and promote differentiation via NRF2-mediated retrograde signaling. These findings reveal mitochondrial dynamics as an upstream regulator of essential mechanisms governing stem cell self-renewal and fate decisions through transcriptional programming. Copyright © 2016 Elsevier Inc. All rights reserved.

A dual switch controls bacterial enhancer-dependent transcription

PubMed Central

Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin

2012-01-01

Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125

Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

PubMed

Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

2008-12-01

Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

Induction of the SHARP-2 mRNA level by insulin is mediated by multiple signaling pathways.

PubMed

Kanai, Yukiko; Asano, Kosuke; Komatsu, Yoshiko; Takagi, Katsuhiro; Ono, Moe; Tanaka, Takashi; Tomita, Koji; Haneishi, Ayumi; Tsukada, Akiko; Yamada, Kazuya

2017-02-01

The rat enhancer of split- and hairy-related protein-2 (SHARP-2) is an insulin-inducible transcription factor which represses transcription of the rat phosphoenolpyruvate carboxykinase gene. In this study, a regulatory mechanism of the SHARP-2 mRNA level by insulin was analyzed. Insulin rapidly induced the level of SHARP-2 mRNA. This induction was blocked by inhibitors for phosphoinositide 3-kinase (PI 3-K), protein kinase C (PKC), and mammalian target of rapamycin (mTOR), actinomycin D, and cycloheximide. Whereas an adenovirus infection expressing a dominant negative form of atypical PKC lambda (aPKCλ) blocked the insulin-induction of the SHARP-2 mRNA level, insulin rapidly activated the mTOR. Insulin did not enhance transcriptional activity from a 3.7 kb upstream region of the rat SHARP-2 gene. Thus, we conclude that insulin induces the expression of the rat SHARP-2 gene at the transcription level via both a PI 3-K/aPKCλ- and a PI 3-K/mTOR- pathways and that protein synthesis is required for this induction.

Biphasic regulation of the transcription factor ABORTED MICROSPORES (AMS) is essential for tapetum and pollen development in Arabidopsis.

PubMed

Ferguson, Alison C; Pearce, Simon; Band, Leah R; Yang, Caiyun; Ferjentsikova, Ivana; King, John; Yuan, Zheng; Zhang, Dabing; Wilson, Zoe A

2017-01-01

Viable pollen is essential for plant reproduction and crop yield. Its production requires coordinated expression at specific stages during anther development, involving early meiosis-associated events and late pollen wall formation. The ABORTED MICROSPORES (AMS) transcription factor is a master regulator of sporopollenin biosynthesis, secretion and pollen wall formation in Arabidopsis. Here we show that it has complex regulation and additional essential roles earlier in pollen formation. An inducible-AMS reporter was created for functional rescue, protein expression pattern analysis, and to distinguish between direct and indirect targets. Mathematical modelling was used to create regulatory networks based on wild-type RNA and protein expression. Dual activity of AMS was defined by biphasic protein expression in anther tapetal cells, with an initial peak around pollen meiosis and then later during pollen wall development. Direct AMS-regulated targets exhibit temporal regulation, indicating that additional factors are associated with their regulation. We demonstrate that AMS biphasic expression is essential for pollen development, and defines distinct functional activities during early and late pollen development. Mathematical modelling suggests that AMS may competitively form a protein complex with other tapetum-expressed transcription factors, and that biphasic regulation is due to repression of upstream regulators and promotion of AMS protein degradation. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Alternative promoter usage generates novel shorter MAPT mRNA transcripts in Alzheimer's disease and progressive supranuclear palsy brains.

PubMed

Huin, Vincent; Buée, Luc; Behal, Hélène; Labreuche, Julien; Sablonnière, Bernard; Dhaenens, Claire-Marie

2017-10-03

Alternative promoter usage is an important mechanism for transcriptome diversity and the regulation of gene expression. Indeed, this alternative usage may influence tissue/subcellular specificity, protein translation and function of the proteins. The existence of an alternative promoter for MAPT gene was considered for a long time to explain differential tissue specificity and differential response to transcription and growth factors between mRNA transcripts. The alternative promoter usage could explain partly the different tau proteins expression patterns observed in tauopathies. Here, we report on our discovery of a functional alternative promoter for MAPT, located upstream of the gene's second exon (exon 1). By analyzing genome databases and brain tissue from control individuals and patients with Alzheimer's disease or progressive supranuclear palsy, we identified novel shorter transcripts derived from this alternative promoter. These transcripts are increased in patients' brain tissue as assessed by 5'RACE-PCR and qPCR. We suggest that these new MAPT isoforms can be translated into normal or amino-terminal-truncated tau proteins. We further suggest that activation of MAPT's alternative promoter under pathological conditions leads to the production of truncated proteins, changes in protein localization and function, and thus neurodegeneration.

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

A Member of the p38 Mitogen-Activated Protein Kinase Family Is Responsible for Transcriptional Induction of Dopa decarboxylase in the Epidermis of Drosophila melanogaster during the Innate Immune Response▿ †

PubMed Central

Davis, Monica M.; Primrose, David A.; Hodgetts, Ross B.

2008-01-01

Drosophila innate immunity is controlled primarily by the activation of IMD (immune deficiency) or Toll signaling leading to the production of antimicrobial peptides (AMPs). IMD signaling also activates the JUN N-terminal kinase (JNK) cascade, which is responsible for immune induction of non-antimicrobial peptide immune gene transcription though the transcription factor AP-1. Transcription of the Dopa decarboxylase (Ddc) gene is induced in response to gram-negative and gram-positive septic injury, but not aseptic wounding. Transcription is induced throughout the epidermis and not specifically at the site of infection. Ddc transcripts are detectible within 2 h and remain high for several hours following infection with either gram-negative or gram-positive bacteria. Using Ddc-green fluorescent protein (GFP) reporter gene constructs, we show that a conserved consensus AP-1 binding site upstream of the Ddc transcription start site is required for induction. However, neither the Toll, IMD, nor JNK pathway is involved. Rather, Ddc transcription depends on a previously uncharacterized member of the p38 mitogen-activated protein kinase family, p38c. We propose that the involvement of DDC in a new pathway involved in Drosophila immunity increases the levels of dopamine, which is metabolized to produce reactive quinones that exert an antimicrobial effect on invading bacteria. PMID:18519585

Activity of the Rhodopseudomonas palustris p-coumaroyl-homoserine lactone-responsive transcription factor RpaR.

PubMed

Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D; Castle, John C; Raymond, Christopher K; Lappala, Colin R; Schaefer, Amy L; Harwood, Caroline S; Greenberg, E Peter

2011-05-01

The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon.

Alphavirus replicon approach to promoterless analysis of IRES elements.

PubMed

Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

2007-04-10

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

PubMed Central

Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

2007-01-01

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572.

PubMed

Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

2002-04-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO(4) to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology.

Differential Regulation of mnp2, a New Manganese Peroxidase-Encoding Gene from the Ligninolytic Fungus Trametes versicolor PRL 572

PubMed Central

Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

2002-01-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology. PMID:11916737

Insulin signalling mechanisms for triacylglycerol storage.

PubMed

Czech, M P; Tencerova, M; Pedersen, D J; Aouadi, M

2013-05-01

Insulin signalling is uniquely required for storing energy as fat in humans. While de novo synthesis of fatty acids and triacylglycerol occurs mostly in liver, adipose tissue is the primary site for triacylglycerol storage. Insulin signalling mechanisms in adipose tissue that stimulate hydrolysis of circulating triacylglycerol, uptake of the released fatty acids and their conversion to triacylglycerol are poorly understood. New findings include (1) activation of DNA-dependent protein kinase to stimulate upstream stimulatory factor (USF)1/USF2 heterodimers, enhancing the lipogenic transcription factor sterol regulatory element binding protein 1c (SREBP1c); (2) stimulation of fatty acid synthase through AMP kinase modulation; (3) mobilisation of lipid droplet proteins to promote retention of triacylglycerol; and (4) upregulation of a novel carbohydrate response element binding protein β isoform that potently stimulates transcription of lipogenic enzymes. Additionally, insulin signalling through mammalian target of rapamycin to activate transcription and processing of SREBP1c described in liver may apply to adipose tissue. Paradoxically, insulin resistance in obesity and type 2 diabetes is associated with increased triacylglycerol synthesis in liver, while it is decreased in adipose tissue. This and other mysteries about insulin signalling and insulin resistance in adipose tissue make this topic especially fertile for future research.

Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome

PubMed Central

Bickhart, Derek M.; Liu, George E.

2013-01-01

A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959

Engineering of synthetic, stress-responsive yeast promoters

PubMed Central

Rajkumar, Arun S.; Liu, Guodong; Bergenholm, David; Arsovska, Dushica; Kristensen, Mette; Nielsen, Jens; Jensen, Michael K.; Keasling, Jay D.

2016-01-01

Advances in synthetic biology and our understanding of the rules of promoter architecture have led to the development of diverse synthetic constitutive and inducible promoters in eukaryotes and prokaryotes. However, the design of promoters inducible by specific endogenous or environmental conditions is still rarely undertaken. In this study, we engineered and characterized a set of strong, synthetic promoters for budding yeast Saccharomyces cerevisiae that are inducible under acidic conditions (pH ≤ 3). Using available expression and transcription factor binding data, literature on transcriptional regulation, and known rules of promoter architecture we improved the low-pH performance of the YGP1 promoter by modifying transcription factor binding sites in its upstream activation sequence. The engineering strategy outlined for the YGP1 promoter was subsequently applied to create a response to low pH in the unrelated CCW14 promoter. We applied our best promoter variants to low-pH fermentations, enabling ten-fold increased production of lactic acid compared to titres obtained with the commonly used, native TEF1 promoter. Our findings outline and validate a general strategy to iteratively design and engineer synthetic yeast promoters inducible to environmental conditions or stresses of interest. PMID:27325743

SHOX interacts with the chondrogenic transcription factors SOX5 and SOX6 to activate the aggrecan enhancer.

PubMed

Aza-Carmona, Miriam; Shears, Debbie J; Yuste-Checa, Patricia; Barca-Tierno, Verónica; Hisado-Oliva, Alfonso; Belinchón, Alberta; Benito-Sanz, Sara; Rodríguez, J Ignacio; Argente, Jesús; Campos-Barros, Angel; Scambler, Peter J; Heath, Karen E

2011-04-15

SHOX (short stature homeobox-containing gene) encodes a transcription factor implicated in skeletal development. SHOX haploinsufficiency has been demonstrated in Leri-Weill dyschondrosteosis (LWD), a skeletal dysplasia associated with disproportionate short stature, as well as in a variable proportion of cases with idiopathic short stature (ISS). In order to gain insight into the SHOX signalling pathways, we performed a yeast two-hybrid screen to identify SHOX-interacting proteins. Two transcription factors, SOX5 and SOX6, were identified. Co-immunoprecipitation assays confirmed the existence of the SHOX-SOX5 and SHOX-SOX6 interactions in human cells, whereas immunohistochemical studies demonstrated the coexpression of these proteins in 18- and 32-week human fetal growth plates. The SHOX homeodomain and the SOX6 HMG domain were shown to be implicated in the SHOX-SOX6 interaction. Moreover, different SHOX missense mutations, identified in LWD and ISS patients, disrupted this interaction. The physiological importance of these interactions was investigated by studying the effect of SHOX on a transcriptional target of the SOX trio, Agc1, which encodes one of the main components of cartilage, aggrecan. Our results show that SHOX cooperates with SOX5/SOX6 and SOX9 in the activation of the upstream Agc1 enhancer and that SHOX mutations affect this activation. In conclusion, we have identified SOX5 and SOX6 as the first two SHOX-interacting proteins and have shown that this interaction regulates aggrecan expression, an essential factor in chondrogenesis and skeletal development.

p38β, A novel regulatory target of Pokemon in hepatic cells.

PubMed

Chen, Zhe; Liu, Feng; Zhang, Nannan; Cao, Deliang; Liu, Min; Tan, Ying; Jiang, Yuyang

2013-06-27

Pokemon is an important proto-oncogene involved in various biological processes and cancer development, such as cell differentiation, tumorigenesis and metastasis. Pokemon is recognized as a transcription factor localized upstream of several oncogenes, regulating their expression. p38MAPKs act as key regulatory factors in cellular signaling pathways associated with inflammatory responses, cell proliferation, differentiation and survival. p38β, a member of p38MAPK family, is closely correlated with tumorigenesis, but the mechanism of activation remains unclear. In this study, we found overexpression of Pokemon promoted the growth, migration and invasion of HepG2 cells. However, a p38 inhibitor SB202190 efficiently attenuated the promoting effect of Pokemon in the HepG2 cells. Targeted expression or silencing of Pokemon changed cellular p38β protein level and phosphorylation of downstream ATF2 in the p38 signaling pathway. Both dual luciferase report assay and ChIP assay suggested that p38β is a novel regulatory target of the transcription factor Pokemon and positively regulated by Pokemon in hepatic cells.

p38β, A Novel Regulatory Target of Pokemon in Hepatic Cells

PubMed Central

Chen, Zhe; Liu, Feng; Zhang, Nannan; Cao, Deliang; Liu, Min; Tan, Ying; Jiang, Yuyang

2013-01-01

Pokemon is an important proto-oncogene involved in various biological processes and cancer development, such as cell differentiation, tumorigenesis and metastasis. Pokemon is recognized as a transcription factor localized upstream of several oncogenes, regulating their expression. p38MAPKs act as key regulatory factors in cellular signaling pathways associated with inflammatory responses, cell proliferation, differentiation and survival. p38β, a member of p38MAPK family, is closely correlated with tumorigenesis, but the mechanism of activation remains unclear. In this study, we found overexpression of Pokemon promoted the growth, migration and invasion of HepG2 cells. However, a p38 inhibitor SB202190 efficiently attenuated the promoting effect of Pokemon in the HepG2 cells. Targeted expression or silencing of Pokemon changed cellular p38β protein level and phosphorylation of downstream ATF2 in the p38 signaling pathway. Both dual luciferase report assay and ChIP assay suggested that p38β is a novel regulatory target of the transcription factor Pokemon and positively regulated by Pokemon in hepatic cells. PMID:23807508

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

Diadenosine Tetraphosphate Hydrolase Is Part of the Transcriptional Regulation Network in Immunologically Activated Mast Cells▿

PubMed Central

Carmi-Levy, Irit; Yannay-Cohen, Nurit; Kay, Gillian; Razin, Ehud; Nechushtan, Hovav

2008-01-01

We previously discovered that microphthalmia transcription factor (MITF) and upstream stimulatory factor 2 (USF2) each forms a complex with its inhibitor histidine triad nucleotide-binding 1 (Hint-1) and with lysyl-tRNA synthetase (LysRS). Moreover, we showed that the dinucleotide diadenosine tetraphosphate (Ap4A), previously shown to be synthesized by LysRS, binds to Hint-1, and as a result the transcription factors are released from their suppression. Thus, transcriptional activity is regulated by Ap4A, suggesting that Ap4A is a second messenger in this context. For Ap4A to be unambiguously established as a second messenger, several criteria have to be fulfilled, including the presence of a metabolizing enzyme. Since several enzymes are able to hydrolize Ap4A, we provided here evidence that the “Nudix” type 2 gene product, Ap4A hydrolase, is responsible for Ap4A degradation following the immunological activation of mast cells. The knockdown of Ap4A hydrolase modulated Ap4A accumulation, resulting in changes in the expression of MITF and USF2 target genes. Moreover, our observations demonstrated that the involvement of Ap4A hydrolase in gene regulation is not a phenomenon exclusive to mast cells but can also be found in cardiac cells activated with the β-agonist isoproterenol. Thus, we have provided concrete evidence establishing Ap4A as a second messenger in the regulation of gene expression. PMID:18644867

Diadenosine tetraphosphate hydrolase is part of the transcriptional regulation network in immunologically activated mast cells.

PubMed

Carmi-Levy, Irit; Yannay-Cohen, Nurit; Kay, Gillian; Razin, Ehud; Nechushtan, Hovav

2008-09-01

We previously discovered that microphthalmia transcription factor (MITF) and upstream stimulatory factor 2 (USF2) each forms a complex with its inhibitor histidine triad nucleotide-binding 1 (Hint-1) and with lysyl-tRNA synthetase (LysRS). Moreover, we showed that the dinucleotide diadenosine tetraphosphate (Ap(4)A), previously shown to be synthesized by LysRS, binds to Hint-1, and as a result the transcription factors are released from their suppression. Thus, transcriptional activity is regulated by Ap(4)A, suggesting that Ap(4)A is a second messenger in this context. For Ap(4)A to be unambiguously established as a second messenger, several criteria have to be fulfilled, including the presence of a metabolizing enzyme. Since several enzymes are able to hydrolyze Ap(4)A, we provided here evidence that the "Nudix" type 2 gene product, Ap(4)A hydrolase, is responsible for Ap(4)A degradation following the immunological activation of mast cells. The knockdown of Ap(4)A hydrolase modulated Ap(4)A accumulation, resulting in changes in the expression of MITF and USF2 target genes. Moreover, our observations demonstrated that the involvement of Ap(4)A hydrolase in gene regulation is not a phenomenon exclusive to mast cells but can also be found in cardiac cells activated with the beta-agonist isoproterenol. Thus, we have provided concrete evidence establishing Ap(4)A as a second messenger in the regulation of gene expression.

Interacting TCP and NLP transcription factors control plant responses to nitrate availability.

PubMed

Guan, Peizhu; Ripoll, Juan-José; Wang, Renhou; Vuong, Lam; Bailey-Steinitz, Lindsay J; Ye, Dening; Crawford, Nigel M

2017-02-28

Plants have evolved adaptive strategies that involve transcriptional networks to cope with and survive environmental challenges. Key transcriptional regulators that mediate responses to environmental fluctuations in nitrate have been identified; however, little is known about how these regulators interact to orchestrate nitrogen (N) responses and cell-cycle regulation. Here we report that teosinte branched1/cycloidea/proliferating cell factor1-20 (TCP20) and NIN-like protein (NLP) transcription factors NLP6 and NLP7, which act as activators of nitrate assimilatory genes, bind to adjacent sites in the upstream promoter region of the nitrate reductase gene, NIA1 , and physically interact under continuous nitrate and N-starvation conditions. Regions of these proteins necessary for these interactions were found to include the type I/II Phox and Bem1p (PB1) domains of NLP6&7, a protein-interaction module conserved in animals for nutrient signaling, and the histidine- and glutamine-rich domain of TCP20, which is conserved across plant species. Under N starvation, TCP20-NLP6&7 heterodimers accumulate in the nucleus, and this coincides with TCP20 and NLP6&7-dependent up-regulation of nitrate assimilation and signaling genes and down-regulation of the G 2 /M cell-cycle marker gene, CYCB1;1 TCP20 and NLP6&7 also support root meristem growth under N starvation. These findings provide insights into how plants coordinate responses to nitrate availability, linking nitrate assimilation and signaling with cell-cycle progression.

A multifaceted role for MOF histone modifying factor in genome maintenance

PubMed Central

Mujoo, Kalpana; Hunt, Clayton R.; Horikoshi, Nobuo; Pandita, Tej K.

2016-01-01

MOF (males absent on the first) was initially identified as a dosage compensation factor in Drosophila that acetylates lysine 16 of histone H4 (H4K16ac) and increased gene transcription from the single copy male X-chromosome. In humans, however, the ortholog of Drosophila MOF has been shown to interact with a range of proteins that extend its potential significance well beyond transcription. For example, recent results indicate MOF is an upstream regulator of the ATM (ataxia-telangiectasia mutated) protein, the loss of which is responsible for ataxia telangiectasia (AT). ATM is a key regulatory kinase that interacts with and phosphorylates multiple substrates that influence critical, cell-cycle control and DNA damage repair pathways in addition to other pathways. Thus, directly or indirectly, MOF may be involved in a wide range of cellular functions. This review will focus on the contribution of MOF to cellular DNA repair and new results that are beginning to examine the in vivo physiological role of MOF. PMID:27038808

Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2008-09-15

Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

Upstream mononucleotide A-repeats play a cis-regulatory role in mammals through the DICER1 and Ago proteins.

PubMed

Aporntewan, Chatchawit; Pin-on, Piyapat; Chaiyaratana, Nachol; Pongpanich, Monnat; Boonyaratanakornkit, Viroj; Mutirangura, Apiwat

2013-10-01

A-repeats are the simplest form of tandem repeats and are found ubiquitously throughout genomes. These mononucleotide repeats have been widely believed to be non-functional 'junk' DNA. However, studies in yeasts suggest that A-repeats play crucial biological functions, and their role in humans remains largely unknown. Here, we showed a non-random pattern of distribution of sense A- and T-repeats within 20 kb around transcription start sites (TSSs) in the human genome. Different distributions of these repeats are observed upstream and downstream of TSSs. Sense A-repeats are enriched upstream, whereas sense T-repeats are enriched downstream of TSSs. This enrichment directly correlates with repeat size. Genes with different functions contain different lengths of repeats. In humans, tissue-specific genes are enriched for short repeats of <10 bp, whereas housekeeping genes are enriched for long repeats of ≥10 bp. We demonstrated that DICER1 and Argonaute proteins are required for the cis-regulatory role of A-repeats. Moreover, in the presence of a synthetic polymer that mimics an A-repeat, protein binding to A-repeats was blocked, resulting in a dramatic change in the expression of genes containing upstream A-repeats. Our findings suggest a length-dependent cis-regulatory function of A-repeats and that Argonaute proteins serve as trans-acting factors, binding to A-repeats.

Co-regulation of Iron Metabolism and Virulence Associated Functions by Iron and XibR, a Novel Iron Binding Transcription Factor, in the Plant Pathogen Xanthomonas

PubMed Central

Pandey, Sheo Shankar; Patnana, Pradeep Kumar; Lomada, Santosh Kumar; Tomar, Archana; Chatterjee, Subhadeep

2016-01-01

Abilities of bacterial pathogens to adapt to the iron limitation present in hosts is critical to their virulence. Bacterial pathogens have evolved diverse strategies to coordinately regulate iron metabolism and virulence associated functions to maintain iron homeostasis in response to changing iron availability in the environment. In many bacteria the ferric uptake regulator (Fur) functions as transcription factor that utilize ferrous form of iron as cofactor to regulate transcription of iron metabolism and many cellular functions. However, mechanisms of fine-tuning and coordinated regulation of virulence associated function beyond iron and Fur-Fe2+ remain undefined. In this study, we show that a novel transcriptional regulator XibR (named X anthomonas iron binding regulator) of the NtrC family, is required for fine-tuning and co-coordinately regulating the expression of several iron regulated genes and virulence associated functions in phytopathogen Xanthomonas campestris pv. campestris (Xcc). Genome wide expression analysis of iron-starvation stimulon and XibR regulon, GUS assays, genetic and functional studies of xibR mutant revealed that XibR positively regulates functions involved in iron storage and uptake, chemotaxis, motility and negatively regulates siderophore production, in response to iron. Furthermore, chromatin immunoprecipitation followed by quantitative real-time PCR indicated that iron promoted binding of the XibR to the upstream regulatory sequence of operon’s involved in chemotaxis and motility. Circular dichroism spectroscopy showed that purified XibR bound ferric form of iron. Electrophoretic mobility shift assay revealed that iron positively affected the binding of XibR to the upstream regulatory sequences of the target virulence genes, an effect that was reversed by ferric iron chelator deferoxamine. Taken together, these data revealed that how XibR coordinately regulates virulence associated and iron metabolism functions in Xanthomonads in response to iron availability. Our results provide insight of the complex regulatory mechanism of fine-tuning of virulence associated functions with iron availability in this important group of phytopathogen. PMID:27902780

A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization

PubMed Central

Vilaboa, Nuria; Bermejo, Rodrigo; Martinez, Pilar; Bornstein, Rafael; Calés, Carmela

2004-01-01

Cdc6 is a key regulator of the strict alternation of S and M phases during the mitotic cell cycle. In mammalian and plant cells that physiologically become polyploid, cdc6 is transcriptionally and post-translationally regulated. We have recently reported that Cdc6 levels are maintained in megakaryoblastic HEL cells, but severely downregulated by ectopic expression of transcriptional repressor Drosophila melanogaster escargot. Here, we show that cdc6 promoter activity is upregulated during megakaryocytic differentiation of HEL endoreplicating cells, and that Escargot interferes with such activation. Transactivation experiments showed that a 1.7 kb region located at 2800 upstream cdc6 transcription initiation site behaved as a potent enhancer in endoreplicating cells only. This activity was mainly dependent on a novel cis-regulatory element composed by an E2 box overlapping a GATA motif. Ectopic Escargot could bind this regulatory element in vitro and endogenous GATA-1 and E2A formed specific complexes in megakaryoblastic cells as well as in primary megakaryocytes. Chromatin Immunoprecipitation analysis revealed that both transcription factors were occupying the E2 box/GATA site in vivo. Altogether, these data suggest that cdc6 expression could be actively maintained during megakaryocytic differentiation through transcriptional mechanisms involving specific cis- and trans-regulatory elements. PMID:15590906

APG: an Active Protein-Gene network model to quantify regulatory signals in complex biological systems.

PubMed

Wang, Jiguang; Sun, Yidan; Zheng, Si; Zhang, Xiang-Sun; Zhou, Huarong; Chen, Luonan

2013-01-01

Synergistic interactions among transcription factors (TFs) and their cofactors collectively determine gene expression in complex biological systems. In this work, we develop a novel graphical model, called Active Protein-Gene (APG) network model, to quantify regulatory signals of transcription in complex biomolecular networks through integrating both TF upstream-regulation and downstream-regulation high-throughput data. Firstly, we theoretically and computationally demonstrate the effectiveness of APG by comparing with the traditional strategy based only on TF downstream-regulation information. We then apply this model to study spontaneous type 2 diabetic Goto-Kakizaki (GK) and Wistar control rats. Our biological experiments validate the theoretical results. In particular, SP1 is found to be a hidden TF with changed regulatory activity, and the loss of SP1 activity contributes to the increased glucose production during diabetes development. APG model provides theoretical basis to quantitatively elucidate transcriptional regulation by modelling TF combinatorial interactions and exploiting multilevel high-throughput information.

APG: an Active Protein-Gene Network Model to Quantify Regulatory Signals in Complex Biological Systems

PubMed Central

Wang, Jiguang; Sun, Yidan; Zheng, Si; Zhang, Xiang-Sun; Zhou, Huarong; Chen, Luonan

2013-01-01

Synergistic interactions among transcription factors (TFs) and their cofactors collectively determine gene expression in complex biological systems. In this work, we develop a novel graphical model, called Active Protein-Gene (APG) network model, to quantify regulatory signals of transcription in complex biomolecular networks through integrating both TF upstream-regulation and downstream-regulation high-throughput data. Firstly, we theoretically and computationally demonstrate the effectiveness of APG by comparing with the traditional strategy based only on TF downstream-regulation information. We then apply this model to study spontaneous type 2 diabetic Goto-Kakizaki (GK) and Wistar control rats. Our biological experiments validate the theoretical results. In particular, SP1 is found to be a hidden TF with changed regulatory activity, and the loss of SP1 activity contributes to the increased glucose production during diabetes development. APG model provides theoretical basis to quantitatively elucidate transcriptional regulation by modelling TF combinatorial interactions and exploiting multilevel high-throughput information. PMID:23346354

Transcriptional Changes That Characterize the Immune Reactions of Leprosy

PubMed Central

Dupnik, Kathryn M.; Bair, Thomas B.; Maia, Andressa O.; Amorim, Francianne M.; Costa, Marcos R.; Keesen, Tatjana S. L.; Valverde, Joanna G.; Queiroz, Maria do Carmo A. P.; Medeiros, Lúcio L.; de Lucena, Nelly L.; Wilson, Mary E.; Nobre, Mauricio L.; Johnson, Warren D.; Jeronimo, Selma M. B.

2015-01-01

Background. Leprosy morbidity is increased by 2 pathologic immune reactions, reversal reaction (RR) and erythema nodosum leprosum (ENL). Methods. To discover host factors related to immune reactions, global transcriptional profiles of peripheral blood mononuclear cells were compared between 11 RR, 11 ENL, and 19 matched control patients, with confirmation by quantitative polymerase chain reaction. Encoded proteins were investigated in skin biopsy specimens by means of immunohistochemistry. Results. There were 275 genes differentially expressed in RR and 517 differentially expressed in ENL on the microarray. Pathway analysis showed immunity-related pathways represented in RR and ENL transcriptional profiles, with the “complement and coagulation” pathway common to both. Interferon γ was identified as a significant upstream regulator of the expression changes for RR and ENL. Immunohistochemical staining of skin lesions showed increased C1q in both RR and ENL. Conclusions. These data suggest a previously underrecognized role for complement in the pathogenesis of both RR and ENL, and we propose new hypotheses for reaction pathogenesis. PMID:25398459

Retrotransposon Tf1 is targeted to pol II promoters by transcription activators

PubMed Central

Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.

2008-01-01

SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330

Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.

PubMed

Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L

2008-04-11

The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.

Mediator-regulated transcription through the +1 nucleosome.

PubMed

Nock, Adam; Ascano, Janice M; Barrero, Maria J; Malik, Sohail

2012-12-28

Many genes are regulated at the level of a Pol II that is recruited to a nucleosome-free region upstream of the +1 nucleosome. How the Mediator coactivator complex, which functions at multiple steps, affects transcription through the promoter proximal region, including this nucleosome, remains largely unaddressed. We have established a fully defined in vitro assay system to delineate mechanisms for Pol II transit across the +1 nucleosome. Our results reveal cooperative functions of multiple cofactors, particularly of Mediator and elongation factor SII, in transcribing into this nucleosome. This is achieved, in part, through an unusual activity of SII that alters the intrinsic catalytic properties of promoter-proximal Pol II and, in concert with the Mediator, leads to enhancement in transcription of nucleosomal DNA. Our data provide additional mechanistic bases for Mediator function after recruitment of Pol II and, potentially, for regulation of genes controlled via nucleosome-mediated promoter-proximal pausing. Copyright © 2012 Elsevier Inc. All rights reserved.

The Histone Acetyltransferase MOF is a Key Regulator of the Embryonic Stem Cell Core Transcriptional Network

PubMed Central

Li, Xiangzhi; Li, Li; Pandey, Ruchi; Byun, Jung S.; Gardner, Kevin; Qin, Zhaohui; Dou, Yali

2012-01-01

SUMMARY Pluripotent embryonic stem cells (ESCs) maintain self-renewal and the potential for rapid response to differentiation cues. Both ESC features are subject to epigenetic regulation. Here we show that histone acetyltransferase Mof plays an essential role in the maintenance of ESC self-renewal and pluripotency. ESCs with Mof deletion lose characteristic morphology, alkaline phosphatase (AP) staining and differentiation potential. They also have aberrant expression of core transcription factors Nanog, Oct4 and Sox2. Importantly, the phenotypes of Mof null ESCs can be partially suppressed by Nanog overexpression, supporting that Mof functions as an upstream regulator of Nanog in ESCs. Genome-wide ChIP sequencing and transcriptome analyses further demonstrate that Mof is an integral component of ESC core transcription network and Mof primes genes for diverse developmental programs. Mof is also required for Wdr5 recruitment and H3 K4 methylation at key regulatory loci, highlighting complexity and interconnectivity of various chromatin regulators in ESCs. PMID:22862943

Regulation of a mammalian gene bearing a CpG island promoter and a distal enhancer.

PubMed

Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Ptashne, Mark

2013-08-15

A quantitative nucleosome occupancy assay revealed rules for nucleosome disposition in yeast and showed how disposition affects regulation of the GAL genes. Here, we show how those findings apply to the control of Kit, a mammalian gene. The Kit promoter lies in a CpG island, and its enhancer (active in mast cells) lies some 150 kb upstream. Nucleosomes form with especially high avidities at the Kit promoter, a reaction that, we surmise, ensures extremely low basal expression. In mast cells, transcriptional activators displace nucleosomes that are less tightly formed at the Kit enhancer. In turn, the active enhancer replaces a single Kit promoter nucleosome with the transcriptional machinery, thereby inducing transcription over 1,000-fold. As at the yeast GAL genes, the inhibitory effects of nucleosomes facilitate high factors of induction by mammalian activators working in the absence of specific repressors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

DOE PAGES

Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...

2016-03-26

Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

Transcriptome Analysis of Polyhydroxybutyrate Cycle Mutants Reveals Discrete Loci Connecting Nitrogen Utilization and Carbon Storage in Sinorhizobium meliloti

PubMed Central

Nordeste, Ricardo

2017-01-01

ABSTRACT Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti, we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis (phbA, phbB, phbAB, and phbC), PHB degradation (bdhA, phaZ, and acsA2), and glycogen synthesis (glgA1). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to the cell. The impact of carbon storage on cellular metabolism would be reflected in global transcription patterns. By investigating the transcriptomic effects of genetically disrupting genes involved in the PHB carbon storage cycle, we revealed a relationship between intracellular carbon storage and nitrogen metabolism. This work demonstrates the utility of combining transcriptome sequencing with metabolic pathway mutations for identifying underlying gene regulatory mechanisms. Author Video: An author video summary of this article is available. PMID:28905000

Estrogen receptor alpha and nuclear factor Y coordinately regulate the transcription of the SUMO-conjugating UBC9 gene in MCF-7 breast cancer cells.

PubMed

Ying, Shibo; Dünnebier, Thomas; Si, Jing; Hamann, Ute

2013-01-01

UBC9 encodes a protein that conjugates small ubiquitin-related modifier (SUMO) to target proteins thereby changing their functions. Recently, it was noted that UBC9 expression and activity play a role in breast tumorigenesis and response to anticancer drugs. However, the underlying mechanism is poorly understood. To investigate the transcriptional regulation of the UBC9 gene, we identified and characterized its promoter and cis-elements. Promoter activity was tested using luciferase reporter assays. The binding of transcription factors to the promoter was detected by chromatin immunoprecipitation (ChIP), and their functional role was confirmed by siRNA knockdown. UBC9 mRNA and protein levels were measured by quantitative reverse transcription PCR and Western blot analysis, respectively. An increased expression of UBC9 mRNA and protein was found in MCF-7 breast cancer cells treated with 17β-estradiol (E2). Analysis of various deletion mutants revealed a 137 bp fragment upstream of the transcription initiation site to be sufficient for reporter gene transcription. Mutations of putative estrogen receptor α (ER-α) (one imperfect estrogen response element, ERE) and/or nuclear factor Y (NF-Y) binding sites (two CCAAT boxes) markedly reduced promoter activity. Similar results were obtained in ER-negative MDA-MB-231 cells except that the ERE mutation did not affect promoter activity. Additionally, promoter activity was stimulated upon E2 treatment and overexpression of ER-α or NF-YA in MCF-7 cells. ChIP confirmed direct binding of both transcription factors to the UBC9 promoter in vivo. Furthermore, UBC9 expression was diminished by ER-α and NF-Y siRNAs on the mRNA and protein levels. In conclusion, we identified the proximal UBC9 promoter and provided evidence that ER-α and NF-Y regulate UBC9 expression on the transcriptional level in response to E2 in MCF-7 cells. These findings may contribute to a better understanding of the regulation of UBC9 in ER-positive breast cancer and be useful for the development of cancer therapies targeting UBC9.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE PAGES

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

2015-03-22

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

PubMed

Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

2015-06-01

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

PubMed

Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

1996-10-01

Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

PubMed Central

Fisher, Susan H.; Wray, Lewis V.

2002-01-01

Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.

PubMed

Fisher, Susan H; Wray, Lewis V

2002-04-01

Expression of the two Bacillus subtilis genes encoding L-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional L-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second L-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression.

Novel mechanism of JNK pathway activation by adenoviral E1A

PubMed Central

Morrison, Helen; Pospelova, Tatiana V.; Pospelov, Valery A.; Herrlich, Peter

2014-01-01

The adenoviral oncoprotein E1A influences cellular regulation by interacting with a number of cellular proteins. In collaboration with complementary oncogenes, E1A fully transforms primary cells. As part of this action, E1A inhibits transcription of c-Jun:Fos target genes while promoting that of c-Jun:ATF2-dependent genes including jun. Both c-Jun and ATF2 are hyperphosphorylated in response to E1A. In the current study, E1A was fused with the ligand binding domain of the estrogen receptor (E1A-ER) to monitor the immediate effect of E1A activation. With this approach we now show that E1A activates c-Jun N-terminal kinase (JNK), the upstream kinases MKK4 and MKK7, as well as the small GTPase Rac1. Activation of the JNK pathway requires the N-terminal domain of E1A, and, importantly, is independent of transcription. In addition, it requires the presence of ERM proteins. Downregulation of signaling components upstream of JNK inhibits E1A-dependent JNK/c-Jun activation. Taking these findings together, we show that E1A activates the JNK/c-Jun signaling pathway upstream of Rac1 in a transcription-independent manner, demonstrating a novel mechanism of E1A action. PMID:24742962

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

The mycobacterial antibiotic resistance determinant WhiB7 acts as a transcriptional activator by binding the primary sigma factor SigA (RpoV)

PubMed Central

Burian, Ján; Yim, Grace; Hsing, Michael; Axerio-Cilies, Peter; Cherkasov, Artem; Spiegelman, George B.; Thompson, Charles J.

2013-01-01

Tuberculosis therapeutic options are limited by the high intrinsic antibiotic resistance of Mycobacterium tuberculosis. The putative transcriptional regulator WhiB7 is crucial for the activation of systems that provide resistance to diverse antibiotic classes. Here, we used in vitro run-off, two-hybrid assays, as well as mutagenic, complementation and protein pull-down experiments, to characterize WhiB7 as an auto-regulatory, redox-sensitive transcriptional activator in Mycobacterium smegmatis. We provide the first direct biochemical proof that a WhiB protein promotes transcription and also demonstrate that this activity is sensitive to oxidation (diamide). Its partner protein for transcriptional activation was identified as SigA, the primary sigma factor subunit of RNA polymerase. Residues required for the interaction mapped to region 4 of SigA (including R515H) or adjacent domains of WhiB7 (including E63D). WhiB7’s ability to provide a specific spectrum of antibiotic-resistance was dependent on these residues as well as its C-terminal AT-hook module that binds to an AT-rich motif immediately upstream of the −35 hexamer recognized by SigA. These experimentally established constrains, combined with protein structure predictions, were used to generate a working model of the WhiB7–SigA-promoter complex. Inhibitors preventing WhiB7 interactions could allow the use of previously ineffective antibiotics for treatment of mycobacterial diseases. PMID:23990327

The mycobacterial antibiotic resistance determinant WhiB7 acts as a transcriptional activator by binding the primary sigma factor SigA (RpoV).

PubMed

Burian, Ján; Yim, Grace; Hsing, Michael; Axerio-Cilies, Peter; Cherkasov, Artem; Spiegelman, George B; Thompson, Charles J

2013-12-01

Tuberculosis therapeutic options are limited by the high intrinsic antibiotic resistance of Mycobacterium tuberculosis. The putative transcriptional regulator WhiB7 is crucial for the activation of systems that provide resistance to diverse antibiotic classes. Here, we used in vitro run-off, two-hybrid assays, as well as mutagenic, complementation and protein pull-down experiments, to characterize WhiB7 as an auto-regulatory, redox-sensitive transcriptional activator in Mycobacterium smegmatis. We provide the first direct biochemical proof that a WhiB protein promotes transcription and also demonstrate that this activity is sensitive to oxidation (diamide). Its partner protein for transcriptional activation was identified as SigA, the primary sigma factor subunit of RNA polymerase. Residues required for the interaction mapped to region 4 of SigA (including R515H) or adjacent domains of WhiB7 (including E63D). WhiB7's ability to provide a specific spectrum of antibiotic-resistance was dependent on these residues as well as its C-terminal AT-hook module that binds to an AT-rich motif immediately upstream of the -35 hexamer recognized by SigA. These experimentally established constrains, combined with protein structure predictions, were used to generate a working model of the WhiB7-SigA-promoter complex. Inhibitors preventing WhiB7 interactions could allow the use of previously ineffective antibiotics for treatment of mycobacterial diseases.

The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

PubMed Central

Diccianni, M B; Imagawa, M; Muramatsu, M

1992-01-01

Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis. Images PMID:1408831

The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

PubMed

Diccianni, M B; Imagawa, M; Muramatsu, M

1992-10-11

Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.

Orphan nuclear receptor chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) protein negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation through suppressing runt-related gene 2 (Runx2) activity.

PubMed

Lee, Kkot-Nim; Jang, Won-Gu; Kim, Eun-Jung; Oh, Sin-Hye; Son, Hye-Ju; Kim, Sun-Hun; Franceschi, Renny; Zhang, Xiao-Kun; Lee, Shee-Eun; Koh, Jeong-Tae

2012-06-01

Chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) is an orphan nuclear receptor of the steroid-thyroid hormone receptor superfamily. COUP-TFII is widely expressed in multiple tissues and organs throughout embryonic development and has been shown to regulate cellular growth, differentiation, and organ development. However, the role of COUP-TFII in osteoblast differentiation has not been systematically evaluated. In the present study, COUP-TFII was strongly expressed in multipotential mesenchymal cells, and the endogenous expression level decreased during osteoblast differentiation. Overexpression of COUP-TFII inhibited bone morphogenetic protein 2 (BMP2)-induced osteoblastic gene expression. The results of alkaline phosphatase, Alizarin Red staining, and osteocalcin production assay showed that COUP-TFII overexpression blocks BMP2-induced osteoblast differentiation. In contrast, the down-regulation of COUP-TFII synergistically induced the expression of BMP2-induced osteoblastic genes and osteoblast differentiation. Furthermore, the immunoprecipitation assay showed that COUP-TFII and Runx2 physically interacted and COUP-TFII significantly impaired the Runx2-dependent activation of the osteocalcin promoter. From the ChIP assay, we found that COUP-TFII repressed DNA binding of Runx2 to the osteocalcin gene, whereas Runx2 inhibited COUP-TFII expression via direct binding to the COUP-TFII promoter. Taken together, these findings demonstrate that COUP-TFII negatively regulates osteoblast differentiation via interaction with Runx2, and during the differentiation state, BMP2-induced Runx2 represses COUP-TFII expression and promotes osteoblast differentiation.

Expression of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) in bladder transitional cell carcinoma.

PubMed

Ham, Won Sik; Lee, Joo Hyoung; Yu, Ho Song; Choi, Young Deuk

2008-10-01

An analysis of differentially expressed genes (DEGs) between bladder transitional cell carcinoma (TCC) and the surrounding urothelium to help identify what lies behind the mechanism of multifocal tumor development has not yet been performed. We sought to find a new DEG related to the development of bladder TCC. Thirty-nine bladder TCC tissues paired with normal-appearing urothelium tissues obtained from the same patient were used as subjects. Initially, we compared the messenger RNA (mRNA) profiles between normal-appearing urothelium and TCC tissue of 1 patient by using annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) and selective amplification of family members (SAFM) PCR to identify potential DEGs. To validate the results of the ACP data, reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on those of all 39 patients. Among the several DEGs discovered in the ACP data, 1 DEG was chosen as the candidate for the RT-PCR, that is present or markedly upregulated in normal-appearing urothelial tissue compared with TCC tissue. Gene sequence searching revealed that this DEG is chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI). Downregulation of COUP-TFI mRNA expression in TCC tissue compared to normal-appearing urothelium tissue of the same patient, irrespective of tumor stage and grade, was confirmed by RT-PCR in 39 patients. Our results suggest that the loss of COUP-TFI may play a role in the transition from normal epithelium to TCC. Further characterization of the COUP-TFI gene is expected to give us informations about bladder TCC tumorigenesis.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Overexpression of CaWRKY27, a subgroup IIe WRKY transcription factor of Capsicum annuum, positively regulates tobacco resistance to Ralstonia solanacearum infection.

PubMed

Dang, Fengfeng; Wang, Yuna; She, Jianju; Lei, Yufen; Liu, Zhiqin; Eulgem, Thomas; Lai, Yan; Lin, Jing; Yu, Lu; Lei, Dan; Guan, Deyi; Li, Xia; Yuan, Qian; He, Shuilin

2014-03-01

WRKY proteins are encoded by a large gene family and are linked to many biological processes across a range of plant species. The functions and underlying mechanisms of WRKY proteins have been investigated primarily in model plants such as Arabidopsis and rice. The roles of these transcription factors in non-model plants, including pepper and other Solanaceae, are poorly understood. Here, we characterize the expression and function of a subgroup IIe WRKY protein from pepper (Capsicum annuum), denoted as CaWRKY27. The protein localized to nuclei and activated the transcription of a reporter GUS gene construct driven by the 35S promoter that contained two copies of the W-box in its proximal upstream region. Inoculation of pepper cultivars with Ralstonia solanacearum induced the expression of CaWRKY27 transcript in 76a, a bacterial wilt-resistant pepper cultivar, whereas it downregulated the expression of CaWRKY27 transcript in Gui-1-3, a bacterial wilt-susceptible pepper cultivar. CaWRKY27 transcript levels were also increased by treatments with salicylic acid (SA), methyl jasmonate (MeJA) and ethephon (ETH). Transgenic tobacco plants overexpressing CaWRKY27 exhibited resistance to R. solanacearum infection compared to that of wild-type plants. This resistance was coupled with increased transcript levels in a number of marker genes, including hypersensitive response genes, and SA-, JA- and ET-associated genes. By contrast, virus-induced gene silencing (VIGS) of CaWRKY27 increased the susceptibility of pepper plants to R. solanacearum infection. These results suggest that CaWRKY27 acts as a positive regulator in tobacco resistance responses to R. solanacearum infection through modulation of SA-, JA- and ET-mediated signaling pathways. © 2013 Scandinavian Plant Physiology Society.

CaWRKY58, encoding a group I WRKY transcription factor of Capsicum annuum, negatively regulates resistance to Ralstonia solanacearum infection.

PubMed

Wang, Yuna; Dang, Fengfeng; Liu, Zhiqin; Wang, Xu; Eulgem, Thomas; Lai, Yan; Yu, Lu; She, Jianju; Shi, Youliang; Lin, Jinhui; Chen, Chengcong; Guan, Deyi; Qiu, Ailian; He, Shuilin

2013-02-01

WRKY transcription factors are encoded by large gene families across the plant kingdom. So far, their biological and molecular functions in nonmodel plants, including pepper (Capsicum annuum) and other Solanaceae, remain poorly understood. Here, we report on the functional characterization of a new group I WRKY protein from pepper, termed CaWRKY58. Our data indicate that CaWRKY58 can be localized to the nucleus and can activate the transcription of the reporter β-glucuronidase (GUS) gene driven by the 35S core promoter with two copies of the W-box in its proximal upstream region. In pepper plants infected with the bacterial pathogen Ralstonia solanacearum, CaWRKY58 transcript levels showed a biphasic response, manifested in an early/transient down-regulation and late up-regulation. CaWRKY58 transcripts were suppressed by treatment with methyl jasmonate and abscisic acid. Tobacco plants overexpressing CaWRKY58 did not show any obvious morphological phenotypes, but exhibited disease symptoms of greater severity than did wild-type plants. The enhanced susceptibility of CaWRKY58-overexpressing tobacco plants correlated with the decreased expression of hypersensitive response marker genes, as well as various defence-associated genes. Consistently, CaWRKY58 pepper plants silenced by virus-induced gene silencing (VIGS) displayed enhanced resistance to the highly virulent R. solanacearum strain FJC100301, and this was correlated with enhanced transcripts of defence-related pepper genes. Our results suggest that CaWRKY58 acts as a transcriptional activator of negative regulators in the resistance of pepper to R. solanacearum infection. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Structure of transcription factor HetR required for heterocyst differentiation in cyanobacteria

PubMed Central

Kim, Youngchang; Joachimiak, Grazyna; Ye, Zi; Binkowski, T. Andrew; Zhang, Rongguang; Gornicki, Piotr; Callahan, Sean M.; Hess, Wolfgang R.; Haselkorn, Robert; Joachimiak, Andrzej

2011-01-01

HetR is an essential regulator of heterocyst development in cyanobacteria. HetR binds to a DNA palindrome upstream of the hetP gene. We report the crystal structure of HetR from Fischerella at 3.0 Å. The protein is a dimer comprised of a central DNA-binding unit containing the N-terminal regions of the two subunits organized with two helix-turn-helix motifs; two globular flaps extending in opposite directions; and a hood over the central core formed from the C-terminal subdomains. The flaps and hood have no structural precedent in the protein database, therefore representing new folds. The structural assignments are supported by site-directed mutagenesis and DNA-binding studies. We suggest that HetR serves as a scaffold for assembly of transcription components critical for heterocyst development. PMID:21628585

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

PubMed

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

2014-08-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

PubMed Central

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix

2014-01-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

An ancestral allele of grapevine transcription factor MYB14 promotes plant defence

PubMed Central

Duan, Dong; Fischer, Sabine; Merz, Patrick; Bogs, Jochen; Riemann, Michael; Nick, Peter

2016-01-01

Stilbene synthase is a key enzyme for the production of the phytoalexin resveratrol. Some clones of Vitis sylvestris, a wild European grapevine species which is almost extinct, have been shown to accumulate more resveratrol in response to different forms of stress. In the current study, we asked whether the induction of stilbene synthase transcripts in Hoe29, one of the V. sylvestris clones with elevated stilbene inducibility, might result from the elevated induction of the transcription factor MYB14. The MYB14 promoter of Hoe29 and of Ke83 (a second stilbene-inducible genotype) harboured distinct regions and were applied to a promoter–reporter system. We show that stilbene synthase inducibility correlates with differences in the induction of MYB14 transcripts for these two genotypes. Both alleles were induced by UV in a promoter–reporter assay, but only the MYB14 promoter from Hoe29 was induced by flg22, consistent with the stilbene synthase expression of the donor genotypes, where both respond to UV but only Hoe29 is responsive to Plasmopara viticola during defence. We mapped upstream signals and found that a RboH-dependent oxidative burst, calcium influx, a MAPK cascade, and jasmonate activated the MYB14 promoter, whereas salicylic acid was ineffective. Our data suggest that the Hoe29 allele of the MYB14 promoter has potential as a candidate target for resistance breeding. PMID:26842984

FLOWERING LOCUS C Mediates Natural Variation in the High-Temperature Response of the Arabidopsis Circadian Clock[W

PubMed Central

Edwards, Kieron D.; Anderson, Paul E.; Hall, Anthony; Salathia, Neeraj S.; Locke, James C.W.; Lynn, James R.; Straume, Martin; Smith, James Q.; Millar, Andrew J.

2006-01-01

Temperature compensation contributes to the accuracy of biological timing by preventing circadian rhythms from running more quickly at high than at low temperatures. We previously identified quantitative trait loci (QTL) with temperature-specific effects on the circadian rhythm of leaf movement, including a QTL linked to the transcription factor FLOWERING LOCUS C (FLC). We have now analyzed FLC alleles in near-isogenic lines and induced mutants to eliminate other candidate genes. We showed that FLC lengthened the circadian period specifically at 27°C, contributing to temperature compensation of the circadian clock. Known upstream regulators of FLC expression in flowering time pathways similarly controlled its circadian effect. We sought to identify downstream targets of FLC regulation in the molecular mechanism of the circadian clock using genome-wide analysis to identify FLC-responsive genes and 3503 transcripts controlled by the circadian clock. A Bayesian clustering method based on Fourier coefficients allowed us to discriminate putative regulatory genes. Among rhythmic FLC-responsive genes, transcripts of the transcription factor LUX ARRHYTHMO (LUX) correlated in peak abundance with the circadian period in flc mutants. Mathematical modeling indicated that the modest change in peak LUX RNA abundance was sufficient to cause the period change due to FLC, providing a molecular target for the crosstalk between flowering time pathways and circadian regulation. PMID:16473970

Co-option of the bZIP transcription factor Vrille as the activator of Doublesex1 in environmental sex determination of the crustacean Daphnia magna.

PubMed

Mohamad Ishak, Nur Syafiqah; Nong, Quang Dang; Matsuura, Tomoaki; Kato, Yasuhiko; Watanabe, Hajime

2017-11-01

Divergence of upstream regulatory pathways of the transcription factor Doublesex (Dsx) serves as a basis for evolution of sex-determining mechanisms in animals. However, little is known about the regulation of Dsx in environmental sex determination. In the crustacean Daphnia magna, environmental sex determination is implemented by male-specific expression of the Dsx ortholog, Dsx1. Transcriptional regulation of Dsx1 comprises at least three phases during embryogenesis: non-sex-specific initiation, male-specific up-regulation, and its maintenance. Herein, we demonstrate that the male-specific up-regulation is controlled by the bZIP transcription factor, Vrille (Vri), an ortholog of the circadian clock genes-Drosophila Vri and mammalian E4BP4/NFIL3. Sequence analysis of the Dsx1 promoter/enhancer revealed a conserved element among two Daphnia species (D. magna and D. pulex), which contains a potential enhancer harboring a consensus Vri binding site overlapped with a consensus Dsx binding site. Besides non-sex-specific expression of Vri in late embryos, we found male-specific expression in early gastrula before the Dsx1 up-regulation phase begins. Knockdown of Vri in male embryos showed reduction of Dsx1 expression. In addition, transient overexpression of Vri in early female embryos up-regulated the expression of Dsx1 and induced male-specific trait. Targeted mutagenesis using CRISPR/Cas9 disrupted the enhancer on genome in males, which led to the reduction of Dsx1 expression. These results indicate that Vri was co-opted as a transcriptional activator of Dsx1 in environmental sex determination of D. magna. The data suggests the remarkably plastic nature of gene regulatory network in sex determination.

Co-option of the bZIP transcription factor Vrille as the activator of Doublesex1 in environmental sex determination of the crustacean Daphnia magna

PubMed Central

Nong, Quang Dang; Matsuura, Tomoaki; Watanabe, Hajime

2017-01-01

Divergence of upstream regulatory pathways of the transcription factor Doublesex (Dsx) serves as a basis for evolution of sex-determining mechanisms in animals. However, little is known about the regulation of Dsx in environmental sex determination. In the crustacean Daphnia magna, environmental sex determination is implemented by male-specific expression of the Dsx ortholog, Dsx1. Transcriptional regulation of Dsx1 comprises at least three phases during embryogenesis: non-sex-specific initiation, male-specific up-regulation, and its maintenance. Herein, we demonstrate that the male-specific up-regulation is controlled by the bZIP transcription factor, Vrille (Vri), an ortholog of the circadian clock genes—Drosophila Vri and mammalian E4BP4/NFIL3. Sequence analysis of the Dsx1 promoter/enhancer revealed a conserved element among two Daphnia species (D. magna and D. pulex), which contains a potential enhancer harboring a consensus Vri binding site overlapped with a consensus Dsx binding site. Besides non-sex-specific expression of Vri in late embryos, we found male-specific expression in early gastrula before the Dsx1 up-regulation phase begins. Knockdown of Vri in male embryos showed reduction of Dsx1 expression. In addition, transient overexpression of Vri in early female embryos up-regulated the expression of Dsx1 and induced male-specific trait. Targeted mutagenesis using CRISPR/Cas9 disrupted the enhancer on genome in males, which led to the reduction of Dsx1 expression. These results indicate that Vri was co-opted as a transcriptional activator of Dsx1 in environmental sex determination of D. magna. The data suggests the remarkably plastic nature of gene regulatory network in sex determination. PMID:29095827

Upstream open reading frames regulate the expression of the nuclear Wnt13 isoforms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang Tao; Rector, Kyle; Barnett, Corey D.

2008-02-22

Wnt proteins control cell survival and cell fate during development. Although Wnt expression is tightly regulated in a spatio-temporal manner, the mechanisms involved both at the transcriptional and translational levels are poorly defined. We have identified a downstream translation initiation codon, AUG(+74), in Wnt13B and Wnt13C mRNAs responsible for the expression of Wnt13 nuclear forms. In this report, we demonstrate that the expression of the nuclear Wnt13C form is translationally regulated in response to stress and apoptosis. Though the 5'-leaders of both Wnt13C and Wnt13B mRNAs have an inhibitory effect on translation, they did not display an internal ribosome entrymore » site activity as demonstrated by dicistronic reporter assays. However, mutations or deletions of the upstream AUG(-99) and AUG(+1) initiation codons abrogate these translation inhibitory effects, demonstrating that Wnt13C expression is controlled by upstream open reading frames. Since long 5'-untranslated region with short upstream open reading frames characterize other Wnt transcripts, our present data on the translational control of Wnt13 expression open the way to further studies on the translation control of Wnt expression as a modulator of their subcellular localization and activity.« less

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

Functional Characterization of the Poplar R2R3-MYB Transcription Factor PtoMYB216 Involved in the Regulation of Lignin Biosynthesis during Wood Formation

PubMed Central

Lu, Wanxiang; Yang, Li; Jiang, Yuanzhong; Luo, Keming

2013-01-01

Because of the importance of wood in many industrial applications, tremendous studies have been performed on wood formation, especially in lignin biosynthesis. MYB transcription factors (TFs), which consist of a large family of plant TFs, have been reported to directly regulate lignin biosynthetic genes in a number of plants. In this study, we describe the cloning and functional characterization of PtoMYB216, a cDNA isolated from Chinese white poplar (Populus tomentosa Carr.). PtoMYB216 encodes a protein belonging to the R2R3-MYB family and displays significant similarity with other MYB factors shown to regulate lignin synthesis in Arabidopsis. Gene expression profiling studies showed that PtoMYB216 mRNA is specifically expressed during secondary wall formation in wood. The 1.8-kb promoter sequence of PtoMYB216 was fused to the GUS coding sequence and introduced into wild-type A. thaliana. GUS expression was shown to be restricted to tissues undergoing secondary cell wall formation. Overexpression of PtoMYB216 specifically activated the expression of the upstream genes in the lignin biosynthetic pathway and resulted in ectopic deposition of lignin in cells that are normally unligninified. These results suggest that PtoMYB216 is specific transcriptional activators of lignin biosynthesis and involved in the regulation of wood formation in poplar. PMID:24204619

Activity of the Rhodopseudomonas palustris p-Coumaroyl-Homoserine Lactone-Responsive Transcription Factor RpaR ▿ †

PubMed Central

Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D.; Castle, John C.; Raymond, Christopher K.; Lappala, Colin R.; Schaefer, Amy L.; Harwood, Caroline S.; Greenberg, E. Peter

2011-01-01

The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His6-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon. PMID:21378182

Molecular Characterization of the Schistosoma mansoni Zinc Finger Protein SmZF1 as a Transcription Factor

PubMed Central

D'Astolfo, Diego S.; Cardoso, Fernanda C.; Rajão, Matheus A.; Mourão, Marina M.; Gava, Elisandra; Oliveira, Sérgio C.; Macedo, Andréa M.; Machado, Carlos R.; Pena, Sérgio D. J.; Kitten, Gregory T.; Franco, Glória R.

2009-01-01

Background During its development, the parasite Schistosoma mansoni is exposed to different environments and undergoes many morphological and physiological transformations as a result of profound changes in gene expression. Characterization of proteins involved in the regulation of these processes is of importance for the understanding of schistosome biology. Proteins containing zinc finger motifs usually participate in regulatory processes and are considered the major class of transcription factors in eukaryotes. It has already been shown, by EMSA (Eletrophoretic Mobility Shift Assay), that SmZF1, a S. mansoni zinc finger (ZF) protein, specifically binds both DNA and RNA oligonucleotides. This suggests that this protein might act as a transcription factor in the parasite. Methodology/Principal Findings In this study we extended the characterization of SmZF1 by determining its subcellular localization and by verifying its ability to regulate gene transcription. We performed immunohistochemistry assays using adult male and female worms, cercariae and schistosomula to analyze the distribution pattern of SmZF1 and verified that the protein is mainly detected in the cells nuclei of all tested life cycle stages except for adult female worms. Also, SmZF1 was heterologously expressed in mammalian COS-7 cells to produce the recombinant protein YFP-SmZF1, which was mainly detected in the nucleus of the cells by confocal microscopy and Western blot assays. To evaluate the ability of this protein to regulate gene transcription, cells expressing YFP-SmZF1 were tested in a luciferase reporter system. In this system, the luciferase gene is downstream of a minimal promoter, upstream of which a DNA region containing four copies of the SmZF1 putative best binding site (D1-3DNA) was inserted. SmZF1 increased the reporter gene transcription by two fold (p≤0.003) only when its specific binding site was present. Conclusion Taken together, these results strongly support the hypothesis that SmZF1 acts as a transcription factor in S. mansoni. PMID:19901992

A putative APSES transcription factor is necessary for normal growth and development of Aspergillus nidulans.

PubMed

Lee, Ji-Yeon; Kim, Lee-Han; Kim, Ha-Eun; Park, Jae-Sin; Han, Kap-Hoon; Han, Dong-Min

2013-12-01

The nsdD gene encoding a GATA type transcription factor positively controls sexual development in Aspergillus nidulans. According to microarray data, 20 genes that were upregulated by deleting nsdD during various life cycle stages were randomly selected and deleted for functional analysis. None of the mutants showed apparent changes in growth or development compared with those of the wild-type except the AN3154 gene that encodes a putative APSES transcription factor and is an ortholog of Saccharomyces cerevisiae swi4. Deleting AN3154 resulted in retarded growth and development, and the gene was named rgdA (retared growth and development). The rgdA deletion mutant developed a reduced number of conidia even under favorable conditions for asexual development. The retarded growth and development was partially suppressed by the veA1 mutation. The conidial heads of the mutant aborted, showing reduced and irregular shaped phialides. Fruiting body development was delayed compared with that in the wild-type. The mutant did not respond to various nutritional or environmental factors that affected the development patterns. The rgdA gene was expressed at low levels throughout the life cycle and was not significantly affected by several regulators of sexual and asexual development such as nsdD, veA, stuA, or brlA. However, the rgdA gene affected brlA and abaA expression, which function as key regulators of asexual sporulation, suggesting that rgdA functions upstream of those genes.

Thymoquinone Suppresses IRF-3-Mediated Expression of Type I Interferons via Suppression of TBK1

PubMed Central

Cho, Jae Youl

2018-01-01

Interferon regulatory factor (IRF)-3 is known to have a critical role in viral and bacterial innate immune responses by regulating the production of type I interferon (IFN). Thymoquinone (TQ) is a compound derived from black cumin (Nigella sativa L.) and is known to regulate immune responses by affecting transcription factors associated with inflammation, including nuclear factor-κB (NF-κB) and activator protein-1 (AP-1). However, the role of TQ in the IRF-3 signaling pathway has not been elucidated. In this study, we explored the molecular mechanism of TQ-dependent regulation of enzymes in IRF-3 signaling pathways using the lipopolysaccharide (LPS)-stimulated murine macrophage-like RAW264.7 cell line. TQ decreased mRNA expression of the interferon genes IFN-α and IFN-β in these cells. This inhibition was due to its suppression of the transcriptional activation of IRF-3, as shown by inhibition of IRF-3 PRD (III-I) luciferase activity as well as the phosphorylation pattern of IRF-3 in the immunoblotting experiment. Moreover, TQ targeted the autophosphorylation of TANK-binding kinase 1 (TBK1), an upstream key enzyme responsible for IRF-3 activation. Taken together, these findings suggest that TQ can downregulate IRF-3 activation via inhibition of TBK1, which would subsequently decrease the production of type I IFN. TQ also regulated IRF-3, one of the inflammatory transcription factors, providing a novel insight into its anti-inflammatory activities. PMID:29751576

Mapping the CgrA regulon of Rhodospirillum centenum reveals a hierarchal network controlling Gram-negative cyst development.

PubMed

Dong, Qian; Fang, Mingxu; Roychowdhury, Sugata; Bauer, Carl E

2015-12-16

Several Gram-negative species undergo development leading to the formation of metabolically dormant desiccation resistant cysts. Recent analysis of cyst development has revealed that ~20 % of the Rhodospirillum centenum transcriptome undergo temporal changes in expression as cells transition from vegetative to cyst forms. It has also been established that one trigger for cyst formation is the synthesis of the signaling nucleotide 3', 5'- cyclic guanosine monophosphate (cGMP) that is sensed by a homolog of the catabolite repressor protein called CgrA. CgrA in the presence of cGMP initiate a cascade of gene expression leading to the development of cysts. In this study, we have used RNA-seq and chromatin immunoprecipitation (ChIP-Seq) techniques to define the CgrA-cGMP regulon. Our results indicate that disruption of CgrA leads to altered expression of 258 genes, 131 of which have been previously reported to be involved in cyst development. ChIP-seq analysis combined with transcriptome data also demonstrates that CgrA directly regulates the expression of numerous sigma factors and transcription factors several of which are known to be involved in cyst cell development. This analysis reveals the presence of CgrA binding sites upstream of many developmentally regulated genes including many transcription factors and signal transduction components. CgrA thus functions as master controller of the cyst development by initiating a hierarchal cascade of downstream transcription factors that induces temporal expression of encystment genes.

Proteomic profiling of early degenerative retina of RCS rats.

PubMed

Zhu, Zhi-Hong; Fu, Yan; Weng, Chuan-Huang; Zhao, Cong-Jian; Yin, Zheng-Qin

2017-01-01

To identify the underlying cellular and molecular changes in retinitis pigmentosa (RP). Label-free quantification-based proteomics analysis, with its advantages of being more economic and consisting of simpler procedures, has been used with increasing frequency in modern biological research. Dystrophic RCS rats, the first laboratory animal model for the study of RP, possess a similar pathological course as human beings with the diseases. Thus, we employed a comparative proteomics analysis approach for in-depth proteome profiling of retinas from dystrophic RCS rats and non-dystrophic congenic controls through Linear Trap Quadrupole - orbitrap MS/MS, to identify the significant differentially expressed proteins (DEPs). Bioinformatics analyses, including Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway annotation and upstream regulatory analysis, were then performed on these retina proteins. Finally, a Western blotting experiment was carried out to verify the difference in the abundance of transcript factor E2F1. In this study, we identified a total of 2375 protein groups from the retinal protein samples of RCS rats and non-dystrophic congenic controls. Four hundred thirty-four significantly DEPs were selected by Student's t -test. Based on the results of the bioinformatics analysis, we identified mitochondrial dysfunction and transcription factor E2F1 as the key initiation factors in early retinal degenerative process. We showed that the mitochondrial dysfunction and the transcription factor E2F1 substantially contribute to the disease etiology of RP. The results provide a new potential therapeutic approach for this retinal degenerative disease.

Proto-oncogene FBI-1 represses transcription of p21CIP1 by inhibition of transcription activation by p53 and Sp1.

PubMed

Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

2009-05-08

Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1-3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target.

Proto-oncogene FBI-1 Represses Transcription of p21CIP1 by Inhibition of Transcription Activation by p53 and Sp1*S⃞

PubMed Central

Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

2009-01-01

Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1–3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

Genome-Wide Analysis of Androgen Receptor Targets Reveals COUP-TF1 as a Novel Player in Human Prostate Cancer

PubMed Central

Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli

2012-01-01

Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR – COUP-TF1 – which could possibly play a role in human prostate cancer. PMID:23056316

Genome-wide analysis of androgen receptor targets reveals COUP-TF1 as a novel player in human prostate cancer.

PubMed

Perets, Ruth; Kaplan, Tommy; Stein, Ilan; Hidas, Guy; Tayeb, Shay; Avraham, Eti; Ben-Neriah, Yinon; Simon, Itamar; Pikarsky, Eli

2012-01-01

Androgen activity plays a key role in prostate cancer progression. Androgen receptor (AR) is the main mediator of androgen activity in the prostate, through its ability to act as a transcription mediator. Here we performed a genome-wide analysis of human AR binding to promoters in the presence of an agonist or antagonist in an androgen dependent prostate cancer cell line. Many of the AR bound promoters are bound in all examined conditions while others are bound only in the presence of an agonist or antagonist. Several motifs are enriched in AR bound promoters, including the AR Response Element (ARE) half-site and recognition elements for the transcription factors OCT1 and SOX9. This suggests that these 3 factors could define a module of co-operating transcription factors in the prostate. Interestingly, AR bound promoters are preferentially located in AT rich genomic regions. Analysis of mRNA expression identified chicken ovalbumin upstream promoter-transcription factor 1 (COUP-TF1) as a direct AR target gene that is downregulated upon binding by the agonist liganded AR. COUP-TF1 immunostaining revealed nucleolar localization of COUP-TF1 in epithelium of human androgen dependent prostate cancer, but not in adjacent benign prostate epithelium. Stromal cells both in human and mouse prostate show nuclear COUP-TF1 staining. We further show that there is an inverse correlation between COUP-TF1 expression in prostate stromal cells and the rising levels of androgen with advancing puberty. This study extends the pool of recognized putative AR targets and identifies a negatively regulated target of AR - COUP-TF1 - which could possibly play a role in human prostate cancer.

Target gene analysis by microarrays and chromatin immunoprecipitation identifies HEY proteins as highly redundant bHLH repressors.

PubMed

Heisig, Julia; Weber, David; Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

2012-01-01

HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression.

Target Gene Analysis by Microarrays and Chromatin Immunoprecipitation Identifies HEY Proteins as Highly Redundant bHLH Repressors

PubMed Central

Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

2012-01-01

HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression. PMID:22615585

Potential Direct Regulators of the Drosophila yellow Gene Identified by Yeast One-Hybrid and RNAi Screens

PubMed Central

Kalay, Gizem; Lusk, Richard; Dome, Mackenzie; Hens, Korneel; Deplancke, Bart; Wittkopp, Patricia J.

2016-01-01

The regulation of gene expression controls development, and changes in this regulation often contribute to phenotypic evolution. Drosophila pigmentation is a model system for studying evolutionary changes in gene regulation, with differences in expression of pigmentation genes such as yellow that correlate with divergent pigment patterns among species shown to be caused by changes in cis- and trans-regulation. Currently, much more is known about the cis-regulatory component of divergent yellow expression than the trans-regulatory component, in part because very few trans-acting regulators of yellow expression have been identified. This study aims to improve our understanding of the trans-acting control of yellow expression by combining yeast-one-hybrid and RNAi screens for transcription factors binding to yellow cis-regulatory sequences and affecting abdominal pigmentation in adults, respectively. Of the 670 transcription factors included in the yeast-one-hybrid screen, 45 showed evidence of binding to one or more sequence fragments tested from the 5′ intergenic and intronic yellow sequences from D. melanogaster, D. pseudoobscura, and D. willistoni, suggesting that they might be direct regulators of yellow expression. Of the 670 transcription factors included in the yeast-one-hybrid screen, plus another TF previously shown to be genetically upstream of yellow, 125 were also tested using RNAi, and 32 showed altered abdominal pigmentation. Nine transcription factors were identified in both screens, including four nuclear receptors related to ecdysone signaling (Hr78, Hr38, Hr46, and Eip78C). This finding suggests that yellow expression might be directly controlled by nuclear receptors influenced by ecdysone during early pupal development when adult pigmentation is forming. PMID:27527791

PTPRS Regulates Colorectal Cancer RAS Pathway Activity by Inactivating Erk and Preventing Its Nuclear Translocation.

PubMed

Davis, Thomas B; Yang, Mingli; Schell, Michael J; Wang, Heiman; Ma, Le; Pledger, W Jack; Yeatman, Timothy J

2018-06-18

Colorectal cancer (CRC) growth and progression is frequently driven by RAS pathway activation through upstream growth factor receptor activation or through mutational activation of KRAS or BRAF. Here we describe an additional mechanism by which the RAS pathway may be modulated in CRC. PTPRS, a receptor-type protein tyrosine phosphatase, appears to regulate RAS pathway activation through ERK. PTPRS modulates ERK phosphorylation and subsequent translocation to the nucleus. Native mutations in PTPRS, present in ~10% of CRC, may reduce its phosphatase activity while increasing ERK activation and downstream transcriptional signaling.

Transcription Factor Stat5, A Novel Therapeutic Protein, Inhibits Metastatic Potential and Invasive Characteristics of Human Breast Cancer Cells

DTIC Science & Technology

2004-10-01

digestion and cloned into pLoxpNeo upstream of the PGK-neomycin cassette. A 1.3 kb fragment with the first coding exon was amplified by Pfx polymerase ...introducing a XhoI site on the 5’-end of the amplification product. The PCR fragment was cloned blunt into the HinDIII(blunt) site 5’ of the single...functionality of each of the loxP sites was tested in AM-1 cells (Invitrogen) that express Cre recombinase . Step 2: Gene targeting in embryonic stem

Biochemical and proteomic analysis of spliceosome factors interacting with intron-1 of human papillomavirus type-16.

PubMed

Martínez-Salazar, Martha; López-Urrutia, Eduardo; Arechaga-Ocampo, Elena; Bonilla-Moreno, Raul; Martínez-Castillo, Macario; Díaz-Hernández, Job; Del Moral-Hernández, Oscar; Cedillo-Barrón, Leticia; Martines-Juarez, Víctor; De Nova-Ocampo, Monica; Valdes, Jesús; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

2014-12-05

The human papillomavirus type 16 (HPV-16) E6/E7 spliced transcripts are heterogeneously expressed in cervical carcinoma. The heterogeneity of the E6/E7 splicing profile might be in part due to the intrinsic variation of splicing factors in tumor cells. However, the splicing factors that bind the E6/E7 intron 1 (In-1) have not been defined. Therefore, we aimed to identify these factors; we used HeLa nuclear extracts (NE) for in vitro spliceosome assembly. The proteins were allowed to bind to an RNA/DNA hybrid formed by the In-1 transcript and a 5'-biotinylated DNA oligonucleotide complementary to the upstream exon sequence, which prevented interference in protein binding to the intron. The hybrid probes bound with the nuclear proteins were coupled to streptavidin magnetic beads for chromatography affinity purification. Proteins were eluted and identified by mass spectrometry (MS). Approximately 170 proteins were identified by MS, 80% of which were RNA binding proteins, including canonical spliceosome core components, helicases and regulatory splicing factors. The canonical factors were identified as components of the spliceosomal B-complex. Although 35-40 of the identified factors were cognate splicing factors or helicases, they have not been previously detected in spliceosome complexes that were assembled using in vivo or in vitro models. Copyright © 2014 Elsevier B.V. All rights reserved.

Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

PubMed Central

Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y.

2013-01-01

Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF-Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrfl attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. PMID:23623971

Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

PubMed Central

Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

1994-01-01

Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

Genome Therapy of Myotonic Dystrophy Type 1 iPS Cells for Development of Autologous Stem Cell Therapy.

PubMed

Gao, Yuanzheng; Guo, Xiuming; Santostefano, Katherine; Wang, Yanlin; Reid, Tammy; Zeng, Desmond; Terada, Naohiro; Ashizawa, Tetsuo; Xia, Guangbin

2016-08-01

Myotonic dystrophy type 1 (DM1) is caused by expanded Cytosine-Thymine-Guanine (CTG) repeats in the 3'-untranslated region (3' UTR) of the Dystrophia myotonica protein kinase (DMPK) gene, for which there is no effective therapy. The objective of this study is to develop genome therapy in human DM1 induced pluripotent stem (iPS) cells to eliminate mutant transcripts and reverse the phenotypes for developing autologous stem cell therapy. The general approach involves targeted insertion of polyA signals (PASs) upstream of DMPK CTG repeats, which will lead to premature termination of transcription and elimination of toxic mutant transcripts. Insertion of PASs was mediated by homologous recombination triggered by site-specific transcription activator-like effector nuclease (TALEN)-induced double-strand break. We found genome-treated DM1 iPS cells continue to maintain pluripotency. The insertion of PASs led to elimination of mutant transcripts and complete disappearance of nuclear RNA foci and reversal of aberrant splicing in linear-differentiated neural stem cells, cardiomyocytes, and teratoma tissues. In conclusion, genome therapy by insertion of PASs upstream of the expanded DMPK CTG repeats prevented the production of toxic mutant transcripts and reversal of phenotypes in DM1 iPS cells and their progeny. These genetically-treated iPS cells will have broad clinical application in developing autologous stem cell therapy for DM1.

ASR5 is involved in the regulation of miRNA expression in rice.

PubMed

Neto, Lauro Bücker; Arenhart, Rafael Augusto; de Oliveira, Luiz Felipe Valter; de Lima, Júlio Cesar; Bodanese-Zanettini, Maria Helena; Margis, Rogerio; Margis-Pinheiro, Márcia

2015-11-01

The work describes an ASR knockdown transcriptomic analysis by deep sequencing of rice root seedlings and the transactivation of ASR cis-acting elements in the upstream region of a MIR gene. MicroRNAs are key regulators of gene expression that guide post-transcriptional control of plant development and responses to environmental stresses. ASR (ABA, Stress and Ripening) proteins are plant-specific transcription factors with key roles in different biological processes. In rice, ASR proteins have been suggested to participate in the regulation of stress response genes. This work describes the transcriptomic analysis by deep sequencing two libraries, comparing miRNA abundance from the roots of transgenic ASR5 knockdown rice seedlings with that of the roots of wild-type non-transformed rice seedlings. Members of 59 miRNA families were detected, and 276 mature miRNAs were identified. Our analysis detected 112 miRNAs that were differentially expressed between the two libraries. A predicted inverse correlation between miR167abc and its target gene (LOC_Os07g29820) was confirmed using RT-qPCR. Protoplast transactivation assays showed that ASR5 is able to recognize binding sites upstream of the MIR167a gene and drive its expression in vivo. Together, our data establish a comparative study of miRNAome profiles and is the first study to suggest the involvement of ASR proteins in miRNA gene regulation.

RAV transcription factors are essential for disease resistance against cassava bacterial blight via activation of melatonin biosynthesis genes.

PubMed

Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao

2018-01-01

With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk

PubMed Central

Pattison, Jillian M.; Posternak, Valeriya; Cole, Michael D.

2016-01-01

It is well established that environmental toxins, such as exposure to arsenic, are risk factors in the development of urinary bladder cancer, yet recent genome-wide association studies (GWAS) provide compelling evidence that there is a strong genetic component associated with disease predisposition. A single nucleotide polymorphism (SNP), rs8102137, was identified on chromosome 19q12, residing 6 kb upstream of the important cell cycle regulator and proto-oncogene, Cyclin E1 (CCNE1). However, the functional role of this variant in bladder cancer predisposition has been unclear since it lies within a non-coding region of the genome. Here, it is demonstrated that bladder cancer cells heterozygous for this SNP exhibit biased allelic expression of CCNE1 with 1.5-fold more transcription occurring from the risk allele. Furthermore, using chromatin immunoprecipitation assays, a novel enhancer element was identified within the first intron of CCNE1 that binds Kruppel-like Factor 5 (KLF5), a known transcriptional activator in bladder cancer. Moreover, the data reveal that the presence of rs200996365, a SNP in high linkage disequilibrium with rs8102137 residing in the center of a KLF5 motif, alters KLF5 binding to this genomic region. Through luciferase assays and CRISPR-Cas9 genome editing, a novel polymorphic intronic regulatory element controlling CCNE1 transcription is characterized. These studies uncover how a cancer-associated polymorphism mechanistically contributes to an increased predisposition for bladder cancer development. Implications A polymorphic KLF5 binding site near the CCNE1 gene explains genetic risk identified through genome wide association studies. PMID:27514407

[Exon-intron structure of the fet5+ gene of Schizosaccharomyces pombe and physical mapping of genome encompassing regions].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1998-01-01

Plasmid pYUK3 bearing the fet5+ gene of Schizosaccharomyces pombe was isolated from a genomic library of the fission yeast, and a detailed physical map of the whole genomic insert (ca. 9.6 Kbp) was constructed. The primary structure of the fet5+ gene and its flanking regions is established. The gene contains a single 45-bp intron in its distal part. A typical TATA-box (TATAAG) was found in the 5'-noncoding region ca. 50 bp upstream of the putative start of transcription, and the 3'-noncoding region contains AT-rich palindromes, which are probably involved in termination of the fet5+ transcription. A previously unidentified gene of Sz. pombe encoding a protein with some similarity to one of the transcriptional activators from the TBP (TATA-binding protein) group of SPT factors of transcription was found in the vicinity of the fet5+ gene. Taking into account that cDNA of the fet5(+)-gene was isolated as a suppressor of the genetic-defect of nuclear RNA polymerases I-III (Bioorg. Khim., 1997, vol. 23, No 3, pp. 234-237), this vicinity may be the first evidence of possible clustering, in the genome of the fission yeast, of genes participating in transcription regulation.

Molecular mechanisms of the mammalian Hippo signaling pathway.

PubMed

Ji, Xin-yan; Zhong, Guoxuan; Zhao, Bin

2017-07-20

The Hippo pathway plays an evolutionarily conserved fundamental role in controlling organ size in multicellular organisms. Importantly, evidence from studies of patient samples and mouse models clearly indicates that deregulation of the Hippo signaling pathway plays a crucial role in the initiation and progression of many different types of human cancers. The Hippo signaling pathway is regulated by various stimuli, such as mechanical stress, G-protein coupled receptor signaling, and cellular energy status. When activated, the Hippo kinase cascade phosphorylates and inhibits the transcription co-activator YAP (Yes-associated protein), and its paralog TAZ (transcriptional coactivator with PDZ-binding motif), resulting in their cytoplasmic retention and degradation. When the Hippo signaling pathway is inactive, dephosphorylated YAP/TAZ translocate into the nucleus and activate gene transcription through binding to TEAD (TEA domain) family and other transcription factors. Such changes in gene expression promote cell proliferation and stem cell/progenitor cell self-renewal but inhibit apoptosis, thereby coordinately promote increase in organ size, tissue regeneration, and tumorigenesis. In this review, we summarize the molecular mechanisms of the mammalian Hippo signaling pathway with special emphasis on the Hippo kinase cascade and its upstream signals, the Hippo signaling pathway regulation of YAP and the mechanisms of YAP in regulation of gene transcription.

Changes in RNA polymerase II progression influence somatic hypermutation of Ig-related genes by AID

PubMed Central

Kodgire, Prashant; Mukkawar, Priyanka; Ratnam, Sarayu; Martin, Terence E.

2013-01-01

Somatic hypermutation (SHM) of Ig genes is initiated by the activation-induced cytidine deaminase (AID), and requires target gene transcription. We previously proposed that AID may associate with the RNA polymerase II (Pol). Here, to determine aspects of the transcription process required for SHM, we knocked-in a transcription terminator into an Ig gene variable region in DT40 chicken B cell line. We found that the human β-globin terminator was an efficient inhibitor of downstream transcription in these cells. The terminator reduced mutations downstream of the poly(A) signal, suggesting that the process of transcription is essential for efficient SHM and that AID has better access to its target when Pol is in the elongating rather than terminating mode. Mutations upstream of the poly(A) site were almost doubled in the active terminator clones compared with an inactivated terminator, and this region showed more single-stranded DNA, indicating that Pol pausing assists SHM. Moreover, the nontranscribed DNA strand was the preferred SHM target upstream of the active terminator. Pol pausing during poly(A) site recognition may facilitate persistence of negative supercoils, exposing the coding single strand and possibly allowing the nascent RNA intermittent reannealing with the template strand, for prolonged access of AID. PMID:23752228

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

Regulating Toxin-Antitoxin Expression: Controlled Detonation of Intracellular Molecular Timebombs

PubMed Central

Hayes, Finbarr; Kędzierska, Barbara

2014-01-01

Genes for toxin-antitoxin (TA) complexes are widely disseminated in bacteria, including in pathogenic and antibiotic resistant species. The toxins are liberated from association with the cognate antitoxins by certain physiological triggers to impair vital cellular functions. TAs also are implicated in antibiotic persistence, biofilm formation, and bacteriophage resistance. Among the ever increasing number of TA modules that have been identified, the most numerous are complexes in which both toxin and antitoxin are proteins. Transcriptional autoregulation of the operons encoding these complexes is key to ensuring balanced TA production and to prevent inadvertent toxin release. Control typically is exerted by binding of the antitoxin to regulatory sequences upstream of the operons. The toxin protein commonly works as a transcriptional corepressor that remodels and stabilizes the antitoxin. However, there are notable exceptions to this paradigm. Moreover, it is becoming clear that TA complexes often form one strand in an interconnected web of stress responses suggesting that their transcriptional regulation may prove to be more intricate than currently understood. Furthermore, interference with TA gene transcriptional autoregulation holds considerable promise as a novel antibacterial strategy: artificial release of the toxin factor using designer drugs is a potential approach to induce bacterial suicide from within. PMID:24434949

The nT1 translocation separates vulval regulatory elements from the egl-18 and elt-6 GATA factor genes.

PubMed

Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V

2004-03-01

egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.

Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

PubMed

Sakumi, K; Sekiguchi, M

1989-01-20

The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

Msn2p/Msn4p act as a key transcriptional activator of yeast cytoplasmic thiol peroxidase II.

PubMed

Hong, Seung-Keun; Cha, Mee-Kyung; Choi, Yong-Soo; Kim, Won-Cheol; Kim, Il-Han

2002-04-05

We observed that the transcription of Saccharomyces cerevisiae cytoplasmic thiol peroxidase type II (cTPx II) (YDR453C) is regulated in response to various stresses (e.g. oxidative stress, carbon starvation, and heat-shock). It has been suggested that both transcription-activating proteins, Yap1p and Skn7p, regulate the transcription of cTPx II upon exposure to oxidative stress. However, a dramatic loss of transcriptional response to various stresses in yeast mutant strains lacking both Msn2p and Msn4p suggests that the transcription factors act as a principal transcriptional activator. In addition to two Yap1p response elements (YREs), TTACTAA and TTAGTAA, the presence of two stress response elements (STREs) (CCCCT) in the upstream sequence of cTPx II also suggests that Msn2p/Msn4p could control stress-induced expression of cTPx II. Analysis of the transcriptional activity of site-directed mutagenesis of the putative STREs (STRE1 and STRE2) and YREs (TRE1 and YRE2) in terms of the activity of a lacZ reporter gene under control of the cTPx II promoter indicates that STRE2 acts as a principal binding element essential for transactivation of the cTPx II promoter. The transcriptional activity of the cTPx II promoter was exponentially increased after postdiauxic growth. The transcriptional activity of the cTPx II promoter is greatly increased by rapamycin. Deletion of Tor1, Tor2, Ras1, and Ras2 resulted in a considerable induction when compared with their parent strains, suggesting that the transcription of cTPx II is under negative control of the Ras/cAMP and target of rapamycin signaling pathways. Taken together, these results suggest that cTPx II is a target of Msn2p/Msn4p transcription factors under negative control of the Ras-protein kinase A and target of rapamycin signaling pathways. Furthermore, the accumulation of cTPx II upon exposure to oxidative stress and during the postdiauxic shift suggests an important antioxidant role in stationary phase yeast cells.

Sox2, Tlx, Gli3, and Her9 converge on Rx2 to define retinal stem cells in vivo

PubMed Central

Reinhardt, Robert; Centanin, Lázaro; Tavhelidse, Tinatini; Inoue, Daigo; Wittbrodt, Beate; Concordet, Jean-Paul; Martinez-Morales, Juan Ramón; Wittbrodt, Joachim

2015-01-01

Transcriptional networks defining stemness in adult neural stem cells (NSCs) are largely unknown. We used the proximal cis-regulatory element (pCRE) of the retina-specific homeobox gene 2 (rx2) to address such a network. Lineage analysis in the fish retina identified rx2 as marker for multipotent NSCs. rx2-positive cells located in the peripheral ciliary marginal zone behave as stem cells for the neuroretina, or the retinal pigmented epithelium. We identified upstream regulators of rx2 interrogating the rx2 pCRE in a trans-regulation screen and focused on four TFs (Sox2, Tlx, Gli3, and Her9) activating or repressing rx2 expression. We demonstrated direct interaction of the rx2 pCRE with the four factors in vitro and in vivo. By conditional mosaic gain- and loss-of-function analyses, we validated the activity of those factors on regulating rx2 transcription and consequently modulating neuroretinal and RPE stem cell features. This becomes obvious by the rx2-mutant phenotypes that together with the data presented above identify rx2 as a transcriptional hub balancing stemness of neuroretinal and RPE stem cells in the adult fish retina. PMID:25908840

Sox2, Tlx, Gli3, and Her9 converge on Rx2 to define retinal stem cells in vivo.

PubMed

Reinhardt, Robert; Centanin, Lázaro; Tavhelidse, Tinatini; Inoue, Daigo; Wittbrodt, Beate; Concordet, Jean-Paul; Martinez-Morales, Juan Ramón; Wittbrodt, Joachim

2015-06-03

Transcriptional networks defining stemness in adult neural stem cells (NSCs) are largely unknown. We used the proximal cis-regulatory element (pCRE) of the retina-specific homeobox gene 2 (rx2) to address such a network. Lineage analysis in the fish retina identified rx2 as marker for multipotent NSCs. rx2-positive cells located in the peripheral ciliary marginal zone behave as stem cells for the neuroretina, or the retinal pigmented epithelium. We identified upstream regulators of rx2 interrogating the rx2 pCRE in a trans-regulation screen and focused on four TFs (Sox2, Tlx, Gli3, and Her9) activating or repressing rx2 expression. We demonstrated direct interaction of the rx2 pCRE with the four factors in vitro and in vivo. By conditional mosaic gain- and loss-of-function analyses, we validated the activity of those factors on regulating rx2 transcription and consequently modulating neuroretinal and RPE stem cell features. This becomes obvious by the rx2-mutant phenotypes that together with the data presented above identify rx2 as a transcriptional hub balancing stemness of neuroretinal and RPE stem cells in the adult fish retina. © 2015 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

An interferon regulatory factor binding site in the U5 region of the bovine leukemia virus long terminal repeat stimulates Tax-independent gene expression.

PubMed

Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L

1998-07-01

Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

PubMed

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-04-08

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Negative and Translation Termination-Dependent Positive Control of FLI-1 Protein Synthesis by Conserved Overlapping 5′ Upstream Open Reading Frames in Fli-1 mRNA

PubMed Central

Sarrazin, Sandrine; Starck, Joëlle; Gonnet, Colette; Doubeikovski, Alexandre; Melet, Fabrice; Morle, François

2000-01-01

The proto-oncogene Fli-1 encodes a transcription factor of the ets family whose overexpression is associated with multiple virally induced leukemias in mouse, inhibits murine and avian erythroid cell differentiation, and induces drastic perturbations of early development in Xenopus. This study demonstrates the surprisingly sophisticated regulation of Fli-1 mRNA translation. We establish that two FLI-1 protein isoforms (of 51 and 48 kDa) detected by Western blotting in vivo are synthesized by alternative translation initiation through the use of two highly conserved in-frame initiation codons, AUG +1 and AUG +100. Furthermore, we show that the synthesis of these two FLI-1 isoforms is regulated by two short overlapping 5′ upstream open reading frames (uORF) beginning at two highly conserved upstream initiation codons, AUG −41 and GUG −37, and terminating at two highly conserved stop codons, UGA +35 and UAA +15. The mutational analysis of these two 5′ uORF revealed that each of them negatively regulates FLI-1 protein synthesis by precluding cap-dependent scanning to the 48- and 51-kDa AUG codons. Simultaneously, the translation termination of the two 5′ uORF appears to enhance 48-kDa protein synthesis, by allowing downstream reinitiation at the 48-kDa AUG codon, and 51-kDa protein synthesis, by allowing scanning ribosomes to pile up and consequently allowing upstream initiation at the 51-kDa AUG codon. To our knowledge, this is the first example of a cellular mRNA displaying overlapping 5′ uORF whose translation termination appears to be involved in the positive control of translation initiation at both downstream and upstream initiation codons. PMID:10757781

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

PubMed

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

AMPK activation represses the human gene promoter of the cardiac isoform of acetyl-CoA carboxylase: Role of nuclear respiratory factor-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adam, Tasneem; Opie, Lionel H.; Essop, M. Faadiel, E-mail: mfessop@sun.ac.za

Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transientlymore » transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.« less

Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae

PubMed Central

Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

2016-01-01

In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. PMID:27016735

Identification and characterisation of a previously unknown drought tolerance-associated microRNA in barley.

PubMed

Zhou, Hui; Hussain, Syed Sarfraz; Hackenberg, Michael; Bazanova, Natalia; Eini, Omid; Li, Jie; Gustafson, Perry; Shi, Bujun

2018-04-22

Drought is the most serious abiotic stress, which causes crop losses on worldwide scale. The present study identified a previously unknown microRNA (designated as hvu-miRX) of 21 nucleotides (nt) in barley. Its precursor (designated pre-miRX) and primary transcript (designated pri-miRX) were also identified, with lengths of 73 nt and 559 nt, respectively. The identified upstream sequence of pri-miRX contains both the TATA box and the CAAT box, which are both required for transcription initiation. Transient promoter activation assays showed that the core promoter region of pri-miRX ranged 500 nt from the transcription start site. In transgenic barley over-expressing the wheat DREB3 transcription factor (TaDREB3) caused hvu-miRX to be highly expressed as compared to the same miRNA in non-transgenic barley. However, the high expression was not directly associated with TaDREB3. Genomic analysis revealed that the hvu-miRX gene was a single copy located on the short arm of chromosome 2 and appeared to be only conserved in Triticeae, but not in other plant species. Notably, transgenic barley overexpressing hvu-miRX showed drought tolerance. Degradome library analysis and other tests showed that hvu-miRX targeted various genes including transcription factors via the cleavage mode. Our data open an excellent opportunity to develop drought stress tolerant cereals with hvu-miRX. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

An Effective Model of the Retinoic Acid Induced HL-60 Differentiation Program.

PubMed

Tasseff, Ryan; Jensen, Holly A; Congleton, Johanna; Dai, David; Rogers, Katharine V; Sagar, Adithya; Bunaciu, Rodica P; Yen, Andrew; Varner, Jeffrey D

2017-10-30

In this study, we present an effective model All-Trans Retinoic Acid (ATRA)-induced differentiation of HL-60 cells. The model describes reinforcing feedback between an ATRA-inducible signalsome complex involving many proteins including Vav1, a guanine nucleotide exchange factor, and the activation of the mitogen activated protein kinase (MAPK) cascade. We decomposed the effective model into three modules; a signal initiation module that sensed and transformed an ATRA signal into program activation signals; a signal integration module that controlled the expression of upstream transcription factors; and a phenotype module which encoded the expression of functional differentiation markers from the ATRA-inducible transcription factors. We identified an ensemble of effective model parameters using measurements taken from ATRA-induced HL-60 cells. Using these parameters, model analysis predicted that MAPK activation was bistable as a function of ATRA exposure. Conformational experiments supported ATRA-induced bistability. Additionally, the model captured intermediate and phenotypic gene expression data. Knockout analysis suggested Gfi-1 and PPARg were critical to the ATRAinduced differentiation program. These findings, combined with other literature evidence, suggested that reinforcing feedback is central to hyperactive signaling in a diversity of cell fate programs.

Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

PubMed

Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

2001-06-01

Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Expression of caveolin in trabecular meshwork cells and its possible implication in pathogenesis of primary open angle glaucoma

PubMed Central

Surgucheva, Irina

2011-01-01

Purpose Primary open-angle glaucoma (POAG), which is the most common form of glaucoma, has been associated with a heterogeneous genetic component. A genome-wide association study has identified a common sequence variant at 7q31 (rs4236601 [A]) near the caveolin genes in patients with POAG. Caveolins are a family of integral membrane proteins which participate in many cellular processes, including vesicular transport, cholesterol homeostasis, signal transduction, cell adhesion and migration. The goal of this study was to investigate the expression and regulation of caveolin 1 (CAV-1) and caveolin 2 (CAV-2) in normal and glaucoma trabecular meshwork (TM) cells. Methods CAV-1 and CAV-2 protein expression was quantified by immunoblot analysis using lysates isolated from primary and immortalized TM cells or TM tissue dissected from normal and POAG eyes. The localization of caveolins in TM cells was assessed by immunofluorescent microscopy. CAV-1 and CAV-2 protein expression was also investigated in TM cells at various time points after subjecting the cells to known glaucomatous insults like dexamethasone (DEX) and tumor growth factor beta2 (TGF-β2) treatment. Phosphorylation of CAV-1 at tyrosine 14 in normal and glaucoma TM cell lines was evaluated using a specific monoclonal antibody (Ab). The 5′ upstream region of the CAV-1 gene was amplified and the sequence variant rs4236601 (A/G polymorphic site) and several putative transcription factor-binding sites were modified by in vitro mutagenesis. The effect of nucleotide sequence modifications in the CAV-1 upstream region on gene expression was assayed in a luciferase-based system in TM and non-TM cells. Results CAV-1 and CAV-2 are expressed in TM cells, with localization to the cytoplasm and perinuclear region. DEX increased CAV-1 expression in immortalized glaucoma TM cells by 2.8±0.1 (n=3) fold at 24 h and 2.5±0.1 (n=3) fold at 48 h, compared to 1.3±0.06 (n=3) fold at 24 and 48 h in immortalized normal TM cells. Phosphorylation of CAV-1 at Tyr14 was reduced by 3.2±0.15 (n=3) fold in glaucomatous TM cells when compared to normal TM cells. In POAG and normal TM tissue, CAV-1 expression was found to be uniform. CAV-2, on the other hand, was variable in independent normal and glaucoma TM tissue. Substitution of a G for an A at base pair −2,388 upstream of the start codon of CAV-1, corresponding to the minor allele rs4236601 [A], increased transcriptional activity in TM and non-TM cells when compared to the native sequence. Deletion analysis of putative transcription factor binding sites in the CAV-1 promoter region caused cell-specific effects on gene expression. Conclusions CAV-1 and CAV-2 are expressed in normal and glaucoma tissue and TM cell lines. Phosphorylation of Tyr14 in CAV-1 and transcriptional regulation of CAV-1 expression may have a role in glaucomatous alterations in TM cells. PMID:22128235

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

PubMed

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR

PubMed Central

2013-01-01

Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071

Differential roles of transcriptional mediator subunits in regulation of multidrug resistance gene expression in Saccharomyces cerevisiae.

PubMed

Shahi, Puja; Gulshan, Kailash; Näär, Anders M; Moye-Rowley, W Scott

2010-07-15

The multiprotein transcriptional Mediator complex provides a key link between RNA polymerase II and upstream transcriptional activator proteins. Previous work has established that the multidrug resistance transcription factors Pdr1 and Pdr3 interact with the Mediator component Med15/Gal11 to drive normal levels of expression of the ATP-binding cassette transporter-encoding gene PDR5 in Saccharomyces cerevisiae. PDR5 transcription is induced upon loss of the mitochondrial genome (rho(0) cells) and here we provide evidence that this rho(0) induction is Med15 independent. A search through other known Mediator components determined that Med12/Srb8, a member of the CDK8 Mediator submodule, is required for rho(0) activation of PDR5 transcription. The CDK8 submodule contains the cyclin C homologue (CycC/Srb11), cyclin-dependent kinase Cdk8/Srb10, and the large Med13/Srb9 protein. Loss of these other proteins did not lead to the same block in PDR5 induction. Chromatin immunoprecipitation analyses demonstrated that Med15 is associated with the PDR5 promoter in both rho(+) and rho(0), whereas Med12 recruitment to this target promoter is highly responsive to loss of the mitochondrial genome. Coimmunoprecipitation experiments revealed that association of Pdr3 with Med12 can only be detected in rho(0) cells. These experiments uncover the unique importance of Med12 in activated transcription of PDR5 seen in rho(0) cells.

Src is a major signaling component for CTGF induction by TGF-β1 in osteoblasts

PubMed Central

X, Zhang; JA, Arnott; S, Rehman; WG, DeLong; A, Sanjay; FF, Safadi; SN, Popoff

2010-01-01

Connective tissue growth factor (CTGF/CCN2) is induced by transforming growth factor beta 1(TGF-β1) where it acts as a downstream mediator of TGF-β1 induced matrix production in osteoblasts. We have shown the requirement of Src, Erk and Smad signaling for CTGF induction by TGF-β1 in osteoblasts, however the potential interaction among these signaling pathways remains undetermined. In this study we demonstrate that TGF-β1 activates Src kinase in ROS17/2.8 cells and that treatment with the Src family kinase inhibitor PP2 prevents Src activation and CTGF induction by TGF-β1. Additionally, inhibiting Src activation prevented Erk activation, Smad 2 & 3 activation and nuclear translocation by TGF-β1, demonstrating that Src is an essential upstream signaling partner of both Erk and Smads in osteoblasts. MAPKs such as Erk can modulate the Smad pathway through directly mediating the phosphorylation of Smads or indirectly through activation/inactivation of required nuclear co-activators that mediate Smad DNA binding. When we treated cells with the Erk inhibitor, PD98059 it inhibited TGF-β1-induced CTGF protein expression but had no effect on Src activation, Smad activation or Smad nuclear translocation. However PD98059 impaired transcriptional complex formation on the Smad binding element (SBE) on the CTGF promoter, demonstrating that Erk activation was required for SBE transactivation. This data demonstrates that Src is an essential upstream signaling transducer of Erk and Smad signaling with respect to TGF-β1 in osteoblasts and that Smads and Erk function independently but are both essential for forming a transcriptionally active complex on the CTGF promoter in osteoblasts. PMID:20432467

Chicken ovalbumin upstream promoter-transcription factor II regulates nuclear receptor, myogenic, and metabolic gene expression in skeletal muscle cells.

PubMed

Crowther, Lisa M; Wang, Shu-Ching Mary; Eriksson, Natalie A; Myers, Stephen A; Murray, Lauren A; Muscat, George E O

2011-02-24

We demonstrate that chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) mRNA is more abundantly expressed (than COUP-TFI mRNA) in skeletal muscle C2C12 cells and in (type I and II) skeletal muscle tissue from C57BL/10 mice. Consequently, we have utilized the ABI TaqMan Low Density Array (TLDA) platform to analyze gene expression changes specifically attributable to ectopic COUP-TFII (relative to vector only) expression in muscle cells. Utilizing a TLDA-based platform and 5 internal controls, we analyze the entire NR superfamily, 96 critical metabolic genes, and 48 important myogenic regulatory genes on the TLDA platform utilizing 5 internal controls. The low density arrays were analyzed by rigorous statistical analysis (with Genorm normalization, Bioconductor R, and the Empirical Bayes statistic) using the (integromics) statminer software. In addition, we validated the differentially expressed patho-physiologically relevant gene (identified on the TLDA platform) glucose transporter type 4 (Glut4). We demonstrated that COUP-TFII expression increased the steady state levels of Glut4 mRNA and protein, while ectopic expression of truncated COUP-TFII lacking helix 12 (COUP-TFΔH12) reduced Glut4 mRNA expression in C2C12 cells. Moreover, COUP-TFII expression trans-activated the Glut4 promoter (-997/+3), and ChIP analysis identified selective recruitment of COUP-TFII to a region encompassing a highly conserved SP1 binding site (in mouse, rat, and human) at nt positions -131/-118. Mutation of the SpI site ablated COUP-TFII mediated trans-activation of the Glut4 promoter. In conclusion, this study demonstrates that in skeletal muscle cells, COUP-TFII regulates several nuclear hormone receptors, and critical metabolic and muscle specific genes.

A novel long non-coding RNA, hypoxia-inducible factor-2α promoter upstream transcript, functions as an inhibitor of osteosarcoma stem cells in vitro.

PubMed

Wang, Yongcheng; Yao, Jie; Meng, Haoye; Yu, Zhiguo; Wang, Zhigang; Yuan, Xueling; Chen, Hong; Wang, Aiyuan

2015-04-01

Long non‑coding RNAs (lncRNAs) have recently been identified as novel modulators of malignant tumors. However, the function of lncRNAs in cancer stem cells (CSCs) remains to be elucidated. The present study aimed to investigate the regulating role of a novel lncRNA, hypoxia‑inducible factor‑2α (HIF‑2α) promoter upstream transcript (HIF2PUT), in osteosarcoma stem cells. The expression levels of HIF2PUT were assessed by quantitative polymerase chain reaction in 17 osteosarcoma tissue specimens, and the correlation between the expression of HIF2PUT and its host transcript‑HIF‑2α was determined. In functional experiments, HIF2PUT expression was knocked down by small interfering RNAs, or overexpressed by transfection with pcDNA‑HIF2PUT, in order to evaluate the effects of HIF2PUT on cell proliferation, migration, expression rate of osteosarcoma stem cell marker CD133, and stem sphere‑forming ability in MG63 cells. HIF2PUT expression levels were positively correlated with HIF‑2α in osteosarcoma tissues. Overexpression of HIF2PUT markedly inhibited cell proliferation and migration, decreased the percentage of CD133 expressing cells, and impaired the osteosarcoma stem sphere‑forming ability of the MG63 cells. Whereas, knockdown of HIF2PUT expression had the opposite effect. Furthermore, altering the expression of HIF2PUT resulted in a concomitant change to HIF‑2α mRNA expression. These results indicate that the lncRNA HIF2PUT may be a novel regulatory factor of osteosarcoma stem cells, which may exert its function partly by controlling HIF‑2α expression. Further studies regarding HIF2PUT may provide a novel therapeutic target of osteosarcoma in the future.

The role of chicken ovalbumin upstream promoter transcription factor II in the regulation of hepatic fatty acid oxidation and gluconeogenesis in newborn mice.

PubMed

Planchais, Julien; Boutant, Marie; Fauveau, Véronique; Qing, Lou Dan; Sabra-Makke, Lina; Bossard, Pascale; Vasseur-Cognet, Mireille; Pégorier, Jean-Paul

2015-05-15

Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) is an orphan nuclear receptor involved in the control of numerous functions in various organs (organogenesis, differentiation, metabolic homeostasis, etc.). The aim of the present work was to characterize the regulation and contribution of COUP-TFII in the control of hepatic fatty acid and glucose metabolisms in newborn mice. Our data show that postnatal increase in COUP-TFII mRNA levels is enhanced by glucagon (via cAMP) and PPARα. To characterize COUP-TFII function in the liver of suckling mice, we used a functional (dominant negative form; COUP-TFII-DN) and a genetic (shRNA) approach. Adenoviral COUP-TFII-DN injection induces a profound hypoglycemia due to the inhibition of gluconeogenesis and fatty acid oxidation secondarily to reduced PEPCK, Gl-6-Pase, CPT I, and mHMG-CoA synthase gene expression. Using the crossover plot technique, we show that gluconeogenesis is inhibited at two different levels: 1) pyruvate carboxylation and 2) trioses phosphate synthesis. This could result from a decreased availability in fatty acid oxidation arising cofactors such as acetyl-CoA and reduced equivalents. Similar results are observed using the shRNA approach. Indeed, when fatty acid oxidation is rescued in response to Wy-14643-induced PPARα target genes (CPT I and mHMG-CoA synthase), blood glucose is normalized in COUP-TFII-DN mice. In conclusion, this work demonstrates that postnatal increase in hepatic COUP-TFII gene expression is involved in the regulation of liver fatty acid oxidation, which in turn sustains an active hepatic gluconeogenesis that is essential to maintain an appropriate blood glucose level required for newborn mice survival. Copyright © 2015 the American Physiological Society.

Perineural Dexmedetomidine Attenuates Inflammation in Rat Sciatic Nerve via the NF-κB Pathway

PubMed Central

Huang, Yan; Lu, Yi; Zhang, Lei; Yan, Jia; Jiang, Jue; Jiang, Hong

2014-01-01

Recent studies have shown that dexmedetomidine exerts an anti-inflammatory effect by reducing serum levels of inflammatory factors, however, the up-stream mechanism is still unknown. The transcription factor NF-κB enters the nucleus and promotes the transcription of its target genes, including those encoding the pro-inflammatory cytokines IL-6 and TNF-α. In this study, we established a rat model that simulates a clinical surgical procedure to investigate the anti-inflammatory effect of perineural administration of dexmedetomidine and the underlying mechanism. Dexmedetomidine reduced the sciatic nerve levels of IL-6 and TNF-α at both the mRNA and protein level. Dexmedetomidine also inhibited the translocation of activated NF-κB to the nucleus and the binding activity of NF-κB. The anti-inflammatory effect is confirmed to be dose-dependent. Finally, pyrrolidine dithiocarbamate also reduced the levels of IL-6 and TNF-α and the activation of NF-κB. In conclusion, dexmedetomidine inhibited the nuclear translocation and binding activity of activated NF-κB, thus reducing inflammatory cytokines. PMID:24663080

Essential roles for Cdx in murine primitive hematopoiesis.

PubMed

Brooke-Bisschop, Travis; Savory, Joanne G A; Foley, Tanya; Ringuette, Randy; Lohnes, David

2017-02-15

The Cdx transcription factors play essential roles in primitive hematopoiesis in the zebrafish where they exert their effects, in part, through regulation of hox genes. Defects in hematopoiesis have also been reported in Cdx mutant murine embryonic stem cell models, however, to date no mouse model reflecting the zebrafish Cdx mutant hematopoietic phenotype has been described. This is likely due, in part, to functional redundancy among Cdx members and the early lethality of Cdx2 null mutants. To circumvent these limitations, we used Cre-mediated conditional deletion to assess the impact of concomitant loss of Cdx1 and Cdx2 on murine primitive hematopoiesis. We found that Cdx1/Cdx2 double mutants exhibited defects in primitive hematopoiesis and yolk sac vasculature concomitant with reduced expression of several genes encoding hematopoietic transcription factors including Scl/Tal1. Chromatin immunoprecipitation analysis revealed that Scl was occupied by Cdx2 in vivo, and Cdx mutant hematopoietic yolk sac differentiation defects could be rescued by expression of exogenous Scl. These findings demonstrate critical roles for Cdx members in murine primitive hematopoiesis upstream of Scl. Copyright © 2017 Elsevier Inc. All rights reserved.

A multifaceted role for MOF histone modifying factor in genome maintenance.

PubMed

Mujoo, Kalpana; Hunt, Clayton R; Horikoshi, Nobuo; Pandita, Tej K

2017-01-01

MOF (males absent on the first) was initially identified as a dosage compensation factor in Drosophila that acetylates lysine 16 of histone H4 (H4K16ac) and increased gene transcription from the single copy male X-chromosome. In humans, however, the ortholog of Drosophila MOF has been shown to interact with a range of proteins that extend its potential significance well beyond transcription. For example, recent results indicate MOF is an upstream regulator of the ATM (ataxia-telangiectasia mutated) protein, the loss of which is responsible for ataxia telangiectasia (AT). ATM is a key regulatory kinase that interacts with and phosphorylates multiple substrates that influence critical, cell-cycle control and DNA damage repair pathways in addition to other pathways. Thus, directly or indirectly, MOF may be involved in a wide range of cellular functions. This review will focus on the contribution of MOF to cellular DNA repair and new results that are beginning to examine the in vivo physiological role of MOF. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Negative regulation of ABA signaling by WRKY33 is critical for Arabidopsis immunity towards Botrytis cinerea 2100

PubMed Central

Liu, Shouan; Kracher, Barbara; Ziegler, Jörg; Birkenbihl, Rainer P; Somssich, Imre E

2015-01-01

The Arabidopsis mutant wrky33 is highly susceptible to Botrytis cinerea. We identified >1680 Botrytis-induced WRKY33 binding sites associated with 1576 Arabidopsis genes. Transcriptional profiling defined 318 functional direct target genes at 14 hr post inoculation. Comparative analyses revealed that WRKY33 possesses dual functionality acting either as a repressor or as an activator in a promoter-context dependent manner. We confirmed known WRKY33 targets involved in hormone signaling and phytoalexin biosynthesis, but also uncovered a novel negative role of abscisic acid (ABA) in resistance towards B. cinerea 2100. The ABA biosynthesis genes NCED3 and NCED5 were identified as direct targets required for WRKY33-mediated resistance. Loss-of-WRKY33 function resulted in elevated ABA levels and genetic studies confirmed that WRKY33 acts upstream of NCED3/NCED5 to negatively regulate ABA biosynthesis. This study provides the first detailed view of the genome-wide contribution of a specific plant transcription factor in modulating the transcriptional network associated with plant immunity. DOI: http://dx.doi.org/10.7554/eLife.07295.001 PMID:26076231

Spatiotemporal behavior of nuclear cyclophilin B indicates a role in RNA transcription.

PubMed

Dieriks, Birger; Van Oostveldt, Patrick

2012-06-01

Cyclophilin B (CypB) is an ubiquitously expressed protein, which performs several intra- and extracellular functions. Despite its abundant use as a household protein, little is known about its exact cellular localization and dynamics. In the present study we show that endogenous CypB localizes in one of two distinct compartments, either within the endoplasmic reticulum (ER) or inside the nucleus, accumulating in the fibrillar centers of the nucleoli. By means of a genetic deletion screen, we identified a minimal nucleolar localization signal for efficient relocation to the nucleoli. Within the fibrillar centers, CypB colocalized with RNA polymerase, upstream binding factor-1 (UBF), fibrillarin and dyskerin (DCK1). Even after chemical disruption of the nucleoli, a strong interaction with these proteins remained. Using live cell imaging, we showed a persistent colocalization of CypB with proteins involved in the ribosome biogenesis during the transcriptionally more active phases of the cell cycle. Supported by in silico data, our observations suggest that CypB interacts with these proteins and is involved in ribosome biogenesis and RNA transcription.

Copy number variation of two separate regulatory regions upstream of SOX9 causes isolated 46,XY or 46,XX disorder of sex development.

PubMed

Kim, Gwang-Jin; Sock, Elisabeth; Buchberger, Astrid; Just, Walter; Denzer, Friederike; Hoepffner, Wolfgang; German, James; Cole, Trevor; Mann, Jillian; Seguin, John H; Zipf, William; Costigan, Colm; Schmiady, Hardi; Rostásy, Moritz; Kramer, Mildred; Kaltenbach, Simon; Rösler, Bernd; Georg, Ina; Troppmann, Elke; Teichmann, Anne-Christin; Salfelder, Anika; Widholz, Sebastian A; Wieacker, Peter; Hiort, Olaf; Camerino, Giovanna; Radi, Orietta; Wegner, Michael; Arnold, Hans-Henning; Scherer, Gerd

2015-04-01

SOX9 mutations cause the skeletal malformation syndrome campomelic dysplasia in combination with XY sex reversal. Studies in mice indicate that SOX9 acts as a testis-inducing transcription factor downstream of SRY, triggering Sertoli cell and testis differentiation. An SRY-dependent testis-specific enhancer for Sox9 has been identified only in mice. A previous study has implicated copy number variations (CNVs) of a 78 kb region 517-595 kb upstream of SOX9 in the aetiology of both 46,XY and 46,XX disorders of sex development (DSD). We wanted to better define this region for both disorders. By CNV analysis, we identified SOX9 upstream duplications in three cases of SRY-negative 46,XX DSD, which together with previously reported duplications define a 68 kb region, 516-584 kb upstream of SOX9, designated XXSR (XX sex reversal region). More importantly, we identified heterozygous deletions in four families with SRY-positive 46,XY DSD without skeletal phenotype, which define a 32.5 kb interval 607.1-639.6 kb upstream of SOX9, designated XY sex reversal region (XYSR). To localise the suspected testis-specific enhancer, XYSR subfragments were tested in cell transfection and transgenic experiments. While transgenic experiments remained inconclusive, a 1.9 kb SRY-responsive subfragment drove expression specifically in Sertoli-like cells. Our results indicate that isolated 46,XY and 46,XX DSD can be assigned to two separate regulatory regions, XYSR and XXSR, far upstream of SOX9. The 1.9 kb SRY-responsive subfragment from the XYSR might constitute the core of the Sertoli-cell enhancer of human SOX9, representing the so far missing link in the genetic cascade of male sex determination. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Transcriptional control of Sost in bone [Transcriptional control of Sclerostin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sebastian, Aimy; Loots, Gabriela G.

Sclerostin is an osteocyte derived negative regulator of bone formation. A highly specific expression pattern and the exclusive bone phenotype have made Sclerostin an attractive target for therapeutic intervention in treating metabolic bone diseases such as osteoporosis and in facilitating fracture repair. Understanding the molecular mechanisms that regulate Sclerostin transcription is of great interest as it may unveil new avenues for therapeutic approaches. Such studies may also elucidate how various signaling pathways intersect to modulate bone metabolism. Furthermore we review the current understanding of the upstream molecular mechanisms that regulate Sost/SOST transcription, in bone.

Transcriptional control of Sost in bone [Transcriptional control of Sclerostin

DOE PAGES

Sebastian, Aimy; Loots, Gabriela G.

2016-10-19

Sclerostin is an osteocyte derived negative regulator of bone formation. A highly specific expression pattern and the exclusive bone phenotype have made Sclerostin an attractive target for therapeutic intervention in treating metabolic bone diseases such as osteoporosis and in facilitating fracture repair. Understanding the molecular mechanisms that regulate Sclerostin transcription is of great interest as it may unveil new avenues for therapeutic approaches. Such studies may also elucidate how various signaling pathways intersect to modulate bone metabolism. Furthermore we review the current understanding of the upstream molecular mechanisms that regulate Sost/SOST transcription, in bone.

NF-κB Activation in Hypothalamic Pro-opiomelanocortin Neurons Is Essential in Illness- and Leptin-induced Anorexia*

PubMed Central

Jang, Pil-Geum; Namkoong, Cherl; Kang, Gil Myoung; Hur, Man-Wook; Kim, Seung-Whan; Kim, Geun Hyang; Kang, Yeoungsup; Jeon, Min-Jae; Kim, Eun Hee; Lee, Myung-Shik; Karin, Michael; Baik, Ja-Hyun; Park, Joong-Yeol; Lee, Ki-Up; Kim, Young-Bum; Kim, Min-Seon

2010-01-01

Anorexia and weight loss are prevalent in infectious diseases. To investigate the molecular mechanisms underlying these phenomena, we established animal models of infection-associated anorexia by administrating bacterial and viral products, lipopolysaccharide (LPS) and human immunodeficiency virus-1 transactivator protein (Tat). In these models, we found that the nuclear factor-κB (NF-κB), a pivotal transcription factor for inflammation-related proteins, was activated in the hypothalamus. In parallel, administration of LPS and Tat increased hypothalamic pro-inflammatory cytokine production, which was abrogated by inhibition of hypothalamic NF-κB. In vitro, NF-κB activation directly stimulated the transcriptional activity of pro-opiomelanocortin (POMC), a precursor of anorexigenic melanocortin, and mediated the stimulatory effects of LPS, Tat, and pro-inflammatory cytokines on POMC transcription, implying the involvement of NF-κB in controlling feeding behavior. Consistently, hypothalamic injection of LPS and Tat caused a significant reduction in food intake and body weight, which was prevented by blockade of NF-κB and melanocortin. Furthermore, disruption of IκB kinase-β, an upstream kinase of NF-κB, in POMC neurons attenuated LPS- and Tat-induced anorexia. These findings suggest that infection-associated anorexia and weight loss are mediated via NF-κB activation in hypothalamic POMC neurons. In addition, hypothalamic NF-κB was activated by leptin, an important anorexigenic hormone, and mediates leptin-stimulated POMC transcription, indicating that hypothalamic NF-κB also serves as a downstream signaling pathway of leptin. PMID:20097762

NF-kappaB activation in hypothalamic pro-opiomelanocortin neurons is essential in illness- and leptin-induced anorexia.

PubMed

Jang, Pil-Geum; Namkoong, Cherl; Kang, Gil Myoung; Hur, Man-Wook; Kim, Seung-Whan; Kim, Geun Hyang; Kang, Yeoungsup; Jeon, Min-Jae; Kim, Eun Hee; Lee, Myung-Shik; Karin, Michael; Baik, Ja-Hyun; Park, Joong-Yeol; Lee, Ki-Up; Kim, Young-Bum; Kim, Min-Seon

2010-03-26

Anorexia and weight loss are prevalent in infectious diseases. To investigate the molecular mechanisms underlying these phenomena, we established animal models of infection-associated anorexia by administrating bacterial and viral products, lipopolysaccharide (LPS) and human immunodeficiency virus-1 transactivator protein (Tat). In these models, we found that the nuclear factor-kappaB (NF-kappaB), a pivotal transcription factor for inflammation-related proteins, was activated in the hypothalamus. In parallel, administration of LPS and Tat increased hypothalamic pro-inflammatory cytokine production, which was abrogated by inhibition of hypothalamic NF-kappaB. In vitro, NF-kappaB activation directly stimulated the transcriptional activity of pro-opiomelanocortin (POMC), a precursor of anorexigenic melanocortin, and mediated the stimulatory effects of LPS, Tat, and pro-inflammatory cytokines on POMC transcription, implying the involvement of NF-kappaB in controlling feeding behavior. Consistently, hypothalamic injection of LPS and Tat caused a significant reduction in food intake and body weight, which was prevented by blockade of NF-kappaB and melanocortin. Furthermore, disruption of I kappaB kinase-beta, an upstream kinase of NF-kappaB, in POMC neurons attenuated LPS- and Tat-induced anorexia. These findings suggest that infection-associated anorexia and weight loss are mediated via NF-kappaB activation in hypothalamic POMC neurons. In addition, hypothalamic NF-kappaB was activated by leptin, an important anorexigenic hormone, and mediates leptin-stimulated POMC transcription, indicating that hypothalamic NF-kappaB also serves as a downstream signaling pathway of leptin.

Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.

PubMed

Shows, Kathryn H; Shiang, Rita

2008-11-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

The Transcription Factors TBX2 and TBX3 Interact with Human Papillomavirus 16 (HPV16) L2 and Repress the Long Control Region of HPVs

PubMed Central

Schneider, Marc A.; Scheffer, Konstanze D.; Bund, Timo; Boukhallouk, Fatima; Lambert, Carsten; Cotarelo, Cristina; Pflugfelder, Gert O.

2013-01-01

The minor capsid protein L2 of human papillomaviruses (HPVs) has multiple functions during the viral life cycle. Although L2 is required for effective invasion and morphogenesis, only a few cellular interaction partners are known so far. Using yeast two-hybrid screening, we identified the transcription factor TBX2 as a novel interaction partner of HPV type 16 (HPV16) L2. Coimmunoprecipitations and immunofluorescence analyses confirmed the L2-TBX2 interaction and revealed that L2 also interacts with TBX3, another member of the T-box family. Transcription of the early genes during HPV infection is under the control of an upstream enhancer and early promoter region, the long control region (LCR). In promoter-reporter gene assays, we observed that TBX2 and TBX3 repress transcription from the LCR and that this effect is enhanced by L2. Repression of the HPV LCR by TBX2/3 seems to be a conserved mechanism, as it was also observed with the LCRs of different HPV types. Finally, interaction of TBX2 with the LCR was detected by chromatin immunoprecipitation, and we found a strong colocalization of L2 and TBX2 in HPV16-positive cervical intraepithelial neoplasia (CIN) I-II tissue sections. These results suggest that TBX2/3 might play a role in the regulation of HPV gene expression during the viral life cycle. PMID:23388722

CIKS, a connection to Ikappa B kinase and stress-activated protein kinase.

PubMed

Leonardi, A; Chariot, A; Claudio, E; Cunningham, K; Siebenlist, U

2000-09-12

Pathogens, inflammatory signals, and stress cause acute transcriptional responses in cells. The induced expression of genes in response to these signals invariably involves transcription factors of the NF-kappaB and AP-1/ATF families. Activation of NF-kappaB factors is thought to be mediated primarily via IkappaB kinases (IKK), whereas that of AP-1/ATF can be mediated by stress-activated protein kinases (SAPKs; also named Jun kinases or JNKs). IKKalpha and IKKbeta are two catalytic subunits of a core IKK complex that also contains the regulatory subunit NEMO (NF-kappaB essential modulator)/IKKgamma. The latter protein is essential for activation of the IKKs, but its mechanism of action is not known. Here we describe the molecular cloning of CIKS (connection to IKK and SAPK/JNK), a previously unknown protein that directly interacts with NEMO/IKKgamma in cells. When ectopically expressed, CIKS stimulates IKK and SAPK/JNK kinases and it transactivates an NF-kappaB-dependent reporter. Activation of NF-kappaB is prevented in the presence of kinase-deficient, interfering mutants of the IKKs. CIKS may help to connect upstream signaling events to IKK and SAPK/JNK modules. CIKS could coordinate the activation of two stress-induced signaling pathways, functions reminiscent of those noted for tumor necrosis factor receptor-associated factor adaptor proteins.

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Engineering transcription factors to improve tolerance against alkane biofuels in Saccharomyces cerevisiae.

PubMed

Ling, Hua; Pratomo Juwono, Nina Kurniasih; Teo, Wei Suong; Liu, Ruirui; Leong, Susanna Su Jan; Chang, Matthew Wook

2015-01-01

Biologically produced alkanes can be used as 'drop in' to existing transportation infrastructure as alkanes are important components of gasoline and jet fuels. Despite the reported microbial production of alkanes, the toxicity of alkanes to microbial hosts could pose a bottleneck for high productivity. In this study, we aimed to improve the tolerance of Saccharomyces cerevisiae, a model eukaryotic host of industrial significance, to alkane biofuels. To increase alkane tolerance in S. cerevisiae, we sought to exploit the pleiotropic drug resistance (Pdr) transcription factors Pdr1p and Pdr3p, which are master regulators of genes with pleiotropic drug resistance elements (PDREs)-containing upstream sequences. Wild-type and site-mutated Pdr1p and Pdr3p were expressed in S. cerevisiae BY4741 pdr1Δ pdr3Δ (BYL13). The point mutations of PDR1 (F815S) and PDR3 (Y276H) in BYL13 resulted in the highest tolerance to C10 alkane, and the expression of wild-type PDR3 in BYL13 led to the highest tolerance to C11 alkane. To identify and verify the correlation between the Pdr transcription factors and tolerance improvement, we analyzed the expression patterns of genes regulated by the Pdr transcription factors in the most tolerant strains against C10 and C11 alkanes. Quantitative PCR results showed that the Pdr transcription factors differentially regulated genes associated with multi-drug resistance, stress responses, and membrane modifications, suggesting different extents of intracellular alkane levels, reactive oxygen species (ROS) production and membrane integrity. We further showed that (i) the expression of Pdr1mt1 + Pdr3mt reduced intracellular C10 alkane by 67 % and ROS by 53 %, and significantly alleviated membrane damage; and (ii) the expression of the Pdr3wt reduced intracellular C11 alkane by 72 % and ROS by 21 %. Alkane transport assays also revealed that the reduction of alkane accumulation was due to higher export (C10 and C11 alkanes) and lower import (C11 alkane). We improved yeast's tolerance to alkane biofuels by modulating the expression of the wild-type and site-mutated Pdr1p and Pdr3p, and extensively identified the correlation between Pdr transcription factors and tolerance improvement by analyzing gene patterns, alkane transport, ROS, and membrane integrity. These findings provide valuable insights into manipulating transcription factors in yeast for improved alkane tolerance and productivity.

Expression of the Wilms' tumor gene WT1 in the murine urogenital system.

PubMed

Pelletier, J; Schalling, M; Buckler, A J; Rogers, A; Haber, D A; Housman, D

1991-08-01

The Wilms' tumor gene WT1 is a recessive oncogene that encodes a putative transcription factor implicated in nephrogenesis during kidney development. In this report we analyze expression of WT1 in the murine urogenital system. WT1 is expressed in non-germ-cell components of the testis and ovaries in both young and adult mice. In situ mRNA hybridization studies demonstrate that WT1 is expressed in the granulosa and epithelial cells of ovaries, the Sertoli cells of the testis, and in the uterine wall. In addition to the 3.1-kb WT1 transcript detected by Northern blotting of RNA from kidney, uterus, and gonads, there is an approximately 2.5-kb WT1-related mRNA species in testis. The levels of WT1 mRNA in the gonads are among the highest observed, surpassing amounts detected in the embryonic kidney. During development, these levels are differentially regulated, depending on the sexual differentiation of the gonad. Expression of WT1 mRNA in the female reproductive system does not fluctuate significantly from days 4 to 40 postpartum. In contrast, WT1 mRNA levels in the tesis increase steadily after birth, reaching their highest expression levels at day 8 postpartum and decreasing slightly as the animal matures. Expression of WT1 in the gonads is detectable as early as 12.5 days postcoitum (p.c.). As an initial step toward exploring the tissue-specific expression of WT1, DNA elements upstream of WT1 were cloned and sequenced. Three putative transcription initiation sites, utilized in testis, ovaries, and uterus, were mapped by S1 nuclease protection assays. The sequences surrounding these sites have a high G + C content, and typical upstream CCAAT and TATAA boxes are not present. These studies allowed us to identify the translation initiation site for WT1 protein synthesis. We have also used an epitope-tagging protocol to demonstrate that WT1 is a nuclear protein, consistent with its role as a transcription factor. Our results demonstrate regulation of WT1 expression during development of the gonads, implicate WT1 in genitourinary development, and provide a molecular framework toward understanding genitourinary defects observed among hereditary cases of Wilms' tumor.

SignaLink 2 – a signaling pathway resource with multi-layered regulatory networks

PubMed Central

2013-01-01

Background Signaling networks in eukaryotes are made up of upstream and downstream subnetworks. The upstream subnetwork contains the intertwined network of signaling pathways, while the downstream regulatory part contains transcription factors and their binding sites on the DNA as well as microRNAs and their mRNA targets. Currently, most signaling and regulatory databases contain only a subsection of this network, making comprehensive analyses highly time-consuming and dependent on specific data handling expertise. The need for detailed mapping of signaling systems is also supported by the fact that several drug development failures were caused by undiscovered cross-talk or regulatory effects of drug targets. We previously created a uniformly curated signaling pathway resource, SignaLink, to facilitate the analysis of pathway cross-talks. Here, we present SignaLink 2, which significantly extends the coverage and applications of its predecessor. Description We developed a novel concept to integrate and utilize different subsections (i.e., layers) of the signaling network. The multi-layered (onion-like) database structure is made up of signaling pathways, their pathway regulators (e.g., scaffold and endocytotic proteins) and modifier enzymes (e.g., phosphatases, ubiquitin ligases), as well as transcriptional and post-transcriptional regulators of all of these components. The user-friendly website allows the interactive exploration of how each signaling protein is regulated. The customizable download page enables the analysis of any user-specified part of the signaling network. Compared to other signaling resources, distinctive features of SignaLink 2 are the following: 1) it involves experimental data not only from humans but from two invertebrate model organisms, C. elegans and D. melanogaster; 2) combines manual curation with large-scale datasets; 3) provides confidence scores for each interaction; 4) operates a customizable download page with multiple file formats (e.g., BioPAX, Cytoscape, SBML). Non-profit users can access SignaLink 2 free of charge at http://SignaLink.org. Conclusions With SignaLink 2 as a single resource, users can effectively analyze signaling pathways, scaffold proteins, modifier enzymes, transcription factors and miRNAs that are important in the regulation of signaling processes. This integrated resource allows the systems-level examination of how cross-talks and signaling flow are regulated, as well as provide data for cross-species comparisons and drug discovery analyses. PMID:23331499

SignaLink 2 - a signaling pathway resource with multi-layered regulatory networks.

PubMed

Fazekas, Dávid; Koltai, Mihály; Türei, Dénes; Módos, Dezső; Pálfy, Máté; Dúl, Zoltán; Zsákai, Lilian; Szalay-Bekő, Máté; Lenti, Katalin; Farkas, Illés J; Vellai, Tibor; Csermely, Péter; Korcsmáros, Tamás

2013-01-18

Signaling networks in eukaryotes are made up of upstream and downstream subnetworks. The upstream subnetwork contains the intertwined network of signaling pathways, while the downstream regulatory part contains transcription factors and their binding sites on the DNA as well as microRNAs and their mRNA targets. Currently, most signaling and regulatory databases contain only a subsection of this network, making comprehensive analyses highly time-consuming and dependent on specific data handling expertise. The need for detailed mapping of signaling systems is also supported by the fact that several drug development failures were caused by undiscovered cross-talk or regulatory effects of drug targets. We previously created a uniformly curated signaling pathway resource, SignaLink, to facilitate the analysis of pathway cross-talks. Here, we present SignaLink 2, which significantly extends the coverage and applications of its predecessor. We developed a novel concept to integrate and utilize different subsections (i.e., layers) of the signaling network. The multi-layered (onion-like) database structure is made up of signaling pathways, their pathway regulators (e.g., scaffold and endocytotic proteins) and modifier enzymes (e.g., phosphatases, ubiquitin ligases), as well as transcriptional and post-transcriptional regulators of all of these components. The user-friendly website allows the interactive exploration of how each signaling protein is regulated. The customizable download page enables the analysis of any user-specified part of the signaling network. Compared to other signaling resources, distinctive features of SignaLink 2 are the following: 1) it involves experimental data not only from humans but from two invertebrate model organisms, C. elegans and D. melanogaster; 2) combines manual curation with large-scale datasets; 3) provides confidence scores for each interaction; 4) operates a customizable download page with multiple file formats (e.g., BioPAX, Cytoscape, SBML). Non-profit users can access SignaLink 2 free of charge at http://SignaLink.org. With SignaLink 2 as a single resource, users can effectively analyze signaling pathways, scaffold proteins, modifier enzymes, transcription factors and miRNAs that are important in the regulation of signaling processes. This integrated resource allows the systems-level examination of how cross-talks and signaling flow are regulated, as well as provide data for cross-species comparisons and drug discovery analyses.

De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

PubMed

Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

2011-02-10

Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.

A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription

PubMed Central

Stefanovsky, Victor Y.; Tremblay, Michel G.; Lindsay, Helen; Robinson, Mark D.

2017-01-01

Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin and place the Enhancer Boundary Complex as the likely entry point for chromatin remodelling complexes. PMID:28715449

A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

PubMed

Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

2017-07-01

Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin and place the Enhancer Boundary Complex as the likely entry point for chromatin remodelling complexes.

The Rts1 Regulatory Subunit of Protein Phosphatase 2A Is Required for Control of G1 Cyclin Transcription and Nutrient Modulation of Cell Size

PubMed Central

Artiles, Karen; Anastasia, Stephanie; McCusker, Derek; Kellogg, Douglas R.

2009-01-01

The key molecular event that marks entry into the cell cycle is transcription of G1 cyclins, which bind and activate cyclin-dependent kinases. In yeast cells, initiation of G1 cyclin transcription is linked to achievement of a critical cell size, which contributes to cell-size homeostasis. The critical cell size is modulated by nutrients, such that cells growing in poor nutrients are smaller than cells growing in rich nutrients. Nutrient modulation of cell size does not work through known critical regulators of G1 cyclin transcription and is therefore thought to work through a distinct pathway. Here, we report that Rts1, a highly conserved regulatory subunit of protein phosphatase 2A (PP2A), is required for normal control of G1 cyclin transcription. Loss of Rts1 caused delayed initiation of bud growth and delayed and reduced accumulation of G1 cyclins. Expression of the G1 cyclin CLN2 from an inducible promoter rescued the delayed bud growth in rts1Δ cells, indicating that Rts1 acts at the level of transcription. Moreover, loss of Rts1 caused altered regulation of Swi6, a key component of the SBF transcription factor that controls G1 cyclin transcription. Epistasis analysis revealed that Rts1 does not work solely through several known critical upstream regulators of G1 cyclin transcription. Cells lacking Rts1 failed to undergo nutrient modulation of cell size. Together, these observations demonstrate that Rts1 is a key player in pathways that link nutrient availability, cell size, and G1 cyclin transcription. Since Rts1 is highly conserved, it may function in similar pathways in vertebrates. PMID:19911052

Identification, cloning and characterization of the tomato TCP transcription factor family.

PubMed

Parapunova, Violeta; Busscher, Marco; Busscher-Lange, Jacqueline; Lammers, Michiel; Karlova, Rumyana; Bovy, Arnaud G; Angenent, Gerco C; de Maagd, Ruud A

2014-06-06

TCP proteins are plant-specific transcription factors, which are known to have a wide range of functions in different plant species such as in leaf development, flower symmetry, shoot branching, and senescence. Only a small number of TCP genes has been characterised from tomato (Solanum lycopersicum). Here we report several functional features of the members of the entire family present in the tomato genome. We have identified 30 Solanum lycopersicum SlTCP genes, most of which have not been described before. Phylogenetic analysis clearly distinguishes two homology classes of the SlTCP transcription factor family - class I and class II. Class II differentiates in two subclasses, the CIN-TCP subclass and the CYC/TB1 subclass, involved in leaf development and axillary shoots formation, respectively. The expression patterns of all members were determined by quantitative PCR. Several SlTCP genes, like SlTCP12, SlTCP15 and SlTCP18 are preferentially expressed in the tomato fruit, suggesting a role during fruit development or ripening. These genes are regulated by RIN (RIPENING INHIBITOR), CNR (COLORLESS NON-RIPENING) and SlAP2a (APETALA2a) proteins, which are transcription factors with key roles in ripening. With a yeast one-hybrid assay we demonstrated that RIN binds the promoter fragments of SlTCP12, SlTCP15 and SlTCP18, and that CNR binds the SlTCP18 promoter. This data strongly suggests that these class I SlTCP proteins are involved in ripening. Furthermore, we demonstrate that SlTCPs bind the promoter fragments of members of their own family, indicating that they regulate each other. Additional yeast one-hybrid studies performed with Arabidopsis transcription factors revealed binding of the promoter fragments by proteins involved in the ethylene signal transduction pathway, contributing to the idea that these SlTCP genes are involved in the ripening process. Yeast two-hybrid data shows that SlTCP proteins can form homo and heterodimers, suggesting that they act together in order to form functional protein complexes and together regulate developmental processes in tomato. The comprehensive analysis we performed, like phylogenetic analysis, expression studies, identification of the upstream regulators and the dimerization specificity of the tomato TCP transcription factor family provides the basis for functional studies to reveal the role of this family in tomato development.

Identification, cloning and characterization of the tomato TCP transcription factor family

PubMed Central

2014-01-01

Background TCP proteins are plant-specific transcription factors, which are known to have a wide range of functions in different plant species such as in leaf development, flower symmetry, shoot branching, and senescence. Only a small number of TCP genes has been characterised from tomato (Solanum lycopersicum). Here we report several functional features of the members of the entire family present in the tomato genome. Results We have identified 30 Solanum lycopersicum SlTCP genes, most of which have not been described before. Phylogenetic analysis clearly distinguishes two homology classes of the SlTCP transcription factor family - class I and class II. Class II differentiates in two subclasses, the CIN-TCP subclass and the CYC/TB1 subclass, involved in leaf development and axillary shoots formation, respectively. The expression patterns of all members were determined by quantitative PCR. Several SlTCP genes, like SlTCP12, SlTCP15 and SlTCP18 are preferentially expressed in the tomato fruit, suggesting a role during fruit development or ripening. These genes are regulated by RIN (RIPENING INHIBITOR), CNR (COLORLESS NON-RIPENING) and SlAP2a (APETALA2a) proteins, which are transcription factors with key roles in ripening. With a yeast one-hybrid assay we demonstrated that RIN binds the promoter fragments of SlTCP12, SlTCP15 and SlTCP18, and that CNR binds the SlTCP18 promoter. This data strongly suggests that these class I SlTCP proteins are involved in ripening. Furthermore, we demonstrate that SlTCPs bind the promoter fragments of members of their own family, indicating that they regulate each other. Additional yeast one-hybrid studies performed with Arabidopsis transcription factors revealed binding of the promoter fragments by proteins involved in the ethylene signal transduction pathway, contributing to the idea that these SlTCP genes are involved in the ripening process. Yeast two-hybrid data shows that SlTCP proteins can form homo and heterodimers, suggesting that they act together in order to form functional protein complexes and together regulate developmental processes in tomato. Conclusions The comprehensive analysis we performed, like phylogenetic analysis, expression studies, identification of the upstream regulators and the dimerization specificity of the tomato TCP transcription factor family provides the basis for functional studies to reveal the role of this family in tomato development. PMID:24903607

Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

PubMed Central

2011-01-01

Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to the expression patterns of hupS, nifD, hypF and hypC. CalA, a known transcription factor, interacts with the promoter region between hupSL and the five ORFs in the extended hyp-operon in both Nostoc strains. PMID:21672234

Impact of resistance exercise on ribosome biogenesis is acutely regulated by post-exercise recovery strategies.

PubMed

Figueiredo, Vandré C; Roberts, Llion A; Markworth, James F; Barnett, Matthew P G; Coombes, Jeff S; Raastad, Truls; Peake, Jonathan M; Cameron-Smith, David

2016-02-01

Muscle hypertrophy occurs following increased protein synthesis, which requires activation of the ribosomal complex. Additionally, increased translational capacity via elevated ribosomal RNA (rRNA) synthesis has also been implicated in resistance training-induced skeletal muscle hypertrophy. The time course of ribosome biogenesis following resistance exercise (RE) and the impact exerted by differing recovery strategies remains unknown. In the present study, the activation of transcriptional regulators, the expression levels of pre-rRNA, and mature rRNA components were measured through 48 h after a single-bout RE. In addition, the effects of either low-intensity cycling (active recovery, ACT) or a cold-water immersion (CWI) recovery strategy were compared. Nine male subjects performed two bouts of high-load RE randomized to be followed by 10 min of either ACT or CWI. Muscle biopsies were collected before RE and at 2, 24, and 48 h after RE. RE increased the phosphorylation of the p38-MNK1-eIF4E axis, an effect only evident with ACT recovery. Downstream, cyclin D1 protein, total eIF4E, upstream binding factor 1 (UBF1), and c-Myc proteins were all increased only after RE with ACT. This corresponded with elevated abundance of the pre-rRNAs (45S, ITS-28S, ITS-5.8S, and ETS-18S) from 24 h after RE with ACT. In conclusion, coordinated upstream signaling and activation of transcriptional factors stimulated pre-rRNA expression after RE. CWI, as a recovery strategy, markedly blunted these events, suggesting that suppressed ribosome biogenesis may be one factor contributing to the impaired hypertrophic response observed when CWI is used regularly after exercise. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Proteome and phosphoproteome analysis of commensally induced dendritic cell maturation states.

PubMed

Korkmaz, Ali Giray; Popov, Todor; Peisl, Loulou; Codrea, Marius Cosmin; Nahnsen, Sven; Steimle, Alexander; Velic, Ana; Macek, Boris; von Bergen, Martin; Bernhardt, Joerg; Frick, Julia-Stefanie

2018-05-30

Dendritic cells (DCs) can shape the immune system towards an inflammatory or tolerant state depending on the bacterial antigens and the environment they encounter. In this study we provide a proteomic catalogue of differentially expressed proteins between distinct DC maturation states, brought about by bacteria that differ in their endotoxicity. To achieve this, we have performed proteomics and phosphoproteomics on murine DC cultures. Symbiont and pathobiont bacteria were used to direct dendritic cells into a semi-mature and fully-mature state, respectively. The comparison of semi-mature and fully-mature DCs revealed differential expression in 103 proteins and differential phosphorylation in 118 phosphosites, including major regulatory factors of central immune processes. Our analyses predict that these differences are mediated by upstream elements such as SOCS1, IRF3, ABCA1, TLR4, and PTGER4. Our analyses indicate that the symbiont bacterial strain affects DC proteome in a distinct way, by downregulating inflammatory proteins and activating anti-inflammatory upstream regulators. Biological significance In this study we have investigated the responses of immune cells to distinct bacterial stimuli. We have used the symbiont bacterial strain B. vulgatus and the pathobiont E. coli strain to stimulate cultured primary dendritic cells and performed a shotgun proteome analysis to investigate the protein expression and phosphorylation level differences on a genome level. We have observed expression and phosphorylation level differences in key immune regulators, transcription factors and signal transducers. Moreover, our subsequent bioinformatics analysis indicated regulation at several signaling pathways such as PPAR signaling, LXR/RXR activation and glucocorticoid signaling pathways, which are not studied in detail in an inflammation and DC maturation context. Our phosphoproteome analysis showed differential phosphorylation in 118 phosphosites including those belonging to epigenetic regulators, transcription factors and major cell cycle regulators. We anticipate that our study will facilitate further investigation of immune cell proteomes under different inflammatory and non-inflammatory conditions. Copyright © 2017. Published by Elsevier B.V.

The purple cauliflower arises from activation of a MYB transcription factor.

PubMed

Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L; Li, Li

2010-11-01

Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3'-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal.

The Purple Cauliflower Arises from Activation of a MYB Transcription Factor1[W][OA

PubMed Central

Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L.; Li, Li

2010-01-01

Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3’-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal. PMID:20855520

Molecular and Electrophysiological Characterization of GABAergic Interneurons Expressing the Transcription Factor COUP-TFII in the Adult Human Temporal Cortex

PubMed Central

Varga, Csaba; Tamas, Gabor; Barzo, Pal; Olah, Szabolcs; Somogyi, Peter

2015-01-01

Transcription factors contribute to the differentiation of cortical neurons, orchestrate specific interneuronal circuits, and define synaptic relationships. We have investigated neurons expressing chicken ovalbumin upstream promoter transcription factor II (COUP-TFII), which plays a role in the migration of GABAergic neurons. Whole-cell, patch-clamp recording in vitro combined with colocalization of molecular cell markers in the adult cortex differentiates distinct interneurons. The majority of strongly COUP-TFII-expressing neurons were in layers I–III. Most calretinin (CR) and/or cholecystokinin- (CCK) and/or reelin-positive interneurons were also COUP-TFII-positive. CR-, CCK-, or reelin-positive neurons formed 80%, 20%, or 17% of COUP-TFII-positive interneurons, respectively. About half of COUP-TFII-/CCK-positive interneurons were CR-positive, a quarter of them reelin-positive, but none expressed both. Interneurons positive for COUP-TFII fired irregular, accommodating and adapting trains of action potentials (APs) and innervated mostly small dendritic shafts and rarely spines or somata. Paired recording showed that a calretinin-/COUP-TFII-positive interneuron elicited inhibitory postsynaptic potentials (IPSPs) in a reciprocally connected pyramidal cell. Calbindin, somatostatin, or parvalbumin-immunoreactive interneurons and most pyramidal cells express no immunohistochemically detectable COUP-TFII. In layers V and VI, some pyramidal cells expressed a low level of COUP-TFII in the nucleus. In conclusion, COUP-TFII is expressed in a diverse subset of GABAergic interneurons predominantly innervating small dendritic shafts originating from both interneurons and pyramidal cells. PMID:25787832

Regulation of the human ascorbate transporter SVCT2 exon 1b gene by zinc-finger transcription factors

PubMed Central

Qiao, Huan; May, James M.

2011-01-01

The sodium-dependent vitamin C transporter (SVCT) 2 is crucial for ascorbate uptake in metabolically active and specialized tissues. The present study focused on the gene regulation of the SVCT2 exon 1b, which is ubiquitously expressed in human and mouse tissues. Although the human SVCT2 exon 1b promoter doesn’t contain a classical TATA-box, we found that it does contain a functional initiator (Inr) that binds YY1 and interacts with upstream Sp1/Sp3 elements in the proximal promoter region. These elements in turn play a critical role in regulating YY1-mediated transcription of the exon 1b gene. Formation of YY1/Sp complexes on the promoter is required for its optional function. YY1 with Sp1 or Sp3 synergistically enhanced exon 1b promoter activity as well as the endogenous SVCT2 protein expression. Further, in addition to Sp1/Sp3 both EGR-1 and -2 were detected in the protein complexes that bound the three GC boxes bearing overlapping binding sites for EGR/WT1 and Sp1/3. The EGR family factors, WT1 and MAZ were found to differentially regulate exon 1b promoter activity. These results show that differential occupancy of transcription factors on the GC-rich consensus sequences in SVCT2 exon 1b promoter contributes to the regulation of cell and tissue expression of SVCT2. PMID:21335086

A Conserved PHD Finger Protein and Endogenous RNAi Modulate Insulin Signaling in Caenorhabditis elegans

PubMed Central

Hoersch, Sebastian; Jensen, Morten B.; Kawli, Trupti; Kennedy, Lisa M.; Chavez, Violeta; Tan, Man-Wah; Lieb, Jason D.; Grishok, Alla

2011-01-01

Insulin signaling has a profound effect on longevity and the oxidative stress resistance of animals. Inhibition of insulin signaling results in the activation of DAF-16/FOXO and SKN-1/Nrf transcription factors and increased animal fitness. By studying the biological functions of the endogenous RNA interference factor RDE-4 and conserved PHD zinc finger protein ZFP-1 (AF10), which regulate overlapping sets of genes in Caenorhabditis elegans, we identified an important role for these factors in the negative modulation of transcription of the insulin/PI3 signaling-dependent kinase PDK-1. Consistently, increased expression of pdk-1 in zfp-1 and rde-4 mutants contributed to their reduced lifespan and sensitivity to oxidative stress and pathogens due to the reduction in the expression of DAF-16 and SKN-1 targets. We found that the function of ZFP-1 in modulating pdk-1 transcription was important for the extended lifespan of the age-1(hx546) reduction-of-function PI3 kinase mutant, since the lifespan of the age-1; zfp-1 double mutant strain was significantly shorter compared to age-1(hx546). We further demonstrate that overexpression of ZFP-1 caused an increased resistance to oxidative stress in a DAF-16–dependent manner. Our findings suggest that epigenetic regulation of key upstream signaling components in signal transduction pathways through chromatin and RNAi may have a large impact on the outcome of signaling and expression of numerous downstream genes. PMID:21980302

A conserved PHD finger protein and endogenous RNAi modulate insulin signaling in Caenorhabditis elegans.

PubMed

Mansisidor, Andres R; Cecere, Germano; Hoersch, Sebastian; Jensen, Morten B; Kawli, Trupti; Kennedy, Lisa M; Chavez, Violeta; Tan, Man-Wah; Lieb, Jason D; Grishok, Alla

2011-09-01

Insulin signaling has a profound effect on longevity and the oxidative stress resistance of animals. Inhibition of insulin signaling results in the activation of DAF-16/FOXO and SKN-1/Nrf transcription factors and increased animal fitness. By studying the biological functions of the endogenous RNA interference factor RDE-4 and conserved PHD zinc finger protein ZFP-1 (AF10), which regulate overlapping sets of genes in Caenorhabditis elegans, we identified an important role for these factors in the negative modulation of transcription of the insulin/PI3 signaling-dependent kinase PDK-1. Consistently, increased expression of pdk-1 in zfp-1 and rde-4 mutants contributed to their reduced lifespan and sensitivity to oxidative stress and pathogens due to the reduction in the expression of DAF-16 and SKN-1 targets. We found that the function of ZFP-1 in modulating pdk-1 transcription was important for the extended lifespan of the age-1(hx546) reduction-of-function PI3 kinase mutant, since the lifespan of the age-1; zfp-1 double mutant strain was significantly shorter compared to age-1(hx546). We further demonstrate that overexpression of ZFP-1 caused an increased resistance to oxidative stress in a DAF-16-dependent manner. Our findings suggest that epigenetic regulation of key upstream signaling components in signal transduction pathways through chromatin and RNAi may have a large impact on the outcome of signaling and expression of numerous downstream genes.

Soybean (Glycine max) WRINKLED1 transcription factor, GmWRI1a, positively regulates seed oil accumulation.

PubMed

Chen, Liang; Zheng, Yuhong; Dong, Zhimin; Meng, Fanfan; Sun, Xingmiao; Fan, Xuhong; Zhang, Yunfeng; Wang, Mingliang; Wang, Shuming

2018-04-01

Soybean is the world's most important leguminous crop producing high-quality protein and oil. Elevating oil accumulation in soybean seed is always many researchers' goal. WRINKLED1 (WRI1) encodes a transcription factor of the APETALA2/ethylene responsive element-binding protein (AP2/EREBP) family that plays important roles during plant seed oil accumulation. In this study, we isolated and characterized three distinct orthologues of WRI1 in soybean (Glycine max) that display different organ-specific expression patterns, among which GmWRI1a was highly expressed in maturing soybean seed. Electrophoretic mobility shift assays and yeast one-hybrid experiments demonstrated that the GmWRI1a protein was capable of binding to AW-box, a conserved sequence in the proximal upstream regions of many genes involved in various steps of oil biosynthesis. Transgenic soybean seeds overexpressing GmWRI1a under the control of the seed-specific napin promoter showed the increased total oil and fatty acid content and the changed fatty acid composition. Furthermore, basing on the activated expressions in transgenic soybean seeds and existence of AW-box element in the promoter regions, direct downstream genes of GmWRI1a were identified, and their products were responsible for fatty acid production, elongation, desaturation and export from plastid. We conclude that GmWRI1a transcription factor can positively regulate oil accumulation in soybean seed by a complex gene expression network related to fatty acid biosynthesis.

Proteomic profiling of early degenerative retina of RCS rats

PubMed Central

Zhu, Zhi-Hong; Fu, Yan; Weng, Chuan-Huang; Zhao, Cong-Jian; Yin, Zheng-Qin

2017-01-01

AIM To identify the underlying cellular and molecular changes in retinitis pigmentosa (RP). METHODS Label-free quantification-based proteomics analysis, with its advantages of being more economic and consisting of simpler procedures, has been used with increasing frequency in modern biological research. Dystrophic RCS rats, the first laboratory animal model for the study of RP, possess a similar pathological course as human beings with the diseases. Thus, we employed a comparative proteomics analysis approach for in-depth proteome profiling of retinas from dystrophic RCS rats and non-dystrophic congenic controls through Linear Trap Quadrupole - orbitrap MS/MS, to identify the significant differentially expressed proteins (DEPs). Bioinformatics analyses, including Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway annotation and upstream regulatory analysis, were then performed on these retina proteins. Finally, a Western blotting experiment was carried out to verify the difference in the abundance of transcript factor E2F1. RESULTS In this study, we identified a total of 2375 protein groups from the retinal protein samples of RCS rats and non-dystrophic congenic controls. Four hundred thirty-four significantly DEPs were selected by Student's t-test. Based on the results of the bioinformatics analysis, we identified mitochondrial dysfunction and transcription factor E2F1 as the key initiation factors in early retinal degenerative process. CONCLUSION We showed that the mitochondrial dysfunction and the transcription factor E2F1 substantially contribute to the disease etiology of RP. The results provide a new potential therapeutic approach for this retinal degenerative disease. PMID:28730077

Anticarcinogenesis by dietary phytochemicals: cytoprotection by Nrf2 in normal cells and cytotoxicity by modulation of transcription factors NF-kappa B and AP-1 in abnormal cancer cells.

PubMed

Gopalakrishnan, Avanthika; Tony Kong, Ah-Ng

2008-04-01

Cancer statistics from the American Cancer Society and other sources are a stark reminder of our failure to combat this deadly disease. Chemoprevention entails the use of specific naturally occurring dietary or synthetic agents to thwart cancer development and progression. Some of these agents are believed to do so by protecting the cells or tissues from the malicious attack of exogenous carcinogens and/or endogenous reactive oxygen/nitrogen species (RONS) by inducing several detoxifying/antioxidant enzymes that appear to form stable conjugates such as glutathione, glucuronides or sulfates thus rendering the carcinogenic species harmless. This process of inducing the cellular defense enzymes is believed to be mediated by the antioxidant response elements (ARE) within the promoter regions of these genes. Nrf2, a redox sensitive transcription factor has been documented to play a central role in ARE-driven gene expression. Nrf2, under normal unstimulated conditions, remains sequestered in the cytosol by Keap1. The putative chemopreventive agents disrupt the Nrf2-Keap1 association, thereby releasing Nrf2 which then translocates to the nucleus and drives the gene expression of detoxifying enzymes. The role of other transcription factors such as NF-kappaB and AP-1 in carcinogenesis is well established. By modulating the activity of these transcription factors and their upstream signaling molecules, naturally occurring dietary phytochemicals appear to cause apoptosis in abnormal cells that over-express these factors, thereby inhibiting the promotion and progression. This review discusses the most current and up to date understanding of the possible signaling mechanisms by which these naturally dietary phytochemicals can differentially modulate signal transduction cascades such that they can bring about apoptosis/cell death in abnormal cancer cells but at the same time induce defensive enzymes to protect against carcinogenesis in normal cells.

HDAC5-LSD1 axis regulates antineoplastic effect of natural HDAC inhibitor sulforaphane in human breast cancer cells.

PubMed

Cao, Chunyu; Wu, Hao; Vasilatos, Shauna N; Chandran, Uma; Qin, Ye; Wan, Yong; Oesterreich, Steffi; Davidson, Nancy E; Huang, Yi

2018-04-06

Our recent studies have shown that cross-talk between histone deacetylase 5 (HDAC5) and lysine-specific demethylase 1 (LSD1) facilitates breast cancer progression. In this work, we demonstrated that regulatory activity at -356 to -100 bp promoter element plays a critical role in governing HDAC5 transcription. By using DNA affinity precipitation and mass spectrometry, we identified a group of factors that bind to this element. Among these factors, Upstream Transcription Factor 1 (USF1) was shown to play a critical role in controlling HDAC5 transcription. Through screening a panel of epigenetic modifying drugs, we showed that a natural bioactive HDAC inhibitor, sulforaphane, downregulated HDAC5 transcription by blocking USF1 activity. Sulforaphane facilitated LSD1 ubiquitination and degradation in an HDAC5-dependent manner. A comparative microarray analysis demonstrated a genome wide cooperative effect of HDAC5 and LSD1 on cancer-related gene expression. shRNA knockdown and sulforaphane inhibition of HDAC5/LSD1 exhibited similar effects on expression of HDAC5/LSD1 target genes. We also showed that coordinated cross-talk of HDAC5 and LSD1 is essential for the antitumor efficacy of sulforaphane. Combination treatment with sulforaphane and a potent LSD1 inhibitor resulted in synergistic growth inhibition in breast cancer cells, but not in normal breast epithelial cells. Furthermore, combined therapy with sulforaphane and LSD1 inhibitor exhibited superior inhibitory effect on MDA-MB-231 xenograft tumor growth. Taken together, our work demonstrates that HDAC5-LSD1 axis is an effective drug target for breast cancer. Inhibition of HDAC5-LSD1 axis with sulforaphane blocks breast cancer growth and combined treatment with LSD1 inhibitor improves the therapeutic efficacy of sulforaphane. © 2018 UICC.

The transcription factor EGR1 localizes to the nucleolus and is linked to suppression of ribosomal precursor synthesis.

PubMed

Ponti, Donatella; Bellenchi, Gian Carlo; Puca, Rosa; Bastianelli, Daniela; Maroder, Marella; Ragona, Giuseppe; Roussel, Pascal; Thiry, Marc; Mercola, Dan; Calogero, Antonella

2014-01-01

EGR1 is an immediate early gene with a wide range of activities as transcription factor, spanning from regulation of cell growth to differentiation. Numerous studies show that EGR1 either promotes the proliferation of stimulated cells or suppresses the tumorigenic growth of transformed cells. Upon interaction with ARF, EGR1 is sumoylated and acquires the ability to bind to specific targets such as PTEN and in turn to regulate cell growth. ARF is mainly localized to the periphery of nucleolus where is able to negatively regulate ribosome biogenesis. Since EGR1 colocalizes with ARF under IGF-1 stimulation we asked the question of whether EGR1 also relocate to the nucleolus to interact with ARF. Here we show that EGR1 colocalizes with nucleolar markers such as fibrillarin and B23 in the presence of ARF. Western analysis of nucleolar extracts from HeLa cells was used to confirm the presence of EGR1 in the nucleolus mainly as the 100 kDa sumoylated form. We also show that the level of the ribosomal RNA precursor 47S is inversely correlated to the level of EGR1 transcripts. The EGR1 iseffective to regulate the synthesis of the 47S rRNA precursor. Then we demonstrated that EGR1 binds to the Upstream Binding Factor (UBF) leading us to hypothesize that the regulating activity of EGR1 is mediated by its interaction within the transcriptional complex of RNA polymerase I. These results confirm the presence of EGR1 in the nucleolus and point to a role for EGR1 in the control of nucleolar metabolism.

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

PubMed

Berends Sexton, T; Jones, J T; Mullet, J E

1990-05-01

A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

XX males SRY negative: a confirmed cause of infertility.

PubMed

Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

2011-10-01

SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

C/EBPβ contributes to transcriptional activation of long non-coding RNA NEAT1 during APL cell differentiation.

PubMed

Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen

2018-05-05

Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.

Variation of DNA methylation patterns associated with gene expression in rice (Oryza sativa) exposed to cadmium.

PubMed

Feng, Sheng Jun; Liu, Xue Song; Tao, Hua; Tan, Shang Kun; Chu, Shan Shan; Oono, Youko; Zhang, Xian Duo; Chen, Jian; Yang, Zhi Min

2016-12-01

We report genome-wide single-base resolution maps of methylated cytosines and transcriptome change in Cd-exposed rice. Widespread differences were identified in CG and non-CG methylation marks between Cd-exposed and Cd-free rice genomes. There are 2320 non-redundant differentially methylated regions detected in the genome. RNA sequencing revealed 2092 DNA methylation-modified genes differentially expressed under Cd exposure. More genes were found hypermethylated than those hypomethylated in CG, CHH and CHG (where H is A, C or T) contexts in upstream, gene body and downstream regions. Many of the genes were involved in stress response, metal transport and transcription factors. Most of the DNA methylation-modified genes were transcriptionally altered under Cd stress. A subset of loss of function mutants defective in DNA methylation and histone modification activities was used to identify transcript abundance of selected genes. Compared with wide type, mutation of MET1 and DRM2 resulted in general lower transcript levels of the genes under Cd stress. Transcripts of OsIRO2, OsPR1b and Os09g02214 in drm2 were significantly reduced. A commonly used DNA methylation inhibitor 5-azacytidine was employed to investigate whether DNA demethylation affected physiological consequences. 5-azacytidine provision decreased general DNA methylation levels of selected genes, but promoted growth of rice seedlings and Cd accumulation in rice plant. © 2016 John Wiley & Sons Ltd.

Scleraxis is a transcriptional activator that regulates the expression of Tenomodulin, a marker of mature tenocytes and ligamentocytes.

PubMed

Shukunami, Chisa; Takimoto, Aki; Nishizaki, Yuriko; Yoshimoto, Yuki; Tanaka, Seima; Miura, Shigenori; Watanabe, Hitomi; Sakuma, Tetsushi; Yamamoto, Takashi; Kondoh, Gen; Hiraki, Yuji

2018-02-16

Tenomodulin (Tnmd) is a type II transmembrane glycoprotein predominantly expressed in tendons and ligaments. We found that scleraxis (Scx), a member of the Twist-family of basic helix-loop-helix transcription factors, is a transcriptional activator of Tnmd expression in tenocytes. During embryonic development, Scx expression preceded that of Tnmd. Tnmd expression was nearly absent in tendons and ligaments of Scx-deficient mice generated by transcription activator-like effector nucleases-mediated gene disruption. Tnmd mRNA levels were dramatically decreased during serial passages of rat tenocytes. Scx silencing by small interfering RNA significantly suppressed endogenous Tnmd mRNA levels in tenocytes. Mouse Tnmd contains five E-box sites in the ~1-kb 5'-flanking region. A 174-base pair genomic fragment containing a TATA box drives transcription in tenocytes. Enhancer activity was increased in the upstream region (-1030 to -295) of Tnmd in tenocytes, but not in NIH3T3 and C3H10T1/2 cells. Preferential binding of both Scx and Twist1 as a heterodimer with E12 or E47 to CAGATG or CATCTG and transactivation of the 5'-flanking region were confirmed by electrophoresis mobility shift and dual luciferase assays, respectively. Scx directly transactivates Tnmd via these E-boxes to positively regulate tenocyte differentiation and maturation.

Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes.

PubMed

Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y

2013-04-01

MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.

Ethylene Response Factor TERF1, Regulated by ETHYLENE-INSENSITIVE3-like Factors, Functions in Reactive Oxygen Species (ROS) Scavenging in Tobacco (Nicotiana tabacum L.).

PubMed

Zhang, Hongbo; Li, Ang; Zhang, Zhijin; Huang, Zejun; Lu, Pingli; Zhang, Dingyu; Liu, Xinmin; Zhang, Zhong-Feng; Huang, Rongfeng

2016-07-20

The phytohormone ethylene plays a crucial role in the production and accumulation of reactive oxygen species (ROS) in plants under stress conditions. Ethylene response factors (ERFs) are important ethylene-signaling regulators functioning in plant defense responses against biotic and abiotic stresses. However, the roles of ERFs during plant adapting to ROS stress have not yet been well documented. Our studies previously reported that a tomato ERF transcription factor TERF1 functions in the regulation of plant ethylene responses and stress tolerance. Here, we report our findings regarding the roles of TERF1 in ROS scavenging. In this study, we revealed that the transcription of TERF1 is regulated by upstream EIN3-like (EIN3, ethylene-insensitive 3) regulators LeEIL3 and LeEIL4 in tomato (Solanum lycopersicum), and is also inducible by exogenous applied ROS-generating reagents. Ectopic expression of TERF1 in tobacco promoted the expression of genes involved in oxidative stress responses, including carbonic anhydrase functioning in hypersensitive defense, catalase and glutathione peroxidase catalyzing oxidative reactions, and GDP-D-mannose pyrophosphorylase functioning in ascorbic acid biosynthesis, reduced the ROS content induced by ethylene treatment, and enhanced stress tolerance of tobacco seedlings to hydrogen peroxide (H2O2). Cumulatively, these findings suggest that TERF1 is an ethylene inducible factor regulating ROS scavenging during stress responses.

A DNA segment spanning the mouse Tnfsf11 transcription unit and its upstream regulatory domain rescues the pleiotropic biologic phenotype of the RANKL null mouse.

PubMed

Onal, Melda; Bishop, Kathleen A; St John, Hillary C; Danielson, Allison L; Riley, Erin M; Piemontese, Marilina; Xiong, Jinhu; Goellner, Joseph J; O'Brien, Charles A; Pike, J Wesley

2015-05-01

Receptor activator of NF-κB ligand (RANKL) is a TNFα-like cytokine that is produced by a diverse set of lineage-specific cells and is involved in a wide variety of physiological processes that include skeletal remodeling, lymph node organogenesis, mammary gland development, and thermal regulation. Consistent with these diverse functions, control of RANKL expression is accomplished in a cell-specific fashion via a set of at least 10 regulatory enhancers that are located up to 170 kb upstream of the gene's transcriptional start site. Here we examined the in vivo consequence of introducing a contiguous DNA segment containing these components into a genetically deleted RANKL null mouse strain. In contrast to RANKL null littermates, null mice containing the transgene exhibited normalized body size, skeletal development, and bone mass as well as normal bone marrow cavities, normalized spleen weights, and the presence of developed lymph nodes. These mice also manifested normalized reproductive capacity, including the ability to lactate and to produce normal healthy litters. Consistent with this, the transgene restored endogenous-like RANKL transcript levels in several RANKL-expressing tissues. Most importantly, restoration of RANKL expression from this segment of DNA was fully capable of rescuing the complex aberrant skeletal and immune phenotype of the RANKL null mouse. RANKL also restored appropriate levels of B220+ IgM+ and B220+ IgD+ B cells in spleen. Finally, we found that RANKL expression from this transgene was regulated by exogenously administered 1,25(OH)2 D3 , parathyroid hormone (PTH), and lipopolysaccharide (LPS), thus recapitulating the ability of these same factors to regulate the endogenous gene. These findings fully highlight the properties of the Tnfsf11 gene locus predicted through previous in vitro dissection. We conclude that the mouse Tnfsf11 gene locus identified originally through unbiased chromatin immunoprecipitation with DNA microarray (ChIP-chip) analysis contains the necessary genetic information to direct appropriate tissue-specific and factor-regulated RANKL expression in vivo. © 2014 American Society for Bone and Mineral Research.

X-Prolyl Dipeptidyl Aminopeptidase Gene (pepX) Is Part of the glnRA Operon in Lactobacillus rhamnosus

PubMed Central

Varmanen, Pekka; Savijoki, Kirsi; Åvall, Silja; Palva, Airi; Tynkkynen, Soile

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate l-glycyl-l-prolyl-β-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks. PMID:10613874

X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

PubMed

Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks.

Cis-regulation of the amphioxus engrailed gene: insights into evolution of a muscle-specific enhancer.

PubMed

Beaster-Jones, Laura; Schubert, Michael; Holland, Linda Z

2007-08-01

To gain insights into the relation between evolution of cis-regulatory DNA and evolution of gene function, we identified tissue-specific enhancers of the engrailed gene of the basal chordate amphioxus (Branchiostoma floridae) and compared their ability to direct expression in both amphioxus and its nearest chordate relative, the tunicate Ciona intestinalis. In amphioxus embryos, the native engrailed gene is expressed in three domains - the eight most anterior somites, a few cells in the central nervous system (CNS) and a few ectodermal cells. In contrast, in C. intestinalis, in which muscle development is highly divergent, engrailed expression is limited to the CNS. To characterize the tissue-specific enhancers of amphioxus engrailed, we first showed that 7.8kb of upstream DNA of amphioxus engrailed directs expression to all three domains in amphioxus that express the native gene. We then identified the amphioxus engrailed muscle-specific enhancer as the 1.2kb region of upstream DNA with the highest sequence identity to the mouse en-2 jaw muscle enhancer. This amphioxus enhancer directed expression to both the somites in amphioxus and to the larval muscles in C. intestinalis. These results show that even though expression of the native engrailed has apparently been lost in developing C. intestinalis muscles, they express the transcription factors necessary to activate transcription from the amphioxus engrailed enhancer, suggesting that gene networks may not be completely disrupted if an individual component is lost.

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.

PubMed

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong

2012-09-01

The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

PubMed

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Regulation of the yjjQ-bglJ Operon, Encoding LuxR-Type Transcription Factors, and the Divergent yjjP Gene by H-NS and LeuO▿ †

PubMed Central

Stratmann, Thomas; Madhusudan, S.; Schnetz, Karin

2008-01-01

The yjjQ and bglJ genes encode LuxR-type transcription factors conserved in several enterobacterial species. YjjQ is a potential virulence factor in avian pathogenic Escherichia coli. BglJ counteracts the silencing of the bgl (β-glucoside) operon by H-NS in E. coli K-12. Here we show that yjjQ and bglJ form an operon carried by E. coli K-12, whose expression is repressed by the histone-like nucleoid structuring (H-NS) protein. The LysR-type transcription factor LeuO counteracts this repression. Furthermore, the yjjP gene, encoding a membrane protein of unknown function and located upstream in divergent orientation to the yjjQ-bglJ operon, is likewise repressed by H-NS. Mapping of the promoters as well as the H-NS and LeuO binding sites within the 555-bp intergenic region revealed that H-NS binds to the center of the AT-rich regulatory region and distal to the divergent promoters. LeuO sites map to the center and to positions distal to the yjjQ promoters, while one LeuO binding site overlaps with the divergent yjjP promoter. This latter LeuO site is required for full derepression of the yjjQ promoters. The arrangement of regulatory sites suggests that LeuO restructures the nucleoprotein complex formed by H-NS. Furthermore, the data support the conclusion that LeuO, whose expression is likewise repressed by H-NS and which is a virulence factor in Salmonella enterica, is a master regulator that among other loci, also controls the yjjQ-bglJ operon and thus indirectly the presumptive targets of YjjQ and BglJ. PMID:18055596

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression

PubMed Central

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-01-01

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377

Duplication of an upstream silencer of FZP increases grain yield in rice.

PubMed

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

PubMed

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

2016-09-16

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

Promoter architecture and transcriptional regulation of Abf1-dependent ribosomal protein genes in Saccharomyces cerevisiae.

PubMed

Fermi, Beatrice; Bosio, Maria Cristina; Dieci, Giorgio

2016-07-27

In Saccharomyces cerevisiae, ribosomal protein gene (RPG) promoters display binding sites for either Rap1 or Abf1 transcription factors. Unlike Rap1-associated promoters, the small cohort of Abf1-dependent RPGs (Abf1-RPGs) has not been extensively investigated. We show that RPL3, RPL4B, RPP1A, RPS22B and RPS28A/B share a common promoter architecture, with an Abf1 site upstream of a conserved element matching the sequence recognized by Fhl1, a transcription factor which together with Ifh1 orchestrates Rap1-associated RPG regulation. Abf1 and Fhl1 promoter association was confirmed by ChIP and/or gel retardation assays. Mutational analysis revealed a more severe requirement of Abf1 than Fhl1 binding sites for RPG transcription. In the case of RPS22B an unusual Tbf1 binding site promoted both RPS22B and intron-hosted SNR44 expression. Abf1-RPG down-regulation upon TOR pathway inhibition was much attenuated at defective mutant promoters unable to bind Abf1. TORC1 inactivation caused the expected reduction of Ifh1 occupancy at RPS22B and RPL3 promoters, but unexpectedly it entailed largely increased Abf1 association with Abf1-RPG promoters. We present evidence that Abf1 recruitment upon nutritional stress, also observed for representative ribosome biogenesis genes, favours RPG transcriptional rescue upon nutrient replenishment, thus pointing to nutrient-regulated Abf1 dynamics at promoters as a novel mechanism in ribosome biogenesis control. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest

PubMed Central

Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

2015-01-01

Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest. PMID:26512957

P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.

PubMed

Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

2015-10-29

Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.

VIH from the mud crab is specifically expressed in the eyestalk and potentially regulated by transactivator of Sox9/Oct4/Oct1.

PubMed

Liu, Chunyun; Jia, Xiwei; Zou, Zhihua; Wang, Xiaowei; Wang, Yilei; Zhang, Ziping

2018-01-01

Vitellogenesis-inhibiting hormone (VIH) is known to regulate ovarian maturation by suppressing the synthesis of vitellogenin (Vtg) in crustaceans, which belongs to a member of crustacean hyperglycemic hormone (CHH) family synthesized and secreted from the X-organ/sinus gland complex of eyestalks. In this study, the cDNA, genomic DNA (gDNA) and the 5'-upstream regulatory (promoter region) sequences of VIH gene were obtained by conventional PCR, genome walker and tail-PCR techniques according to our transcriptomic database of Scylla paramamosain. The full-length cDNA of SpVIH is 634bp including 105bp 5'UTR, 151bp 3'UTR and 378bp ORF that encodes a peptide of 125 amino acids. The full length gDNA of SpVIH is 790bp containing two exons and one intron. The 5'-flanking promoter regions of SpVIH we isolated are 3070bp from the translation initiation (ATG) and 2398bp from the predicted transcription initiation (A), which consists of putative core promoter region and multiple potential transcription factor binding sites. SpVIH was only expressed in eyestalk. The expression level of SpVIH in eyestalk of female crab decreased gradually along with the development of ovary. As there is not cell line of crabs available, we chose the mature transfection system HEK293FT cell lines to explore the mechanism of transcription regulation of SpVIH in crabs. Sequential deletion assays using luciferase reporter gene in HEK293FT cells revealed that the possible promoter activity regions (including positive and negative transcription factors binding sites simultaneously) presented between pSpVIH-4 and pSpVIH-6. In order to further identify the crucial transcription factors binding site in this region, the site-directed mutagenesis of Sox9/Oct4/Oct1 binding site of pSpVIH-4 was created. The results demonstrated that the transcriptional activity of pSpVIH-4△ decreased significantly (p<0.05). Thus, it is reasonable to deduce that the Sox9/Oct4/Oct1 may be the essential positive transcription factors which regulate the expression of SpVIH. Copyright © 2017 Elsevier Inc. All rights reserved.

Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

PubMed

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

2014-06-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

Pseudomonas aeruginosa AmrZ Binds to Four Sites in the algD Promoter, Inducing DNA-AmrZ Complex Formation and Transcriptional Activation.

PubMed

Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J

2016-10-01

During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Coordination of hepatocyte nuclear factor 4 and seven-up controls insect counter-defense cathepsin B expression.

PubMed

Ahn, Ji-Eun; Guarino, Linda A; Zhu-Salzman, Keyan

2010-02-26

CmCatB, a cathepsin B-type cysteine protease, is insensitive to inhibition by the soybean cysteine protease inhibitor (scN). Cowpea bruchids dramatically induce CmCatB expression when major digestive proteases are inactivated by dietary scN, which is presumably an adaptive strategy that insects use to minimize effects of nutrient deficiency. In this study, we cloned the cowpea bruchid hepatocyte nuclear factor 4 (CmHNF-4) and demonstrated its involvement in transcriptional activation of CmCatB in the digestive tract of scN-adapted bruchids. Electrophoretic mobility shift assays demonstrated that CmHNF-4 binds to a CmCatB promoter region containing two tandem chicken ovalbumin upstream promoter (COUP) sites, which is also the cis-element for Seven-up (CmSvp), a previously identified transcriptional repressor of CmCatB. Although CmSvp is predominantly expressed in unadapted insect midgut, CmHNF-4 is more abundant in adapted bruchids. When transiently expressed in Drosophila S2 cells, CmHNF-4 substantially increased CmCatB expression through COUP binding. CmSvp inhibited CmHNF-4-mediated transcriptional activation even in the absence of its DNA-binding domain. Thus antagonism resulted, at least in part, from protein-protein interactions between CmSvp and CmHNF-4. Association of the two transcription factors was subsequently confirmed by glutathione S-transferase pulldown assays. Interestingly, anti-CmHNF-4 serum caused a supershift not only with nuclear extracts of scN-adapted insect midgut but with that of unadapted control insects as well. The presence of CmHNF-4 in unadapted insects further supported the idea that interplay between CmSvp and CmHNF-4 controls CmCatB transcription activation. Together, these results suggest that coordination between CmHNF-4 and CmSvp is important in counter-defense gene regulation in insects.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

PubMed

Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-08-16

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

PubMed Central

Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-01-01

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene NRBP1 upregulates its expression by inhibition of TFAP2A binding.

PubMed

Zhu, Zaihua; Meng, Weida; Liu, Peiru; Zhu, Xiaoxia; Liu, Yun; Zou, Hejian

2017-01-01

Genome-wide association studies (GWASs) have identified dozens of loci associated with gout, but for most cases, the risk genes and the underlying molecular mechanisms contributing to these associations are unknown. This study sought to understand the molecular mechanism of a common genetic variant, rs780093, in the development of gout, both in vitro and in vivo. Nuclear receptor binding protein 1 ( NRBP1 ), as a gout risk gene, and its regulatory region, 72 bp upstream of the transcription start site, designated as B1, were identified through integrative analyses of genome-wide genotype and DNA methylation data. We observed elevated NRBP1 expression in human peripheral blood mononuclear cells (PBMCs) from gout patients. In vitro luciferase reporter and protein pulldown assay results showed that DNA methylation could increase the binding of the transcription factor TFAP2A to B1, leading to suppressed gene expression. There results were further confirmed by in vivo bisulfite pyrosequencing showing that hypomethylation on B1 is associated with increased NRBP1 expression in gout patients. Hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which might contribute to the development of gout.

Post-transcriptional Regulation of Keratinocyte Progenitor Cell Expansion, Differentiation and Hair Follicle Regression by miR-22

PubMed Central

Meng, Qingyong; Zhao, Yiqiang; Chen, Lei; Zhang, Hongquan; Xue, Lixiang; Zhang, Xiuqing; Lengner, Christopher; Yu, Zhengquan

2015-01-01

Hair follicles (HF) undergo precisely regulated recurrent cycles of growth, cessation, and rest. The transitions from anagen (growth), to catagen (regression), to telogen (rest) involve a physiological involution of the HF. This process is likely coordinated by a variety of mechanisms including apoptosis and loss of growth factor signaling. However, the precise molecular mechanisms underlying follicle involution after hair keratinocyte differentiation and hair shaft assembly remain poorly understood. Here we demonstrate that a highly conserved microRNA, miR-22 is markedly upregulated during catagen and peaks in telogen. Using gain- and loss-of-function approaches in vivo, we find that miR-22 overexpression leads to hair loss by promoting anagen-to-catagen transition of the HF, and that deletion of miR-22 delays entry to catagen and accelerates the transition from telogen to anagen. Ectopic activation of miR-22 results in hair loss due to the repression a hair keratinocyte differentiation program and keratinocyte progenitor expansion, as well as promotion of apoptosis. At the molecular level, we demonstrate that miR-22 directly represses numerous transcription factors upstream of phenotypic keratin genes, including Dlx3, Foxn1, and Hoxc13. We conclude that miR-22 is a critical post-transcriptional regulator of the hair cycle and may represent a novel target for therapeutic modulation of hair growth. PMID:26020521

Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

PubMed

Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

2017-10-19

Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

Genome-wide analysis identifies chickpea (Cicer arietinum) heat stress transcription factors (Hsfs) responsive to heat stress at the pod development stage.

PubMed

Chidambaranathan, Parameswaran; Jagannadham, Prasanth Tej Kumar; Satheesh, Viswanathan; Kohli, Deshika; Basavarajappa, Santosh Halasabala; Chellapilla, Bharadwaj; Kumar, Jitendra; Jain, Pradeep Kumar; Srinivasan, R

2018-05-01

The heat stress transcription factors (Hsfs) play a prominent role in thermotolerance and eliciting the heat stress response in plants. Identification and expression analysis of Hsfs gene family members in chickpea would provide valuable information on heat stress responsive Hsfs. A genome-wide analysis of Hsfs gene family resulted in the identification of 22 Hsf genes in chickpea in both desi and kabuli genome. Phylogenetic analysis distinctly separated 12 A, 9 B, and 1 C class Hsfs, respectively. An analysis of cis-regulatory elements in the upstream region of the genes identified many stress responsive elements such as heat stress elements (HSE), abscisic acid responsive element (ABRE) etc. In silico expression analysis showed nine and three Hsfs were also expressed in drought and salinity stresses, respectively. Q-PCR expression analysis of Hsfs under heat stress at pod development and at 15 days old seedling stage showed that CarHsfA2, A6, and B2 were significantly upregulated in both the stages of crop growth and other four Hsfs (CarHsfA2, A6a, A6c, B2a) showed early transcriptional upregulation for heat stress at seedling stage of chickpea. These subclasses of Hsfs identified in this study can be further evaluated as candidate genes in the characterization of heat stress response in chickpea.

Duplicate Maize Wrinkled1 Transcription Factors Activate Target Genes Involved in Seed Oil Biosynthesis1[C][W

PubMed Central

Pouvreau, Benjamin; Baud, Sébastien; Vernoud, Vanessa; Morin, Valérie; Py, Cyrille; Gendrot, Ghislaine; Pichon, Jean-Philippe; Rouster, Jacques; Paul, Wyatt; Rogowsky, Peter M.

2011-01-01

WRINKLED1 (WRI1), a key regulator of seed oil biosynthesis in Arabidopsis (Arabidopsis thaliana), was duplicated during the genome amplification of the cereal ancestor genome 90 million years ago. Both maize (Zea mays) coorthologs ZmWri1a and ZmWri1b show a strong transcriptional induction during the early filling stage of the embryo and complement the reduced fatty acid content of Arabidopsis wri1-4 seeds, suggesting conservation of molecular function. Overexpression of ZmWri1a not only increases the fatty acid content of the mature maize grain but also the content of certain amino acids, of several compounds involved in amino acid biosynthesis, and of two intermediates of the tricarboxylic acid cycle. Transcriptomic experiments identified 18 putative target genes of this transcription factor, 12 of which contain in their upstream regions an AW box, the cis-element bound by AtWRI1. In addition to functions related to late glycolysis and fatty acid biosynthesis in plastids, the target genes also have functions related to coenzyme A biosynthesis in mitochondria and the production of glycerol backbones for triacylglycerol biosynthesis in the cytoplasm. Interestingly, the higher seed oil content in ZmWri1a overexpression lines is not accompanied by a reduction in starch, thus opening possibilities for the use of the transgenic maize lines in breeding programs. PMID:21474435

Regulation of the Candida albicans Cell Wall Damage Response by Transcription Factor Sko1 and PAS Kinase Psk1

PubMed Central

Rauceo, Jason M.; Blankenship, Jill R.; Fanning, Saranna; Hamaker, Jessica J.; Deneault, Jean-Sebastien; Smith, Frank J.; Nantel, Andre

2008-01-01

The environmental niche of each fungus places distinct functional demands on the cell wall. Hence cell wall regulatory pathways may be highly divergent. We have pursued this hypothesis through analysis of Candida albicans transcription factor mutants that are hypersensitive to caspofungin, an inhibitor of beta-1,3-glucan synthase. We report here that mutations in SKO1 cause this phenotype. C. albicans Sko1 undergoes Hog1-dependent phosphorylation after osmotic stress, like its Saccharomyces cerevisiae orthologues, thus arguing that this Hog1-Sko1 relationship is conserved. However, Sko1 has a distinct role in the response to cell wall inhibition because 1) sko1 mutants are much more sensitive to caspofungin than hog1 mutants; 2) Sko1 does not undergo detectable phosphorylation in response to caspofungin; 3) SKO1 transcript levels are induced by caspofungin in both wild-type and hog1 mutant strains; and 4) sko1 mutants are defective in expression of caspofungin-inducible genes that are not induced by osmotic stress. Upstream Sko1 regulators were identified from a panel of caspofungin-hypersensitive protein kinase–defective mutants. Our results show that protein kinase Psk1 is required for expression of SKO1 and of Sko1-dependent genes in response to caspofungin. Thus Psk1 and Sko1 lie in a newly described signal transduction pathway. PMID:18434592

Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

NASA Technical Reports Server (NTRS)

Romano, Laura A.; Wray, Gregory A.

2003-01-01

Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.